JP2000000095A - Protein p53 related to amyotrophic lateral sclerosis, its gene and utilization thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new protein p53 comprising protein p53 related to amyotrophic lateral sclerosis(ALS) represented by a specific amino acid sequence and enabling measurement and diagnosis of ALS by the antibody against the protein p53 prepared by using the protein. SOLUTION: This new protein p53 is related to amyotrophic lateral sclerosis represented by amino acid sequence of the formula and the use of the protein p53 enables preparation of an antibody against the protein p53 and measurement and diagnosis of amyotrophic lateral sclerosis is made possible by using the antibody. The protein p53 is obtained by separating erythrocyte from blood of familial ALS patient in which variation of SOD gene is recognized, adding distilled water to the collected erythrocyte to hemolyze the erythrocyte, passing the erythrocyte through an ion-exchanged column to remove hemoglobin, subjecting the treated erythrocyte to high-performance liquid chromatography, collecting a fraction which does not exist in healthy person, electrophoresing the fraction and separating a fraction having 53 kDA molecular weight.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a protein p53, a gene for the protein p53, and a protein p53 which are associated with amyotrophic lateral sclerosis.
53 and protein p5 using the antibody
3 relates to the measuring method.

[0002]

BACKGROUND OF THE INVENTION Amyotrophic lateral sclerosis (amytrop)
hic lateral sclerosis; ALS
Is a disease in which only motor neurons are impaired and voluntary motor skills are progressively impaired.
986) was first described as a single disease,
There is a name for Charcot disease. It is also called Lou Gehrig's disease because the famous baseball player Lou Gehrig got sick in the United States. Muscles of the whole body are affected as the disease progresses, and the disease is progressive and often ends in 3 to 4 years. The term “amytrophy” refers to the phenomenon in which the spinal cord anterior horn cells (lower motor neurons) that control skeletal muscle cause the muscle to atrophy (neurogenic muscle atrophy), and the skeletal muscle itself Does not include muscle atrophy caused by the disease (myogenic muscle atrophy). In addition, lateral sclerosis (lateral sclerosis)
Lateral cord of the spinal cord (pyramidal tract = nerve fiber of upper motor neuron)
Shows that the cells are degenerated and hardened due to the proliferation of glial cells. Thus, amyotrophic lateral sclerosis affects both lower and upper motor neurons, resulting in decreased muscle movement. In amyotrophic lateral sclerosis, only the motor nerves are affected purely, and other types of nerves, such as sensory and autonomic, are not affected.

[0003] Neurons refer to neurons containing the vesicles of neurons and their various processes. Motor neurons refer to spinal anterior horn cells, which are the mothers of peripheral nerves that control skeletal muscles, and furthermore, The motor neurons of the cerebral cortex (the nerve fibers pass through the pyramidal tract and in the spinal cord in the seminal medulla) that send stimulation to the spinal cord horn cells for voluntary movement. Motor system disorders consist of disorders of upper neurons (pyramidal tract) and disorders of lower neurons (motor peripheral nerves below spinal cord horn cells). Motor neuron disease (MND) is AL in a narrow sense
Synonymous with S, but in a broad sense, in addition to ALS, similar spinal and bulbar spinal muscular atrophy (Kendy-Alter-Sung Syndrome), mainly due to degeneration of motor neurons, Weldenich-Hoffman disease, Kugelberg Weh Lander's disease,
Use including chronic spinal muscular atrophy.

When the tissue of an ALS patient is examined pathologically, the anterior root derived from the anterior horn of the spinal cord shrinks and becomes thin due to degeneration of motor neurons. The lateral horn through which the nerve fibers pass, and the anterior horn where the cell bodies of the lower motor neurons are also atrophied.

Currently, familial amyotrophic lateral sclerosis (fam)
ilial ALS (referred to as fALS) is observed at a frequency of 5 to 10% of the entire ALS, but in some families, the causative gene is Cu / Zn superoxide dismutase (Cu / Zn superox).
ide dismutase (referred to as SOD1). Sporadic amyotrophic lateral sclerosis (SAL
A point mutation of this gene has been found in a part of S), and the possibility that SOD1 is involved in the cause of ALS is increasing. SOD1 is an enzyme that inactivates superoxide, a type of active enzyme that is produced in cells during the process of aerobic metabolism. It has been speculated that nerve cells may be denatured due to reduced activity of this enzyme. For this reason, antioxidants, administration of SOD-like substances, treatment by gene therapy and the like are expected in the future.

Although the cause of ALS other than fALS is completely unknown, the following hypotheses have been proposed so far. 1. Viral theory Since poliovirus causes only motor nerve damage like ALS, A
There is no hypothesis that LS may occur, but there is no support for it. 2. Addiction Theory If ALS is due to environmentally toxic substances, the incidence of ALS worldwide cannot be surprisingly constant, and this is unlikely. 3. Deficiency theory of neurotrophic factor Neurotrophic factor
Is a general term for biological materials necessary for survival of nerve cells. The theory that motor neurons are degenerated by a deficiency of some neurotrophic factors. 4. Autoimmunity Theory that there are autoantibodies that attack the motor nerves and cause degenerative necrosis. It has been suggested that some ALS patients have monoclonal gammopathy and that the results of animal experiments suggest that steroid therapy, immunotherapy, Globulin therapy does not stop ALS progression. 5. Glutamate excess theory A theory that abnormal action of excitatory amino acids, especially glutamate, results in degeneration of motor neurons. 6. Free radical theory As mentioned earlier, genetic mutations have been found in some cases of fALS. This SOD1 gene encodes a protein having a function of neutralizing a cell damaging substance called free radical. It is theorized that abnormalities in this gene cause motor nerve damage. However, this gene mutation was found in only about 20% of fALS,
LS as a whole is only about 1%.
It is likely that the etiology of LS is not directly related.

[0007] The diagnosis of ALS consists of three essential clinical requirements (1 to 3) and two excluded clinical requirements (4, 5) for excluding similar diseases. 1) The lower motor neuron can be confirmed clinically, electrophysiologically, and neuropathologically. 2) The above motor neuron symptom can be confirmed by clinical means. 3) To the same site or the other site of the clinical symptoms of 1) and 2). 4) The lower and upper motor neuron symptoms can be distinguished from ALS by characteristic electrophysiological findings. 5) The clinical symptoms and electrophysiological findings can be distinguished from ALS by neuroradiological findings. There is no definitive etiology for the pathogenesis of ALS, and the diagnosis is based on the patient's medical history and neurological examination. It has been desired to develop a new measurement method that assists the measurement.

[0008] The present invention has been made to solve such a problem, and an object of the present invention is to provide a novel ALS-related protein p53 and a gene thereof that can establish a novel method for diagnosing ALS. Another object of the present invention is to measure and diagnose protein p53 using an antibody against protein p53.

[0009]

Means for Solving the Problems and Effects of the Invention The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result,
Focusing on the function of OD1, from fractionating SOD1,
We succeeded in finding a new protein related to fALS.

A first aspect of the present invention is a protein p53 associated with amyotrophic lateral sclerosis represented by the amino acid sequence of SEQ ID NO: 1 in the sequence listing. This protein p53 is purified from erythrocytes of fALS patients. According to the protein p53 of the present invention, an antibody against the protein p53 can be prepared, and ALS can be measured and diagnosed using the antibody. In the amino acid sequence of SEQ ID NO: 1 in the sequence listing, even if one or several amino acids are deleted, substituted, inserted or added, as long as they are related to ALS in their properties, Considered to be substantially the same as protein p53.

The second aspect of the present invention is a gene for protein p53 which encodes the amino acid sequence of SEQ ID NO: 1 in the sequence listing.
18 sequences. According to this gene, the gene is transformed into a cell such as a bacterium having a very high growth potential, the gene is recombined to transform the trait, and the gene is grown and recovered while producing the protein p53 in the cell. , Protein p53 can be mass-produced.

The third aspect of the present invention is an antibody against the protein p53. This antibody can be obtained by immunizing an animal with the protein p53 itself or a carrier bound to a known carrier (for example, keyhole limpet hemocyanin (KLH) or bovine serum albumin (BSA)) as an immunogen and obtaining from the animal serum. Alternatively, it may be obtained from a hybridoma prepared and selected by a well-known cell fusion method.

A fourth aspect of the present invention is an immunoassay for protein p53 using the antibody. For example, by quantifying the protein p53 in a sample obtained from a patient's erythrocytes by the immunological assay of the present invention and comparing it with the quantified value of a healthy person, the diagnosis of ALS can be made accurately.
That is, an antibody against the protein p53 is useful as a diagnostic agent for ALS. Examples of the immunoassay include well-known immunoassays (ELISA, EIA), fluorescence immunoassay, radioimmunoassay (RIA), luminescence immunoassay, immunoturbidimetry, immunoassay, and the like. A measuring method can be used. For example, in an enzyme immunoassay, a fluorescence immunoassay, a radioimmunoassay, a luminescence immunoassay, and the like, measurement can be performed using a solid-phased antibody and a labeled antibody.In this case, at least one of the antibodies is used. An antibody that specifically reacts with the protein p53 of the present invention may be used. Specifically, the immobilized antibody is allowed to react with the protein p53 in the specimen, and then reacted with the labeled antibody, thereby forming a complex of the immobilized antibody-protein p53-labeled antibody. The protein p53 is quantified by measuring the amount of labeled antibody in the body. In addition, as the carrier of the immobilized antibody, polystyrene,
Polycarbonate, polyvinyltoluene, polypropylene, polyethylene, polyvinyl chloride, nylon, polymethacrylate, latex, gelatin, agarose, cellulose, glass, metal, ceramics, beads made of a material selected from magnetic materials, etc., microplate,
A test tube, a stick, a test piece, or the like can be used. Examples of the labeling substance of the labeled antibody include peroxidase, alkaline phosphatase, β-galactosidase, urease, catalase, glucose oxidase, lactate dehydrogenase or amylase in enzyme immunoassay, and fluorescein isothiocyanate and tetramethyl rhodamine in fluorescence immunoassay. Isothiocyanate, substituted rhodamine isothiocyanate, dichlorotriazine isothiocyanate and the like can be used, and in the case of radioimmunoassay, tritium, iodine 125 or iodine 131 can be used.

[0014]

Embodiments and Examples of the Invention About fALS-related protein p53 and its gene (1) Treatment of fALS patient's blood fALS patient (H46) showing mutation in SOD1 gene
Erythrocytes were separated from 10 ml of heparinized blood collected from R) by centrifugation. The same treatment was performed for healthy subjects. After removing the plasma, erythrocytes were washed by adding physiological saline, and centrifuged at 4,000 rpm at 4 ° C. for 10 minutes. After repeating this three times, 76 ml of distilled water obtained by distilling the collected erythrocytes twice is added to lyse the cells, and the erythrocytes are treated with acetic acid at pH 6.0.
Adjusted to zero. After centrifugation at 9,000 rpm at 4 ° C. for 20 minutes, the supernatant was washed with 30 ml of CM-52 previously equilibrated with 2.5 mM Tris acetate buffer (pH 6.0).
It was added to an ion exchange column (Whatman). Hemoglobin was adsorbed on a CM-52 ion exchange column at pH 6.0, and SOD1 eluted in the fractions passed through.

A portion (4 ml) was taken from each fraction, and the SOD activity and Cu ion concentration were measured. In addition,
The SOD activity was determined by the method of McCord et al. (J. Biol. Ch.
em. , 244, 6049-6055 (1969)). The Cu ion concentration was measured using an atomic absorption spectrophotometer (Hitachi Z-8000).

The fractions in which SOD activity is recognized are pooled,
It was applied to an 8 ml DE-52 ion exchange column (Whatman) equilibrated with the same buffer. After washing with 10 volumes of buffer, the bound protein was
M was eluted at 0.5 ml / min (1.8 ml / fraction) with a linear gradient of NaCl at pH 6.0. Each fraction was again measured for SOD activity, Cu and protein concentrations, and the pooled fractions were further analyzed by immunoprecipitation using anti-human SOD1 antibody and high performance liquid chromatography / electrospray mass spectrometry (HPLC / ESIMS).

The protein concentration was determined by the method of Bradford (Anal. Biochem. 7) using a Bio-Rad Protein Assay Kit (Bio-Rad).
2,248-254 (1976)). In addition, immunoprecipitation and HPLC / ESIMS analysis were performed by the method of Nakanishi et al. (Proceedings of the 4th edition).
5th American Society for
Mass Spectrometry Confere
sense on Mass Spectrometry
and Allied Topics. (1997))
Followed.

(2) Treatment of Purified Protein fALS patient (H46) having a mutation in the SOD1 gene
R) SOD from erythrocytes by column chromatography
In the process of purifying 1, Cu
Was eluted, and this fraction contained a protein (molecular weight 53 kDa and 21 kDa) not found in healthy subjects. This fraction was dissolved in SDS-PAGE sample buffer and electrophoresed. The protein was transferred to a nitrocellulose membrane by semi-dry blotting (Western blotting) as usual, and the protein was stained with Coomassie Brilliant Blue.

The target band (53 kDa) is applied about three times,
After washing with Milli-Q water, 500 ul of PVP buffer (0.5% polyvinylpyrrolidone-40, 100
mM acetic acid) and kept at 37 ° C. for 1 h. Mill
After washing the membrane 10 times with iQ water, 500 u
1 denaturing buffer (100 mM Tris-HCl pH
8.3, 6M guanidine hydrochloride). Furthermore, triethylamine 5ul, 0.2mg / ul DTT 5u
1 (prepared at the time of use) and purging with nitrogen gas to replace oxygen, followed by keeping the temperature at 37 ° C. 2h later 4-
5 ul of vinylpyridine was added, nitrogen gas purging was performed, and the temperature was further kept for 2 hours. Then 6% with 50% MeOH
Wash twice, and add lysyl reaction buffer (50 mM
(Tris-HCl, pH 9.0).

After adding 30 ul of lysyl reaction buffer to the membrane and immersing the membrane, 10% acetonitrile was finally added, and lysyl endopeptidase (Wako Pure Chemical Industries, Ltd.) was added at 1 pmol × (mo of the protein in the sample).
1)). Incubated overnight at 37 ° C. Lysyl endopeptidase is an enzyme that cleaves a protein at the C-terminal side of a lysine residue. The liquid was recovered after keeping the temperature for about 14 hours. The remaining membrane is 20
The solution was washed with% acetonitrile, and the washing solution was also collected.
The collected liquid was diluted with 1 mM HCl to a final concentration of 5% acetonitrile, and the pH was adjusted to about 3-4.

(3) Separation and Recovery by HPLC The sample degraded by the lysyl endopeptidase was separated by HPLC under the following conditions. That is, HPL
The C system is LC10Ai (Shimadzu) and the column is C
18φ4.6 × 150mm (YMC), buffer is A
Liquid: 0.1% trifluoroacetic acid aqueous solution, Liquid B: 0.0
9% acetonitrile trifluoroacetate solution, flow rate 1m
1 / min, gradient 5% B (0 min), 70
% B (40 min) and linear. Each peak was collected separately. The collected fractions are collected in a vacuum concentrator for 50 minutes.
After concentrating to about ul or less, it was stored at -20 ° C until it was applied to a protein sequencer.

(4) Amino acid sequencing and database search Amino acid sequencing was performed on each fraction previously stored at -20 ° C using ABI protein sequencer 490 (Perkin Elmer) according to the manufacturer's manual. Was. Table 1 shows the results.

[0023]

[Table 1]

The N-terminus of peak # 17, which is one of the obtained amino acid sequence information-KDELHHSGWNTCSSCFGDSTK-
A protein similar to the C-terminus is
A homology search was performed using a database using the ST program. The reason that lysine (K) was added to the N-terminus was that lysyl endopeptidase cleaving after lysine (K) was used to obtain each amino acid sequence in Table 1, so that the sequence was obtained before the obtained sequence. Is also considered to have lysine (K).

As a result of the homology search, human selenium-binding protein (hSBP) was found as a candidate. BLAST is a protein database (here, translations + PDB + Swisspro).
t + PIR), which is a basic local alignment search tool (Bas)
ic Local Alignment Search
Tool).

(5) Acquisition of p53 gene by PCR The hSBP gene information registered in the database (GeneBank, USA) is obtained, and the following four primers for PCR, namely SBP primer 1-F,
-B, 2-F and 2-B were designed.

One ul (1.5 × 10 8 pfu) of human spleen cDNA / λgt11 (Clontech) was combined with 20 pmol of SBP primer 1-F 5-atggctac
gaaatgtgggaattgtggaccc-3 and SBP primer 1-B
1. Using 5-tcaaatccagatgtcagagctacaatcgcc-3
Using 25 units of recombinant pfu DNA polymerase (Stratadine), 5% D
6 minutes in MSO at 94 ° C., then 50 seconds at 94 ° C .;
35 cycles of 1 minute at 0 ° C; 5 minutes at 72 ° C, then 72
Amplification was performed at 8 ° C. for 8 minutes. After electrophoresis, the PCR product was excised from the gel and purified using a gel extraction kit (Qiagen).

A 1/50 volume of the purified PCR product was further purified under the same conditions as described above using the SBP primer 2-F 5-AAggatccAAatggct containing the following BamHI and EcoRI cleavage sites.
acgaaatgtgggaattgtg-3 and SBP primer 2-B 5
-Amplified by GGgaattctcaaatccagatgtcagagctacaatc-3 (in the sequence, the portion between uppercase letters is the cleavage site of the newly inserted restriction enzyme). The obtained PCR product is purified by PCR Purification Kit (Qiagen)
After purification with BamHI and EcoRI at 37 ° C., 1
h. The purified PCR product was purified using the gel extraction kit, cloned into a GST fusion protein expression vector pGEX-5X-3 (Pharmacia), and transformed into Escherichia coli XL-1 blue.

The cloned SBP gene is pGEX
5 Sequencing primer 5-gggctggcaagccacgtt
tggtg-3 (Pharmacia) or pGEX3 sequencing primer 5-ccgggagctgcatgtgtcagagg-
DNA sequencing was performed on four samples using an ABI prism 377 DNA sequencer (Perkin Elmer) using 3 (Pharmacia) as a sequencing primer. As a result, the sequence of the three samples was the same (the nucleotide sequence of SEQ ID NO: 1 in the sequence listing), but the sequence of the remaining one sample was different. This was considered to be due to a point mutation generated in the process of PCR and the like, and the sequence of the above three samples was judged to be correct.

Furthermore, SBP234R primers 5-catcctgagtgatgcagctcgtccttc-3, SBP5 were selected from the p53 DNA sequence identified using the above primers.
47F primer 5-ggtgctgcaccgttgggctatgacttc-
3, SBP1069R primer 5-gctgcctccgaggaagagc
tgtcctg-3 was prepared, and DNA sequencing was performed on two of the three samples. The reason why the sequencing was performed twice as described above is one reason that there is a possibility that there is an error in one sequence, and therefore, it is performed to confirm the error. The number of bases that can be read in the sequence is 600 to 70
Since it is 0, if there are as many as 1600 bases as in the present protein, the middle part cannot be read even when read from both sides, so that the whole length is confirmed by sequencing using primers for a middle sequence. The finally obtained conclusion is shown in SEQ ID NO: 1 in the sequence listing and FIG. This nucleotide sequence is the gene for protein p53.

2. Antibodies to protein p53 and fAL
Measurement and diagnosis of S (1) Preparation of immunogen Based on the elucidated base sequence of p53, p53 was expressed as a GST (glutathione-S-transferase) fusion protein by genetic recombination. That is, the cDNA of p53, which was amplified by PCR and incorporated SBP primer 2-F and SBP primer 2-B, was treated with restriction enzymes BamHI and EcoRI, and a GST fusion protein expression vector pGEX-5X-3 (Pharmacia)
And transformed into Escherichia coli XL-1 blue (the genetic map of the vector pGEX-5X-3 incorporating the p53 cDNA is shown in FIG. 2).

After culturing the Escherichia coli in 1 L of LB medium supplemented with ampicillin at 37 ° C. until the absorbance at a wavelength of 600 nm becomes 0.6, IPTG having a final concentration of 0.3 mM was added, and further cultured at 25 ° C. for 16 hours. Centrifuge to collect the cells,
The cells were added to 100 ml of L buffer (50 mM Tris, p
H7.5 25% sucrose) and 5 ml of 1
0% Nonidet P-40 and 0.5 ml of 1M M
gCl ₂ was added and the cells were sonicated on ice to destroy the cells. After centrifugation at 10,000 rpm for 15 minutes to precipitate the cell membrane, about 110 ml of the supernatant was added to 14 ml of GSH.
(Reduced glutathione)-added to agarose column,
70 ml of WE buffer (20 mM Tris, pH7.
After washing with 5, ₂ mM MgCl ₂ , 1 mM DTT, 50 ml of G buffer (5 mM GSH, 50 mM
Tris, pH 9.6) to elute the GST-fused p53 protein.

(2) Immunization The above-prepared GST-fused p53 was suspended in Freund's complete adjuvant, and about 0.1 mg of a protein was immunized once on the back skin of a rabbit (Japanese white) once a week. After four weeks, immunization was performed every two weeks for two months, and blood was collected from the ear vein.

(3) Purification of antibody and confirmation of specificity The collected rabbit blood was subjected to serum separation by a conventional method,
Antibodies to GST were absorbed through an ST-coupled Sepharose column, and their specificity was confirmed by Western blotting. That is, it is purified on a 10% agarose gel.
53 protein, GST fusion p53 protein, GST protein,
After 5 ml each of Escherichia coli extract and Jurkat cell extract were added and electrophoresed, transferred to a membrane and reacted with rabbit antiserum (diluted 1: 500) and rabbit serum before immunization, and then reacted with peroxidase-labeled anti-rabbit IgG. Let
A band was confirmed by performing a substrate reaction. The results are as shown in FIG. 3, where the purified p53 was located at a molecular weight of 53 kDa, and the GST-fused p53 and the E. coli extract had a molecular weight of about 80 kDa.
One band was observed at position a, and GST protein, Jur
No band was observed in the kat cell extract. Also, no band was observed when preimmune serum was used.

(4) Construction of ELISA System The detection of p53 in the specimen was examined using the antiserum obtained above. Serum was subjected to 33% ammonium sulfate salting out twice, followed by DE
An IgG fraction was obtained using AE cellulose, and a part of the fraction was used as a peroxidase-labeled antibody by the maleimide method (Ultrasensitive enzyme immunoassay by Eiji Ishikawa (Academic Society Press Center)). As the solid phase, 100 ml of a PBS solution (5 mg / ml) of anti-p53 antibody was added to each well of a 96-well microplate (Maxi Soap manufactured by Nunc), sensitized at 4 ° C. for 18 hours, washed with PBS, and blocked. Solution (5% bovine serum, 5% sucrose, 0.1% NaN3, 0.05
% Tween 20) and blocking was performed at room temperature for 2 hours. Using purified protein p53 as standard
Make a dilution series with PBS, add 100 ml each and add
After reacting at 5 ° C. for 1 hour, the plate was washed three times with PBS, and 100 ml of a peroxidase-labeled antibody was added.
For 1 hour. After washing again with PBS, tetramethylbenzidine in a hydrogen peroxide solution was used as a substrate for 100 minutes.
and add 1.5N phosphoric acid 1 while monitoring the degree of color development.
The reaction was stopped by adding 00 ml, and the absorbance at a wavelength of 450 nm was measured. FIG. 4 shows the results.

Next, erythrocytes obtained from ALS patients and healthy subjects were lysed, diluted 51-fold with PBS to prepare a sample, and 100 ml of the sample was allowed to react as in the case of the standard sample. The concentration of protein p53 was determined. As shown in Table 2, the concentration of protein p53 was significantly higher in ALS patients than in healthy subjects.

[0037]

[Table 2]

[0038]

[Sequence List] SEQ ID NO: 1 Sequence length: 1627 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA sequence ATCCAGCAAG TATATAGCAT GGCCTTTGCA GGGCTGGCAA GCCACGTTTG GTGGTGGCGA 60 CCATCCTCCA AAATCGGATC TGATCGAAGG TCTC 102 ATG GCT ACG AAA TGT GGG AAT TGT GGA CCC GGC TAC TCC ACC CCT CTG 150 Met Ala Thr Lys Cys Gly Asn Cys Gly Pro Gly Tyr Ser Thr Pro Leu 1 5 10 15 GAG GCC ATG AAA GGA CCC AGG GAA GAG ATC GTC TAC CTG CCC TGC ATT 198 Glu Ala Met Lys Gly Pro Arg Glu Glu Ile Val Tyr Leu Pro Cys Ile 20 25 30 TAC CGA AAC ACA GGC ACT GAG GCC CCA GAT TAT CTG GCC ACT GTG GAT 246 Tyr Arg Asn Thr Gly Thr Glu Ala Pro Asp Tyr Leu Ala Thr Val Asp 35 40 45 GTT GAC CCC AAG TCT CCC CAG TAT TGC CAG GTC ATC CAC CGG CTG CCC 294 Val Asp Pro Lys Ser Pro Gln Tyr Cys Gln Val Ile His Arg Leu Pro 50 55 60 ATG CCC AAC CTG AAG GAC GAG CTG CAT CAC TCA GGA TGG AAC ACC TGC 342 Met Pro Asn Leu Lys Asp Glu Leu His His Ser Gly Trp Asn Thr Cys 65 70 75 80 AGC AGC TGC TTC GGT GAT AGC ACC AAG TCG CGC ACC AAG CTG GTG CTG 390 Ser Ser Cys Phe Gly Asp Ser Thr Lys Ser Arg Thr Lys Leu Val Leu 85 90 95 CCC AGT CTC ATC TCC TCT CGC ATC TAT GTG GTG GAC GTG GGC TCT GAG 438 Pro Ser Leu Ile Ser Ser Arg Ile Tyr Val Val Asp Val Gly Ser Glu 100 105 110 CCC CGG GCC CCA AAG CTG CAC AAG GTC ATT GAG CCC AAG GAC ATC CAT 486 Pro Arg Ala Pro Lys Leu His Lys Val Ile Glu Pro Lys Asp Ile His 115 120 125 GCC AAG TGC GAA CTG GCC TTT CTC CAC ACC AGC CAC TGC CTG GCC AGC 534 Ala Lys Cys Glu Leu Ala Phe Leu His Thr Ser His Cys Leu Ala Ser 130 135 140 GGG GAA GTG ATG ATC AGC TCC CTG GGA GAC GTC AAG GGC AAT GGC AAA 582 Gly Glu Val Met Ile Ser Ser Leu Gly Asp Val Lys Gly Asn Gly Lys 145 150 155 160 GGG GGT TTT GTG CTG CTG GAT GGG GAG ACG TTC GAG GTG AAG GGG ACA 630 Gly Gly Phe Val Leu Leu Asp Gly Glu Thr Phe Glu Val Lys Gly Thr 165 170 175 TGG GAG AGA CCT GGG GGT GCT GCA CCG TTG GGC TAT GAC TTC TGG TAC 678 Trp Glu Arg Pro Gly Gly Ala Ala Pro Leu Gl y Tyr Asp Phe Trp Tyr 180 185 190 CAG CCT CGA CAC AAT GTC ATG ATC AGC ACT GAG TGG GCA GCT CCC AAT 726 Gln Pro Arg His Asn Val Met Ile Ser Thr Glu Trp Ala Ala Pro Asn 195 200 205 GTC TTA CGA GAT GGC TTC AAC CCC GCT GAT GTG GAG GCT GGA CTG TAC 774 Val Leu Arg Asp Gly Phe Asn Pro Ala Asp Val Glu Ala Gly Leu Tyr 210 215 220 GGG AGC CAC TTA TAT GTA TGG GAC TGG CAG CGC CAT GAG ATT GTG CAG 822 Gly Ser His Leu Tyr Val Trp Asp Trp Gln Arg His Glu Ile Val Gln 225 230 235 240 ACC CTG TCT CTA AAA GAT GGG CTT ATT CCC TTG GAG ATC CGC TTC CTG 870 Thr Leu Ser Leu Lys Asp Gly Leu Ile Pro Leu Glu Ile Arg Phe Leu 245 250 255 CAC AAC CCA GAC GCT GCC CAA GGC TTT GTG GGC TGC GCA CTC AGC TCC 918 His Asn Pro Asp Ala Ala Gln Gly Phe Val Gly Cys Ala Leu Ser Ser 260 265 270 ACC ACC ATC CAG CGC TTC TAC AAG AAC GAG GGA GGT ACA TGG TCA GTG GAG 966 Thr Ile Gln Arg Phe Tyr Lys Asn Glu Gly Gly Thr Trp Ser Val Glu 275 280 285 AAG GTG ATC CAG GTG CCC CCC AAG AAA GTG AAG GGC TGG CTG CTG CCC 1014 Lys Val Ile Gln Val Pro Pro L ys Lys Val Lys Gly Trp Leu Leu Pro 290 295 300 GAA ATG CCA GGC CTG ATC ACC GAC ATC CTG CTC TCC CTG GAC GAC CGC 1062 Glu Met Pro Gly Leu Ile Thr Asp Ile Leu Leu Ser Leu Asp Asp Arg 305 310 315 320 TTC CTC TAC TTC AGC AAC TGG CTG CAT GGG GAC CTG AGG CAG TAT GAC 1110 Phe Leu Tyr Phe Ser Asn Trp Leu His Gly Asp Leu Arg Gln Tyr Asp 325 330 335 ATC TCT GAC CCA CAG AGA CCC CGC CTC ACA GGA CAG CTC TTC CTC GGA 1158 Ile Ser Asp Pro Gln Arg Pro Arg Leu Thr Gly Gln Leu Phe Leu Gly 340 345 350 GGC AGC ATT GTT AAG GGA GGC CCT GTG CAA GTG CTG GAG GAC GAG GAA 1206 Gly Ser Ile Val Lys Gly Gly Pro Val Gln Val Leu Glu Asp Glu Glu 355 360 365 CTA AAG TCC CAG CCA GAG CCC CTA GTG GTC AAG GGA AAA CGG GTG GCT 1254 Leu Lys Ser Gln Pro Glu Pro Leu Val Val Lys Gly Lys Arg Val Ala 370 375 380 380 GGA GGC CCT CAG ATG ATC CAG CTC AGC CTG GAT GGG AAG CGC CTC TAC 1302 Gly Gly Pro Gln Met Ile Gln Leu Ser Leu Asp Gly Lys Arg Leu Tyr 385 390 395 400 ATC ACC ACG TCG CTG TAC AGT GCC TGG GAC AAG CAG TTT TAC CCT GAT 1350 Ile Th r Thr Ser Leu Tyr Ser Ala Trp Asp Lys Gln Phe Tyr Pro Asp 405 410 415 CTC ATC AGG GAA GGC TCT GTG ATG CTG CAG GTT GAT GTA GAC ACA GTA 1398 Leu Ile Arg Glu Gly Ser Val Met Leu Gln Val Asp Val Asp Thr Val 420 425 430 AAA GGA GGG CTG AAG TTG AAC CCC AAC TTC CTG GTG GAC TTC GGG AAG 1446 Lys Gly Gly Leu Lys Leu Asn Pro Asn Phe Leu Val Asp Phe Gly Lys 435 440 445 445 GAG CCC CTT GGC CCA GCC CTT GCC CAT GAG CTC CGC TAC CCT GGG GGC 1494 Glu Pro Leu Gly Pro Ala Leu Ala His Glu Leu Arg Tyr Pro Gly Gly 450 455 460 GAT TGT AGC TCT GAC ATC TGG ATT TGA GAA 1524 Asp Cys Ser Ser Asp Ile Trp Ile 465 470 TTCCCGGCTCCGCGCGCGCGCGCG GACTGACTGA CGATCTGCCT CGCGCGTTTC 1584 GGTGATGACG GTGAAAACCT CTGACACATG CAGCTCCCGG AGA 1627

[Brief description of the drawings]

FIG. 1 is an explanatory diagram showing DNA sequencing of a gene for protein p53.

FIG. 2 is a genetic map of a vector pGEX-5X-3 into which cDNA of a protein p53 has been incorporated.

FIG. 3 is an explanatory diagram showing a result of Western blotting.

FIG. 4 is a graph of a standard curve showing the relationship between the concentration of protein p53 and absorbance.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/53 G01N 33/53 D // (C12P 21/02 C12R 1:19) (72) Inventor Noguchi Jun 1063-103 Ohara, Terasawaoka, Ina-shi, Nagano Prefecture Inside the Medical Biology Research Institute (72) Inventor Masao Shibata 1063-103, Ohara, Terasawaoka, Ina-shi, Nagano Pref. (Reference) 4B024 AA01 AA11 BA43 CA04 DA06 EA04 GA11 HA15 HA17 4B064 AG01 AG27 CA02 CA19 CC24 DA01 DA13 4B065 AA26X AA90X AA94Y AB01 AC14 BA02 CA24 CA25 CA44 CA46 4H045 AA10 AA11 BA10 CA42 DA75 DA86 EA50 FA

Claims (5)

[Claims] 1. A protein p53 associated with amyotrophic lateral sclerosis represented by the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 2. A protein p53 gene encoding the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 3. A gene for a protein p53 comprising the sequence of base numbers 103 to 1518 in the base sequence of SEQ ID NO: 1 in the sequence listing. 4. An antibody against the protein p53 according to claim 1. 5. A protein p5 using the antibody according to claim 4.
3. Immunoassay.