WO2005038026A1

WO2005038026A1 - Method of typing mutation

Info

Publication number: WO2005038026A1
Application number: PCT/JP2004/015214
Authority: WO
Inventors: Nobuto Koyama; Junichi Mineno; Shusaku Yamashita; Nao Yamanaka; Masahiro Sato; Hiroyuki Izu; Masanori Takayama; Kiyozo Asada; Ikunoshin Kato
Original assignee: Takara Bio Inc.
Priority date: 2003-10-16
Filing date: 2004-10-15
Publication date: 2005-04-28

Abstract

A method of typing a mutation characterized by comprising the step of preparing target DNA containing a mutation site to be typed, the step of attaching a sample identification code to the target DNA, and the step of determining the base sequence of a region containing the sample identification code and the mutation site in the target DNA having the sample identification code attached thereto.

Description

Specification

Mutation typing method

Technical field

The present invention relates to a method for typing a mutation useful in the fields of molecular biology and medicine.

[0002] Even in the same species of organisms, the genomic DNA base sequence differs between individuals, and this phenomenon and the sites where the differences occur are called genetic polymorphisms. Usually, those that occur at a frequency of 1% or more in a population are defined as polymorphisms. The following three types of polymorphism markers are mainly used. That is, restriction fragment length polymorphism ^ RFLP, simple sequence length polymorphism ^ SSLP and one; ^ polymorphism (single nucleotide polymorphi sm, SNP). .

[0003] If a certain genomic region has a relatively large insertion, deletion, or mutation in a restriction enzyme recognition site, RFLP is analyzed by performing Southern hybridization using a probe at that site. be able to. However, polymorphisms that can be detected as RFLP are not so frequently present in the genome, so they are not suitable for comprehensive analysis of detailed polymorphisms. There are many repetitive sequences of 16 bases in the genome, which are called microsatellite. The number of microsatellite repetitions may vary from individual to individual and is referred to as SSLP. Since the sequence around the microsatellite is different for each repetitive sequence, amplification by polymerase chain reaction (PCR) using specific primers and analysis of the chain length of the amplified product by gel electrophoresis The number of repetitions can be easily known. However, more detailed polymorphism analysis requires polymorphic markers with higher density than SSLP. SNP is the most frequently found polymorphism, and exists in human at about 1 kb. SNP analysis is useful for understanding the relationship between the efficacy and side effects of diseases and pharmaceuticals and individual differences, and conducting more effective and safe medical treatment.SNP screening and typing are performed on a large scale worldwide. ing. [0004] Mutation detection methods utilize a method for determining a DNA base sequence, a method based on hybridization, a method based on primer extension, a method based on ligation, and an enzyme recognizing a special DNA structure. It is roughly divided into methods.

[0005] The method of comparing the genomic DNA base sequences of multiple individuals is the most direct mutation detection method. Methods for determining the nucleotide sequence of DNA are broadly classified into a chemical decomposition method (for example, see Non-Patent Document 1) and an enzyme synthesis method (for example, see Non-Patent Document 2). The former is called the Maxam-Gilbert method, and the latter is called the dideoxy method or the Sanger method. In the latter, in particular, an automatic sequencer based on the principle has become widespread and has become the mainstream DNA sequencing method. In addition, Matsushiburi No Larel Signature Sequencing (Massively Parallel Signature Sequencing; hereinafter, referred to as MPSS); This is a technique for determining the sequence. The sample DNA is bound to the microbeads, the microbeads are two-dimensionally packed in a flow cell, and a series of reactions and detections are performed to determine the sequence of about 20 bases at a time. can do. DNA microbead array technology relating to sample processing applied to the MPSS method is disclosed in Patent Document 2, Non-patent Document 4, and the like.

[0006] (h) The method based on hybridization detects the presence or absence of a mutation by hybridization between a nucleic acid sample and a probe. In this method, it is necessary to find out a probe whose hybridization is influenced by a difference of one base and hybridization conditions, and it is difficult to construct a detection system having high reproducibility.

For example, a mutation detection method using a cycle probe reaction described in Patent Document 3 can be mentioned. In this method, a nucleic acid probe having a special structure is hybridized to a nucleic acid molecule of interest. When a cleavage reagent is added thereto, the target nucleic acid molecule and the probe are cleaved when they are hybridized, and the probe is not cleaved when they are not hybridized. Thereafter, the mutation is detected by detecting and quantifying the free fragment derived from the cleaved probe. However, in the method, when the amount of the target nucleic acid is very small, there is a considerable time lag until the amount of the free fragment of the probe reaches a detectable level. As another method, there is a mutation detection method using the TaqMan method (for example, see Patent Documents 4 and 5). In this method, a TaqMan probe to which a fluorescent dye and a quencher are bound is used. As the probe, two types, one containing a mutation and one containing no mutation, are used. When the probe is hybridized to the target nucleic acid molecule and the primer is extended from the upstream of the probe, the 5 ′ → 3 ′ exonuclease activity of the DNA polymerase is increased only when the target nucleic acid molecule and the probe are hybridized. And the mutation is detected by detecting the generated fluorescence. However, in this method, it is necessary to perform PCR using a polymerase having 5 ′ → 3 ′ exonuclease activity and a labeled nucleotide having a blocked 3 ′ end, and thus a problem that strict temperature control is required. is there.

[0008] The method based on primer extension is based on (1) a method for detecting a mutation in the presence or absence of a primer extension reaction by using a primer whose 3 'end anneals to a base portion to be detected for mutation (for example, (6), (2) 3 'terminal force A method for detecting the presence or absence of a primer extension reaction using a primer in which the mutation site to be detected is located at the second nucleotide (for example, see Patent Document 7) (3) Use a primer whose 3 'end anneals to the base adjacent to the 3' side of the base for which mutation is to be detected, determine the base of the target portion from the type of base incorporated into the primer, and determine the mutation. Detection method (for example, see Patent Document 8).

Next, there is a method based on ligation. In this method, DNA ligase is applied to a DNA having a portion containing a mutation as a protruding end and a probe having a sequence complementary to this portion, and the mutation is detected based on the presence or absence of ligation.

[0010] A method using a DNA polymerase or a DNA ligase may not be able to accurately detect a mismatch between a primer or a probe based on mutation and a target nucleic acid. In other words, these enzymes may initiate the enzymatic reaction even in the case of mismatched primers and probes, and may give incorrect results.

In other words, there may be false positives due to an annealing error between the target nucleic acid and the primer and an error in the ligase or polymerase used, and it is necessary to control the reaction conditions, especially the reaction temperature, etc. very strictly, and the There is a problem with sex. Finally, there is a method using an enzyme having an activity of recognizing and cleaving a special structure of a double-stranded nucleic acid, such as the Invader method (for example, see Patent Document 9). As such an enzyme, cleavase is known. When a mutation is present (or not present), a probe is designed to form a structure recognized by the enzyme, and the presence or absence of cleavage of the probe is determined. By examining it, it is possible to detect the mutation. However, the method using an enzyme having an activity of recognizing and cleaving a special structure of a double-stranded nucleic acid has a problem in its sensitivity. That is, this method is a method in which one molecule of a target nucleic acid generates one molecule of a fluorescent signal, and a small amount of a nucleic acid sample cannot provide a signal sufficient for detecting a mutation. Of course, it is possible to enhance the signal by repeating the probe cleavage reaction, but it is necessary to amplify the target nucleic acid in advance to obtain a strong signal. That is, in the method, when the amount of the target nucleic acid is very small, there is a considerable time lag until the amount of the cleaved product reaches a detectable level because the amount of the cleaved product of the probe is small. In addition, depending on the sequence around the mutation site to be detected, cleavase may be difficult to act. When a large number of SNPs are typed by this method, it is said that the typeable SNP is 60-70%.

As described above, the above method has several problems, and a method capable of simultaneously and accurately detecting a large number of mutations has been required.

[0013] Patent Document 1: Japanese Patent Publication No. 2000-515006

Patent Document 2: Japanese Patent Publication No. 11-507528

Patent Document 3: US Pat. No. 5,660,988

Patent Document 4: U.S. Pat.No. 5210015

Patent Document 5: US Patent No. 5487972

Patent Document 6: US Pat. No. 5,137,806

Patent Document 7: International Publication No. 01Z42498 pamphlet

Patent Document 8: U.S. Patent No. 6210891

Patent Document 9: U.S. Pat.No. 5,846,717

Non-patent literature l: Maxam AM, Gilert W., Proceedings of National Academy of Sciences of the USA, Vol. 74, Brother 2 Issue 560-564, 1977

Non-Patent Document 2 _: _Sanger F., et al., Bulletin of the National Academy of Sciences, Vol. 74, No. 12, pp. 5463-5467, 1977

Non-Patent Document 3: Brenner S., 23 others, Nature Biotechnology, Vol. 18, No. 6, 630-634, 2000

Non-Patent Document 4: Brenner S., 12 others, Bulletin of the National Academy of Sciences, Vol. 97, No. 4, pp. 1665-1670, 2000

Disclosure of the invention

Problems to be solved by the invention

[0014] An object of the present invention is to provide a method for inexpensively and accurately detecting a mutation in a large number of samples.

Means for solving the problem

[0015] The inventors of the present invention have conducted intensive studies and, as a result, added a sample identification code to the target DNA for which mutation is to be detected, and determined the nucleotide sequence of the obtained DNA to detect mutation and identify the sample. And found that the present invention can be performed simultaneously, and completed the present invention.

That is, to outline the present invention, the first invention of the present invention is a mutation typing method, which includes the following steps.

(1) a step of preparing a target DNA containing a mutation site to be typed,

(2) adding a sample identification code to the target DNA, and

(3) A step of determining the base sequence of a region containing the sample identification code and the mutation site in the target DNA to which the sample identification code has been added.

[0017] In the method of the first invention of the present invention, examples of the step of determining a base sequence include a method including the following steps.

(a) ligating the region containing the sample identification code and the mutation site in the target DNA to which the sample identification code has been added to a tag vector to produce a tag library;

(b) a step of preparing a tag library with DNA in which a tag sequence is linked to DNA containing a sample identification code and a mutation site,

(c) Step of binding DNA containing the sample identification code and the mutation site to the microbeads (d) if necessary, linking an initiation adapter to the end of the target DNA on the microbeads,

(e) Two-dimensionally filling the microbeads into the flow cell and recording the position of each bead,

(f) a step of digesting the DNA on the microbeads with a restriction enzyme to make the end of the target DNA a protruding end,

(g) ligating the encoding adapter complementary to the protruding end generated in step (f) with the target DNA on the microbead,

(h) hybridizing the microbeads obtained in step (g) with a decoder probe to confirm the encoded adapter ligated with the target DNA;

(i) A step of removing the decoder probe from the microbeads in step (h) and using the resulting microbeads in step (f) and subsequent steps.

[0018] In another embodiment of the first invention of the present invention, a mutation including a step of polymerizing two or more regions including the sample identification code and the mutation site in the target DNA to which the sample identification code has been added is provided. A typing method is exemplified.

The invention's effect

According to the present invention, a method for typing a mutation is provided.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described specifically.

The definitions and explanations of the terms used in this specification are as follows. Terms other than those specifically defined are used in a meaning generally understood by those skilled in the art such as molecular biology and molecular genetics.

[0021] The "DNA microbead array technology" means the technology disclosed in Patent Document 2 and Non-patent Document 4 and a technology for analyzing gene expression and gene structure using the technology. In other words, a DNA to which an oligonucleotide called a tag is bound and microbeads to which an anti-tag which is an oligonucleotide complementary to the tag are bound are used as a tag and an anti-tag. This is a technique of bonding by hybridization between the two. As a result, a library of DNA immobilized on microbeads can be prepared, and one type of DNA is bound to one microbead!

[0022] The term "tag library" refers to a library of DNA to be bound to microbeads in DNA microbead array technology. Each clone in the tag library is a DNA containing the tag sequence and the DNA to be bound to the microbeads in the same molecule, and a collection of these clones is the tag library.

[0023] A "tag" is an oligonucleotide that is covalently bound to DNA to be bound to microbeads in DNA microbead array technology. A single-sequence DNA is placed on each microbead. Use to The repertoire of tags must be sufficiently larger than the number of clones in the tag library.

[0024] An "anti-tag" is an oligonucleotide that is covalently bound to microbeads in DNA microbead array technology and has a sequence that is complementary to the tag. One microbead has a single-sequence antitag attached to it, and the repertoire of the antitag is substantially the same size as the tag repertoire.

[0025] The "MPSS method" means the technology disclosed in Patent Document 1 and Non-Patent Document 3. In other words, microbeads to which DNA was bound, prepared by DNA microbead array technology, were two-dimensionally filled in a flow cell, digested with type lis restriction enzyme, and an adapter was connected to the protruding end generated by the restriction, and then ligated. This is a technology that identifies the adapter using a fluorescent probe in the flow cell. Originally, the MPSS method is a technique for determining a sequence of about 20 bases downstream from a specific restriction enzyme recognition sequence at the most downstream side of a cDNA.In this specification, the MPSS method refers to only the base sequence determination step of the method. Sometimes called the law.

The term "encoded adapter" refers to a mixture of partially double-stranded oligonucleotides used for ligation to a protruding end of a target DNA in the MPSS method. One end of the adapter (hereinafter referred to as the A-terminal) may be a protruding end having a sequence to which a decoder-probe described below can hybridize.

The other end (hereinafter, referred to as B end) may be a protruding end satisfying the following conditions. i) A 5′- or 3′-protruding end that can be ligated to the end of the target DNA generated by the type I Is restriction enzyme used in the “step of determining the base sequence of the target DNA fragment” in the present invention. That is, when the above-mentioned restriction enzyme generates a 5 '-(or 3'-) end that protrudes N bases, the A-terminal is also a 5 (or 3'-) end that protrudes N bases.

ii) In an encoded adapter having the A-terminus of the same sequence, the n-th base (l≤n≤N) at the B-terminus is any of A, G, C or T, and 4 at other positions. It is a mixture of different bases.

iii) Cover all sequences complementary to all possible protruding end sequences generated by the above restriction enzymes.

On the other hand, the double-stranded portion at the center of the enzyme adapter has the type lis restriction enzyme recognition sequence described above. When the restriction enzyme recognition sequence is digested with the restriction enzyme to obtain a DNA obtained by ligating an encoding adapter to a target DNA fragment, the sequence of the target DNA adjacent to the sequence of the protruding end used in the ligation is abrupt. It is designed to be generated as a terminal end! / ヽ.

Assuming that the adapters with the same A-terminal are grouped into one group, the adapters in each group are a mixture of 4 ^N_1 B-terminal adapters, and the entire adapter is 4 XN. NX 4 consists of ^N types of arrays.

Examples of preferably used adapters include those described in the Bulletin of the National Academy of Sciences, Vol. 97, pp. 165-1670, 2000. This encoded adapter is applicable when Bbvl is used as a type lis restriction enzyme, and the A-terminal has a 10 base 3'-overhang and the B-terminal has 4 bases 5'-overhang.

A "decoder probe" is a fluorescently labeled oligonucleotide that is used to detect which group of encoded adapters in the MPSS method have been ligated, and is complementary to the A-terminal sequence of the encoded adapter. What is necessary is just to have a proper arrangement. Proteins such as phycoerythrin, low molecular weight compounds such as fluorescein, and quantum dots are not particularly limited to the fluorescent dyes used in the decoder probe. Etc. can be used.

“Type lis restriction enzyme” is a restriction enzyme that recognizes an asymmetric sequence and cuts a site different from the recognition sequence. The type lis restriction enzyme used in the “step of determining the base sequence of the target DNA fragment” in the present invention should have the following conditions.

i) 5 'one or 3'—generates overhanging ends.

ii) The distance between the cleavage site and the recognition sequence is N bases or more, where N is the protruding base length of the generated terminal.

Preferred examples of the type lis restriction enzyme used in the “step of determining the base sequence of the target DNA fragment” include Bbvl. As described below, this enzyme recognizes the GCAGC sequence and generates a 5'-terminal with a 4-base overhang.

5,... GCAGCNNNNNNNN-3 '

3,... CGTCGNNNNNNNNNNNN-5 '

[0026] "Target DNA" refers to a DNA whose nucleotide sequence is to be determined. It also refers to the DNA for which mutations are to be detected or typed. The target DNA may be prepared from a biological sample, processed artificially, or synthesized artificially.

[0027] The term "mutation" refers to a site where genomic DNA sequences differ between individuals, between alleles of the same individual, between cells or between alleles of the same cell, and at different sites. That is, it includes polymorphisms, mutations, mutations caused by mutagenic agents or electromagnetic waves, mutations caused by artificial gene recombination, and changes in genomic DNA sequences caused by infection with viruses and the like.

The above “mutation” includes various forms of mutation such as “base substitution”, “deletion mutation”, “insertion mutation” and the like.

[0028] The term "base substitution" means that a particular base on a nucleic acid is partially replaced with another base. In the “base substitution” described in the present specification, the number of bases substituted is not particularly limited, and one or more bases may be substituted. Substitutions found at one base in the base sequence are called "single nucleotide polymorphisms (SNPs)". In addition, a base substitution artificially introduced into a nucleic acid is also included in the “base substitution” in the present specification. [0029] The term "deletion mutation" means that a specific nucleotide sequence is deleted at a specific site on a nucleic acid. The deleted base sequence may be a single base or a plurality of bases. In addition, the deletion of these nucleotide sequences includes those occurring at a plurality of specific sites on the nucleic acid. Furthermore, “deletion mutation” includes a specific region of a gene, for example, but not limited to, exon and Z or an intron region, and a case where the full length of the gene is deleted. In addition, deletion of a nucleotide sequence artificially introduced into a nucleic acid is also included in the “deletion mutation” in the present specification.

[0030] "Insertion mutation" means insertion of a base sequence at a specific site on a nucleic acid. The inserted base sequence may be a single base, a plurality of bases, or an arbitrary chain length. In addition, insertion of these nucleotide sequences may include those occurring at a plurality of specific positions on the nucleic acid. In addition, insertion of a base sequence artificially introduced into a nucleic acid is also included in the “insertion mutation” in the present specification.

[0031] The present invention relates to the detection and screening of genomic polymorphisms and variations, in particular, the detection and screening of substitution of one or more nucleotides on a gene, for example, SNP, deletion of one or more nucleotides and insertion of one or more nucleotides. Suitable for typing. In the following description, the operation described as “typing” does not only refer to clarifying the nucleotide sequence of a mutation whose presence has already been detected, but also detects the mutation at the same time as the detection of the presence of the mutation. Includes operations to determine sequences.

[0032] The mutation typing in the present invention is described in detail below.

(1) Step of preparing target DNA containing the mutation site to be typed

In practicing the present invention, first, a target DNA is prepared. The method for preparing the target DNA is not particularly limited, for example, genomic DNA, cDNA, DNA amplified by nucleic acid amplification methods such as these PCR, ICAN, etc., and these DNAs as vectors, for example, plasmid vectors or Batatelio phage vectors, DNA, a mixture of cloned DNA, cloned DNA from which the vector portion has been removed by restriction enzyme digestion, etc., nucleases such as restriction enzymes, chemical treatment such as acid treatment, or Those subjected to physical treatment, for example, ultrasonic treatment, may be mentioned.

[0033] A method of amplifying by PCR using genomic DNA as type I, whether total RNA or poly A RNA The method of amplification by RT-PCR (hereinafter collectively referred to as PCR method) and the method of digesting these DNAs with restriction enzymes are simple, low in cost, and large in the number of samples that can be processed at one time. It can be suitably used from the viewpoint of easiness of application to the subsequent steps.

[0034] The method for preparing the target DNA, which is not particularly limited to the chain length of the target DNA, the method for determining the sample identification code and the nucleotide sequence of the region containing the mutation site, the nucleotide sequence around the mutation site, etc. Just select. When the target DNA is prepared by the above PCR method, the molecular weight of the target DNA can be 10 to 10,000 bases, preferably 15 to 5000 bases, and more preferably 20 to 1000 bases.

There is no particular limitation on where the range of the target DNA is set so that the mutation site to be typed is located in the target DNA. The method may be appropriately determined by a method for determining the base sequence of the region including the sample identification code and the mutation site. Just choose! For example, when the nucleotide sequence is determined by the same method as the MPSS method of Patent Document 6 and Non-patent Document 3, the nucleotide sequence length that can be determined by this method is about 20 bases, and thus the sample identification code and the mutation to be typed It must be included in the range of 20 bases or less. Therefore, when the MPSS method is used to decode the nucleotide sequence, the mutation site is located within 20 bases, preferably within 15 bases, more preferably within 10 bases, from the end of the target DNA to which the sample identification code is added. It just needs to be. In addition, for example, when determining the force sequence by combining two or more regions including the sample identification code and the mutation site, the smaller the molecular weight of the polymerized unit, the smaller the amount of information obtained per sequence analysis Therefore, the mutation site should be located within 500 bases, preferably within 100 bases, more preferably within 20 bases, from the end of the target DNA to which the sample identification code is added.

[0036] In carrying out the present method, a polymerization method similar to the Serial Analysis of Gene Expression method (hereinafter, referred to as SAGE method) can be used. The SAGE method is a method in which a large amount of gene expression information can be obtained by one sequence determination by polymerizing DNA fragmented with a type lis restriction enzyme and determining its base sequence (U.S. Pat. Book, Vel culescu VE, and 3 others, Science, Vol. 270, 484-487, 1995. At present, type lis restriction enzymes that cleave sites that are 20 bases or more apart from the recognition sequence are known, so the sample identification code and the mutation site are included in the region of 20 bases or less. Need to be. Therefore, the mutation site may be located within 19 bases, preferably within 15 bases, more preferably within 10 bases, from the end of the target DNA to which the sample identification code is added.

As described above, in the present invention, it is desirable to prepare a target DNA having a mutation site near the end. When the target DNA is prepared by the PCR method, the relationship between the primer sequence and the mutation site is not particularly limited. However, it is desirable to design the primer so that the primer sequence does not include the mutation site for the following reasons. That is, when the primer sequence contains a mutation site, it is necessary to prepare a primer having a plurality of sequences corresponding to the type of mutation, and when the mutation site is located other than near the 3 ′ end of the primer, Since there is a possibility that amplification will occur with primers containing bases that are not complementary to type II, there is a risk that DNA that does not accurately reflect the type II base sequence will be amplified.

[0038] For example, when PCR or RT-PCR is performed using mammalian genomic DNA or RNA as type I, primers of 15 bases or more, preferably 17 bases or more, more preferably 20 bases or more to specifically amplify Use Therefore, if a PCR product or an RT-PCR product (hereinafter collectively referred to as a PCR product) amplified using a primer that does not contain a mutation site is used as it is as the target DNA, the terminal power of the target DNA is also approximately up to the mutation site. They will be more than 15 bases apart. By appropriately removing the terminal sequence of the PCR product, it is possible to prepare a target DNA having a mutation site at a position having a terminal force of less than about 15 bases. The method for removing the terminal sequence is not particularly limited. A method using an enzyme, a physical method such as ultrasonic treatment and shearing, a chemical method such as acid treatment, or a method combining these methods is used. be able to. As the enzyme, deoxyribonuclease (D Nase) can be used, and examples thereof include restriction enzymes, endonucleases such as DNasel, exonucleases such as BAL31 exonuclease, exonuclease ΠΙ, λ exonuclease, and DNA4 DNA polymerase. .

[0039] Since the restriction enzyme has high specificity, a desired target DNA having a mutation site near the end can be prepared if a recognition sequence is present at an appropriate position in the PCR product. To prepare such a target DNA, it is desirable to cleave the inside of the primer sequence or between the 3'-end of the primer sequence and the mutation site. On genomic DNA or cDNA If a restriction enzyme site exists near the mutation site, the use of a restriction enzyme is an effective means.

[0040] Most of the restriction enzymes cut inside the recognition sequence. In order to use such a restriction enzyme to remove the sequence at the end of the PCR product, an appropriate restriction enzyme recognition sequence must be present near the mutation site. However, if there is no appropriate restriction enzyme recognition sequence, such a restriction enzyme cannot be used.

[0041] The type lis restriction enzyme is a restriction enzyme that cleaves a site at a certain distance also in recognition sequence power. If such an enzyme is used, the PCR product is irrespective of the sequence near the mutation site on the genomic DNA or cDNA. The terminal sequence can be removed to prepare the target DNA. That is, if a type lis restriction enzyme recognition sequence is added to the 5 ′ side of the PCR primer, the terminal sequence can be removed by digesting the PCR product with the type lis restriction enzyme. Even if multiple mutation sites are typed simultaneously, only one type of lis restriction enzyme can be used by adding a common type lis restriction enzyme recognition sequence to the primer for amplifying the vicinity of each mutation site. Thus, terminal sequences near all mutation sites can be removed. The type of type lis restriction enzyme to be used is not particularly limited and may be appropriately selected in consideration of the size of the terminal sequence to be removed, the sequence of the target DNA, the reactivity with methylated DNA, and the like. When using mammalian genomic DNA or RNA, a primer having 15 bases or more, preferably 17 bases or more, more preferably 20 bases or more is used as described above, and it is preferable that the mutation site is not included in the primer sequence. A type lis restriction enzyme that cleaves at a position separated from the recognition sequence by 5 bases or more, preferably 10 bases or more, more preferably 15 bases or more may be used. As a type lis restriction enzyme having such properties and suitable for use, for example, Mmel can be mentioned.

[0042] Cleavage by the type lis restriction enzyme recognition sequence in the target DNA may adversely affect subsequent steps. In such a case, a type lis restriction enzyme having no recognition sequence in the target DNA may be used. Alternatively, it is also possible to use a type lis restriction enzyme that does not cleave both strands of DNA that has been ligated (hemimethyl). By using the appropriate methylidaninucleoside triphosphate during PCR, the recognition sequence added to the primer becomes hemimethyl, Since the recognition sequence inside the DNA is both methylated, the restriction enzyme having the above properties recognizes only the recognition site added to the primer.

In step (2), in order to efficiently add a sample identification code to the target DNA, the 5 ′ end of the target DNA to which the sample identification code is added is a phosphate group or an OH group, and the 3 ′ It is desirable that the terminal be an OH group. When the terminal is purified by endonuclease treatment with a restriction enzyme or the like, no special treatment is required since the terminal is usually a 5 ′ phosphate group or a Z3 ′ OH group. When the target DNA is a PCR product and its end is ligated to an adapter in step (2) described later, it is necessary to phosphorylate at least one of the 5 ′ end of the adapter and the target DNA. To phosphorylate the 5 'end of the PCR product, a known method is used, for example, using a primer chemically phosphorylated during synthesis, or using a primer enzymatically phosphorylated after synthesis. A method such as enzymatic phosphorylation after PCR can be used.

[0044] The shape of the target DNA on the side to which the sample identification code is added is not particularly limited as long as the adapter can be ligated in step (2), but a shape that can easily design an adapter to be efficiently ligated is used. desirable. In other words, particularly when multiple mutation sites are to be probed at once, it is desirable that one type of adapter or a pool of adapters be ligated to target DNAs corresponding to all mutation sites. Examples include blunt ends, 5 'overhangs or 3' overhangs with a common sequence, 5 'overhangs or 3' overhangs with a common number of bases, and these ends are generated by known methods. Let me do it. In order to generate blunt ends, a restriction enzyme having a blunt end is used, and the ends are blunted with a DNA polymerase such as T4 DNA polymerase, Escherichia coli DNA polymerase I, and tarenow enzyme. Can be used. In order to generate a protruding end having a common sequence, a restriction enzyme that cleaves inside the recognition site may be used. In order to generate overhanging ends having the same number of overhanging bases, a type lis restriction enzyme may be used.

(2) Step of adding sample identification code to target DNA

A sample identification code, that is, a DNA having a base sequence capable of identifying the origin of the target DNA, is added to the target DNA prepared in the above step. The sample identification code is Although the method of use is not particularly limited, it can be used to specify a sample from which the target DNA of the first stage is derived, for example, an individual organism, an organ, a tissue, a cell, a gene, and the like.

The sample identification code is composed of a DNA sequence of one or more bases, and the number of bases may be appropriately set according to the number of samples for which mutations are desired to be simultaneously tested. In other words, a sample identification code that has ⁿ bases can identify 4 ⁿ samples.For example, when the number of samples is 4 or less, n = l, when the number of samples is 16 or less, n = 2, and when the number of samples is 64 or less, Is n = 3, n = 4 for 256 or less, n = 5 for 1024 or less, and n = 6 for 4096 or less. It is not always necessary to use a sample identification code that also has a minimum number of bases for the number of samples. For example, it is possible to use a sample identification code that also has three bases for 10 samples. By using a combination of sample identification codes that differ by at least 2 bases in any two of the sample identification codes used, samples can be more accurately identified from the obtained sequence data. . For example, if n = 3 and number of samples = 10, any 10 of the 12 sample identification codes AAA, GG G, CCC 、 TTT, AGC, ACT ゝ ATG, GAC ゝ GTA, CAG, CGTCA TCA By selecting, the sample can be identified more accurately. In order to add the sample identification code to the target DNA, an adapter containing the sample identification code sequence must be ligated. The adapter may be a nucleic acid containing a sample identification coding sequence, such as single-stranded RNA, double-stranded RNA, single-stranded DNA, or double-stranded DNA. The most suitable point force can be used such as high ligation efficiency and easy cloning. To the adapter, in addition to the sample identification code, a restriction enzyme recognition sequence, a primer binding sequence, etc. may be added, and these appropriate sequences may be added to amplify a DNA fragment containing the sample identification code and the mutated site. Cloning into DNA, determination of base sequence, etc. can be performed efficiently. The shape of the ends of the ligated target DNA and the adapter can be expected to increase the ligation efficiency by desiring that both are blunt ends or that they have protruding ends that are complementary to each other. When target DNA is prepared by digesting a PCR product with a type lis restriction enzyme and cleaving near the mutation site, the terminal sequence of the target DNA to which the sample identification code is added differs depending on the mutation site. The number of protruding bases is common. Therefore, when using such target DNA, an adapter having a complementary end to the end of each target DNA If a mixture of the above is used, the ligation reaction for each sample and each mutation site becomes unnecessary,

If one ligation reaction is performed per sample, that means that.

[0047] In addition, since at least one of the 5 'ends must be phosphorylated, the 5' end of the adapter to be ligated is phosphorylated. Alternatively, the end of the target DNA to be ligated must be a 5 'phosphate group. The method for obtaining the 5 ′ phosphate end of the target DNA is as described in the description of step (1) of the third embodiment of the present invention. The 5 ′ end of the adapter can be phosphorylated by a known method, for example, a method of chemically phosphorylating at the time of synthesis, or an enzyme such as T4 polynucleotide kinase after synthesis. A method of acidifying can be suitably used.

[0048] The ligation method may be appropriately selected depending on the type of the adapter. When the adapter is RNA or single-stranded DNA, RNA ligase, for example, T4 RNA ligase, and when it is double-stranded DNA, DNA ligase, for example, T4 DNA ligase or E. coli DNA ligase can be suitably used.

[0049] The position of the sample identification code in the adapter is not particularly limited. When the sequence is determined according to the same principle as the MPSS method, or when the sequence is determined by polymerizing low-molecular-weight DNA by the same method as the SAGE method, the sample identification code and the mutation site have approximately 20 bases. It must be included in the following range. Therefore, the sample identification code is desirably located near the end ligated to the target DNA in the adapter. The sample identification code may be a continuous base, or another base may be inserted between the bases constituting the sample identification code. However, when the sequence is determined by the same method as the MPSS method or SAGE method as described above, the bases constituting the sample identification code are set so that the combined sequence of the sample identification code and the mutation site is about 20 bases or less. It is necessary to set the number of other bases inserted between.

(3) Step of determining the base sequence of a region containing the sample identification code and the mutation site in the target DNA to which the sample identification code has been added

The base sequence of the region containing the sample identification code and the mutation site in the target DNA to which the sample identification code has been added may be determined by a known method. In order to simultaneously type a plurality of mutation sites in a plurality of samples, it is described in Patent Document 6 and Non-patent Document 3 described above. The method based on the principle of the MPSS method and the method based on the principle of the SAGE method can be particularly preferably used.

(A) Method based on the principle of MPSS method

(A-1) Step of ligating fragmented target DNA to tag vector and preparing tag library

The fragmented target DNA prepared in step (2) is ligated to a tag vector. As the tag sequence contained in the tag vector, those disclosed in Patent Document 2 can be used, and among them, those described in Non-Patent Document 4 can be particularly preferably used. It is desirable that the tag vector contains a selection marker such as drug resistance. When Escherichia coli is used as a host, genes such as ampicillin resistance, chloramuecole resistance, kinamicin resistance, and streptomycin resistance can be used as markers.

[0052] The ends of the DNA fragments linked to the tag vector may be blunted by enzymatic treatment, for example, treatment with BAL31 exonuclease, T4 DNA polymerase, Klenow enzyme, or a combination of these enzymes !. The DNA fragment thus prepared can be efficiently ligated to a tag vector that has been linearized by treatment with a restriction enzyme that generates blunt ends. The terminal shape of DNA fragmented by physical or chemical treatment is irregular, and usually contains 5, -OH, 5-phosphoric acid, 3, -OH, and 3-phosphoric acid. Of these, only DNA having 5, monophosphate and 3'-OH groups can be used as substrates for DNA ligases such as T4 DNA ligase, so after removing terminal phosphate groups with an enzyme such as alkaline phosphatase, When the 5'-end is selectively phosphorylated with an enzyme such as T4 polynucleotide kinase, a DNA fragment that can be efficiently ligated to a vector is obtained. A protruding end can be obtained by ligating a linker to the blunted end of the fragmented DNA and digesting with a restriction enzyme that recognizes the sequence of the linker, or ligating an adapter. This DNA fragment can be more efficiently ligated to a linear tag vector having complementary ends.

[0053] The tag vector to which the fragmented DNA has been linked is introduced into an appropriate host, preferably Escherichia coli. DNA can be introduced into a host by a known method, and there is no particular limitation. When transformation is performed using Escherichia coli as a host, an electoporation method or a method using a competent cell can be used. Selection corresponding to marker gene of tag vector The transformant is cultured under pressure to prepare a tag library, which is a mixture of the DNA fragmented with the fragmented DNA and the tag vector. In preparing a tag library, DNA can be prepared by a known method. If the tag vector is a plasmid vector, for example, the alkali-SDS method can be used. It is desirable to measure the number of independent clones contained in the tag library by inoculating a portion of the transformed host cells into a solid selection medium and counting the number of colonies that appear. Independent black Ichin number may be set as appropriate depending on the purpose but, considering the sequencing capabilities of MPSS 10 ⁴ or more, preferably 10 ⁵ or more, more preferably be set to 10 ⁶ or more. It is effective to prepare the tag library as a plurality of pools and obtain the desired number of clones by selecting the number of pools to be used. In this case, the tag library having the desired number of clones can be easily prepared by setting the number of clones per pool to 11,100,000 and the number of pools to be prepared from 2 to 100.

[0054] The tag vector of Patent Document 2 is a mixture of about 17 million types of plasmids having different tag portion sequences. In order to perform sequence analysis by the MPSS method, it is necessary to bind one type of DNA to one microbead, and therefore, one type of target DNA must correspond to one type of tag sequence. is necessary. By setting the number of clones contained in each pool of the tag library to 170,000 and 1 million, and binding target DNA to microbeads for each pool, the number of tags to which two or more types of The ratio can be as low as 0.5-several%.

[0055] (A-2) A step of preparing a DNA in which a fragment of a target DNA and a tag sequence are linked to one another by a tag library

Prepare a tag library and DNA containing the target DNA fragment and tag. The method is not particularly limited, for example, a method in which the vector portion is removed from the DNA by digestion with one or more appropriate restriction enzymes, followed by molecular weight fractionation by gel electrophoresis or gel filtration. Examples include a method using PCR. In particular, the PCR method has advantages such as simplicity when preparing a large amount of DNA containing a target DNA and a tag, and because it can amplify only the desired portion, there is no need to remove the vector. In this case, the primer on the target DNA side can be specifically selected with a fluorescent group, and the primer on the tag side with a specific selection such as biotin. By labeling with a group, subsequent operations can be performed efficiently and easily.

(A-3) Step of Binding Target DNA Fragment to Microbeads

The tag portion of this DNA is made single-stranded by, for example, the following method. The tag of Non-patent Document 4 has A, T, and G base forces, and the complementary strand of the tag includes T, A, and C. If necessary, digest the DNA with a restriction enzyme that cuts between the tag and the end on the tag side, remove the terminal fragments, and then make T4 DNA polymerase act in the presence of dGTP to convert only the tag into a single strand. it can.

[0057] The thus obtained target DNA fragment with a single-stranded tag is bound to a microbead to which an anti-tag is bound (hereinafter abbreviated as microbead). Microbeads can be prepared, for example, by the methods described in Patent Document 2 and Non-patent Document 4. Mix single-stranded tagged target DNA and microbeads and incubate. Conditions such as the composition and temperature of the incubation solution are such that the anti-tag on the microbeads and the single-stranded tag bound to the fragmented target DNA specifically hybridize, that is, only the completely complementary anti-tag and single-stranded tag are used. Is not particularly limited as long as the hybridization conditions are satisfied, but the conditions described in Non-Patent Document 4 described above, namely, 500 mM NaCl, 10 mM Na phosphate, 0.01% Tween 20, 3% dextran sulfate at 72 ° C., 3 ° C. Conditions for hybridizing for a day can be used favorably. After washing the microbeads, the microbeads to which the target DNA with a single-stranded tag is bound by hybridization are selected. If the PCR primer on the target DNA side is fluorescently labeled, the label can be used as a marker by using a cell sorter, which is advantageous in terms of operability, purity of the obtained microbeads, and the like.

[0058] A covalent bond is formed between the anti-tag and the target DNA fragment bound to the microbeads by DNA ligase. The DNA ligase to be used is not particularly limited. For example, T4 DNA ligase and E. coli DNA ligase can be suitably used. If the DNA polymerase is allowed to act in the presence of dATP, dGTP, dCTP, and dTTP prior to the reaction with DNA ligase, the efficiency of the DNA ligase reaction may be improved. Therefore, this reaction may be performed if necessary. The DNA polymerase to be used is not particularly limited, but for example, T4 DNA polymerase can be suitably used.

(A-4) Step of Determining Base Sequence of Target DNA Fragment The base sequence of the DNA immobilized on the microbeads prepared in the above step (A-3) can be determined according to the following operation.

(A) A DNA fragment containing a fluorescent group at the end of the target DNA on the microbead is removed with a restriction enzyme, and an initiation adapter is ligated. For this purpose, it is desirable to insert an appropriate restriction enzyme recognition sequence into the tag vector. The sequence of the initiation adapter is not particularly limited as long as the DNA base sequence can be determined by performing a series of subsequent reactions. In other words, the recognition sequence for the type lis restriction enzyme used in the next step may be at the correct position. For example, as described in Non-patent Document 3, an initiating adapter (initiating adapter 1) for analyzing four bases at a time from the end of the target DNA, and a site force 2 bases away from the end of the target sequence 4 You can use two types of adapters, starting adapters (starting adapter 2) for analyzing each base, or use only one type of starting adapter.

Alternatively, the above-mentioned fluorescent group can be obtained by inserting a recognition sequence for the type lis restriction enzyme used in the next step in the tag vector used in the step (A-1) near the site where the target DNA is to be closed. Removal of the DNA fragment containing and ligation of the initiation adapter can be omitted.

(B) The microbeads thus prepared are two-dimensionally filled in a flow cell. The flow cell is made up of glass plates stacked at intervals slightly larger than the diameter of the microbeads, and there is a dam near the outlet to prevent the beads from flowing out. Perform the following reaction in the flow cell to determine the base sequence of the target DNA.

(C) First, hundreds of thousands to hundreds of thousands of beads are filled in a flow cell, and fluorescence emitted from the beads is photographed with a CCD camera to record the position of each bead.

(D) The start adapter has a type lis restriction enzyme recognition sequence, and is designed such that digestion with this enzyme makes the end of the target DNA a protruding end. By flowing a type lis restriction enzyme through a flow cell filled with beads and reacting with the DNA on the beads, the four bases at the end of the target DNA are made to be protruding ends. The type lis restriction enzyme is not particularly limited as long as it generates a protruding end, but an enzyme generating a 4-base protruding end, for example, Bbvl can be suitably used. (E) Preferable examples of the encoder adapter and decoder probe used in the present invention include those described in Non-patent Document 4. The dead adapter disclosed in this document is designed for use with Bbvl as a type lis restriction enzyme. The adapter is a partially double-stranded synthetic DNA having a 5 ′ overhang of 4 bases at one end and a 3 ′ overhang of 10 bases at the other end. The sequence of the double-stranded portion of the dead adapter is common, and is divided into 16 groups according to the sequence of the protruding end. Encoad adapters belonging to the same group have one base and all 3 'protruding end sequences common to the 5' overhanging end, and the remaining 3 bases at the 5 'overhanging end are a mixture of four bases. is there. By reacting T4 DNA ligase with a mixture of 16 groups of adapter adapters (64 x 16 = 1,024 types of sequences), an adapter with a sequence complementary to the sequence of the protruding end of the target DNA Only Licensing.

(F) In order to detect which encoding adapter has been ligated, 16 kinds of decoder probes are passed through the flow cell to perform hybridization. The decoder probe is a fluorescently labeled synthetic DNA, the sequence of which is complementary to any of the sequences at the 3 'protruding end of the enzyme adapter. Each time one type of decoder probe is noisy, fluorescence is recorded with a CCD camera and the image data is imported to a computer. Then, the temperature is raised and the decoder probe is removed.

The structure of the encoder adapter is not particularly limited as long as it can perform MPSS. That is, it is only necessary to have a single-stranded portion linked to the protruding end of the target DNA, a double-stranded portion having a type lis restriction enzyme recognition sequence, and a single-stranded portion for hybridizing a decoder probe. . The type lis restriction enzyme recognition sequence and its position may be any as long as they can be recognized by the type lis restriction enzyme used here and generate an end from which a base to be determined next protrudes. The decoder probe has a sequence and a fluorescent group complementary to the decoder probe binding sequence of the encoder adapter! /, And as the fluorescent group, for example, phycoerythrin can be suitably used.

(G) Digestion of the target DNA ligated with the enzyme dead adapter with a type lis restriction enzyme that recognizes the double-stranded portion of the enzyme dead adapter yielded the above results. A base adjacent to the determined base sequence becomes a protruding end. The base sequence can be determined by repeating the cycle of ligation of the adapter (e), hybridization with the decoder probe, recording with the CCD camera, and removal of the decoder probe (f).

As described above, several hundred thousand to one million DNA sequences having about 20 bases can be obtained.

(B) Method of Determining a Force Sequence by Polymerizing a Region Containing a Sample Identification Code and a Mutation Site In the method of the present invention, it is sufficient to determine the sequence around the sample identification code and the mutation site. Mutation can be typed by determining the sequence of several bases to 20 bases per mutation site. A method using an automatic sequencer based on the principle of the dideoxy method, which is the mainstream of the current DNA sequencing method, can determine a sequence of several hundred bases per analysis. Therefore, by polymerizing a plurality of sample identification codes and sequences around the mutation site and determining the force sequence, it becomes possible to type a plurality of mutations per sequence analysis.

(B-1) Preparation of Monomer

The target DNA added with the sample identification code can be the one prepared in step (2). This DNA may be used as it is as a region for which a sequence is to be determined, including the sample identification code and the mutation site (hereinafter, referred to as a sequencing region). May be. The former has the advantage of easy operation, and the latter has the advantage of obtaining more information per analysis.

[0070] The method of cutting out the sequence determination region in the latter method will be described in detail below.

The range of the sequencing region is not limited as long as it includes the sample identification code and the mutation site. However, when it is desired to type a plurality of mutation sites at the same time, it is necessary to include, in addition to these, sequences around the mutation site necessary for identifying the mutation site. The method of cutting out this region is not particularly limited, and a method using an enzyme, a physical method such as sonication shearing, a chemical method such as acid treatment, or a method combining these methods can be used. Deoxyribonuclease (DNase) can be used as the enzyme; restriction enzymes, endonucleases such as DNasel, BAL31 exonuclease, exonuclease Exonucleases such as Rease III, λ exonuclease, and Τ4 DNA polymerase. Since restriction enzymes have high specificity, they are effective when a recognition sequence is present at an appropriate position. In particular, since the type lis restriction enzyme also cleaves sites at a certain distance apart from the recognition sequence, the addition of an appropriate type lis restriction enzyme recognition sequence to the adapter having the sample identification code allows the sequencing region with the desired molecular weight to be added. Can be cut out. There is no particular restriction on the type of type lis restriction enzyme as long as the sequencing region can be cut out. For example, Mmel and BsmFI can be used.

(B-2) Preparation and Conjugation of Concatemer

The sequencing region thus prepared is polymerized using DNA ligase, for example T4 DNA ligase or E. coli DNA ligase, and is cloned into a vector. The polymerization efficiency can be improved by converting the shape of the end of the sequencing region to a shape suitable for the polymerization reaction as follows, for example, before performing the polymerization. When the sequencing region is cut out with a type lis restriction enzyme that generates a 5 'overhanging end or a 3' overhanging end, the protruding nucleotide sequence at the cleavage end of the enzyme differs for each mutation site, and In general, there is no arrangement determination area having. By blunting the terminal, a dimer can be prepared regardless of the nucleotide sequence of the protruding terminal. In addition, an appropriate restriction enzyme recognition sequence is added to the adapter having the sample identification code, and the dimer is digested with this restriction enzyme. It becomes a suitable shape. The degree of polymerization is not particularly limited as long as it is 2 or more. When cloned into a plasmid vector, it is 10 kb or less, preferably 300 bp or more and 5 kb or less, more preferably 1 kb or more and 3 kb or less. Since it is often difficult to strictly control the degree of polymerization, the fraction having the desired degree of polymerization is purified by a molecular weight fractionation, for example, by agarose gel electrophoresis or gel filtration after the polymerization reaction, and the resulting fraction is cloned into a vector. Is also good. Plasmid vectors, phage vectors, and the like, which are not particularly limited by the type of vector, can be suitably used. The host at the time of cloning is not particularly limited, but Escherichia coli can be suitably used.

[0072] (B-3) Sequencing

From the thus obtained transformant, a vector containing the polymer for the sequencing region is extracted, and the nucleotide sequence is determined. Although there is no particular limitation on the nucleotide sequence determination method, The Maxam Gilbert method described in Document 1, the dideoxy method described in Non-Patent Document 2, and the method based on the principle of the MPSS method described in Non-Patent Document 3 and Patent Document 6 can be used. Above all, if an automatic sequencer using the dideoxy method is used, much sequence information can be obtained. The sequence power of the sample identification code can identify the sample, the mutation site from the sequence around the mutation site, and the sequence power of the mutation site. The mutation of the sample can be typed.

Example

[0073] Power for explaining the present invention more specifically with reference to the following examples The present invention is not limited to only the following examples.

Among the operations described in this specification, the basic operations such as plasmid DNA preparation and restriction enzyme digestion are described in Sambrook et al., "Molecular Development", "Lab", "Laboratory", "Mayuanore No. 2". Edition (Molecular Cloning—A Laboratory Manual, 2nd Ed.), Cold Spring Harbor Laboratory Press, 1989. Furthermore, Escherichia coli TOP10 was used as a host for the construction of plasmids using Escherichia coli shown below unless otherwise specified. The transformed Escherichia coli was cultured in LB medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl, pH 7.0) containing 30 gZml of chloramphenicol, or 1.5% agar in the above medium. Was cultured aerobically at 37 ° C. using an LB chloramphene-coal plate on which the coconut was solidified.

Example 1

(1) Sample preparation

Genomic DNA was prepared from K-562 cells (ATCC CCL-243), T.T cells (JCRB0262), SKBR-3 cells (H TB-30), Lu-65 cells (JCRB0079) and ΚΑΤΟΠΙ cells (JCRB0611). . Using these genomic DNAs as type III, PCR was carried out using the combinations of primers shown in Table 1-1 and Table 18 to amplify the area around the site where the presence of SNP was known! /. However, the 5 'end of primer 2 is labeled with biotin.

[0075] [Table 1-1]

Oozdf / e :) d 93 9Z08C0 / S00Z OAV

. . . .

~, O

Primer

Pair of names Primer 1 Primer 2

Name

CAGAGTTCTACAGTCCGACAACTGGA ATGCTGCATTCGTCTCTGGCCATGCTCT

SLC26A8

TCCCGAAGCATCC CAAAATGTGAGCA

CAGAGTTCTACAGTCCGACGAGCAGG ATGCTGCATTCGTCTCTGGCCAGCAACT

SLC28A 1_ 1

CAAAGAGGAGAGC GGTGTCCTTCGCA

CAGAGTTCTACAGTCCGACCGTAACC ATGCTGCATTCGTCTCTGGCCCCCTACT

SLC28A 1_2

TCCGGTCATGACA TGGCAGACATGAC

CAGAGTTCTACAGTCCGACTCCTCGG ATGCTGCATTCGTCTCTGGCCTTGTGGC

SLC28A 1— 3

CCCCTGCCAGGCG CTATCAAGACCTC

CAGAGTTCTACAGTCCGACCACGGAG ATGCTGCATTCGTCTCTGGCCACGCCGC

SLC28A 1— 4

ATCCACTGCTTCC CTGGCAGGGGCCG

CAGAGTTCTACAGTCCGACCCTTTGG ATGCTGCATTCGTCTCTGGCCTGCAGGA

SLC28A2

GCTGTGTCTAAAG GTCTCCTTGGTTG

CAGAGTTCTACAGTCCGACGTGGGGT ATGCTGCATTCGTCTCTGGCCCAAGCTT

SLC29A 1

TGTCTTTCACTCC ACTTGGTGGAGTG

CAGAGTTCTACAGTCCGACGGAACTT ATGCTGCATTCGTCTCTGGCCTTTTCCT

SLC2A2— 1

TAAAAAATGTAAA CTTTGCTGGAGTG

CAGAGTTCTACAGTCCGACCAGCTTT ATGCTGCATTCGTCTCTGGCCTGTGTCC

SLC2A2_2

GCAGTTGGTGGAA CCAAGCCACCCAC

CAGAGTTCTACAGTCCGACCACGGAG ATGCTGCATTCGTCTCTGGCCTGAGGGA

SLC2A4_2

AGGGCCCAGAGGG CCCAGCTCCATCC

CAGAGTTCTACAGTCCGACTTTGGAA ATGCTGCATTCGTCTCTGGCCCCCCTGT

SLC2A9— 1

AAGCTGGGATCCC ACTCAAGGTGACG

CAGAGTTCTACAGTCCGACTAGAGGA ATGCTGCATTCGTCTCTGGCCAGCACGG

SLC2A9— 2

GGTCCTGGCTGAG ACACCAGGCGGAT

CAGAGTTCTACAGTCCGACTGCCCAT ATGCTGCATTCGTCTCTGGCCTGCTCGC

SLC2A9— 3

GATGAAGCGTCCC TCCAGGCAGGAGC

CAGAGTTCTACAGTCCGACCACAGAT ATGCTGCATTCGTCTCTGGCCACACTCC

SLC2A9_4

GACACCAGCCACG AGCAGTGCCCTCC

CAGAGTTCTACAGTCCGACCGTTTGC ATGCTGCATTCGTCTCTGGCCACGCCAC

SLC33A 1

TTGGGAATACCGA AGTGAGAGCAATC 1-5]

AGTGGCATCCTT

TGCTGCATTCGTCTC

TGGTGGCCTCAA

CAG TGCTGCATTCGTCTCTGGCC-

GGTGGCATTGGC

c¾ TGCTGCATTCGTCTCTGGCCATTCT

GAAGATGCTTTC

TGCTGCATTCGTCTCTGGCC

AGAAAATAATGC

TTT TGCTGCATTCGTCTCTGGCC 2 ~,

GGTTCCTACACC

TGCTGCATTCGTCTC

TCCTCCTGCTCG

TGCTGCATTCGTCTCTGGCC-

TGGTAGTCTGTG

TGCTGCATTCGTCTCTGGCCATGTG

GAACGGAGGAGG

TGCTGCATTCGTCTCTGGCC

TCATGGCCGGTA

TTC TGCTGCATTCGTCTCTGGCCCCTTG 2,

Primer

Pair of names Primer 1 Primer 2

Name

CAGAGTTC TACAGTCCGACAGGCGGA ATGCTGCATTCGTC TCTGGCCCCCGCAC

SLC9A3

AGGGCATCAGGCG GCAGATTCCCTAC

CAGAGTTC TACAGTCCGACCCACTAC ATGCTGCATTCGTC TCTGGCCCAGGTAC

SLC9A8

ATCAGGCGGCAGG TTGGCGTCCAGCC

CAGAGTTC TACAGTCCGACGAGGAAA ATGCTGCATTCGTC TCTGGCCATCTGTA

2C 19—99

ACTCCCTC CTGGC GGATATTTCCAAT

CAGAGTTC TACAGTCCGACATCAGGA ATGCTGCATTCGTC TCTGGCCTTTCCCA

2C 19—636

TTGTAAGCACCCC GAAAAAAAGACTG

CAGAGTTC TACAGTCCGACCCACTAT ATGCTGCATTCGTC TCTGGCCAAAGCAA

2C 19_681

CATTGATTATTTC GGTTTTTAAGTAA

CAGAGTTC TACAGTCCGACGTCCAGG ATGCTGCATTCGTC TCTGGCCCCTGTCC

2C 19_990

AAGAGATT GAACG TGCATGCAGGGGC

CAGAGTTC TACAGTCCGACCGTCACT ATGCTGCATTCGTC TCTGGCCAGAAAGG

2C 19_ 125 1

TTCTGGAT GAAGG CATGAAGTAGTTA

CAGAGTTC TACAGTCCGACGCGGAAG ATGCTGCATTCGTC TCTGGCCGATAGCC

1A 1— 1384

TGTATCGGTGAGA AGGAAGAGAAAGA

CAGAGTTC TACAGTCCGACGTTTCAC ATGCTGCATTCGTC TCTGGCCCTCAGAG

1Α 1_3 '

TGTAACCT CCACC GCTGAGGTGGGAG

ALDH2— 145 CAGAGTTC TACAGTCCGACGTACGGG ATGCTGCATTCGTC TCTGGCCGCCCCCA 9 CTGCAGGCATACA GCAGGTCCCACAC (2) Preparation of tag library

The PCR product was mixed for each cell of origin and digested with Mmel (NEB) (target DNA). The above-mentioned DNA derived from K562 cells, T.T cells, SKBR-3 cells, Lu-65 cells, and 0111 cells are used as adapters having sample identification codes, such as adapter CAG, adapter GCA, and adapter GGG. Adapter ACG and adapter AGC were each ligated using T4 DNA ligase. The adapter CAG is obtained by annealing the oligonucleotide represented by SEQ ID NO: 1 in the sequence table and the oligonucleotide represented by SEQ ID NO: 2 in the sequence table, and the adapter GCA is represented by SEQ ID NO: 3 in the sequence table. An adapter GGG is obtained by annealing the oligonucleotide shown in SEQ ID NO: 4 and the oligonucleotide shown in SEQ ID NO: 4 in the Sequence Listing, and the oligonucleotide shown in SEQ ID NO: 5 in the Sequence Listing and SEQ ID NO: 6 in the Sequence Listing. An annealed oligonucleotide shown, adapter GAC is an annealed oligonucleotide shown by SEQ ID NO: 7 in the sequence list and an oligonucleotide shown by SEQ ID NO: 8 in the sequence list, and an adapter CCC Sequence listing The oligonucleotides represented by SEQ ID NO: 9 and the oligonucleotides represented by SEQ ID NO: 10 in the Sequence Listing are annealed. The oligonucleotides represented by SEQ ID NOs: 2, 4, 6, 8, and 10 are phosphorylated at the 5 'end.

[0084] Equal amounts of the DNA ligated to the adapter were mixed and treated at 95 ° C for 2 minutes to form a single strand, and then Dynabeads M-280 Streptavidin (Dinal Beads), which is magnetic beads to which streptavidin was bound. (Manufactured by K.K.) and the biotin-labeled DNA was bound to the magnetic beads. After thoroughly washing the unbound fraction, primer T shown in SEQ ID NO: 11 is added to the magnetic beads and annealed, and then, in the presence of dATP, dGTP, dCTP, and dTTP, a tarenow enzyme (manufactured by Takara Bio Inc.) ) To make the DNA double-stranded. The magnetic beads were washed with Sau3AI (Takara Bio), washed with BsmBI (NEB), and then inactivated with small intestinal alkaline phosphatase (CIAP, Takara Bay). DNA was recovered from the DNA and its 5'-phosphate group was removed, and the DNA was recovered.

[0085] A tag vector pLCV2 was constructed according to the method described in Non-Patent Document 4. After digesting pLCV2 with BamHI (manufactured by NEB) and Bpul20I (manufactured by Famentas), dephosphorylate with CIAP (manufactured by Takara Bio), and terminate the ends using DNA Blunting Kit (manufactured by Takara Bio). Smoothed. This pLCV2 was ligated to the DNA recovered from the above magnetic beads. Using this, E.coli TOP10 was transformed by electoporation. The number of colonies generated by inoculating a part of the transformant on an LB-chloramphene-coal plate was calculated independently, and another part was inoculated on six 50 ml LB medium containing chloramphene-coal. The plasmid DNA was purified from the culture using QIAGEN Plasmid Midi Kit (Qiagen). The number of independent clones per LB medium containing 50 ml of chloramphine-chol was approximately 160,000. Each culture power The obtained plasmid DNA was used as a tag library pool, and a tag library consisting of six pools was obtained.

[0086] (3) Preparation of microbeads

The tag library pool was subjected to PCR using a type I, FAM-labeled PCR-R primer (SEQ ID NO: 12) and a biotinylated PCR-F primer (SEQ ID NO: 13). The part containing the tag was amplified. Operations are performed for each pool from this PCR to the first sorting, and in this example, one pool is described. After digesting the PCR product with Pad (manufactured by NEB), T4 DNA polymerase (manufactured by Takara Bio Inc.) was allowed to act in the presence of dGTP to convert the tag portion to single-stranded.

The thus-prepared 50 IX g of the single-stranded tagged target DNA fragment and 1.67 × 10 ⁷ micro-beads to which the anti-tag prepared by the method described in Non-patent Document 4 were mixed were mixed at 100 / zl. The cells were hybridized in 500 mM NaCl, 10 mM sodium phosphate, 0.01% Tween20, and 3% dextran sulfate at 72 ° C. for 3 days. Microbeads were added to 50 mM Tris-HCl (pH 8), 50 mM NaCl, 3 mM MgCl, followed by lOmM Tris-HCl (p

2

After washing with H8), lmM EDTA and 0.01% Tween20, the microbeads with the highest 1% fluorescence intensity by FAM were sorted using a MoFlo cytometer (manufactured by Dako Cytometry) (first sorting). ).

[0087] T4 DNA ligase was allowed to act on the sorted microbeads to form a covalent bond between the target DNA fragment and the anti-tag, and then digested with BamHI. Furthermore, after T4 DNA polymerase was allowed to act on the microbeads in the presence of dGTP, the starting adapter was ligated using T4 DNA ligase. The starting adapter was obtained by annealing an oligonucleotide represented by SEQ ID NO: 14 in the sequence listing and an oligonucleotide represented by SEQ ID NO: 15 in the sequence listing. Microbeads with fluorescence by FAM were sorted using a MoFlo cytometer (second sorting).

(4) Determination of DNA base sequence on microbeads

The flow cell was filled with microbeads to which an initiation adapter was connected, and the sample identification code on the microbeads and the sequence around the SNP site were determined according to the MPSS method described in Non-patent Document 3. As a result, about 1 million sequences were obtained, including a sample identification code of 3 bases and a sequence around the SNP site of 9 bases.

These sequences were classified by sample identification code and SNP site. As a result, SNPs of each cell line could be typed.

Industrial applicability

[0089] The present invention provides a method for typing a mutation. Using the method of the present invention In addition, it is easy to perform mutation typing on a large number of samples, so that infrequent mutations can be found at low cost. As a result, effective and safe medical treatment using SNP and other polymorphism typing will be possible.

Sequence listing free text

SEQ ID NO: l; Oligonucleotide fine adapter CAG.

SEQ ID NO: 2; Oligonucleotide fine adapter CAG.

SEQ ID N〇: 3; Oligonucleotide mass adapter GCA.

SEQ ID NO: 4; Oligonucleotide fine adapter GCA.

SEQ ID NO: 5; Oligonucleotide fine adapter GGG.

SEQ ID NO: 6; Oligonucleotide fine adapter GGG.

SEQ ID NO: 7; Oligonucleotide fine adapter GAC.

SEQ ID N〇: 8; Oligonucleotide mass adapter GAC.

SEQ ID NO: 9; Oligonucleotide fine adapter CCC.

SEQ ID NO: 10; Oligonucleotide fine adapter CCC.

SEQ ID N〇: l l; Primer T to synthesize double-strand DNA.

SEQ ID NO: 12; PCR primer PCR-R to amplify a DNA fragment in tag library pool.SEQ ID N〇: 13; PCR primer PCR-F to amplify a DNA fragment in tag library pool.SEQ ID NO: 14; Oligonucleotide lower initiating adapter.

SEQ ID N〇: 15; Oligonucleotide mass initiating adapter.

Claims

Claims [1] A mutation typing method comprising the following steps:

(1) a step of preparing a target DNA containing a mutation site to be typed,

(2) adding a sample identification code to the target DNA,

[2] The method of typing a mutation according to claim 1, wherein the step of determining a nucleotide sequence comprises the following steps:

(c) a step of binding DNA containing the sample identification code and the mutation site to the microbeads

(d) if necessary, linking an initiation adapter to the end of the target DNA on the microbeads,

[3] Of the target DNA to which the sample identification code has been added, 2. The method for typing a mutation according to claim 1, comprising a step of polymerizing two or more of the included regions.