ITNA20070112A1

ITNA20070112A1 - UNA DEIDROGENASI / RIDUTTASI NAD (H) EMPLOYEE, THERMOFILAME AND THERMOSTABLE, AS BIOCATALYZER IN THE SYNTHESIS OF CHIRAL AROMATIC ALCOHOLS.

Info

Publication number: ITNA20070112A1
Authority: IT
Inventors: Carla Francesco La; Carlo Antonio Raia; Mose Rossi
Original assignee: Consiglio Nazionale Ricerche
Priority date: 2007-12-05
Filing date: 2007-12-05
Publication date: 2009-06-06

Description

DESCRIZIONE DESCRIPTION

“UNA DEIDROGENASI/RIDUTTASI NAD(H) DIPENDENTE, TERMOFILA E TERMOSTABILE, COME BIOCATALIZZATORE NELLA SINTESI DI ALCOLI AROMATICI CHIRALl” "A DEHYDROGENASE / REDUCTASE NAD (H) DEPENDENT, THERMOPHILIC AND THERMOSTABLE, AS A BIOCATALYST IN THE SYNTHESIS OF CHIRALl AROMATIC ALCOHOLS"

RIASSUNTO SUMMARY

Il presente brevetto è diretto a proteggere la scoperta di un nuovo enzima con attività deidrogenasi/riduttasica, ottenuto mediante l isolamento, il clonaggio ed espressione in E. coli del rispettivo gene, identificato nella sequenza genomica di Thermus thermophilus HB27, un batterio termofilo aerobico avente una temperatura ottimale di crescita di 85°C. L’enzima fa parte della superfamiglia delle deidrogenasi/riduttasi a catena corta, è un tetramero composto da quattro subunità identiche di 26.961 Da, utilizza come cofattore beta-nicotinamide adenin dinucleotide NAD(H), e mostra una eccellente termoattività e termostabilità e una buona tolleranza verso i comuni solventi organici se confrontato a enzimi simili isolati da procarioti ed eucarioti. L’enzima ha una attività ottimale ad una temperatura di circa 80°C, e presenta una temperatura di semi inattivazione di 30 minuti a 90°C, nonché una bassa specificità di substrato e una alta enantioselettività. The present patent is aimed at protecting the discovery of a new enzyme with dehydrogenase / reductase activity, obtained through the isolation, cloning and expression in E. coli of the respective gene, identified in the genomic sequence of Thermus thermophilus HB27, an aerobic thermophilic bacterium having an optimal growth temperature of 85 ° C. The enzyme is part of the short-chain dehydrogenase / reductase superfamily, is a tetramer composed of four identical subunits of 26.961 Da, uses beta-nicotinamide adenine dinucleotide NAD (H) as a cofactor, and shows excellent thermoactivity and thermostability and good tolerance towards common organic solvents when compared to similar enzymes isolated from prokaryotes and eukaryotes. The enzyme has an optimal activity at a temperature of about 80 ° C, and has a semi inactivation temperature of 30 minutes at 90 ° C, as well as a low substrate specificity and high enantioselectivity.

Si riporta la sequenza amminoacidica del nuovo enzima, nonché la sequenza di DNA del gene che lo codifica e si rivendicano tutte le sequenze di DNA contenenti addizioni, delezioni, inserzioni o sostituzioni tali che la sequenza amminoacidica risultante abbia una similitudine maggiore dell’80% della nativa. Si rivendica anche una efficiente sistema di riciclo in situ del coenzima nella sua forma ridotta (NADH) che consiste neH’utilizzo dell’alcol deidrogenasi di B. stearothermophilus, termofila e NAD-dipendente, per catalizzare la riconversione NAD a NADH in presenza di 2-propanolo quale sorgente di ioni idruro, in appropriato tampone per mantenere il pH ottimale per entrambi gli enzimi. The amino acid sequence of the new enzyme is reported, as well as the DNA sequence of the gene that encodes it and all DNA sequences containing additions, deletions, insertions or substitutions are claimed such that the resulting amino acid sequence has a similarity greater than 80% of the native. An efficient in situ recycling system of the coenzyme in its reduced form (NADH) is also claimed, which consists in the use of the thermophilic and NAD-dependent alcohol dehydrogenase of B. stearothermophilus, to catalyze the reconversion of NAD to NADH in the presence of 2 -propanol as a source of hydride ions, in an appropriate buffer to maintain the optimal pH for both enzymes.

Questo è la prima deidrogenasi/riduttasi a catena corta che utilizza come coenzima il NADH isolata da un microrganismo termofilo e le sue caratteristiche (quali la stabilità alla temperatura e ai solventi organici) ne fanno un enzima con notevoli potenzialità applicative. This is the first short-chain dehydrogenase / reductase that uses NADH isolated from a thermophilic microorganism as a coenzyme and its characteristics (such as stability to temperature and organic solvents) make it an enzyme with considerable application potential.

DESCRIZIONE DESCRIPTION

Stato dell’arte State of the art

Le alcol deidrogenasi (ADH) sono enzimi di grande interesse applicativo per la sintesi di enantiomeri (S) o (R) di alcoli da chetoni prochirali (1). Dopo le prime applicazioni per la sintesi asimmetrica di alcoli utilizzando ADH di fegato equino e di lievito (2) e Termoanae brockii (3), sono stati effettuati screening su molti microrganismi alla ricerca di ADH con particolari proprietà quali la specificità di substrato, buona efficienza e alta enantioselettività. Esempi rappresentativi sono la ADH di Lactobacillus brevis NADPH dipendente e (R) specifica, attiva sugli arii chetoni (4), la ADH NADH dipendente ed (S) specifica dal batterio denitrificante EbNl (5) e la ADH NADH dipendente di Leisfonia attiva su alcoli secondari (R), aldeidi, chetoni e chetoesteri (6). Questi enzimi sono omotetrameri e appartengono alla famiglia delle ADH a catena corta caratterizzati da circa 250 residui aminoacidici per subunità (7, 8). Esempi rappresentativi delle ADH da microrganismi termofili sono le ADH a catena media di Bacillus stearothermophilus (9) e due enzimi di archeabatteri quali l’Aeropyrum pernix (10) e Sulfolobus solfataricus (11, 12). Quest’ ultima, ( S ) specifica e NAD dipendente, è attiva sugli alcoli primari e secondari e scarsamente attiva sugli arilchetoni. Alcohol dehydrogenases (ADH) are enzymes of great application interest for the synthesis of (S) or (R) enantiomers of alcohols from prochiral ketones (1). After the first applications for the asymmetric synthesis of alcohols using ADH from equine liver and yeast (2) and Termoanae brockii (3), many microorganisms were screened for ADH with particular properties such as substrate specificity, good efficiency. and high enantioselectivity. Representative examples are the Lactobacillus brevis NADPH dependent and (R) specific ADH, active on arii ketones (4), the NADH dependent and (S) specific ADH from the denitrifying bacterium EbNl (5) and the Leysphonia dependent ADH NADH active on alcohols. secondary (R), aldehydes, ketones and ketoesters (6). These enzymes are homotetramers and belong to the short-chain ADH family characterized by about 250 amino acid residues per subunit (7, 8). Representative examples of ADH from thermophilic microorganisms are the medium chain ADHs of Bacillus stearothermophilus (9) and two enzymes of archeabacteria such as Aeropyrum pernix (10) and Sulfolobus solfataricus (11, 12). The latter, (S) specific and NAD dependent, is active on primary and secondary alcohols and scarcely active on arylketones.

La ricerca di una deidrogenasi/riduttasi avente caratteristiche di stabilità operazionale e NADH dipendenza si è diretta su genomi di organismi termofili disponibili nel database per individuare geni che codificassero per ADH putative appartenenti alla subfamiglia delle deidrogenasi/riduttasi a catena corta. The search for a dehydrogenase / reductase having characteristics of operational stability and NADH dependence was directed to genomes of thermophilic organisms available in the database to identify genes encoding putative ADH belonging to the short-chain dehydrogenase / reductase subfamily.

Sorprendentemente è stata trovata una tale sequenza nel genoma del microorganismo termofilo Thermus thermophilus HB27. Il gene è stato isolato, clonato ed espresso in E. coli e l’enzima è stato purificato e caratterizzato rispetto alla specificità di substrato, cinetica e stabilità. L’enzima di T. thermophilus HB27 (denominato in avanti TtADH) è risultato essere una deidrogenasi/riduttasi attiva su alcoli aromatici e composti carbonilici che includono benzaldeidi sostituite, chetoni aromatici, dichetoni e chetoesteri. I dati di enantioselettività verso i composti carbonilici prochirali indicano che TtADH è una ADH termofila a catena corta caratterizzata da una specificità di tipo Prelog (13). Surprisingly, such a sequence was found in the genome of the thermophilic microorganism Thermus thermophilus HB27. The gene was isolated, cloned and expressed in E. coli and the enzyme was purified and characterized with respect to substrate specificity, kinetics and stability. The T. thermophilus HB27 enzyme (hereafter referred to as TtADH) was found to be a dehydrogenase / reductase active on aromatic alcohols and carbonyl compounds which include substituted benzaldehydes, aromatic ketones, diketones and ketoesters. Data of enantioselectivity towards prochiral carbonyl compounds indicate that TtADH is a short-chain thermophilic ADH characterized by a specificity of the Prelog type (13).

La descrizione delle attività effettuate e dei risultati raggiunti nella presente invenzione sono solo esemplificative e altre alterazioni, adattamenti, modificazioni sulla deidrogenasi/riduttasi sono comprese negli scopi della presente invenzione. Di conseguenza la presente invenzione non è limitata dalle specifiche rivendicazioni qui illustrate. The description of the activities carried out and the results achieved in the present invention are exemplary only and other alterations, adaptations, modifications on the dehydrogenase / reductase are included within the scope of the present invention. Consequently, the present invention is not limited by the specific claims illustrated herein.

1. Identificazione ed isolamento del gene. 1. Identification and isolation of the gene.

Il gene codificante la deidrogenasi/riduttasi d’interesse, detto ttadh, individuato nel genoma completo di Thermus thermophilus HB27 (GenBank accession no. YP 003977), è composto da 771 coppie di basi codificanti una proteina di 256 amino acidi. Le sequenza del gene e della proteina dell’invenzione sono qui riportate rispettivamente come SEQ NR1 e SEG NR2: The gene encoding the dehydrogenase / reductase of interest, called ttadh, identified in the complete genome of Thermus thermophilus HB27 (GenBank accession no. YP 003977), is composed of 771 base pairs encoding a protein of 256 amino acids. The sequence of the gene and protein of the invention are shown here respectively as SEQ NR1 and SEG NR2:

SEQ NR1 atgggccttttcgctggcaaaggggtgctggtgaccggaggggcccggggtatcggccgg SEQ NR2 M G L F A G K G V L V T G G A R G I G R Gccatcgcccaggccttcgcccgggagggggccttggtggccctgtgcgacctccgcccg A I A Q A F A R E G A L V A L C D L R P SEQ NR1 atgggccttttcgctggcaaaggggtgctggtgaccggaggggcccggggtatcggccgg SEQ NR2 M G L F A G K G V L V T G G G A R G I G R Gccatcgcccaggccttcgcccgggagggggccttggtggcc Acctg A G Cg A Lcc A Lcc A Lcc A Lcc A Lcc A Lcc A Lcc A Lcc A R

gaggggaaggaggtggcggaggccatcgggggggcgtttttccaggtggacctcgaggac E G K E V A E A I G G A F F Q V D L E D gaggggaaggaggtggcggaggccatcgggggggcgtttttccaggtggacctcgaggac E G K E V A E A I G G A F F Q V D L E D

gagagggagcgagtgcgcttcgtggaggaggccgcctacgccctgggccgggtggacgtt E R E R V R F V E E A A Y A L G R V D V gagagggagcgagtgcgcttcgtggaggaggccgcctacgccctgggccgggtggacgtt E R E R V R F V E E A A Y A L G R V D V

ctggtcaacaacgccgccatcgccgcccccggctcggccctcacggtgcggcttcccgag L V N N A A I A A P G S A L T V R L P E ctggtcaacaacgccgccatcgccgcccccggctcggccctcacggtgcggcttcccgag L V N N A A I A A P G S A L T V R L P E

tggcgcagggtgcttgaggtcaacctcaccgcccccatgcacctttccgccttggccgcg W R R V L E V N L T A P M H L S A L A A tggcgcagggtgcttgaggtcaacctcaccgcccccatgcacctttccgccttggccgcg W R R V L E V N L T A P M H L S A L A A

cgggagatgcggaaggtgggcggtggggccatcgtcaacgtggccagcgtgcaggggctt R E M R K V G G G A I V N V A S V Q G L cgggagatgcggaaggtgggcggtggggccatcgtcaacgtggccagcgtgcaggggctt R E M R K V G G G A I V N V A S V Q G L

ttcgccgagcaggagaacgccgcctacaacgcttccaagggggggcttgtgaacctcacc ttcgccgagcaggagaacgccgcctacaacgcttccaagggggggcttgtgaacctcacc

FA EQ EN AA Y N A S K G G L V N L T cgctccctggcgctggacctcgcccccctccgcatccgggtgaacgcggtagcgcccggg R S L A L D L A P L R I R V N A V A P G FA EQ EN AA Y N A S K G G L V N L T cgctccctggcgctggacctcgcccccctccgcatccgggtgaacgcggtagcgcccggg R S L A L D L A P L R I R V N A V A P G

gccatcgccacggaggcggtcctggaggccatcgccctctccccggacccggagagaacc A I A T E A V L E A I A L S P D P E R T gccatcgccacggaggcggtcctggaggccatcgccctctccccggacccggagagaacc A I A T E A V L E A I A L S P D P E R T

cggagggactgggaggacctccacgccctgaggcgcctggggaagcccgaggaggtggcg R R D W E D L H A L R R L G K P E E V A cggagggactgggaggacctccacgccctgaggcgcctggggaagcccgaggaggtggcg R R D W E D L H A L R R L G K P E E V A

gaggccgtcctcttcctggcctcggagaaggctagcttcatcaccggggccatcctgccc E A V L F L A S E K A S F I T G A I L P gaggccgtcctcttcctggcctcggagaaggctagcttcatcaccggggccatcctgccc E A V L F L A S E K A S F I T G A I L P

gtggacggggggatgacggcgagcttcatgatggcggggcggccggtgtag V D G G M T A S F M M A G R P V - gtggacggggggatgacggcgagcttcatgatggcggggcggccggtgtag V D G G M T A S F M M A G R P V -

2. Clonaggio ed espressione in E. coli ed ottenimento dell’enzima ricombinante. 2. Cloning and expression in E. coli and obtaining the recombinant enzyme.

Il DNA cromosomiale di Thermus thermophilus HB27 è stato estratto secondo il metodo di Sambrock et alti (14) ed è stato usato come templato nella PCR. Gli oligonucletotidi The chromosomal DNA of Thermus thermophilus HB27 was extracted according to the method of Sambrock et alti (14) and was used as a template in the PCR. The oligonucletotides

5 '-GGTTGGGGTTCATATGGGCCTTTTCGCTGGCAAAGGGGTGCTG-3 ' e 5 '-GGTTGGTTGAATTCCTACACCGGCCGCCCCGCCATCATGAAGCT-3 ' sono stati disegnati per legarsi rispettivamente al sito di inizio e al codone di stop della ORF di Thermus thermophilus HB27. Il prodotto della PCR è stato clonato nel vettore di espressione pET29a (Novagen, Madison, Wis., USA) e con il clone risultante sono state trasformate le cellule di E. coli BL21 (DE23) (Novagen). La proteina ricombinante è stata prodotta in scala di laboratorio per incubazione a 37°C di 2 litri di mezzo di coltura LB contenente kanamicina e inducendo l’espressione con IPTG alla lettura di 1.4 OD a 600 nm. Dopo 24 ore di ulteriore fermentazione, le cellule sono state raccolte per centrifugazione e sottoposte alla procedura di estrazione. 5 '-GGTTGGGGTTCATATGGCCTTTTCGCTGGCAAAGGGGTGCTG-3' and 5 '-GGTTGGTTGAATTCCTACACCGGCCGCCCCGCCATCATGAAGCT-3' were designed to bind to the thermophil start site of the thermophil or the thermophil HB 27 thermophil codon, respectively. The PCR product was cloned into the pET29a expression vector (Novagen, Madison, Wis., USA) and E. coli BL21 (DE23) (Novagen) cells were transformed with the resulting clone. The recombinant protein was produced on a laboratory scale by incubating 2 liters of culture medium LB containing kanamycin at 37 ° C and inducing expression with IPTG at a reading of 1.4 OD at 600 nm. After 24 hours of further fermentation, the cells were collected by centrifugation and subjected to the extraction procedure.

3. Purificazione dell’enzima 3. Purification of the enzyme

Le cellule raccolte (14 g) e sospese in tampone Tris-HCl 20 mM, pH 7.5, contenente un inibitore di proteasi, il PMSF (0.1 mM), sono lisae mediante French Press e l’estratto grezzo ottenuto è sottoposto a centrifugazione. Il supematante è trattato con DNasi e poi con protamina e i frammenti di acido nucleico derivati sono rimossi per centrifugazione. Il supematante risultante è quindi incubato per 15 min a 75 °C e le proteine estranee termoinstabili rimosse per centrifugazione. Il supematante attivo ottenuto è posto a dializzare contro Tris-HCl, 20 mM, pH 8.4 (Tampone A) contenente PMSF. Il campione dializzato è applicato su colonna di DEAE-Sepharose FF in tampone A e frazionato con gradiente salino (0-0.6 M NaCl). Il pool attivo, dializzato e concentrato, è sottoposto a cromatografia di gel filtrazione su Sephadex G-75. Dal picco attivo eluito si ottengono 25-30 mg di enzima puro al 95%, sulla base di analisi per HPLC. Il preparato è stabile per oltre 6 mesi a -20°C in glicerolo al 50%. The cells collected (14 g) and suspended in 20 mM Tris-HCl buffer, pH 7.5, containing a protease inhibitor, PMSF (0.1 mM), are lisae by French Press and the crude extract obtained is subjected to centrifugation. The supernatant is treated with DNase and then with protamine and the derived nucleic acid fragments are removed by centrifugation. The resulting supernatant is then incubated for 15 min at 75 ° C and the heat-unstable foreign proteins removed by centrifugation. The obtained active supematant is dialyzed against Tris-HCl, 20 mM, pH 8.4 (Buffer A) containing PMSF. The dialyzed sample is applied to a column of DEAE-Sepharose FF in buffer A and fractionated with a saline gradient (0-0.6 M NaCl). The dialyzed and concentrated active pool is subjected to gel filtration chromatography on Sephadex G-75. From the eluted active peak 25-30 mg of 95% pure enzyme are obtained, on the basis of HPLC analysis. The preparation is stable for over 6 months at -20 ° C in 50% glycerol.

4. Proprietà dell’enzima. 4. Properties of the enzyme.

L’analisi cromatografica su colonna ad esclusione molecolare e l’analisi elettroforetica su SDS-PAGE stabiliscono che l’enzima è un tetramero composto di 4 subunità di 27 kDa ciascuna. Molecular exclusion column chromatography and electrophoretic analysis on SDS-PAGE establish that the enzyme is a tetramer composed of 4 subunits of 27 kDa each.

Saggio di attività. Activity essay.

L’attività della TtADH è saggiata a 65°C, misurando allo spettrofotometro la diminuizione di assorbanza del NADH a 340 nm per l’aggiunta dell’enzima (5-25 μg) ad una cuvetta contenente 1 mi di benzoilformiato di etile 20 mM, NADH 0.3 mM, in tampone fosfato di potassio 50 mM, pH 6.0. Il saggio alternatio consiste nella misura dell’aumento assorbanza del NADH per l’aggiunta deU’enzìma ad una cuvetta contenente 1 mi di 20 mM (S)Ί-phenylethanol, 1 mM NAD<+>in tampone 100 mM glicina-NaOH, pH 10.5. The activity of TtADH is tested at 65 ° C, by measuring with the spectrophotometer the decrease in absorbance of NADH at 340 nm by adding the enzyme (5-25 μg) to a cuvette containing 1 ml of 20 mM ethyl benzoylformate, 0.3 mM NADH, in 50 mM potassium phosphate buffer, pH 6.0. The alternatio assay consists in measuring the increase in absorbance of NADH by adding the enzyme to a cuvette containing 1 ml of 20 mM (S) Ί-phenylethanol, 1 mM NAD <+> in 100 mM glycine-NaOH buffer, pH 10.5.

Una Unità di enzima rappresenta una μmole di coenzima utilizzato o prodotto in un minuto a 65°C sulla base del coefficiente di assorbimento di 6.22 mM<'1>per il NADH a 340 nm. One Enzyme Unit represents one μmole of coenzyme used or produced in one minute at 65 ° C based on the absorption coefficient of 6.22 mM <'1> for NADH at 340 nm.

pH e temperatura ottimali. Optimal pH and temperature.

Il pH ottimale, determinato a 65°C con l’utilizzo di soluzioni tampone appropriate, è risultato 6.0 per la reazione di riduzione e intorno a 10.0 per la reazione di ossidazione. Il profilo dell’andamento del numero di turnover contro valori crescenti di temperatura mostra che la velocità di reazione catalizzata dalla TtADH aumenta sino a 80°C, e quindi diminuisce a causa della inattivazione termica. Per motivi strumentali è assunta la temperatura operativa di 65°C. The optimal pH, determined at 65 ° C with the use of appropriate buffer solutions, was 6.0 for the reduction reaction and around 10.0 for the oxidation reaction. The profile of the trend of the turnover number against increasing temperature values shows that the reaction rate catalyzed by TtADH increases up to 80 ° C, and therefore decreases due to thermal inactivation. For instrumental reasons the operating temperature of 65 ° C is assumed.

Dipendenza da ioni specifici. Dependence on specific ions.

Test di attività e stabilità in presenza di ioni mono e divalenti e di agenti chelanti hanno mostrato che TtADH non richiede e non contiene metalli con ruolo catalitico o strutturale. Activity and stability tests in the presence of mono and divalent ions and chelating agents have shown that TtADH does not require and does not contain metals with a catalytic or structural role.

Stabilità alle alte temperature e in presenza di solventi organici. Stability at high temperatures and in the presence of organic solvents.

L’attività catalitica della TtADH misurata dopo 24 h d’incubazione at 50°, 60° and 70°C è risultata il 142, 134, e 107% in campioni da 0.1 mg di proteina/ml e il 97, 105, and 94% in campioni da 1.0 mg/ml. L’enzima a concentrazione di 1 mg/ml risulta attivo del 50% dopo 30 min d’incubazione a 90°C. L’enzima si attiva in presenza di diversi solventi organici. Infatti, dopo 65 h incubazione a 25 °C l’attività misurata in campioni contenenti il 10% di metanolo, o di 2propanolo, acetonitrile, diossano, acetato di etile, 1 -propano lo, e «-esano è risultata il 172, 110, 167, 160, 115, 173 e il 182%, rispettivamente, rispetto a quella invariata del controllo. L’effetto attivante è riscontrato anche a temperature superiori. Infatti, l’enzima si attiva del 185, 192, 210, 170, 180 e 178% dopo incubazione di 24 ore a 60°C in presenza rispettivamente di 5% metanolo, 2% 2-propanolo, 10% 2-propanolo, 5% acetonitrile, 5% diossano e 5% acetato di etile. The catalytic activity of TtADH measured after 24 h of incubation at 50 °, 60 ° and 70 ° C was found to be 142, 134, and 107% in 0.1 mg protein / ml samples and 97, 105, and 94 % in 1.0 mg / ml samples. The enzyme at a concentration of 1 mg / ml is 50% active after 30 min of incubation at 90 ° C. The enzyme is activated in the presence of various organic solvents. In fact, after 65 h incubation at 25 ° C, the activity measured in samples containing 10% of methanol, or of 2propanol, acetonitrile, dioxane, ethyl acetate, 1 -propane, and «-hexane was 172, 110 , 167, 160, 115, 173 and 182%, respectively, with respect to the unchanged one of the control. The activating effect is also found at higher temperatures. In fact, the enzyme is activated by 185, 192, 210, 170, 180 and 178% after incubation of 24 hours at 60 ° C in the presence of 5% methanol, 2% 2-propanol, 10% 2-propanol, respectively, 5 % acetonitrile, 5% dioxane and 5% ethyl acetate.

Specificità dell’enzima. Specificity of the enzyme.

L’enzima è attivo solo in presenza di NAD<+>/NADH e totalmente inattivo con NADP<+>/NADPH. Sono substrati i seguenti composti, riportati in ordine decrescente di attività relativa (%), misurata a 65°C: The enzyme is active only in the presence of NAD <+> / NADH and totally inactive with NADP <+> / NADPH. The following compounds are substrates, reported in decreasing order of relative activity (%), measured at 65 ° C:

Alcoli aromatici: (S)-l-phenylethanol (100), alcol 4-metossibenzilico (99), (±)-1-fenil-l -propanolo (59) l-(4-fluorofenil)etanolo (45), l-(4-clorofenil)etanolo (26), alcol tran-cinnammilico (25), alcol 2-metossibenzilico (25), l-fenil-2-propanolo (16), (i?)-l-fenil-2-propen-l-olo (14) alcol 3-metossibenzilico. Aromatic alcohols: (S) -l-phenylethanol (100), 4-methoxybenzyl alcohol (99), (±) -1-phenyl-l -propanol (59) l- (4-fluorophenyl) ethanol (45), l- (4-chlorophenyl) ethanol (26), tran-cinnamyl alcohol (25), 2-methoxybenzyl alcohol (25), 1-phenyl-2-propanol (16), (i?) - 1-phenyl-2-propan 1-ol (14) 3-methoxybenzyl alcohol.

Chetoni e aldeidi aromatici: l-fenil-l,2-propanedione (146), 2,2,2-trifluoroacetofenone (100), 2,2-dichloroacetophenone (32), benzaldeide (14), 2-, 3-, e 4-metossibenzaldeide (13, 14, 13). Aromatic ketones and aldehydes: 1-phenyl-1,2-propanedione (146), 2,2,2-trifluoroacetophenone (100), 2,2-dichloroacetophenone (32), benzaldehyde (14), 2-, 3-, and 4-methoxybenzaldehyde (13, 14, 13).

Chetoesteri aromatici: benzoli formiato di etile (100), benzoli formiato di metile (57). Aromatic ketoesters: benzene ethyl formate (100), benzene methyl formate (57).

L’affinità e il numero di turnover dell’enzima verso i migliori substrati, espressi rispettivamente in termini di Kme kcA, determinati a 65°C, sono i seguenti (in parentesi mM e s<4)>: The affinity and turnover number of the enzyme towards the best substrates, respectively expressed in terms of Kme kcA, determined at 65 ° C, are as follows (in brackets mM and s <4)>:

Alcol 4-metossibenzilico (60; 1.6), (£)-l-phenylethanol (17.9; 0.98), 3-metossibenzaldeide (4.4; 3.1), benzoli formiato di etile (4.3; 91.4), benzoli formiato di metile (10.3; 96.6), 2,2,2-trifluoroacetofenone (11.2; 25.5), 1-fenil-1,2-propanedione (5.9; 17.1), NAD<+>(0.24; 0.84), NADH (0.23; 126.1). 4-methoxybenzyl alcohol (60; 1.6), (£) -l-phenylethanol (17.9; 0.98), 3-methoxybenzaldehyde (4.4; 3.1), benzene ethyl formate (4.3; 91.4), benzene methyl formate (10.3; 96.6 ), 2,2,2-trifluoroacetophenone (11.2; 25.5), 1-phenyl-1,2-propanedione (5.9; 17.1), NAD <+> (0.24; 0.84), NADH (0.23; 126.1).

5. Sistema di rigenerazione del NADH. 5. NADH regeneration system.

Il sistema sviluppato dagli inventori per il riciclo in continuo del NAD<+>a NADH necessario per massimizzare la resa di conversione del chetone prochirale in alcol catalizzata dalla TtADH, si basa sull’utilizzo dell’ alcol deidrogenasi di Bacillus stearothermophilus LLD-R, (BsADH), termofila e stabile sino a 60°C, anch’essa NAD(H) dipendente, specificamente molto attiva su alcoli primari e secondari e aldeidi, ma inattiva su nessuno dei substrati tipici della TtADH. La BsADH è preparata di routine nel nostro laboratorio in forma ricombinante da E. coli con rese soddisfacenti, secondo una procedura standardizzata (15). The system developed by the inventors for the continuous recycling of NAD <+> to NADH necessary to maximize the conversion yield of the prochiral ketone into alcohol catalyzed by TtADH, is based on the use of the alcohol dehydrogenase of Bacillus stearothermophilus LLD-R, ( BsADH), thermophilic and stable up to 60 ° C, also NAD (H) dependent, specifically very active on primary and secondary alcohols and aldehydes, but inactive on any of the typical substrates of TtADH. BsADH is routinely prepared in our laboratory in recombinant form from E. coli with satisfactory yields, according to a standardized procedure (15).

La composizione della miscela di reazione complessiva del sistema d’invenzione, standardizzata per un volume di 1.0 mi in provetta tappata, comprende: The composition of the overall reaction mixture of the inventive system, standardized for a volume of 1.0 ml in a capped tube, includes:

NAD 1 mM; substrato carbonilico 20 mM; 2-propanolo 260 mM, 11 U di BsADH, 50 μg di TtADH in 100 mM tampone MES, pH 6.0, 2-mercaptoetanolo 5 mM e KCl 100 mM. NAD 1 mM; 20 mM carbonyl substrate; 260 mM 2-propanol, 11 U of BsADH, 50 μg of TtADH in 100 mM MES buffer, pH 6.0, 5 mM 2-mercaptoethanol and 100 mM KCl.

La reazione di conversione è iniziata per incubazione della soluzione a 50° o 60°C e lasciata procedere a tempi diversi sino a 24 ore. Alla scadenza stabilita segue l’estrazione della miscela con acetato di etile (due volte con 0.5 mi di solvente) e l’estratto è analizzato per gas cromatografia (GC) su una colonna chirale. La enantioselettività della TtADH è stabilita dal confronto del profilo cromatografico con il profilo dei singoli alcoli enantiomeri (R) e (5) usati come standard. L’eccesso enantiomerico (ee) è determinato dal rapporto differenza/somma delle aree sottese dei picchi dei due enantiomeri prodotti, ovvero ee = [S]-[R]/[S]+[R]xlOO. La resa della conversione è determinata dal rapporto “area alcoli prodotti/area totale”. The conversion reaction is started by incubating the solution at 50 ° or 60 ° C and allowed to proceed at different times up to 24 hours. At the established deadline, the mixture is extracted with ethyl acetate (twice with 0.5 ml of solvent) and the extract is analyzed by gas chromatography (GC) on a chiral column. The enantioselectivity of TtADH is established by comparing the chromatographic profile with the profile of the single enantiomeric alcohols (R) and (5) used as standard. The enantiomeric excess (ee) is determined by the difference / sum ratio of the underlying areas of the peaks of the two enantiomers produced, or ee = [S] - [R] / [S] + [R] x100. The yield of the conversion is determined by the ratio "area of alcohol produced / total area".

L’invenzione è ulteriormente descritta con riferimento ai seguenti esempi. E’ sottinteso che vari altri esempi e modifiche nella pratica dell’invenzione saranno evidenti e potranno essere prontamente sviluppati da coloro che sono esperti del settore senza allontanarsi dallo scopo e dallo spirito dell’invenzione in oggetto. In accordo a ciò, non si intende che lo scopo delle rivendicazioni presentate sia limitato alla esatta descrizione qui riportata, ma che piuttosto le rivendicazioni sono composte in modo da racchiudere tutti gli aspetti di novità brevettabili che risiedono nella presente invenzione, inclusi tutti gli aspetti e gli esempi che ne potrebbero essere intesi come equivalenti da coloro che sono esperti del settore. The invention is further described with reference to the following examples. It is understood that various other examples and modifications in the practice of the invention will be evident and can be readily developed by those who are experts in the field without departing from the purpose and spirit of the invention in question. Accordingly, it is not intended that the scope of the presented claims be limited to the exact description given here, but rather that the claims are composed in such a way as to encompass all the patentable novelty aspects that reside in the present invention, including all aspects and examples that could be understood as equivalent by those who are skilled in the art.

Esempio 1. Biosintesi dell’alcol (R)-a-(trifiuoromethyl)benzilico Example 1. Biosynthesis of (R) -a- (trifiuoromethyl) benzyl alcohol

Il 2,2,2-trifluoroacetofenone è usato come substrato carbonilico nel metodo descritto nel paragrafo 5. La conversione risulta 20% e 40% dopo 1 ora di reazione rispettivamente a 50° e 60°C, ed è ~100% dopo 6 ore di reazione ad entrambe le temperature. Il prodotto principale è l’alcol (R)-a-(trifluoromethyl)benzilico ottenuto con un valore di ee del 90 e 93% a 60° e 50°C dopo 3 ore di reazione. Questi valori sono riscontrati anche dopo 6 e 24 ore di reazione ad entrambe le temperature. 2,2,2-trifluoroacetophenone is used as a carbonyl substrate in the method described in paragraph 5. The conversion is 20% and 40% after 1 hour of reaction at 50 ° and 60 ° C respectively, and is ~ 100% after 6 hours reaction at both temperatures. The main product is (R) -a- (trifluoromethyl) benzyl alcohol obtained with an ee value of 90 and 93% at 60 ° and 50 ° C after 3 hours of reaction. These values are also found after 6 and 24 hours of reaction at both temperatures.

Esempio 2. Biosintesi del (S)-l-feniletanolo Example 2. Biosynthesis of (S) -1-phenylethanol

L’acetofenone è usato come substrato carbonilico nel metodo descritto nel paragrafo 5 e risulta ridotto in (S)-l-feniletanolo con una resa del 70% e un ee del 99% in 6 ore di reazione a 50°C. Acetophenone is used as a carbonyl substrate in the method described in paragraph 5 and is reduced in (S) -l-phenylethanol with a yield of 70% and ee of 99% in 6 hours of reaction at 50 ° C.

Esempio 3. Biosintesi del (R )-mandelato di metile Example 3. Biosynthesis of methyl (R) -mandelate

Il benzoilformiato di metile è usato come substrato carbonilico nel metodo descritto nel paragrafo 5, e risulta ridotto a (R )-mandelato di metile con una resa del 91 % e un ee del 92% in 6 h di reazione a 60°C. Methyl benzoyl formate is used as a carbonyl substrate in the method described in paragraph 5, and is reduced to methyl (R) -mandelate with a yield of 91% and ee of 92% in 6 h of reaction at 60 ° C.

Esempio 4. Biosintesi del (R )-mandelato di etile Example 4. Biosynthesis of ethyl (R) -mandelate

Il benzoilformiato di etile è usato come substrato carbonilico nel metodo descritto nel paragrafo 5 e risulta ridotto a (R )-mandelato di etile con una resa del 90% ed un ee del 95% in 6 h di reazione a 50°C. Ethyl benzoylformate is used as a carbonyl substrate in the method described in paragraph 5 and is reduced to ethyl (R) -mandelate with a yield of 90% and ee of 95% in 6 h of reaction at 50 ° C.

Nel complesso, i dati di enantioselettività indicano che lo ione idruro del NADH è trasferito dal lato re del gruppo carbonile di tutti i chetoni testati e pertanto l’enzima TtADH segue la regola di Prelog (13). Overall, the enantioselectivity data indicate that the hydride ion of NADH is transferred from the king side of the carbonyl group of all the ketones tested and therefore the TtADH enzyme follows the Prelog rule (13).

E’ importante notare che gli alcoli otticamente attivi prodotti sono usati come intermedi chirali nella sintesi industriale. Il (R)-mandelato di metile è usato come intermedio chirale in preparazioni farmaceutiche (16, 17) e i derivati dell’alcol trifluorometilbenzilico sono importanti precursori impiegati nel campo dei cristalli liquidi (18). It is important to note that the optically active alcohols produced are used as chiral intermediates in industrial synthesis. Methyl (R) -mandelate is used as a chiral intermediate in pharmaceutical preparations (16, 17) and trifluoromethylbenzyl alcohol derivatives are important precursors used in the field of liquid crystals (18).

Riferimenti bibliografici Bibliographical references

1. Hummel W. 1999. Large-scale applications of NAD(P)-dependent oxidoreductases: recent developments. Trends Biotechnol. 17:487-492. 2. Jones J. B., and J. F. Beck. 1976. Applications of Biochemical systems in Organic Chemistry, pp 248-401. In Jones J. B., C. J. Sih, and D. Perlman (ed.), Techniques of Chemistry Series, Pari: I, voi.10. J. Wiley Sons N. Y. 1. Hummel W. 1999. Large-scale applications of NAD (P) -dependent oxidoreductases: recent developments. Trends Biotechnol. 17: 487-492. 2. Jones J. B., and J. F. Beck. 1976. Applications of Biochemical systems in Organic Chemistry, pp 248-401. In Jones J. B., C. J. Sih, and D. Perlman (ed.), Techniques of Chemistry Series, Pari: I, vol.10. J. Wiley Sons N. Y.

3. Keinan E., E. K. Hafely, K. K. Seth, and R. Lamed. 1986. Thermostable enzymes in organic synthesis. Asymmetric reduction of ketones with alcohol dehydrogenase from Thermoanaerobium brockii. J. Am. Chem. Soc. 108:162-169. 3. Keinan E., E. K. Hafely, K. K. Seth, and R. Lamed. 1986. Thermostable enzymes in organic synthesis. Asymmetric reduction of ketones with alcohol dehydrogenase from Thermoanaerobium brockii. J. Am. Chem. Soc. 108: 162-169.

4. Schlieben N. H., K. Nieflnd, J. Muller, B. Riebel, W. Hummel, and D. 4. Schlieben N. H., K. Nieflnd, J. Muller, B. Riebel, W. Hummel, and D.

Schomburg. 2005. Atomic resolution structures of R-specific alcohol dehydrogenase from Lactobacillus brevis provide thè structural bases of its substrate and cosubstrate specificity. J. Mol. Biol. 349:801-813. Schomburg. 2005. Atomic resolution structures of R-specific alcohol dehydrogenase from Lactobacillus brevis provide the structural bases of its substrate and cosubstrate specificity. J. Mol. Biol. 349: 801-813.

5. Hóffken H.W., M. Duong, T. Friedrich, M. Breuer, B. Hauer, R. Reinhardt, R. Rabus, and J. Heider. 2006. Crystal structure and enzyme kinetics of thè (5)-specific 1 -phenylethanol dehydrogenase of thè denitrifying bacterium strain EbNl. Biochemistry 45:82-93. 5. Hóffken H.W., M. Duong, T. Friedrich, M. Breuer, B. Hauer, R. Reinhardt, R. Rabus, and J. Heider. 2006. Crystal structure and enzyme kinetics of the (5) -specific 1 -phenylethanol dehydrogenase of the denitrifying bacterium strain EbNl. Biochemistry 45: 82-93.

6. Inoue K., Y. Makino, T. Dairi, and N. Itoh. 2006. Gene cloning and expression of Leifsonia alcohol dehydrogenase (LSADH) involved in asymmetric hydrogen-transfer bioreduction to produce (R)-form chiral alcohols. Biosci Bìotechnol Biochem. 70:418-426. 6. Inoue K., Y. Makino, T. Dairi, and N. Itoh. 2006. Gene cloning and expression of Leifsonia alcohol dehydrogenase (LSADH) involved in asymmetric hydrogen-transfer bioreduction to produce (R) -form chiral alcohols. Biosci Bìotechnol Biochem. 70: 418-426.

Filling C., K. D. Bemdt, J. Benach, S. Knapp, T. Prozorovski, E. Nordling, R. Ladenstein, H. Jomvall, and U. Oppermann. 2002. Criticai residues for structure and catalysis in short-chain dehydrogenases/reductases. J Biol Chem. 277:25677-25684. Filling C., K. D. Bemdt, J. Benach, S. Knapp, T. Prozorovski, E. Nordling, R. Ladenstein, H. Jomvall, and U. Oppermann. 2002. Criticai residues for structure and catalysis in short-chain dehydrogenases / reductases. J Biol Chem. 277: 25677-25684.

8. Schlieben N. H., K. Niefind, J. Muller, B. Riebel, W. Hummel, and D. 8. Schlieben N. H., K. Niefind, J. Muller, B. Riebel, W. Hummel, and D.

9. Ceccarelli C., Z. X. Liang, M. Strickler, G. Prehna, B. M. Goldstein, J. P. 9. Ceccarelli C., Z. X. Liang, M. Strickler, G. Prehna, B. M. Goldstein, J. P.

Klinman, and B. J. Bahnson. 2004. Crystal structure and amide H/D exchange of binary coraplexes of alcohol dehydrogenase from Bacillus stearothermophilus: insight into thermostability and cofactor binding. Biochemistry 43:5266-5277. Klinman, and B. J. Bahnson. 2004. Crystal structure and amide H / D exchange of binary coraplexes of alcohol dehydrogenase from Bacillus stearothermophilus: insight into thermostability and cofactor binding. Biochemistry 43: 5266-5277.

10. Guy J. E., M. N. Isupov, J. A. Littlechild. 2003. The structure of an alcohol dehydrogenase from thè hyperthermophilic archaeon Aeropyrum pernix. J MolBiol. 331:1041-1051. 10. Guy J. E., M. N. Isupov, J. A. Littlechild. 2003. The structure of an alcohol dehydrogenase from the hyperthermophilic archaeon Aeropyrum pernix. J MolBiol. 331: 1041-1051.

11. Raia C. A., A. Giordano, and M. Rossi. 2001. Alcohol dehydrogenase from Sulfolobus solfataricus. Methods Enzymol. 331:176-195. 11. Raia C. A., A. Giordano, and M. Rossi. 2001. Alcohol dehydrogenase from Sulfolobus solfataricus. Methods Enzymol. 331: 176-195.

12. Giordano A., F. Febbraio, C. Russo, M. Rossi, and C. A. Raia. 2005. 12. Giordano A., F. February, C. Russo, M. Rossi, and C. A. Raia. 2005.

Evidence for co-operativity in coenzyme binding to tetrameric Sulfolobus solfataricus alcohol dehydrogenase and its structural basis: fluorescence, kinetic and structural studies of thè wild-type enzyme and non-co-operative N249Y mutant. Biochem J. 388:657-667. Evidence for co-operativity in coenzyme binding to tetrameric Sulfolobus solfataricus alcohol dehydrogenase and its structural basis: fluorescence, kinetic and structural studies of the wild-type enzyme and non-co-operative N249Y mutant. Biochem J. 388: 657-667.

13. Prelog V., 1964. Specification of thè stereospecificity of some oxidoreductase by diamond lattice sections. Pure Appi. Chem. 9:119-130. 13. Prelog V., 1964. Specification of the stereospecificity of some oxidoreductase by diamond lattice sections. Pure Appi. Chem. 9: 119-130.

14. Sambrock J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. 14. Sambrock J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.

15. Fiorentino G., R. Cannio, M. Rossi, and S. Bartolucci.1998. Decreasing thè stability and changing thè substrate specificity of thè Bacillus stearothermophilus alcohol dehydrogenase by single amino acid replacements. Protein Eng. 11:925-930. 15. Fiorentino G., R. Cannio, M. Rossi, and S. Bartolucci. 1998. Decreasing the stability and changing the substrate specificity of the Bacillus stearothermophilus alcohol dehydrogenase by single amino acid replacements. Protein Eng. 11: 925-930.

16. Pousset C., M. Haddad, and M. Larchevèque. 2001. Diastereocontrolled synthesis of unii A of cryptophycin. Tetrahedron 57, 7163-7167. 16. Pousset C., M. Haddad, and M. Larchevèque. 2001. Diastereocontrolled synthesis of unii A of cryptophycin. Tetrahedron 57, 7163-7167.

17. Kobayashi Y., Y. Takemoto, Y. Ito, and S. Terashima. 1990. A novel synthesis of thè (2R,3S)- and (2S3R)-3-amino-2-hydroxycarboxylic acid derivatives, thè key componente of a renin inhibitor and bestatin, from methyl (R)- and (5)-mandelate Tetrahedron Letters 31: 3031-3034. 17. Kobayashi Y., Y. Takemoto, Y. Ito, and S. Terashima. 1990. A novel synthesis of the (2R, 3S) - and (2S3R) -3-amino-2-hydroxycarboxylic acid derivatives, the key component of a renin inhibitor and bestatin, from methyl (R) - and (5) -mandelate Tetrahedron Letters 31: 3031-3034.

18. Fujisawa T. , K. Ichikawa, and M. Shimizu. 1993. Stereocontrolled Synthesis of /j-Substituted Trifluoromethylbenzylic Alcohol Derivatives of High Optical Purity by thè Baker’s Yeast Reduction. Tetrahedron: Asymmetry 4:1237-1240. 18. Fujisawa T., K. Ichikawa, and M. Shimizu. 1993. Stereocontrolled Synthesis of / j-Substituted Trifluoromethylbenzylic Alcohol Derivatives of High Optical Purity by the Baker's Yeast Reduction. Tetrahedron: Asymmetry 4: 1237-1240.

Claims

Claims. The following is claimed: 1. An isolated polynucleotide whose sequence SEQ NR1 is reported in paragraph 1 "Identification and isolation of the gene" of the Description of the invention, and is encoding a recombinant polypeptide having the sequence SEQ NR2 reported in the same paragraph, or is encoding a polypeptide having at least 80% identity with respect to SEQ NR2, having dehydrogenase / reductase activity.

2. An isolated polypeptidide whose SEQ NR2 sequence is reported in paragraph 1 "Identification and isolation of the gene" of the Description of the invention and is encoded by the polynucleotide sequence referred to in point 1.

3. The in situ regeneration method of the coenzyme jS-nicotinamide adenine dinucleotide NAD (H) described in paragraph 5 which uses the enzyme called TtADH in the description of the invention and having the polypeptide sequence referred to in point 2.

4. The process for the biosynthetic production of (R) -a - (trifluoromethyl) benzyl alcohol from 2,2,2-trifluoroacetophenone using the method referred to in paragraph 5.

5. The process for the biosynthetic production of alcohol (5) -l-phenylethanol from acetophenone using the method referred to in paragraph 5.

6. The process for the biosynthetic production of methyl (R) -mandelate from methyl benzoate using the system referred to in paragraph 5.

7. The process for the biosynthetic production of ethyl (R) -mandelate from ethyl benzoate using the system referred to in paragraph 5.