ITTO960578A1 - RECOMBINANT MYXOMATOUS VIRUS, ITS USE FOR THE PRODUCTION OF A VACCINE AND RELATED VACCINE. - Google Patents

Description

DESCRIPTION of the industrial invention entitled:

"Recombinant myxomatous virus, its use for the production of a vaccine and relative vaccine"

The present invention relates to an attenuated living recombinant myxomatous virus, its use for the production of a vaccine, as well as such a vaccine.

The present invention relates in particular to a recombinant myxomatous / viral haemorrhagic disease of rabbits which can be used to simultaneously vaccinate leporidae against these two diseases.

The myxomatous virus, being a leporipoxvirus, has characteristics that are common to all hypoxvirides. Indeed, poxvirides are part of a family of doubly stranded DNA viruses that reproduce in the cytoplasm of host eukaryotic cells. The central part of the myxomatous virus genome includes genes required for viral transcription, replication, and maturation.

At the ends of this genome there are non-essential genes for the viral cycle, coding for proteins that determine in particular the virulence of the virus.

In known form, myxomatosis always represents one of the major viral pathologies of leporidae, in particular of the wild rabbit, of the farmed rabbit, the hare being, in turn, receptive to the virus, but not very sensitive.

After infection and 3 to 5 days of incubation of the disease, the appearance of pseudotumoral skin lesions (myxomas), a strong inflammation of the eyelids or blepharitis, and a purulent effusion (conjunctivitis and rhinitis) are observed in particular, leading in some days to the death of the leporid.

Sanitary prophylaxis of myxomatosis is very difficult to apply due to its epidemiological characteristics (transmission essentially through vector anthropods, mainly fleas and mosquitoes). Only a generalized medical prophylaxis allows to limit its progression and the mortality of rabbits.

But, this is all the more complicated to apply as current farming practices (production under hangar ...) do not favor this sanitary prophylaxis.

The numerous researches carried out in the field for years have made it possible to develop more or less effective vaccination techniques against this disease.

Thus, in France, a vaccination technique was developed based on the first vaccination of a leporipoxvirus similar to the myxomatous virus, the Shope fibroma virus, and, for booster injections, a strain of myxomatous virus attenuated by passages in series on cell culture, in particular the SG33 strain.

Although the SG33 virus proves to be a very stable virus, it has been found that this is not very usable in young animals and in high-risk farms due to a residual immunodepressive power.

However, myxomatosis is not the only pathology affecting leporidia. In fact, these are also particularly sensitive to other pathogens, not only of viral origin, but also of bacterial or parasitic origin.

Thus, non-limiting examples can be cited: viral haemorrhagic disease of rabbits or RVHD (for Rabbit Virai Haemorrhagic Disease), EBHS (for European Brown Hare Syndrome), diseases due to rotaviruses, tularemia due to Francisella tularensis, coccidiosis, enteritis due to E. coli or Clostridies, Tyzzer's disease due to "Bacillus piliformis", encephalitozoonosis, pasteurellosis, Staphylococcus.

In order to fight against the different agents responsible for these pathologies, various researches have been conducted, but these have only reached very poor results or are difficult to apply from an industrial point of view.

As a non-limiting example, we can recall those conducted on the viral haemorrhagic disease of rabbits or RVHD, which is also one of the major viral diseases of leporidae.

The RVHD virus is mainly transported through food and / or drink.

In the acute form, rabbit death occurs 48 to 72 hours after infection.

After autopsy, numerous internal haemorrhages are noted as well as significant lesions of the animal's liver, trachea and lungs.

Currently, anti-RVHD medical prophylaxis is based on the use of a vaccine added to inactivated virus previously extracted from the livers of inoculated animals. It is easy to understand that this technique has a major drawback. In fact, this procedure, based on an extraction of viruses from inoculated animal livers, is complex. However, it is one of the few known so far as RHDV (Rabbit Haemorrhagic Disease Virus) remains impossible to grow on cell systems.

In summary, current prophylaxis against myxoraatosis and other pathologies of leporidae have the following problems and drawbacks:

they are sometimes difficult to apply because they are based on "heavy" techniques;

- they are not always effective and sometimes have undesirable side effects;

they do not allow to fight simultaneously against different diseases;

they are only very difficult to apply on an industrial scale.

In order to remedy the technical problems and drawbacks of the prior art, the inventors of the present invention have set themselves as their objective the development of a recombinant myxomatous virus and a vaccine based on such a recombinant virus which allows to vaccinate effectively and simultaneously leporidia against myxomatosis and another pathology, which is easy to apply while being very specific.

To do this, the inventors of the present invention had the idea of altering the non-essential genes present on the genome of the myxomatous virus, which are in particular the TK gene coding for thymidine kinase and the M11L and MGF genes involved in the pathogenic power of aim of obtaining new deleted and attenuated recombinant viruses that can be used for the realization of an anti-myxomatosis vaccine and expressing foreign antigens as well.

Such recombinations between the genome of a myxomatous virus and one or more genes coding for antigens present on different pathogens allow a vaccination of leporids not only against myxomatosis, but also against the target disease (s).

The present invention therefore proposes to solve the drawbacks and to fill the gaps of the prior art thanks to an attenuated living recombinant myxomatous virus, comprising at least one nucleotide sequence coding for, and expressing, an antigenic polypeptide below. .the control of a promoter inserted in one of the genes not essential for the replication of said virus, for example a virulence gene.

Advantageously, the said nucleotide sequence codes for a viral, bacterial or parasitic immunogen of leporids.

Preferably, the said nucleotide sequence codes for an antigenic protein, and in particular for the capsid, membrane or envelope of a pathogen selected from the group formed by: the RVHD virus, the EBHS virus, the rotaviruses, the protozoan responsible for the encephalitozoonosis, the enterobacteria in particular E. Coli and the clostridias, "Bacillus piliformis", the cocciài, the Pasteurella, Francisella tularensis, the staphylococci.

Advantageously, the myxomatous virus is generated by a leporipoxvirus strain chosen from the group formed by the strains: SG 33, LEON 162, HONGROIS, FINISTERE, R 801, TOULOUSE 1, LAUSANNE.

These different strains have made the subject of a deposit at the National Collection of Cultures of Microorganisms (C.N.C.M.) and have been marked as follows:

SG 33 CNCM n. 1-1594

LEON 162 CNCM n. 1-1595

HONGROIS (HG) CNCM n. 1-1593

FINISTERE (F9) CNCM n. 1-1596

R 801 CNCM n. 1-1598

TOULOUSE 1 (Tl): CNCM n. 1-1592

LAUSANNE (Laus): CNCM n. 1-1597

It should be noted that the 801 strain is a respiratory type strain that is, it induces a respiratory pathology in the rabbit but without myxomas, and that the TOULOUSE 1 and LAUSAN-NE strains are classical virulent strains but which can be attenuated by deletion.

These different strains have the usual properties and characteristics regarding their cultivation.

Preferably the said nucleotide sequence and the said promoter are inserted in the M11L-MGF or TK genes of the said myxomatous virus.

The present invention also relates to the use of a live attenuated recombinant virus as described above for the manufacture of a vaccine capable of effectively vaccinating leporidae simultaneously against myxomatosis and another pathology.

Advantageously, the vaccine according to the invention comprises as a vector the attenuated living recombinant myxomatous virus as described above.

Advantageously, the said vaccine comprises an effective vaccine dose of recombined myxomatous virus.

According to a preferential embodiment, the invention relates to a recombinant vaccine which allows to simultaneously vaccinate leporidae against myxomatosis and viral haemorrhagic disease of rabbits (RVHD), characterized in that it comprises as a vector the attenuated living myxomatous virus comprising a sequence nucleotide encoding, and expressing, an antigenic polypeptide of the rabbit viral haemorrhagic disease virus, under the control of a promoter.

Preferably, the said nucleotide sequence codes for and expresses the capsid protein VP60 or VP60 + VP12 of said virus of the viral haemorrhagic disease of rabbits.

Advantageously, the said promoter of the said nucleotide sequence and the early / late vaccine promoter P7.5.

Advantageously, the effective amount of recombinant virus per vaccine dose is between 102 and 109 pfu equivalents ("plaque forming units" in English), and for the intradermal route, preferably between 10 and 10 pfu equivalents. .

Advantageously, the vaccine is formulated for parenteral, preferably intradermal, or oral administration. In the case of viral haemorrhagic disease of rabbits (RVHD), the inventors created a recombinant myxomatosis-RHDV virus starting from one and the same attenuated living virus generated by the SG33 strain, in which an RHDV capsid gene coding for the VF60 protein.

Another recombinant virus has also been realized with total deletion of the Mll-L and MGF sequences, elimination of the LacZ operator gene and introduction of a polystop downstream of the VTP60 sequence.

These myxomatosis-RHDV recombinants allow a double anti-myxomatosis and anti-RVHD (Rabbit Virai Haemorrhagic Oisease) vaccination, thus solving the problem (s) posed by these two pathogens in rabbit breeding.

Other features and advantages of the invention will appear in the following description of the non-limiting experimental procedure followed, which illustrates an embodiment of the invention, i.e. the realization of a myxomatosis-RHDV recombinant virus, with reference to the figures including:

- figure 1 represents diagrams illustrating the construction of the pSM1 and pSM2 plasmids starting from the plasmid pSC11- (VP60 + VP12) and genes M11L-MGF and TK of the virus of the SG33 strain;

figure 2A represents a southern blot after migration to PFGE and hybridization by means of a total probe SG33;

figure 2B represents a southern blot after migration to PFGE and hybridization by means of a VP60 probe; Figures 3A and 3B show the electrophoresis gels obtained after immunoprecipitation of the SG33, RecIA122 and RecB2111 viruses;

figure 4 represents the titration curves of anti VP60 antibodies (ie anti RVHD) obtained by ELISA test after vaccination of rabbits with the Ree A and Ree B viruses;

- figure 5 represents the titration curves of antimixomatous antibodies obtained by ELISA test after vaccination of rabbits with the SG33, Ree A and Ree B viruses;

figure 6 represents the titration curves of anti-myxomatosis antibodies obtained by seroneutralization after vaccination of rabbits with the virus SG33, Ree A and Ree B;

Figure 7 is a graph representing the kinetics of anti-myxomatous and anti-RHDV antibodies and the response to a virulent test by the TI strain of the myxomatosis virus after vaccination of rabbits orally with the recombinant Ree B; Figures 8A and 8B are graphs representing the kinetics of anti-myxomatous and anti-RHDV antibodies and the response to a virulent test by RHDV after oral vaccination of rabbits, with the recombinants Ree A and Ree B and the strain SG33; figure 9 schematises the construction of the plasmid used in the preparation of the recombinant "26b" and open phases of reading the reason of UT Pasa / VP60 / M9-L, in the 6 possible schemes;

figure 9a) represents the physical and gene map of the Mll-L / MGF region of SG 33;

figure 9b) represents the physical and gene map of the Xhol Noti fragment of pAT VP60;

figure 9c) represents the cartography of the AUG codons (i) and of the stop codons (|);

Figure 10 schematises the recombination event obtained in the construction of the recombinant myxomatosis / VP60 "26b".

First, myxomatous virus SG33 (vaccine strain) is cultured on RK13 cells at 37 ° C in the presence of OptiMEM medium at 2% SVF (Fetal Calf Serum).

The viral genome includes the M11L and MGF genes which are located at its left end. These two genes are placed in tandem, the 3 'part of M11L overlapping the 5' part of MGF (two reading schemes).

A 1063 bp sequence comprising the two reading patterns plus the promoter zones was amplified by the Polymerase Chain Reaction (PCR) reaction.

The primers used are the following:

GTAGGATCCGTAACAAGTGTAAATATA (SEQ ID 1)

CCCGGGATGTTTTCGCGATGTGA (SEQ ID 2)

The amplification was carried out in the presence of a unit of Taq polymerase on a Perkin-Elmer device using the following program over 30 cycles:

50QC for 1 minute, 72 ° C for 1 minute and 95 ° C for 1 minute.

The product obtained was then visualized on 0.7% agarose gel after staining with BET.

We also proceed to an amplification of the TK gene of the SG33 virus under the same conditions, thanks to the following primers (sequence of the LAUSANNE strain):

GGTTTGGATAAGGAAGTTACG (SEQ ID 3)

GAGGTCGCTGTCGGAGACG (SEQ ID 4)

The 700 bp product obtained includes the open reading scheme plus the regulatory sequences.

The obtained amplicons were cloned into the PGEMT plasmid (Promega). The M11L-MGF sequence was then sub-cloned in pSK + (Stratagene), at the Apal and Spel sites.

Moreover, the VP60 gene, with its promoter sequences, followed by the VP12 sequence in 3 'was cloned in the form of cDNA in pSK +. VP60 protein is the only capsid protein of RHDV.

After digestion with Sacl and Smal then cleaning by means of the Klenow fragment of DNA then I, a fragment of 2.2 kb comprising the ORF of VP60 and VP12 is cloned in the Smal site of the PSC11 plasmid which gives the plasmid pSC11-VP60 + VP12.

The plasmid pSCll-VP60 + VP12 is digested by Noti in 3 'and undergoes partial digestion by PstI in 5', thus releasing a 5.6 kb fragment (fragment A) comprising the Bgal gene, under; the control of the promoter of late P11K vaccine and the VP60 + VP12 genes downstream of the P7.5 early / late vaccine promoter.

This group is sub-cloned in pSK + at the Known and PstI sites (pSKH— A) -After PCR amplification of the TK and M11L-MGF genes of the SG33 strain, the obtained amplicons were cloned in pGEMT, then sub-cloned in the pSK + plasmid for M11L-MGF.

The pGEMT-TK plasmid was digested by EcoRV and, after digestion by Noti and Kpnl, the h fragment is integrated into pGEMT-TK in the EcoRV site which gives the pSM2 plasmid whose good orientation (the VP60 gene towards the 3 end 'of TK) is verified by PCR and restriction profile.

As for pSK + (MHL-MGF), digestions by Hind i and BsaBI allowed to eliminate the ORFs of the M11L and MGF genes of 356 bp and insert a smaller fragment of 5.3 kb (fragment B ) generated by the digestion of pSK + (A) by HindlII and which does not include the sequence VP12, which thus gives pSM1.

Good orientation (VP60 towards the 3 'end of MGF) is verified by PCR and restriction profile.

For each plasmid, the correct orientation is that in which the direction of transcription of the VP60 gene corresponds to that of the TK gene or the M11L-MGF genes. This is verified by PCR restriction and amplification profile using an external primer on the TK or M11L-MGF sequences and an internal primer on the Bgal sequence or the VP60 sequence.

The recombinant viruses were constructed following a modified procedure of the standard method for the preparation of poxvirus mutants.

24-hour, 90% confluence RK13 cells were infected with 0.03 to 0.04 pfu / cell of SG33 virus.

After 2 hours at 37 ° C, the viral inoculum is removed and the cells washed twice with OptiMEMSS (without serum). The spiked 3ml transfection mix of OptiMEMSS is then added to the cells. This transfection mix comprises 10 μg of pSM1 or pSM2, preliminarily mixed in 20 minutes to 40 μg of lipofectamine.

The mixture is left at 37 ° C for 5.30 hours, then completed with 3 ml of OptiMEM at 4% fetal calf serum (SVF), and put back in the oven (37 °). After 48 hours, the recombination products undergo three freeze-thaw cycles and 20 seconds of sonication (maximum power, Branson sonicator B15) then lay on 24-hour RK13 cells in OptiMEM 2% SVF.

48 hours later, the liquid medium is replaced with a gelose medium (M.E.M.E. 2 X, 1% LM (Low Melting) agarose and 2.5% SVF) which, after 48 hours, is covered with an agarose overlay that allows the detection of recombinant viruses (M.E.M.E. 2 X, LM 1%, RN (Neutral Red) 1% and Xgal 330 pg / ml). Each blue zone that signals the presence of the recombinant virus is removed and diluted in DMEM at 2.5% SVF in order to be redistributed, after freezing-thawing and sonication, on RK13 cells. After 5 rounds of purification under 1% LM agarose, the recombinant viruses are amplified on RK13 cells.

The genomic structure of the recombinant viruses was confirmed by PCR reaction (data not exposed), then analyzed by Southern Blot. The recombinant Myx virus. (Δ MI1L-MGF) (VP60) is called RecB2111 (Ree B) and the recombinant virus Myx. [TK- (VP60 + VP12)] is called RecIA122 (Ree A).

As described later, the recombinant viruses RecIA122 and RecB2111 were obtained by a classical method in which the selection of mutant viruses is carried out thanks to the blue color generated by the degradation of Xgal by means of the Bgalactosidase.

The foyers de lyse produced by RecIA122 (Ree A) and the SG33 virus are of equivalent size and appearance. On the other hand, for RecB2111 (Ree B), the foyers are smaller, without affecting viral production.

First verified by PCR (data not provided), candidate viruses are analyzed by southern-blot after migration using the pulsed field electrophoresis (PFGE) technique.

Thus, a restriction polymorphism can be observed between the recombinant viruses and SG33.

The steps of the electrophoretic analysis are set out below.

The 0.75% agarose grafts containing the cytoplasmic extract of the equivalent of 10 ^ RK13 cells infected with a recombinant virus or SG33 virus are preincubated in 1 X digestion buffer for 15 minutes at 4 ° C. Then, 80 U of restriction enzyme (HindII or PstI) are added and the assembly is incubated for 12 hours at 37 ° C.

The grafts thus prepared are deposited on an 11% agarose gel where they undergo an electrophoretic migration in pulsed fields (alternation 1.5 s) in a 0.5 X TBE buffer, at 275 V for 7 hours. The obtained profiles are visualized after staining with BET.

To complete the analysis of the genomic structure, the Southern-Blot technique is used. 1 electrophoresis gel in previous pulsating fields was transferred to nylon membranes. An 830 bp DNA fragment corresponding to the internal Clal-Clal sites of the VP60 gene, and of the total DNA of the SG33 virus, were labeled with digoxigenin by "Random-Priming". After hybridization overnight with one or the other of the two probes, the detection occurs by means of a chemiluminescent reaction following the degradation of a substrate by means of alkaline phosphatase coupled to an anti-digoxigenin antibody.

In BET staining, and after hybridization with a total SG33 probe, clear differences appear between the digestion profiles of the recombinant virus and those of the SG33 virus. These restriction profiles are represented on figure 2.

Starting from the restriction profiles by HindlII and PstI of the myxoraatosus virus of the Lausanne strain, the DNA fragments comprising the genes TK and M11L-MGF were identified.

It should be noted that the 5.6 kb fragment (fragment A) adds 2 HindlII and PstI sites to those already existing on the SG33 genome.

This is also illustrated by Figure 2 where:

Track 1: SG33 virus DNA digested by PstI

Track 2: RecIAl22 virus DNA digested by PstI

Track 3 · RecB2111 virus DNA digested by PstI

Track 4: RecB2111 virus DNA digested by HindlII. Track 5: RecIA122 virus DNA digested by HindlII. Track 6: SG33 virus DNA digested by HindlII.

In fact, on figure 2, we see disappear, on the profiles, a band of about 32 kb for the RecIA122 virus, profit of two of 25 kb and about 7 kb (figure 2A, tracks 5 and 6), and a band of 60 kb a profit of one of about 30 kb (lanes 1 and 2).

Similarly, the 5.3 kb fragment adds, in turn, two PstI sites and a HindlII site, causing the disappearance of a 23 kb band (figure 2A, track 3) on the one hand and on the other hand the 'appearance of two bands of 13 kb and 8 kb (figure 2A, track 4) approximately on the profiles obtained with the RecB2111 viruses.

On the other hand, hybridization with an internal probe (Cìal-Clal) VP60, of 830 bp confirms the presence of only one graft on the myxomatous genome for each recombinant virus, as can be seen in figure 2B where:

Track 1: RecIA122 virus DNA digested by PstI

Track 2: RecB2111 virus DNA digested by PstI

Track 3: RecB2111 virus DNA digested by HindlII. Track 4: RecIA122 virus DNA digested by HindlII.

VP60 expression in cell culture was verified by immunoprecipitation and immunofluorescence.

24-hour RK13 cells, confluent infected with 30 pfu / cell of recombinant virus, both RecB2111 and RecIA122, are labeled with 35s methionine (100µl / ml) for 5 hours and 30 minutes.

At the end of this labeling, the cells are collected, dissolved and the cytosols are precipitated in the presence of protein A sepharose, both with an anti myxomatosis and RVHD immune serum, and with an anti RVHD polyclonal antibody, and with 2 monoclonal antibodies anti VP60, 61A47 and 4E3.

The proteins thus marked and precipitated undergo a 10% SDS-PAGE gel electrophoresis (Figures 3A and 3B).

VP60 protein is visualized on infected RK13 cells by indirect immunofluorescence. For this, cells infected with one or the other of the recombinant viruses are fixed 20 hours post-infection with a 50% ethanol / 50% acetone solution before being placed in the presence of anti-VP60 antibodies, both polyclonal and monoclonal. Detection is accomplished by an anti-rabbit or anti-mouse FITC antibody.

After immunoprecipitation, for the two viruses, a protein band at about 60 JcDa clearly appeared on the SDS-page, signaling the presence of the VP60 protein.

The gels obtained after immunoprecipitation on RK13 cells and electrophoresis are shown in Figures 3A and 3B.

The electrophoresis gel represented on figure 3A was made according to the following procedure:

- Track 1: RK13 cell proteins infected with the SG3 virus 3

- Track 2: proteins of RK13 cells infected with the RecIA122 virus,

- Track 3: proteins from uninfected cells,

- PM: molecular weight marker,

- Series a: precipitation by means of an antimixomatosis and anti RVHD immune serum,

- Series b: precipitation by means of an anti RVHD immune serum,

- Series c: precipitation by means of a monoclonal antibody against VP60 (61A47),

- Series d: precipitation using an anti VP60 monoclonal antibody (4E3).

Similarly, the electrophoresis gel depicted on Figure 3B was made according to the following procedure:

- Track 1: RK13 cell proteins infected with SG33,

- Track 2: proteins from RK13 cells infected with RecB2111, - Track 3: proteins from uninfected RK13 cells.

PM: molecular weight marker,

Series a: precipitation using an anti-myxomatosis immune serum.

- Series b: precipitation by means of an anti RVHD immune serum,

- Series c: precipitation using an anti VP60 monoclonal antibody (61A47).

In immunofluorescence on RK13 cells, the cytoplasmic fluorescence obtained thanks to anti VP60 antibodies leaves no doubt regarding the expression of VP60 by the two recombinant viruses.

After verification of good VP60 expression in vitro, 5-week-old rabbits underwent a single ID (intradermal) injection of 5.10 pfu of recombinant virus.

Here it must be remembered that in the case of young animals just weaned, the classical procedures suggested by the industrialists, on the one hand, associate two successive injections of vaccines with inactivated viruses, and on the other hand recommend a first vaccination against myxomatosis with Shope fibroma virus, followed from a recall with SG33.

Therefore, in order to improve existing systems by processing myxomatous-RHDV recombinant viruses thus expressing the VP60 protein, the procedure described below was followed.

For the RVHD valence;

The experiments to explore the RVHD valence were conducted on 5-week-old bunnies.

After blood sampling from each individual, 54 rabbits were vaccinated both with a commercial preparation ("lapin ject" by Sanofi) (18 animals), and with one of the two recombinant viruses (18 animals for each).

Sanofi's "lapinject" vaccine is an inactivated and adjuvanted RHDV virus preparation. Half of each batch, and 5 controls, underwent virulent testing 5 days later (J5), while the other half and 5 new controls are tested on day 15 (J15) with 1000 LD50 of RHDV virus.

The virulent tests carried out on the 5th and 15th day postinoculation have highlighted the complete protection of the rabbits against an intramuscular injection of 1000 LD50 of wild RHDV virus. In fact, unlike the control batches, no vaccinated animals, whatever the injection made, showed the slightest clinical signal, and all survived after inoculation on the 5th or 15th day.

Table 1 below shows not only some details of the inoculation procedure of the different viruses, but also the results obtained after virulent tests with 1000 LD50 of RHDV virus, at the time of the exploration of the RVHD valence.

For the myxomatous valence:

The RecIA122 and RecB2111 viruses were studied according to the procedure described below and the results are given in Table 2.

For the purpose of examining the RecIA122 virus, 24 5-week-old male rabbits underwent a single intradermal inoculation on the outer face of the ear with 5 10 pfu tips of virus at a single injection site (12 with the SG33 virus and 12 with RecIA122).

At the same time, 6 uninoculated witness rabbits of the same age are reared under the same conditions.

Each rabbit undergoes a blood sample on day 0, day 10, day 20, day 30 and day 44 in order to perform serologies for the two valences.

A detailed clinical examination is carried out daily from day 0 to day 15 in order to verify the appearance of local or general symptoms

At the end of this surveillance, rabbits are tested on day 44 by XD injection of 5.IO3 pfu of myxomatous TI virus (virulent TOULOUSE 1 strain) and clinical symptoms are observed for each for ten days.

The same procedure was later applied to the RecB2111 virus with, this time, 15 rabbits in each batch.

This procedure made it possible to verify the total harmlessness of these two viruses for young rabbits. In fact, only a local reaction was observed at the injection point equivalent to that obtained with the SG33 virus.

A kinetics of anti-myxoma antibody production was performed for recombinant viruses and for SG33, again on 44 days. The responses obtained measured with the ELISA method are presented in figure 5. It appears that for the SG33 and RecIA122 viruses, the kinetics are completely comparable, with a maximum titer at day 30. For the RecB2111 virus, the antibody titers reach the limit maximum from day 21 and are well below day 30 and day 44 than those obtained for the other two viruses. The results of the seroneutralization tests carried out on the three viruses confirm this trend: the seroneutralizing antibody titers are stable from day 30 to day 44, but still remain lower for the RecB2111 virus, as shown in figure 6.

Table 2 below shows the inoculation protocol of the different viruses for the exploration of the myxomatous valence:

TABLE 2

Vaccine lot Via di Inoculo / Number of rabbits used subject inoculation

1 RecA ID 5.IO3 pfu 12

2 It bears ID 5.IO3 pfu 15

3 SG3 3 ID 5.IO3 pfu 22

T Controls 12

The virulent test carried out on day 14 with the virus

mrxomatous of TI strain (5.10 pfu) confirms the equivalence

of the protective power between the SG33 vaccine strain and viruses

recombinants. This protection, although partial, is a lot

satisfactory since only three have died

rabbits in batches SG33, a rabbit in batch RecIA122, and

of three rabbits in batch RecB2111 after a clinical card of

generalized severe myxomatosis (table 3).

In table 3, the results obtained are indicated

after virulent test with the TI strain at one concentration

of 5.IO3 pfu injected intradermally.

TABLE 3

Lot Myxoma prd. Myxomas according to Generalize Deaths / Mario only dari without ation with total alteration alteration

of the EG of the general state

1 2 4 1/12 2 7 7 3/15 3 7 9 3/22 T 0 12 12/12

Moreover, the titers of anti-myxomatosis antibodies ed

anti-RVHD were determined by ELISA tests sie-

roneutralization.

ELISA tests: For myxomatous valence, plates with 96

wells (Probin Falcon type) have been carpeted for contact

overnight at 37 ° C with a suspension of myxoma virus

semi-purified toso on a sucrose cushion in PBS buffer

in quantities of 800 ng with 1 pg / dome.

For the RVHD valence, the wells were covered in ¬

the same conditions, with the same amount of ri¬ protein

purified VP60 combiner produced by means of a Ba-

culovirus in PIPES buffer at pH 6.5.

The wells are then saturated for 1 hour at 37 ° C by

gelatin with 15 mg / ml diluted in PBS.

After washing, the serum samples to be examined are diluted two by two in PBS at 0.1% Tween 20, the antigen-antibody reaction then taking place at 37 ° C for 1 hour. After washing, the wells are incubated with an anti-rabbit alkaline phosphatase conjugate at 37 ° C for 1 hour. Finally, after washing, the substrate (PNPP in ethanolamine buffer) is added at room temperature.

After 12 to 15 minutes, the spectrophotometer reading is taken with a OD of 405 nm. The antibody titer is equal to the inverse of the dilution whose OD is greater than or equal to three times that of the internal negative test.

The results obtained are summarized in figures 4 and 5.

Considering the kinetics of anti-VP60 antibody production by ELISA test on 44 days after inoculation of the recombinant virus RecIA122 to 12 rabbits and of the RecB2111 virus to 15 subjects under identical conditions, it clearly appears that the contents of anti-VP60 antibodies obtained are much more relevant after injection of the RecB2111 virus, and this from day 21 (figure 4). Furthermore, on day 44 it seems that the antibody titers are not yet at their maximum.

However, starting from the two attenuated recombinant viruses the production of anti VP60 antibodies is early, and it increases steadily and allows total protection from day 5 against a virulent RVHD virus.

Seroneutraiization: This technique can only be used for myxomatous valence as the RVHD virus is not suitable for cell culture. The sera to be tested are serially diluted with OptiMEM in 96-well plates in a volume of 50 μΐ. 750 pfu of viral suspension per well are then added to 50 ml of OptiMEM and the whole is incubated for 60 minutes at 37 ° C then another 60 minutes at 4 ° C. RK13 cells are then distributed in quantities of 1 to 2.10 ^ / well at 50 ml of OptiMEM in the presence of SVF at a final concentration of 5%. After 3 to 4 days of incubation at 37 ° C, the reading is carried out when the cytopathogenic effect is total in the test wells without antibodies.

The neutralizing titer is expressed with the inverse of the final serum dilution capable of protecting 75% of the cell mat (a positive reference serum is included in each experiment).

The results obtained are shown in figure 6.

Considering all the previous results, it can be concluded that the vaccine according to the present invention has a quite remarkable safety and efficacy: - on the one hand, none of the viruses used in this stage has revealed residual pathogenicity for rabbits.

on the other hand, total and perfect protection against RVHD is observed on the fifth day after vaccination with one or the other of the recombinant viruses, despite the modest antibody contents then measured.

The presence or absence of PV12 has no influence on the protective power of PV60 expressed by the myxomatous vector. These results, particularly interesting since obtained after vaccination with living viruses, encourage the use of new vaccines and significantly alleviate the manufacturing processes of anti RVHD vaccines.

Furthermore, in breeding conditions, contrary to the current recommendations regarding the classic anti RVHD vaccine, the same result could be obtained with a single injection on rabbits of less than 2 months regardless of the presence or not of residual maternal anti-RVHD antibodies.

The imperfect protection observed after a test with a myxomatous virus of type Tl, both with the virus G33 (3 deaths out of 22) and with the viruses RecIA122 (1 died out of 12) or RecB2111 (3 deaths out of 15), goes in the direction of previous works. In fact, on such young animals, the protection conferred by a single injection of SG33-type vaccine virus is very heterogeneous and explains the two-injection procedure suggested by the manufacturers. However, all rabbits with strong seroconversion have resisted without it

give virulent evidence. On the other hand, what they are

dead were part of a population with an anti¬ index

lower bodies (including neutralizing antibodies).

On the other hand, despite lower antibody titers, i

rabbits vaccinated with RecB2111 virus have, on the whole,

well withstood the test.

Rabbit vaccination trials with recombinants

RecA and RecB orally have also been implemented.

The oral route is a route of vaccine administration

which can be interesting for protecting forest rabbits

tics against the diseases that affect them. It takes place partico¬

especially for myxomatosis and viral haemorrhagic disease,

diseases that decimate wild rabbit populations,

which also serve as virus reservoirs for the rabbit's

farm.

In order to examine the possibility of vaccination of

rabbits orally with myxomatosis- recorabinant viruses

VP60, RecA and RecB virus were administered by the route

oral in two independent trials, at a dose of g

5.10 pfu, to small batches of animals.

In both cases they have proved capable of inducing

the synthesis of anti-myxomatous virus and anti-VP60 antibodies e

to protect animals against virulent testing by the

TI strain of myxomatous virus and by means of the viral haemorrhagic disease virus, in quantities close to those obtained

nute at the time of intradermal administration.

The results are presented on Figures 7 and 8a) -8b).

The results presented in Figure 7 were obtained

nuti with a batch of rabbits vaccinated, orally, with g

5.10 pfu of the recombinant RecB.

The results presented on Figures 8a-8b were

obtained with a batch of rabbits vaccinated, orally, g

with 5.10 pfu of the recombinants RecA and RecB and by the

strain SG33.

The construction of another recombinant SG33 / VP60 is

described below:

The recombination targets chosen were the six

quences encoding the dUTPase and the open reading phase

M9-L framing the ORF Mll-L and MGF-

A plasmid (pAT VP60) was constructed second

Figures 9a to 9c and used by transfection with

co-infection with the recombinant RecB described above

The recombinants were chosen on a pheno basis

white type of the zones of lysis in the presence of X-Gal. I can ¬

data were verified by PCR at the limits of the

serimento.

A recombinant viral clone, which exhibits the phenotype

desired was purified and its dUTPase / VP60 / M9-L region was fully sequenced.

This allowed us to confirm that this clone called 26b "had the following characteristics:

total deletion of the Mll-L and MGF sequences elimination of the lacZ regulatory gene

introduction of a polystop (transcription terminator in the three reading phases) downstream of the VP60 sequence, which makes it possible to ensure that the insertion has no polar effect.

ii recomtoinant correctly expresses the VP60.

It should be noted that this is the first time that the SG33 strain forms the object of a deletion or attenuation by recombination.

Another originality of the invention is that the virus also carries the pathogen against which you want to vaccinate.

Finally, a not insignificant advantage of the use of a vector such as the myxomatous virus is that its specificity is so strict that it is pathogenic only to lepers.

Claims (20)

CLAIMS 1. Attenuated living recombinant myxomatous virus, comprising at least one nucleotide sequence encoding, and expressing, an antigenic polypeptide under the control of a promoter inserted in one of the genes not essential for the replication of said virus. 2. Recombinant virus according to claim 1, characterized in that said nucleotide sequence codes for a viral, bacterial or parasitic immunogen of leporids. 3. Recombinant virus according to one of claims 1 or 2, characterized in that said nucleotide sequence encodes an antigenic protein, in particular of capsid, membrane or envelope, of a pathogen selected from the group formed by: the virus of the RVHD, the EBHS virus, the rotaviruses, the protozoan responsible for encephalitozoonosis, the enterobacteria in particular E. Coli and the clostridia, "Bacillus piliformis", the coccidia, the Pasteurella, the Francisella tularensis, the staphylococci. 4. Recombinant virus according to claim 1, characterized in that the myxomatous virus is generated by a strain selected from the group formed by the strains: SG33, LEON 162, HONGROIS, FINISTERE, R 801, TOULOUSE 1, LAUSANNE. 5. Recombinant virus according to one of claims 1, 2, 3 or 4, characterized in that said nucleotide sequence and said promoter are inserted in the M11L-MGF or TK genes of said myxomatous virus. Recombinant virus according to any one of the preceding claims, characterized in that it comprises a nucleotide sequence encoding, and expressing, an antigenic polypeptide of the rabbit viral haemorrhagic disease virus, under the control of a promoter. 7. Recombinant virus according to claim 6, characterized in that said nucleotide sequence codes for and expresses the capsule protein VP60 to VP60 + VP12 of said virus of the viral haemorrhagic disease of rabbits. 8. Recombinant virus according to one of claims 6 or 7, characterized in that the said promoter of the said nucleotide sequence is the early / late P7,5 vaccine promoter. Recombinant virus according to one of claims 6 to 8, characterized in that it comprises the nucleotide sequence encoding and expressing the capsid protein VP60 + VP12 under the control of the early / late vaccine promoter P7.5, inserted in the gene TK. Recombinant virus according to one of claims 6 to 8, characterized in that it comprises the nucleotide sequence encoding and expressing the capsid protein VF60 under the control of the early / late vaccine promoter P7.5, inserted in the M11L- genes FGM. Recombinant virus according to one of the preceding claims, characterized in that it further comprises the nucleotide sequence encoding, and expressing, the figai gene, under the control of the late P11K vaccine promoter. Recombinant virus according to one of claims 1 to 4 and 6 to 8, characterized in that said nucleotide sequence and said promoter are inserted in the dUTPase and M9-L genes. 13. Recombinant virus according to claim 12, characterized in that the nucleotide sequences encoding and expressing the genes Mll-L and MGF are totally deleted and in that it further comprises a polystop downstream of the VP60 sequence. 14. Use of an attenuated living recombinant virus according to one of claims 1 to 13 for the production of a vaccine capable of effectively vaccinating leporidae simultaneously against myxomatosis and another pathology. 15. Live attenuated recombinant vaccine which allows to simultaneously vaccinate leporids against myxomatosis and another pathology according to claim 3, characterized in that it comprises as a vector the attenuated living recombinant myxomatous virus according to one of claims 1 to 13. Recombinant vaccine according to one of claims 14 or 15, characterized in that it comprises an effective vaccine dose of recombinant myxomatous virus. 17. Recombinant vaccine allowing to simultaneously vaccinate leporids against myxomatosis and viral haemorrhagic disease of rabbits (RVHD) according to one of claims 15 or 16, characterized in that it comprises as a vector the attenuated living myxomatous virus which comprises a nucleotide sequence encoding, and expressing, an antigenic polypeptide of the rabbit viral haemorrhagic disease virus, under the control of a promoter. 18. Recombinant vaccine according to claim 17, characterized in that it comprises as a vector the myxomatous virus as defined according to one of claims 7 to 13. 19. Recombinant vaccine according to one of claims 17 and 18, characterized in that the effective amount of. Combinant virus per vaccine dose is between 102 g and 10 pfu equivalents, and for the intradermal route, preferably, between 103 and 106 pfu equivalents. 20. Recombinant vaccine according to claim 19, characterized in that the vaccine is formulated for parenteral administration, preferably intradermal or oral.