IT201800020299A1 - ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL - Google Patents

ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL Download PDF

Info

Publication number
IT201800020299A1
IT201800020299A1 IT102018000020299A IT201800020299A IT201800020299A1 IT 201800020299 A1 IT201800020299 A1 IT 201800020299A1 IT 102018000020299 A IT102018000020299 A IT 102018000020299A IT 201800020299 A IT201800020299 A IT 201800020299A IT 201800020299 A1 IT201800020299 A1 IT 201800020299A1
Authority
IT
Italy
Prior art keywords
seq
sample
bcr
isolated
amplified
Prior art date
Application number
IT102018000020299A
Other languages
Italian (it)
Inventor
Simona Soverini
Luana Bavaro
Original Assignee
Univ Bologna Alma Mater Studiorum
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Univ Bologna Alma Mater Studiorum filed Critical Univ Bologna Alma Mater Studiorum
Priority to IT102018000020299A priority Critical patent/IT201800020299A1/en
Publication of IT201800020299A1 publication Critical patent/IT201800020299A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Description

OLIGONUCLEOTIDE ISOLATO, RELATIVO USO COME PRIMER PER PCR, METODO E KIT PER LO SCREENING MUTAZIONALE DEL DOMINIO TIROSIN-CHINASICO DI BCR-ABL ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL

DESCRIZIONE DELL’INVENZIONE DESCRIPTION OF THE INVENTION

L’invenzione è relativa ai mezzi ed ai metodi per lo screening mutazionale, in particolare del dominio tirosin-chinasico di BCR-ABL. The invention relates to the means and methods for mutational screening, in particular of the tyrosine kinase domain of BCR-ABL.

I pazienti con Leucemia Mieloide Cronica e Leucemia Linfoblastica Acuta Philadelphia positiva hanno un cromosoma 22 anomalo derivante dalla traslocazione t(9;22). Su questo cromosoma si crea un gene ibrido derivante dalla fusione di una regione del gene ABL1 sul cromosoma 9 con la regione del gene BCR sul cromosoma 22. Il punto di fusione può avvenire in punti diversi identificati dalle sigle e1a2, e13a2, e14a2. Patients with Chronic Myeloid Leukemia and Philadelphia positive Acute Lymphoblastic Leukemia have an abnormal chromosome 22 resulting from the t (9; 22) translocation. A hybrid gene is created on this chromosome resulting from the fusion of a region of the ABL1 gene on chromosome 9 with the region of the BCR gene on chromosome 22. The fusion point can occur at different points identified by the initials e1a2, e13a2, e14a2.

Il gene BCR-ABL1 codifica per una proteina anomala, ossia un enzima chiamato tirosin chinasi che risulta costitutivamente attiva e causa la proliferazione incontrollata delle cellule con il conseguente insorgere delle leucemie. Queste ultime vengono trattate con degli specifici farmaci, gli inibitori della tirosin chinasi (noti anche con la sigla “TKI”). Alcuni pazienti sviluppano una singola e specifica variazione, detta anche mutazione o anomalia genetica (ossia una variazione di almeno un nucleotide in un codone), nel dominio tirosin-chinasico di BCR-ABL1. La sequenza di nucleotidi di riferimento (d’ora in avanti indicata per brevità come “sequenza di riferimento”), rispetto alla quale individuare le variazioni è nota ed è stata riportata nel database NCBI Genbank, versione 228.0; con il seguente numero di accesso: X16416.1. The BCR-ABL1 gene encodes an abnormal protein, an enzyme called tyrosine kinase which is constitutively active and causes the uncontrolled proliferation of cells with the consequent onset of leukemia. The latter are treated with specific drugs, tyrosine kinase inhibitors (also known as "TKI"). Some patients develop a single, specific variation, also called a genetic mutation or abnormality (ie a variation of at least one nucleotide in a codon), in the tyrosine kinase domain of BCR-ABL1. The reference nucleotide sequence (hereinafter referred to for brevity as the "reference sequence"), with respect to which to identify the variations is known and has been reported in the NCBI Genbank database, version 228.0; with the following access number: X16416.1.

Alcune variazioni, rispetto a tale sequenza di riferimento, comportano una resistenza a uno o più degli inibitori della tirosin chinasi. Ciò può rendere la terapia farmacologica inefficace. A tal proposito, si veda la figura 1 che raffigura una tabella relativa alle possibili 105 variazioni note relative al dominio tirosin-chinasico BCR-ABL e l’inibitore/i della tirosin chinasi a cui la variazione è resistente e l’articolo di S. Soverini ed al. “Unraveling the complexity of tyrosine kinase inhibitor-resistant populations by ultra-deep sequencing of the BCR-ABL kinase domain” Blood. 2013 Agosto 29;122(9):1634-48. doi: 10.1182/blood-2013-03-487728. Epub 21 giugno 2013 e i correlati “Supplemental Methods”. Tale articolo descrive l’amplificazione del trascritto BCR‐ABL e del relativo dominio chinasi (KD), tramite reazione a catena della polimerasi, o “PCR”, utilizzando degli specifici primer (o inneschi) di cui: il “reverse primer” è l’oligonucleotide CTTGGAGTGAGGCATCTCAG (vedasi SEQ ID NO:9) e il “forward primer” è l’oligonucleotide CAACAGTCCTTCGACAGCAG (vedasi SEQ ID NO:11), nel caso di pazienti di cui è noto che il punto di fusione sia e1a2, o l’oligonucleotide GAGCAGCAGAAGAAGTGTTTCAGA (vedasi SEQ ID NO:10) nel caso di pazienti di cui è noto che il punto di fusione sia e13a2 o e14a2. Some variations from this reference sequence result in resistance to one or more of the tyrosine kinase inhibitors. This can make drug therapy ineffective. In this regard, see Figure 1 which depicts a table relating to the possible 105 known variations relating to the tyrosine kinase domain BCR-ABL and the tyrosine kinase inhibitor (s) to which the variation is resistant and the article by S. Soverini and al. "Unraveling the complexity of tyrosine kinase inhibitor-resistant populations by ultra-deep sequencing of the BCR-ABL kinase domain" Blood. 2013 Aug 29; 122 (9): 1634-48. doi: 10.1182 / blood-2013-03-487728. Epub June 21, 2013 and the related “Supplemental Methods”. This article describes the amplification of the BCR ‐ ABL transcript and its kinase domain (KD), by means of a polymerase chain reaction, or "PCR", using specific primers (or primers) of which: the "reverse primer" is the 'oligonucleotide CTTGGAGTGAGGCATCTCAG (see SEQ ID NO: 9) and the "forward primer" is the oligonucleotide CAACAGTCCTTCGACAGCAG (see SEQ ID NO: 11), in the case of patients whose melting point is known to be e1a2, or oligonucleotide GAGCAGCAGAAGAAGTGTTTCAGA (see SEQ ID NO: 10) in the case of patients whose melting point is known to be e13a2 or e14a2.

Ovviamente, nel caso di un paziente affetto da leucemia, poter conoscere precocemente che tipo di mutazione genetica è presente nel dominio tirosinchinasico di BCR-ABL sarebbe di notevole aiuto per prevenire la ricaduta clinica e suggerire una nuova terapia farmacologica efficace a cui sottoporlo. Alla diagnosi della malattia non si riesce a determinare la presenza di variazioni perché, anche se ce ne fossero, riguarderebbero talmente poche cellule mutate che le attuali metodiche di screening non sarebbero in grado di individuarle. Ciò, poiché manca la pressione selettiva esercitata dalla terapia con un inibitore della tirosin chinasi che seleziona il clone resistente a scapito dei cloni non mutati. Obviously, in the case of a patient suffering from leukemia, being able to know early on what type of genetic mutation is present in the tyrosine kinase domain of BCR-ABL would be of considerable help in preventing clinical relapse and suggesting a new effective drug therapy to undergo it. At the diagnosis of the disease it is not possible to determine the presence of variations because, even if there were any, they would involve so few mutated cells that current screening methods would not be able to identify them. This is because the selective pressure exerted by therapy with a tyrosine kinase inhibitor that selects the resistant clone at the expense of the unmutated clones is lacking.

Uno degli attuali metodi per lo screening mutazionale del dominio tirosinchinasico di BCR-ABL è in grado di rilevare le variazioni rispetto alla citata sequenza di riferimento ad una bassa sensibilità. Tale metodo, inoltre, non permette di interpretare correttamente la contemporanea presenza di più variazioni nello stesso clone o in cloni diversi. In alternativa, è possibile eseguire una serie di saggi specifici ad alta sensibilità, ognuno dei quali, però, è relativo ad una singola variazione. Poiché le variazioni sono 105 e i saggi specifici comportano relativi tempi, manodopera e costi di esecuzione elevati, lo screening di tutte le variazioni non è, di fatto, praticabile perché i relativi tempi e costi sono insostenibili. One of the current methods for mutational screening of the BCR-ABL tyrosine kinase domain is capable of detecting variations with respect to the aforementioned reference sequence at low sensitivity. Furthermore, this method does not allow to correctly interpret the simultaneous presence of multiple variations in the same clone or in different clones. Alternatively, it is possible to perform a series of specific high-sensitivity assays, each of which, however, relates to a single variation. Since there are 105 variations and specific assays involve relative time, labor and high execution costs, screening for all variations is not, in fact, feasible because the related time and costs are unsustainable.

Sono note delle tecniche di sequenziamento massivo parallelo del genoma dette anche “Next Generation Sequencing” o “NGS” che permettono di raggiungere un’elevata sensibilità per le sequenze di nucleotidi rientranti in un determinato intervallo di lunghezza. Una di esse è relativa all’amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore (o detector) a fluorescenza ed è attuabile utilizzando un apposito sequenziatore (ad. esempio la piattaforma per next-generation sequencing con amplificazione a ponte e sequenziamento per sintesi—Illumina MiSeq) e i relativi kit di reagenti (ad es. Kapa Biosystem for Illumina® Platform, ecc..). Il sequenziamento con amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza prevede l’utilizzo di un supporto solido a cui sono legate, ad una relativa estremità delle specifiche sequenze oligonucleotidiche fisse aventi la restante estremità libera e dei cosiddetti “adattatori” oligonucleotidici specifici che hanno una relativa estremità appaiabile a dette sequenze oligonucleotidiche fisse. Inoltre, il campione di DNA va preventivamente ed opportunamente preparato con una pluralità di reagenti. Infatti, i frammenti nucleotidici di DNA da sequenziare possono non avere solo le estremità terminanti con basi appaiate (“blunt ends”) ma anche le estremità con basi spaiate (“overhangs ends”). Pertanto, per ottenere solo frammenti con estremità aventi basi appaiate si aggiunge al campione un kit relativo alla modifica delle estremità del DNA, detta anche “END REPAIR e A-TAILING”, in cui i reagenti relativi all’END REPAIR convertono i frammenti con estremità a basi spaiate a frammenti di DNA con estremità a basi appaiate e 5′-fosforilate mentre i reagenti relativi all’A-TAILING consentono di adenilare l’estremità -3’ aggiungendo adenosina, in particolare una pluralità di adenosina. Pertanto, si sfruttano le attività polimerasi 5 '→ 3' e di esonucleasi 3 '→ 5' della polimerasi T4 DNA. Si ottiene quindi un campione di DNA avente le relative estremità modificate. Ad esso vanno aggiunti gli specifici adattatori oligonucleotidici che consentono di legare, per appaiamento dei nucleotidi, ogni estremità modificate del campione a una diversa specifica sequenze oligonucleotidiche fisse, legate a detto supporto solido, formando un ponte. Successivamente, si effettua la PCR, utilizzando i relativi reagenti, e infine si effettua il sequenziamento aggiungendo specifici primer, l’enzima DNA polimerasi e terminatori dideossi-nucleotidi reversibili marcati con fluorocromi. Ad ogni nucleotide aggiunto corrisponde una particolare emissione di fluorescenza. Il rilevatore del sequenziatore registra la fluorescenza emessa durante l’aggiunta di ogni singolo nucleotide, e un sistema di elaborazione dei dati fornisce la sequenza esatta dei nucleotidi sequenziati. Purtroppo, tale tecnica di sequenziamento non è attualmente idonea per il sequenziamento del dominio tirosin-chinasico di BCR-ABL perché la lunghezza di tale sequenza non rientra nel relativo intervallo di lunghezza sequenziabile essendo molto più lunga di quest’ ultimo. Massive parallel genome sequencing techniques also known as "Next Generation Sequencing" or "NGS" are known which allow to achieve high sensitivity for nucleotide sequences falling within a certain length range. One of them relates to bridging amplification, sequencing by synthesis and detection with fluorescence detector (or detector) and is feasible using a specific sequencer (for example the platform for next-generation sequencing with bridge amplification and sequencing by synthesis —Illumina MiSeq) and related reagent kits (eg Kapa Biosystem for Illumina® Platform, etc ..). Sequencing with bridged amplification, sequencing by synthesis and detection with a fluorescence detector involves the use of a solid support to which specific fixed oligonucleotide sequences with the remaining free end and so-called oligonucleotide "adapters" are linked at one end. which have a relative end that can be matched to said fixed oligonucleotide sequences. Furthermore, the DNA sample must be previously and suitably prepared with a plurality of reagents. In fact, the nucleotide fragments of DNA to be sequenced may have not only the ends terminating with paired bases (“blunt ends”) but also the ends with unpaired bases (“overhangs ends”). Therefore, to obtain only fragments with ends having paired bases, a kit related to the modification of DNA ends, also called "END REPAIR and A-TAILING", is added to the sample, in which the reagents relating to the END REPAIR convert the fragments with ends with unpaired bases to DNA fragments with paired and 5'-phosphorylated ends while the reagents related to A-TAILING allow to adenylate the -3 'end by adding adenosine, in particular a plurality of adenosine. Therefore, the 5 '→ 3' polymerase and 3 '→ 5' exonuclease activities of the T4 DNA polymerase are exploited. A DNA sample is then obtained having the relative ends modified. To it must be added the specific oligonucleotide adapters which allow to bind, by pairing of the nucleotides, each modified end of the sample to a different specific fixed oligonucleotide sequences, linked to said solid support, forming a bridge. Subsequently, PCR is carried out, using the relevant reagents, and finally sequencing is carried out by adding specific primers, the enzyme DNA polymerase and reversible didoxy-nucleotide terminators labeled with fluorochromes. Each added nucleotide corresponds to a particular fluorescence emission. The sequencer detector records the fluorescence emitted during the addition of each individual nucleotide, and a data processing system provides the exact sequence of the sequenced nucleotides. Unfortunately, this sequencing technique is currently not suitable for sequencing the tyrosine kinase domain of BCR-ABL because the length of this sequence does not fall within the relative sequenceable length range, being much longer than the latter.

Emerge pertanto la necessità di rilevare con un’elevata sensibilità, e con tempi e costi accessibili tutte le variazioni nel dominio tirosin-chinasico di BCR-ABL di un paziente affetto da leucemia, rispetto alla citata sequenza di riferimento, ed in special modo di ottenere l’assetto clonale della mutazione di detto dominio. Therefore, the need emerges to detect with high sensitivity, and with affordable times and costs, all the variations in the tyrosine-kinase domain of BCR-ABL of a patient suffering from leukemia, with respect to the aforementioned reference sequence, and in particular to obtain the clonal structure of the mutation of said domain.

Scopo della presente invenzione è di ovviare ai summenzionati svantaggi delle citate metodiche note per la rilevazione delle variazioni dominio tirosinchinasico di BCR-ABL rispetto a detta sequenza di riferimento. The object of the present invention is to obviate the aforementioned disadvantages of the aforementioned known methods for detecting the variations in the tyrosine kinase domain of BCR-ABL with respect to said reference sequence.

In particolare, l’obiettivo principale dell’invenzione consiste nel consentire il rilevamento tutte le variazioni nel dominio tirosin-chinasico di BCR-ABL di un paziente, rispetto alla citata sequenza di riferimento con relativi tempi e costi accessibili e con una relativa sensibilità elevata. In aggiunta, anche l’ottenimento dell’assetto clonale delle mutazioni di detto dominio rientra negli scopi dell’invenzione. In particular, the main objective of the invention is to allow the detection of all the variations in the tyrosine kinase domain of BCR-ABL of a patient, with respect to the aforementioned reference sequence with relative accessible times and costs and with a relative high sensitivity. In addition, obtaining the clonal structure of the mutations of this domain also falls within the scope of the invention.

Tali scopi ed obiettivi sono risolti tramite un oligonucleotide, il relativo uso come primer in PCR, un metodo per lo screening mutazionale del dominio tirosin-chinasico di BCR-ABL in accordo le rivendicazioni indipendenti e da un kit per lo screening mutazionale di tale dominio comprendente detto oligonucleotide. These aims and objectives are solved by means of an oligonucleotide, its use as a primer in PCR, a method for mutational screening of the tyrosine kinase domain of BCR-ABL according to the independent claims and by a kit for mutational screening of this domain comprising called oligonucleotide.

Infatti, ognuno degli oligonucleotidi in accordo con la rivendicazione 1 può essere utilizzato come primer in PCR per attuare il metodo per lo screening mutazionale del dominio tirosin-chinasico di BCR-ABL secondo l’invenzione. Tale metodo consente di amplificare tramite PCR un primo, un secondo, un terzo, ed un quarto amplicone di detto primo campione di cDNA relativo al dominio tirosin-chinasico di BCR-ABL di un paziente a cui è stata diagnosticata una leucemia. Tali ampliconi hanno dimensioni idonee ad essere sequenziate tramite un sequenziatore ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza che è ad elevata sensibilità. Questo, permette di ottenere una pluralità di sequenze di nucleoditi amplificate, sequenziate e rilevate con un’elevata sensibilità da confrontare automaticamente allineando ognuna di esse alla citata sequenza di riferimento avente numero di accesso: X16416.1, data base: NCBI Genbank, versione 228.0. Pertanto, è possibile rilevare contemporaneamente e con un’elevata sensibilità tutte le variazioni di nucleotidi o di codoni di nucleotidi, rispetto alla detta sequenza di riferimento con relativi tempi, utilizzo di manodopera e costi accessibili. Ciò consente di rilevare la resistenza e di individuare una terapia con un inibitore delle tirosinchinasi per il quale il campione di cDNA oggetto di screening non presenta mutazioni che gli conferiscano resistenza. In fact, each of the oligonucleotides in accordance with claim 1 can be used as a primer in PCR to implement the method for mutational screening of the tyrosine kinase domain of BCR-ABL according to the invention. This method allows to amplify by PCR a first, a second, a third, and a fourth amplicon of said first cDNA sample relating to the tyrosine kinase domain of BCR-ABL of a patient diagnosed with leukemia. Such amplicons have dimensions suitable for being sequenced by a bridged amplification sequencer, sequencing by synthesis and detection with a fluorescence detector which is highly sensitive. This allows to obtain a plurality of nucleodite sequences amplified, sequenced and detected with high sensitivity to be automatically compared by aligning each of them to the aforementioned reference sequence with access number: X16416.1, database: NCBI Genbank, version 228.0 . Therefore, it is possible to detect simultaneously and with a high sensitivity all the variations of nucleotides or nucleotide codons, with respect to the said reference sequence with relative times, use of labor and accessible costs. This allows resistance to be detected and a tyrosine kinase inhibitor therapy to be identified for which the cDNA sample being screened does not have mutations that confer resistance.

Inoltre, si noti che il metodo secondo l’invenzione può essere effettuato con sequenziatori ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza di tipo noto utilizzando, oltre agli oligonucleotidi in accordo con la rivendicazione 1, reagenti già disponibili sul mercato per PCR e per il sequenziamento con tale sequenziatore. Furthermore, it should be noted that the method according to the invention can be carried out with bridged amplification sequencers, sequencing by synthesis and detection with a known type of fluorescence detector using, in addition to the oligonucleotides according to claim 1, reagents already available on the market for PCR and for sequencing with this sequencer.

Le caratteristiche dell’invenzione saranno evidenziate nel seguito in cui vengono descritte alcune preferite, ma non esclusive, forme di realizzazione, con riferimento alle allegate tavole di disegno nelle quali la figura 1 è una tabella relativa alle possibili mutazioni note del gene BCR-ABL. The characteristics of the invention will be highlighted below in which some preferred, but not exclusive, embodiments are described, with reference to the attached drawing tables in which Figure 1 is a table relating to possible known mutations of the BCR-ABL gene.

Ogni nuovo oligonucleotide isolato scelto nel gruppo consistente nelle seguenti sequenze di acido nucleico: SEQ ID NO:1; SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; e SEQ ID NO:8 (ossia, rispettivamente: tctatggtgtgtcccccaac; gagggcgtgtggaagaaata; actacctgagggagtgcaacc; gcctggcctacaacaagttc; tctgagtggccatgtacagc; caagtggttctcccctacca; atactccaaatgcccagacg; e gaggtcctcgtcttggtgg) rientra nell’ambito dell’invenzione. Esso può essere utilizzato come primer per l’amplificazione tramite PCR di quattro ampliconi di detto campione di cDNA relativo al dominio tirosin-chinasico di BCR-ABL. Each new isolated oligonucleotide selected from the group consisting of the following nucleic acid sequences: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; and SEQ ID NO: 8 (that is, respectively: tctatggtgtgtcccccaac; gagggcgtgtggaagaaata; actacctgagggagtgcaacc; gcctggcctacaacaagttc; tctgagtggccatgtacagc; caagtggttctccttcctacca; atactracctaggtgcc; It can be used as a primer for the amplification by PCR of four amplicons of said cDNA sample related to the tyrosine kinase domain of BCR-ABL.

In particolare a coppie, gli oligonucleotidi isolati secondo l’invenzione costituiscono le seguenti coppie di primer per PCR per utilizzabili per l’amplificazione di un relativo amplicone di detto primo campione di cDNA: - Coppia di primer n.1: Primer 1 FWD (SEQ ID NO:1) e Primer 1 REV (SEQ ID NO:5); In particular in pairs, the oligonucleotides isolated according to the invention constitute the following pairs of primers for PCR to be used for the amplification of a relative amplicon of said first cDNA sample: - Pair of primers n.1: Primer 1 FWD (SEQ ID NO: 1) and Primer 1 REV (SEQ ID NO: 5);

- Coppia di primer n.2: Primer 2 FWD (SEQ ID NO:2); e Primer 2 FWD (SEQ ID NO:6); - Pair of primers n.2: Primer 2 FWD (SEQ ID NO: 2); and Primer 2 FWD (SEQ ID NO: 6);

- Coppia di primer n.3: Primer 3 FWD (SEQ ID NO:3); e Primer 3 FWD (SEQ ID NO:7); - Pair of primers n.3: Primer 3 FWD (SEQ ID NO: 3); and Primer 3 FWD (SEQ ID NO: 7);

- Coppia di primer n.4: Primer 4 FWD (SEQ ID NO:4); e Primer 2 FWD (SEQ ID NO:8). - Pair of primers n.4: Primer 4 FWD (SEQ ID NO: 4); and Primer 2 FWD (SEQ ID NO: 8).

Il metodo per lo screening mutazionale del dominio tirosin-chinasico di BCR-ABL secondo l’invenzione comprende le seguenti fasi: The method for mutational screening of the tyrosine kinase domain of BCR-ABL according to the invention includes the following steps:

- predisporre un primo campione di cDNA, che è purificato, amplificato e ottenibile tramite retrotrascrizione di mRNA, relativo al gene BCR-ABL di un paziente, e successiva amplificazione e purificazione; - prepare a first sample of cDNA, which is purified, amplified and obtainable by reverse transcription of mRNA, relative to the BCR-ABL gene of a patient, and subsequent amplification and purification;

- suddividere il primo campione di cDNA purificato in una prima, una seconda, una terza ed una quarta relativa aliquota; aggiungere alla prima aliquota gli oligonucleotidi isolati SEQ ID NO:1 e SEQ ID NO:5 ottenendo una prima miscela; aggiungere alla seconda aliquota gli oligonucleotidi isolati SEQ ID NO:2; e SEQ ID NO:6 ottenendo una seconda miscela; aggiungere alla terza aliquota gli oligonucleotidi isolati SEQ ID NO:3; e SEQ ID NO:7 ottenendo una terza miscela; ed aggiungere alla quarta aliquota gli oligonucleotidi isolati SEQ ID NO:4; e SEQ ID NO:8 ottenendo una quarta miscela; - dividing the first sample of purified cDNA into a first, second, third and fourth relative aliquot; add to the first aliquot the isolated oligonucleotides SEQ ID NO: 1 and SEQ ID NO: 5 obtaining a first mixture; add to the second aliquot the isolated oligonucleotides SEQ ID NO: 2; and SEQ ID NO: 6 obtaining a second blend; add the isolated oligonucleotides SEQ ID NO: 3 to the third aliquot; and SEQ ID NO: 7 obtaining a third blend; and add to the fourth aliquot the isolated oligonucleotides SEQ ID NO: 4; and SEQ ID NO: 8 obtaining a fourth blend;

- amplificare tramite PCR, separatamente, la prima, la seconda, la terza e la quarta miscela per ottenere, rispettivamente, un primo, un secondo, un terzo e un quarto campione amplificato comprendente, rispettivamente, un primo, un secondo, un terzo, ed un quarto amplicone di detto primo campione di cDNA; - amplify by PCR, separately, the first, second, third and fourth mix to obtain, respectively, a first, second, third and fourth amplified sample comprising, respectively, a first, a second, a third, and a fourth amplicon of said first cDNA sample;

- purificare detti primo, secondo, terzo e quarto campione amplificato ottenendo un primo, un secondo, un terzo e un quarto campione amplificato e purificato; - purifying said first, second, third and fourth amplified sample obtaining a first, second, third and fourth amplified and purified sample;

- determinare la concentrazione del primo, del secondo, del terzo, e del quarto amplicone nei rispettivi primo, secondo, terzo, e quarto campione amplificato e purificato; - determine the concentration of the first, second, third, and fourth amplicons in the respective first, second, third, and fourth amplified and purified samples;

- normalizzare il primo, il secondo, il terzo, e il quarto campione amplificato e purificato per ottenere un relativo campione normalizzato comprendente il primo, il secondo, il terzo, e il quarto amplicone alla stessa concentrazione; - effettuare un sequenziamento di detto campione normalizzato con un sequenziatore, che è: ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza, ottenendo una pluralità di sequenze di nucleoditi amplificate, sequenziate e rilevate. - normalize the first, second, third, and fourth amplicon samples to obtain a relative normalized sample comprising the first, second, third, and fourth amplicon at the same concentration; - carry out a sequencing of said normalized sample with a sequencer, which is: bridged amplification, sequencing by synthesis and detection with a fluorescence detector, obtaining a plurality of amplified, sequenced and detected nucleodite sequences.

- confrontare automaticamente ogni sequenza di detta pluralità di sequenze amplificate, sequenziate e rilevate allineandola ad una sequenza di riferimento avente numero di accesso: X16416.1, data base: NCBI Genbank, versione 228.0; indicandone ogni variazione di nucleotidi o di codoni di nucleotidi, rispetto a detta sequenza di riferimento e il numero di volte in cui tale variazione è stata individuata. - automatically comparing each sequence of said plurality of amplified, sequenced and detected sequences, aligning it with a reference sequence having access number: X16416.1, database: NCBI Genbank, version 228.0; indicating any variation of nucleotides or nucleotide codons, with respect to said reference sequence and the number of times such variation has been identified.

Come precedentemente riportato tale metodo consente di individuare contemporaneamente tutte le mutazioni presenti nel dominio tirosin-chinasico di BCR-ABL di un paziente a cui è stata diagnosticata la leucemia durante le fasi iniziali dell’insorgere della malattia in virtù dell’elevata sensibilità correlata al sequenziamento utilizzato. As previously reported, this method allows to simultaneously identify all the mutations present in the tyrosine kinase domain of BCR-ABL of a patient diagnosed with leukemia during the initial stages of the onset of the disease by virtue of the high sensitivity related to sequencing. used.

La tabella di figura 1 riporta, per ogni possibile variazione nota del gene BCR-ABL: gli input del programma software con il quale è stata effettuata la fase di confronto automatico del metodo secondo l’invenzione nell’esempio riportato di seguito nella sezione dati sperimentali; il numero della coppia di primer (vedere elenco precedentemente riportato) utilizzabile per amplificare tramite PCR una porzione del dominio tirosin-chinasico in cui si potrebbe avere la variazione; l’eventuale relativo inibitore delle tirosin-chinasi o TKI a cui la variazione conferisce resistenza; il relativo transcritto (codificante proteina); la relativa coordinata relativa al gDNA, al cDNA ed alla proteina; la relativa regione (indicando in quale esone si trova il cds); il codone di riferimento nella sequenza di riferimento; ed il/i codone/i da ricercare nella relativa sequenza rilevata da confrontare. Tutti i dati riportati nella tabella sono relativi al gene ABL e al filamento . Si noti che nella colonna TKI “I” indica Imatinib, “N” indica Nilotinib, “D” indica Dasatinib, “B” indica Bosutinib e “P” indica Ponatinib. The table in figure 1 shows, for each possible known variation of the BCR-ABL gene: the inputs of the software program with which the automatic comparison step of the method according to the invention was carried out in the example shown below in the experimental data section ; the number of the primer pair (see list previously reported) that can be used to amplify by PCR a portion of the tyrosine kinase domain in which the variation could occur; any related inhibitor of tyrosine kinases or TKI to which the variation confers resistance; the relative transcript (protein coding); the relative coordinate relative to the gDNA, the cDNA and the protein; the relative region (indicating in which exon the CDS is located); the reference codon in the reference sequence; and the codon (s) to be searched in the relative detected sequence to be compared. All the data shown in the table relate to the ABL gene and the strand. Note that in the TKI column "I" indicates Imatinib, "N" indicates Nilotinib, "D" indicates Dasatinib, "B" indicates Bosutinib and "P" indicates Ponatinib.

Risulta particolarmente preferito un kit per lo screening mutazionale del dominio tirosin-chinasico di BCR-ABL che comprende almeno un oligonucleotide isolato in accordo con l’invenzione. Vantaggiosamente esso comprendente almeno una coppia di oligonucleotidi isolati in accordo con l’invenzione in cui detta coppia è scelta nel gruppo consistente nelle seguenti coppie oligonucleotidi isolati: SEQ ID NO:1 e SEQ ID NO:5; SEQ ID NO:2 e SEQ ID NO:6 SEQ ID NO:3 e SEQ ID NO:7; e SEQ ID NO:; e SEQ ID NO:8. Ovviamente è preferibile che il kit proposto, comprenda tutti i seguenti oligonucleotidi isolati: SEQ ID NO:1; SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; e SEQ ID NO:8. In tal modo, si facilita l’acquisto dei reagenti da utilizzare per attuare il metodo secondo l’invenzione. A kit for mutational screening of the tyrosine kinase domain of BCR-ABL which comprises at least one isolated oligonucleotide in accordance with the invention is particularly preferred. Advantageously, it comprises at least one pair of isolated oligonucleotides in accordance with the invention in which said pair is selected from the group consisting of the following isolated oligonucleotide pairs: SEQ ID NO: 1 and SEQ ID NO: 5; SEQ ID NO: 2 and SEQ ID NO: 6 SEQ ID NO: 3 and SEQ ID NO: 7; and SEQ ID NO :; and SEQ ID NO: 8. Obviously it is preferable that the proposed kit includes all the following isolated oligonucleotides: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; and SEQ ID NO: 8. In this way, the purchase of reagents to be used to implement the method according to the invention is facilitated.

Sempre a tal fine, il kit secondo l’invenzione può comprendere anche dei reagenti relativi all’END REPAIR e A-TALING, ossia alla modifica delle estremità dei frammenti di DNA per renderli appaiabili a detti specifici adattatori oligonucleotidici previsti per effettuare il sequenziamento con detto sequenziatore ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza. Secondo una forma di realizzazione preferita, tale kit comprende anche detti specifici adattatori oligonucleotidici. Again for this purpose, the kit according to the invention can also comprise reagents relating to END REPAIR and A-TALING, that is to modify the ends of the DNA fragments to make them compatible with said specific oligonucleotide adapters provided for sequencing with said bridged amplification sequencer, sequencing by synthesis and detection with fluorescence detector. According to a preferred embodiment, this kit also comprises said specific oligonucleotide adapters.

Detto un primo campione di cDNA che deve essere predisposto in accordo con il metodo secondo l’invenzione è ottenibile, ad esempio, in accordo con quanto descritto in S. Soverini ed al. “Unraveling the complexity of tyrosine kinase inhibitor-resistant populations by ultra-deep sequencing of the BCR-ABL kinase domain” Blood. 2013 Agosto 29;122(9):1634-48. doi: 10.1182/blood-2013-03-487728. Epub 21 giugno 2013 e nei correlati “Supplemental Methods”. Said a first sample of cDNA that must be prepared in accordance with the method according to the invention can be obtained, for example, in accordance with what is described in S. Soverini et al. "Unraveling the complexity of tyrosine kinase inhibitor-resistant populations by ultra-deep sequencing of the BCR-ABL kinase domain" Blood. 2013 Aug 29; 122 (9): 1634-48. doi: 10.1182 / blood-2013-03-487728. Epub June 21, 2013 and in the related "Supplemental Methods".

Pertanto, qualora sia disponibile solo un campione di mRNA cellulare del paziente ottenuto da sangue midollare o periferico, la fase di predisposizione del primo campione di cDNA può vantaggiosamente comprendere le seguenti fasi di: retrotrascrivere l’mRNA cellulare del paziente ottenendo un corrispondente cDNA; aggiungere a quest’ ultimo l’oligonucleotide isolato SEQ ID NO:9 e l’oligonucleotide isolato SEQ ID NO:11, se il punto di fusione delle sequenze dei geni BCR e ABL sul cDNA del paziente è e1a2, e l’oligonucleotide isolato SEQ ID NO:10, se detto punto di fusione delle sequenze dei geni BCR e ABL è e13a2 o e14a2; e amplificare tramite PCR. Ovviamente in tal caso, è preferibile prevedere una fase di purificazione di detto primo campione di cDNA. Therefore, if only a patient's cellular mRNA sample obtained from bone marrow or peripheral blood is available, the stage of preparation of the first cDNA sample can advantageously include the following steps: retrotranscribing the patient's cellular mRNA obtaining a corresponding cDNA; add to the latter the isolated oligonucleotide SEQ ID NO: 9 and the isolated oligonucleotide SEQ ID NO: 11, if the melting point of the sequences of the BCR and ABL genes on the patient's cDNA is e1a2, and the isolated oligonucleotide SEQ ID NO: 10, if said melting point of the BCR and ABL gene sequences is e13a2 or e14a2; and amplify by PCR. Obviously in this case, it is preferable to provide a purification step of said first cDNA sample.

Il tal caso, è preferibile che il kit in accordo con l’invenzione comprenda ulteriormente i seguenti oligonucleotidi isolati SEQ ID NO:9; SEQ ID NO:10; e/o SEQ ID NO: 11 ossia, rispettivamente: cttggagtgaggcatctcag; gagcagcagaagaagtgtttcaga e caacagtccttcgacagcag. Preferibilmente il kit comprende sia l’oligonucleotide SEQ ID NO:10 che l’oligonucleotide SEQ ID NO: 11. In this case, it is preferable that the kit in accordance with the invention further comprises the following isolated oligonucleotides SEQ ID NO: 9; SEQ ID NO: 10; and / or SEQ ID NO: 11 or, respectively: cttggagtgaggcatctcag; gagcagcagaagaagtgtttcaga and caacagtccttcgacagcag. Preferably, the kit includes both the oligonucleotide SEQ ID NO: 10 and the oligonucleotide SEQ ID NO: 11.

La fase di sequenziamento, prevede di utilizzare per ogni campione normalizzato dei reagenti oligonucleotidici, aventi relative specifiche sequenze nucleotidiche, per accoppiare gli ampliconi di detto campione normalizzato ad un supporto solido del sequenziatore, tali reagenti oligonucleotidici hanno la funzione di specifici adattatori oligonucleotidici citati in riferimento all’arte nota relativa ai reagenti per il sequenziamento con sequenziatore ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza. Ciò poiché hanno una relativa estremità appaiabile ad una delle citate sequenze oligonucleotidiche fisse presenti sul supporto solido di tale sequenziatore. The sequencing step involves using oligonucleotide reagents for each normalized sample, having relative specific nucleotide sequences, to couple the amplicons of said normalized sample to a solid support of the sequencer, these oligonucleotide reagents have the function of specific oligonucleotide adapters mentioned in reference to the known art relating to reagents for sequencing with a bridged amplification sequencer, sequencing by synthesis and detection with a fluorescence detector. This is because they have a relative end that can be coupled to one of the aforementioned fixed oligonucleotide sequences present on the solid support of this sequencer.

Vantaggiosamente la fase di sequenziamento è effettuata contemporaneamente su una pluralità di campioni normalizzati relativa ad una corrispondente pluralità di pazienti diversi utilizzando per ogni campione normalizzato di detta pluralità di campioni normalizzati un differente gruppo di reagenti oligonucleotidici aventi relative specifiche sequenze nucleotidiche, per accoppiare gli ampliconi di detto campione normalizzato ad un supporto solido del sequenziatore, ed in cui la fase di confronto di ogni sequenza di detta pluralità di sequenze amplificate, sequenziate e rilevate comprende una fase di individuazione del relativo paziente in base alle specifiche sequenze nucleotidiche del gruppo di reagenti utilizzato per accoppiare i relativi ampliconi a detto supporto solido. Advantageously, the sequencing step is carried out simultaneously on a plurality of normalized samples relating to a corresponding plurality of different patients using for each normalized sample of said plurality of normalized samples a different group of oligonucleotide reagents having relative specific nucleotide sequences, to couple the amplicons of said sample normalized to a solid support of the sequencer, and in which the step of comparing each sequence of said plurality of amplified, sequenced and detected sequences comprises a step of identifying the relative patient on the basis of the specific nucleotide sequences of the group of reagents used for couple the relative amplicons to said solid support.

Preferibilmente, dopo aver fatto reagire il campione normalizzato con detti reagenti oligonucleotidici, può essere prevista la purificazione dei prodotti di reazione ottenuti tramite l’utilizzo di biglie paramagnetiche. Preferably, after having made the normalized sample react with said oligonucleotide reagents, the purification of the reaction products obtained through the use of paramagnetic beads can be envisaged.

Possono essere sviluppati vari programmi per elaboratore elettronico comprendenti istruzioni atte ad attuare la fase di confronto del metodo secondo l’invenzione basandosi sul le informazioni presenti nella tabella 1 di figura 1. Pertanto sono preferiti i kit secondo l’invenzione che comprendono un supporto informatico su cui è memorizzato un programma per elaboratore elettronico comprendenti istruzioni atte ad attuare la fase di confronto del metodo secondo l’invenzione o mezzi per consentire di scaricare, tramite internet, detto programma per elaboratore elettronico. Various computer programs can be developed including instructions suitable for carrying out the comparison step of the method according to the invention based on the information present in table 1 of figure 1. Therefore, the kits according to the invention are preferred which include a computer support on in which an electronic computer program is memorized comprising instructions suitable for carrying out the comparison step of the method according to the invention or means for allowing said computer program to be downloaded via the internet.

Preferibilmente nel metodo secondo l’invenzione, la fase di amplificazione separata, tramite PCR, della prima, seconda, terza e quarta miscela può prevedere l’utilizza una DNA polimerasi ad alta fedeltà (detta anche “HiFi”), ossia di una DNA polimerasi il cui tasso di errore è di approssimativamente 100 volte minore di quello di una DNA polimerasi Taq più comune in natura. È preferibile utilizzare per tale fase la “master mix” compresa nel kit commerciale denominato: KAPA HiFi HotStart ReadyMix PCR Kit (prodotto da Kapa Biosystem) che comprende detta una DNA polimerasi Taq ad alta fedeltà (DNA Polymerase Taq (0,5 U per 25 μL di reazione) in tampone di reazione contenente e deossinucleoside trifosfati, o “dNTPs” (0,3 mM di ogni deossinucleoside trifosfati a 1X), MgCl2 (2.5 mM a 1X) e stabilizzanti). Preferably in the method according to the invention, the separate amplification step, by means of PCR, of the first, second, third and fourth mixture can foresee the use of a high fidelity DNA polymerase (also called "HiFi"), that is a DNA polymerase whose error rate is approximately 100 times lower than that of a more common naturally occurring Taq DNA polymerase. It is preferable to use for this phase the "master mix" included in the commercial kit called: KAPA HiFi HotStart ReadyMix PCR Kit (produced by Kapa Biosystem) which includes said high fidelity Taq DNA polymerase (DNA Polymerase Taq (0.5 U for 25 μL of reaction) in reaction buffer containing and deoxynucleoside triphosphates, or “dNTPs” (0.3 mM of each deoxynucleoside triphosphates at 1X), MgCl2 (2.5 mM at 1X) and stabilizers).

Preferibilmente, nel kit in accordo con l’invenzione, ognuno degli oligonucleotidi isolati è in soluzione in una relativa soluzione ed ha una relativa concentrazione di 90-110 µM. Vantaggiosamente ognuna di dette relative concentrazioni è di 100 µM. Prima dell’utilizzo nella fase di amplificazione separata tramite PCR della prima, seconda, terza e quarta miscela ognuna di dette soluzioni può essere diluita fino ad una concentrazione di 5-30 µM, preferibilmente 8-20 µM, più preferibilmente a circa 10 µM. Il volume di tali soluzioni diluite da utilizzare può variare da 0,9 a 1,5 µl e preferibilmente, in special modo quando la concentrazione è di circa 10 µM, si possono utilizzare 1,5 µl e, ad esempio 12,5 - 25 µl (preferibilmente 17,5 µl di detta “master mix”, per ottenere un volume finale di reazione di 30-50 µl, preferibilmente di 35 µl. Il volume da sottoporre ad amplificazione ottenuto con la DNA polimerasi Taq ad alta fedeltà può essere da 1,2 a 2 µl, preferibilmente di 1,4 µl. Preferably, in the kit according to the invention, each of the isolated oligonucleotides is in solution in a relative solution and has a relative concentration of 90-110 µM. Advantageously, each of said relative concentrations is 100 µM. Before use in the separate amplification phase by PCR of the first, second, third and fourth mixture, each of these solutions can be diluted up to a concentration of 5-30 µM, preferably 8-20 µM, more preferably at about 10 µM. The volume of these diluted solutions to be used can vary from 0.9 to 1.5 µl and preferably, especially when the concentration is about 10 µM, 1.5 µl can be used and, for example 12.5 - 25 µl (preferably 17.5 µl of said "master mix", to obtain a final reaction volume of 30-50 µl, preferably 35 µl. The volume to be amplified obtained with the high fidelity Taq DNA polymerase can be from 1.2 to 2 µl, preferably 1.4 µl.

Di seguito s’indica un possibile profilo termico a cui effettuare la fase di amplificazione tramite PCR in cui fra parentesi sono indicati i valori particolarmente preferiti da utilizzare: Below is a possible thermal profile to carry out the amplification phase by PCR in which the particularly preferred values to be used are indicated in brackets:

- stadio iniziale, temperatura 94-96°C (95 °C) per 2-4 minuti (3 minuti)- 1 ciclo; - initial stage, temperature 94-96 ° C (95 ° C) for 2-4 minutes (3 minutes) - 1 cycle;

- stadio di denaturazione: temperatura 97-99 °C (98 °C) per 18-22 secondi (20 secondi), 30-40 cicli (35 cicli); - denaturation stage: temperature 97-99 ° C (98 ° C) for 18-22 seconds (20 seconds), 30-40 cycles (35 cycles);

- stadio di annealing: temperatura 60-75 °C (60-64 °C, più preferibilmente 62 °C) per 13-17 secondi (15 secondi) 30-40 cicli (35 cicli); - annealing stage: temperature 60-75 ° C (60-64 ° C, more preferably 62 ° C) for 13-17 seconds (15 seconds) 30-40 cycles (35 cycles);

- stadio di estensione; temperatura 70-74 °C (72 °C) per 14-16 secondi (15 secondi)- 1 ciclo; - extension stage; temperature 70-74 ° C (72 ° C) for 14-16 seconds (15 seconds) - 1 cycle;

- stadio di estensione finale; temperatura 70-74 °C (72 °C) per 57-63 secondi (60 secondi)-1 ciclo. - final extension stage; temperature 70-74 ° C (72 ° C) for 57-63 seconds (60 seconds) -1 cycle.

Relativamente al metodo secondo l’invenzione, risulta preferibile che, prima della prevista fase di purificazione di detti primo, secondo, terzo e quarto campione amplificato, si effettui un fase di controllo della qualità di tali campione amplificato, ad esempio tramite elettroforesi su gel di agarosio (preferibilmente al 2%) per verificare se la lunghezza dei relativi ampliconi rientra nell’intervallo 300-400 pb e se sono assenti dimeri, in particolare i dimeri degli oligonucleotidi isolati SEQ ID NO:9; SEQ ID NO:10; e/o SEQ ID NO: 11. With regard to the method according to the invention, it is preferable that, before the planned purification step of said first, second, third and fourth amplified sample, a quality control step is carried out on said amplified sample, for example by electrophoresis on gel agarose (preferably at 2%) to check if the length of the related amplicons falls within the range of 300-400 bp and if dimers are absent, in particular the dimers of the isolated oligonucleotides SEQ ID NO: 9; SEQ ID NO: 10; and / or SEQ ID NO: 11.

La fase del metodo secondo l’invenzione di purificazione di detti primo, secondo, terzo e quarto campione amplificato preferibilmente comprende l’utilizzo di biglie paramagnetiche, ad esempio possono essere utilizzate quelle denominate “Agencourt AMPure XP, 60 mL” prodotte da Beckman Coulter o “KAPA Pure Beads” prodotte da Kapa Biosystems. Vantaggiosamente queste ultime possono essere utilizzate in un rapporto volumetrico, rispetto al volume del campione da purificare, di 0,9-2,2, preferibilmente pari a circa 1,6. The step of the method according to the invention of purification of said first, second, third and fourth amplified sample preferably comprises the use of paramagnetic beads, for example those called "Agencourt AMPure XP, 60 mL" produced by Beckman Coulter or “KAPA Pure Beads” produced by Kapa Biosystems. Advantageously, the latter can be used in a volumetric ratio, with respect to the volume of the sample to be purified, of 0.9-2.2, preferably equal to about 1.6.

Nella fase del metodo secondo l’invenzione di determinazione della concentrazione del primo, del secondo, del terzo, e del quarto amplicone nei rispettivi primo, secondo, terzo, e quarto campione amplificato e purificato è possibile utilizzare un kit di reagenti commerciale denominato Quant-It PicoGreen dsDNA Assay Kit (prodotto dalla Thermo Fisher) che comprende il reagente Quant-iT™ PicoGreen® dsDNA che è un reagente ultra sensibile fluorescente in grado di marcare colorando l’acido nucleico ed è utilizzabile per la quantificazione del DNA a doppio filamento (dsDNA) in soluzione. Risulta preferibile effettuare detta determinazione della concentrazione in duplicato su ogni campione da quantificare e per la curva standard. A commercial reagent kit called Quant- It PicoGreen dsDNA Assay Kit (manufactured by Thermo Fisher) which includes the Quant-iT ™ PicoGreen® dsDNA reagent which is an ultra sensitive fluorescent reagent capable of staining by staining nucleic acid and is usable for the quantification of double stranded DNA ( dsDNA) in solution. It is preferable to carry out this determination of the concentration in duplicate on each sample to be quantified and for the standard curve.

La fase di sequenziamento di detto campione normalizzato può vantaggiosamente prevedere, analogamente a quanto riportato in precedenza, una fase di modifica delle estremità dei frammenti nucleotidici di DNA da sequenziare. A tal proposito può essere previsto l’utilizzo di kit commerciali quali ad esempio quello denominato “KAPA HYPER PREP KIT”, prodotto dalla Kapa Biosystem, che comprende “End-Repair & A-Tailing Buffer” e ”End-Repair & A-Tailing Enzyme Mix”. Preferibilmente il profilo termico di detta fase modifica delle estremità coincide con quello riportato nei seguenti dati sperimentali. The step of sequencing said normalized sample can advantageously provide, similarly to what has been previously reported, a step of modification of the ends of the nucleotide fragments of DNA to be sequenced. In this regard, the use of commercial kits such as the one called "KAPA HYPER PREP KIT", produced by Kapa Biosystem, which includes "End-Repair & A-Tailing Buffer" and "End-Repair & A-Tailing Enzyme Mix ". Preferably the thermal profile of said phase modification of the ends coincides with that reported in the following experimental data.

Vantaggiosamente la fase di sequenziamento può prevedere l’aggiunta al campione normalizzato di un cosiddetto “spike-in”, ossia una sequenza nucleotidica nota, ad esempio si può utilizzare uno spike-in commerciale come quello del PhiX Sequencing Control V3 (prodotto da Illumina) in una relativa percentuale compresa fra 5 e 30 % (preferibilmente al 10%). Advantageously, the sequencing step can provide for the addition to the normalized sample of a so-called "spike-in", that is a known nucleotide sequence, for example, a commercial spike-in such as that of the PhiX Sequencing Control V3 (produced by Illumina) can be used in a relative percentage comprised between 5 and 30% (preferably 10%).

Inoltre, detta fase di sequenziamento può prevedere l’utilizzo del sequenziatore denominato “PIATTAFORMA MISEQ” (prodotto da ILLUMINA) e/o di kit commerciali comprendenti i summenzionati specifici adattatori oligonucleotidici per sequenziamento con sequenziatore ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza. Ad esempio, è possibile utilizzare il kit commerciale denominato “KAPA Single-Indexed Adapter Kit”, prodotto dalla Kapa Biosystem per piattaforme Ilumina<®>. Inoltre può essere prevista una fase di purificazione del prodotto di reazione del campione normalizzato e detti i summenzionati specifici adattatori oligonucleotidici, ossia detti reagenti oligonucleotidici. In addition, said sequencing phase may involve the use of the sequencer called "MISEQ PLATFORM" (produced by ILLUMINA) and / or commercial kits including the aforementioned specific oligonucleotide adapters for sequencing with a bridged amplification sequencer, sequencing by synthesis and detection with fluorescence detector. For example, you can use the commercial kit called “KAPA Single-Indexed Adapter Kit”, produced by Kapa Biosystem for Ilumina <®> platforms. Furthermore, a purification step of the reaction product of the normalized sample and the aforementioned specific oligonucleotide adapters, ie said oligonucleotide reagents, can be provided.

A titolo puramente esemplificativo, si riporta un esempio di un protocollo utilizzato per l’attuazione del metodo secondo l’invenzione utilizzando una PIATTAFORMA MISEQ, prodotta da ILLUMINA, con riferimento alle relative fasi del metodo. By way of example, an example of a protocol used for the implementation of the method according to the invention is shown using a MISEQ PLATFORM, produced by ILLUMINA, with reference to the relevant phases of the method.

Fase di predisposizione del primo campione Preparation phase of the first sample

Campione: campione di cDNA purificato, amplificato ed ottenuto tramite retrotrascrizione di mRNA, relativo al gene BCR-ABL ottenuto da sangue midollare di un paziente a cui è stata diagnosticata una leucemia, e successiva amplificazione e purificazione, in cui detto mRNA, è stato ottenuto da sangue midollare di un paziente a cui è stata diagnosticata una leucemia. Sample: sample of purified cDNA, amplified and obtained by mRNA reverse transcription, related to the BCR-ABL gene obtained from bone marrow blood of a patient diagnosed with leukemia, and subsequent amplification and purification, in which said mRNA was obtained from bone marrow blood of a patient diagnosed with leukemia.

- Fase di suddivisione del primo campione di cDNA e fase di amplificazione tramite PCR, delle prima, seconda, terza e quarta miscela - Subdivision phase of the first cDNA sample and amplification phase by PCR, of the first, second, third and fourth mixes

1.GENERAZIONE DELLA LIBRERIA DI AMPLICONI 1. GENERATION OF THE AMPLICONI LIBRARY

Amplificazione mediante PCR in piastra (da 96 pozzetti) utilizzando la master mix KAPA HiFi HotStart ReadyMix PCR Kit (prodotta da Kapa Biosystem). Amplification by plate PCR (96 wells) using the KAPA HiFi HotStart ReadyMix PCR Kit master mix (manufactured by Kapa Biosystem).

• Utilizzare le seguenti coppie di primers per ciascun amplicone (concentrazione del primer nella soluzione da utilizzare = 10 µM): • Use the following pairs of primers for each amplicon (concentration of the primer in the solution to be used = 10 µM):

- Coppia di primer n.1: Primer 1 FWD (SEQ ID NO:1) e Primer 1 REV (SEQ ID NO:5); - Pair of primers n.1: Primer 1 FWD (SEQ ID NO: 1) and Primer 1 REV (SEQ ID NO: 5);

- Coppia di primer n.2: Primer 2 FWD (SEQ ID NO:2); e Primer 2 FWD (SEQ ID NO:6); - Pair of primers n.2: Primer 2 FWD (SEQ ID NO: 2); and Primer 2 FWD (SEQ ID NO: 6);

- Coppia di primer n.3: Primer 3 FWD (SEQ ID NO:3); e Primer 3 FWD (SEQ ID NO:7); - Pair of primers n.3: Primer 3 FWD (SEQ ID NO: 3); and Primer 3 FWD (SEQ ID NO: 7);

- Coppia di primer n.4: Primer 4 FWD (SEQ ID NO:4); e Primer 2 FWD (SEQ ID NO:8). - Pair of primers n.4: Primer 4 FWD (SEQ ID NO: 4); and Primer 2 FWD (SEQ ID NO: 8).

Volumi da utilizzare: Volumes to be used:

Volume finale di reazione: 35 µl Final reaction volume: 35 µl

Volume Master Mix: 17,5 µl Master Mix Volume: 17.5 µl

Volume primers: 1,5 µl Primers volume: 1.5 µl

Volume I STEP (Cdna) di amplificazione (ottenuto con Taq HiFi): 1,4 µl ● Impostare il seguente profilo termico: Volume I STEP (Cdna) of amplification (obtained with Taq HiFi): 1.4 µl ● Set the following thermal profile:

2. ELETTROFORESI SU GEL DI AGAROSIO 2. ELECTROPHORESIS ON AGAROSE GEL

Controllo qualità dei prodotti di PCR (ampliconi di lunghezza di 300-400pb) e controllo dell’assenza dei dimeri di primers usando l’agarosio al 2% Quality control of PCR products (amplicons with a length of 300-400pb) and control of the absence of primers dimers using 2% agarose

- Fase di purificazione di detti primo, secondo, terzo e quarto campione amplificato - Purification phase of said first, second, third and fourth amplified sample

3. PURIFICAZIONE DELLA LIBRERIA (BEAD-BASED PURIFICATION) 3. PURIFICATION OF THE LIBRARY (BEAD-BASED PURIFICATION)

1. Preparare l’EtOH al 70% (diluizione con Molecular Biology Grade Water) 2. Centrifugare brevemente la piastra con i prodotti di PCR 1. Prepare 70% EtOH (dilution with Molecular Biology Grade Water) 2. Briefly centrifuge the plate with the PCR products

3. Portare la sospensione di biglie paramagnetiche (“Agencourt AMPure XP, 60mL“ prodotto da Beckman Coulter o “KAPA Pure Beads” prodotto da Kapa Biosystems) a temperatura ambiente per circa 20-30 minuti e successivamente vortexarle per 20 secondi finchè le biglie paramagnetiche non sono completamente risospese. 3. Bring the suspension of paramagnetic beads ("Agencourt AMPure XP, 60mL" produced by Beckman Coulter or "KAPA Pure Beads" produced by Kapa Biosystems) at room temperature for about 20-30 minutes and then vortex them for 20 seconds until the paramagnetic beads they are not fully resuspended.

4. Utilizzare una piastra da 96 pozzetti per PCR per la purificazione 4. Use a 96-well PCR plate for purification

5. Aggiungere 22,5 µl di EB prodotto da Qiagen (ossia, 10 mM Tris-Cl, pH 8.5, ovvero tris(idrossimetil)amminometano cloroidrato) nei pozzetti nuovi di una piastra 5. Add 22.5 µl of EB produced by Qiagen (i.e. 10 mM Tris-Cl, pH 8.5, i.e. tris (hydroxymethyl) aminomethane hydrochloride) to the new wells of a plate

6. Trasferire 22,5 µl dai pozzetti contenenti i prodotti di PCR ai pozzetti con EB 6. Transfer 22.5 µl from the wells containing the PCR products to the wells with EB

7. Aggiungere 72.0 µl di biglie paramagnetiche vortexate ad ogni pozzetto e mescolare spipettando almeno 12 volte finché il liquido non è omogeneo 8. Incubare per 10 minuti a Temperatura ambiente 7. Add 72.0 µl of vortexed paramagnetic beads to each well and mix by spitting at least 12 times until the liquid is homogeneous 8. Incubate for 10 minutes at room temperature

9. Incubare la piastra nel rack magnetico da 96 pozzetti per 5 minuti a Temperatura ambiente finchè il surnatante non diventa chiaro 9. Incubate the plate in the 96-well magnetic rack for 5 minutes at RT until the supernatant becomes clear.

10. Mantenendo la piastra sul rack magnetico, rimuovere attentamente il surnatante sena disturbare le biglie e gettarlo via 10. While keeping the plate on the magnetic rack, carefully remove the supernatant without disturbing the beads and discard it

11. Mantenendo la piastra sul rack magnetico, aggiungere 100 µl di EtOH al 70% ed incubare per 30 secondi-1minuto a Temperatura ambiente 12. Rimuovere attentamente il surnatante e gettarlo via 11. While holding the plate on the magnetic rack, add 100 µl of 70% EtOH and incubate for 30 seconds to 1 minute at room temperature 12. Carefully remove the supernatant and discard it

13. Ripetere il lavaggio con EtOH ancora una volta assicurandosi di aver rimosso tutto il surnatante possibile 13. Repeat the EtOH wash one more time ensuring that all possible supernatant is removed

14. Mantenendo la piastra sul rack magnetico, far asciugare i pellets dai residui di EtOH per circa 3-5 minuti a temperatura ambiente 14. While holding the plate on the magnetic rack, allow the EtOH residues to dry the pellets for approximately 3-5 minutes at room temperature

15. Rimuovere la piastra dal rack magnetico, aggiungere 13-20 µl di EB (10 mM Tris-Cl, pH 8.5). Muovere la piastra sul rack magnetico in maniera circolare per circa 10 volte 15. Remove the plate from the magnetic rack, add 13-20 µl of EB (10 mM Tris-Cl, pH 8.5). Move the plate on the magnetic rack in a circular fashion about 10 times

16. Incubare la piastra a temperatura ambiente per 2 minuti sul rack magnetico 16. Incubate the plate at room temperature for 2 minutes on the magnetic rack

17. Trasferire il surnatante in dei nuovi pozzetti di una piastra da 96 pozzetti 17. Transfer the supernatant to new wells of a 96-well plate

18. Sigillare la piastra con una pellicola o con dei tappini appositi e conservare a -20 °C 18. Seal the plate with plastic wrap or caps and store at -20 ° C

- Fase di determinazione della concentrazione del primo, del secondo, del terzo, e del quarto amplicone - Phase of determining the concentration of the first, second, third and fourth amplicons

4. QUANTIFICAZIONE DELLA LIBRERIA TRAMITE FLUORESCENZA Usare Quant-It PicoGreen dsDNA Assay Kit, prodotto da Thermo Fisher. Si raccomanda di quantificare in duplicato sia i campioni sia la curva standard. 4. LIBRARY QUANTIFICATION USING FLUORESCENCE Use the Quant-It PicoGreen dsDNA Assay Kit, manufactured by Thermo Fisher. It is recommended that both the samples and the standard curve be quantified in duplicate.

Diluizione utilizzando “Quant-iT™ PicoGreen® dsDNA reagent: Dilution using “Quant-iT ™ PicoGreen® dsDNA reagent:

1. Diluire il reagente PicoGreen 1:200 in EB (calcolando un volume di 100 µl per ciascun campione più qualche aliquota in più) e vortexare brevemente Curva standard (Lambda DNA standard) (tabella concentrazioni standard): 1.Scongelare il DNA Standard (100ng/µl) fornito nel kit insieme al PicoGreen (sensibile alla luce). 1. Dilute the PicoGreen reagent 1: 200 in EB (calculating a volume of 100 µl for each sample plus a few more aliquots) and briefly vortex Standard curve (Lambda DNA standard) (standard concentration table): 1. Thaw the DNA Standard ( 100ng / µl) supplied in the kit together with the PicoGreen (sensitive to light).

2. Etichettare 8 eppendorf da 1.5 e trasferire 594 µl di EB nell’eppendorf num 1 e 300 µl nelle altre. 2. Label 8 eppendorf 1.5 and transfer 594 µl of EB in eppendorf num 1 and 300 µl in the others.

3. Aliquotare 6 µl del DNA Standard nell’eppendorf numero 1 e vortexare per 10 secondi. Trasferire poi dall’eppenorf num 1 all’eppendorf num 2, 300 µl e vortexare 10 secondi. 3. Aliquot 6 µl of the DNA Standard into eppendorf number 1 and vortex for 10 seconds. Then transfer from eppenorf num 1 to eppendorf num 2, 300 µl and vortex 10 seconds.

4. Proseguire così fino al’eppendorf num 7. L’eppendorf num 8 rappresenta invece il controllo negativo (no DNA). 4. Continue like this up to eppendorf num 7. Eppendorf num 8 represents the negative control (no DNA).

Campioni: Samples:

1. Aliquotare 99 µl di EB in tutti i pozzetti vuoti da utilizzare 1. Aliquot 99 µl of EB into all empty wells to be used

2. Dispensare 1 µl di ogni campione da quantificare in doppio 2. Add 1 µl of each sample to be quantified in duplicate

● Aggiungeren 100 µl di PicoGreen diluito in tutti i pozzetti e mescolare spipettando 4 volte ● Add 100 µl of diluted PicoGreen to all wells and mix by spitting 4 times

● Sigillare la piastra con l’apposita pellicola ● Seal the plate with the appropriate film

● Inserire la piastra nello strumento Light Cycler (Roche) e far partire il corretto profilo termico ● Insert the plate into the Light Cycler instrument (Roche) and start the correct thermal profile

- Fase di normalizzazione del il primo, il secondo, il terzo, e il quarto campione amplificato e purificato - Normalization phase of the first, second, third, and fourth amplified and purified sample

5. NORMALIZZAZIONE 5. STANDARDIZATION

● Verificare l’R2 della curva standard (≥0.98) ● Check the R2 of the standard curve (≥0.98)

● Ricavare le concentrazioni dei campioni ● Obtain the concentrations of the samples

● Calcolare in numero di molecole/µl ● Calculate in number of molecules / µl

● Normalizzare allo stesso numero di molecole/µl (1 x 10<10>) ● Normalize to the same number of molecules / µl (1 x 10 <10>)

● Diluire gli ampliconi in EB ● Dilute the amplicons in EB

● Unire 12,5 µl di ogni amplicone in un pool (avrà una concentrazione di circa 150-300 ng/µl) ● Combine 12.5 µl of each amplicon in a pool (it will have a concentration of approximately 150-300 ng / µl)

- Fase di effettuazione di un sequenziamento del campione normalizzato con un sequenziatore ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza. - Sequencing phase of the normalized sample with a bridged amplification sequencer, sequencing by synthesis and detection with a fluorescence detector.

6. Modifica delle estremità dei frammenti di DNA da sequenziare (END REPAIR E A-TAILING) utilizzando KAPA HYPER PREP KIT della Kapa Biosystem 6. Modification of the ends of the DNA fragments to be sequenced (END REPAIR AND A-TAILING) using KAPA HYPER PREP KIT from Kapa Biosystem

1.Preparare una mix in cui si aggiungono 7 µl di End-Repair & A-Tailing Buffer e 3 µl di End-Repair & A-Tailing Enzyme Mix ad ogni campione (50 µl di prodotto di PCR) 1. Make a mix in which 7 µl of End-Repair & A-Tailing Buffer and 3 µl of End-Repair & A-Tailing Enzyme Mix are added to each sample (50 µl of PCR product)

2.Vortexare e spinnare 2.Vortex and spin

3. Incubare secondo il seguente profilo termico: 3. Incubate according to the following thermal profile:

4. Procedere immediatamente allo step successivo 4. Proceed to the next step immediately

7. ADAPTER LIGATION - aggiunta e reazione con reagenti oligonucleotidici , ossia detti specifici adattatori oligonucleotidici. 7. ADAPTER LIGATION - addition and reaction with oligonucleotide reagents, ie called specific oligonucleotide adapters.

Utilizzare il kit KAPA Single-Indexed Adapter Kit prodotto da Kapa Biosystem for Illumina® Platforms Use the KAPA Single-Indexed Adapter Kit manufactured by Kapa Biosystem for Illumina® Platforms

1. Diluire gli specifici adattatori oligonucleotidici per sequenziamento con sequenziatore ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza contenuti nel KAPA Single-Indexed Adapter Kit fino ad una relativa concentrazione compresa tra 5 e 15 µM (preferibilmente di 7,5 µM) 1. Dilute the specific oligonucleotide adapters for sequencing with amplified bridge sequencing, sequencing by synthesis and detection with fluorescence detector contained in the KAPA Single-Indexed Adapter Kit up to a relative concentration between 5 and 15 µM (preferably 7.5 µM)

2. Preparare una miscela calcolando 5 µl di PCR-grade water, 30 µl di Ligation Buffer e 10 µl di DNA ligasi per ogni campione. 2. Prepare a mix by calculating 5 µl of PCR-grade water, 30 µl of Ligation Buffer and 10 µl of DNA ligase for each sample.

3. Aggiungere 5 µl di ciascun adattatore diluito al campione 3. Add 5 µL of each diluted adapter to the sample

4. Aliquotare 45 µl di mix a 60 µl del prodotto di reazione 4. Aliquot 45 µl of the mix to 60 µl of the reaction product

5. Mescolare spipettanado e spinnare 5. Mix spipettanado and spin

6. Incubare a 20°C da 2 a 3 ore o 20°C per 2 ore e a 4C° per una notte (preferibilmente a 20 °C per 150 minuti) 6. Incubate at 20 ° C for 2 to 3 hours or 20 ° C for 2 hours and at 4C ° overnight (preferably at 20 ° C for 150 minutes)

7. Procedere immediatamente allo step successivo 7. Proceed to the next step immediately

8.PURIFICAZIONE DEL PRODOTTO DI REAZIONE FRA IL CAMPIONE 8.PURIFICATION OF THE REACTION PRODUCT BETWEEN THE SAMPLE

NORMALIZZATO E DETTI REAGENTI OLIGONUCLEOTIDICI NORMALIZED AND SAID OLIGONUCLEOTIDE REAGENTS

1. Normalizzare le biglie paramagnetiche a temperatura ambiente per circa 30 min 1. Normalize the paramagnetic beads at room temperature for approximately 30 min

2. Aggiungere 88 µl di biglie paramagnetiche al prodotto di reazione (post ligazione) 2. Add 88 µl of paramagnetic beads to the reaction product (post ligation)

3. Mescolare spipettando molte volte 3. Mix by stirring several times

4. Incubare a temperatura ambiente per 5-15 minunti (preferibilmente preferibilmente 10 minuti) 4. Incubate at room temperature for 5-15 minutes (preferably preferably 10 minutes)

5. Incubare sul rack magnetico per 5-15min ( preferibilmente preferibilmente 10 minuti) 5. Incubate on the magnetic rack for 5-15min (preferably preferably 10 minutes)

6.Rimuovere il surnatante 6. Remove the supernatant

7. Eseguire 2 lavaggi con EtOH 80% (preparato fresco): aggiungere 200 µl di ETOH mantenendo la piastra sul rack magnetico, incubare per 30sec, eliminare il surnatante Ripetere questi passaggi. 7. Perform 2 washes with EtOH 80% (fresh preparation): add 200 µl of ETOH while keeping the plate on the magnetic rack, incubate for 30sec, discard the supernatant Repeat these steps.

8. Rimuovere la piastra dal magnete 8. Remove the plate from the magnet

9. Aggiungere 25 µl di EB e risospedere10. Incubare per 2 minuti a temperatura ambiente 9. Add 25 µl of EB and resuspend10. Incubate for 2 minutes at room temperature

11. Incubare per 2 minuti a temperatura ambiente sul rack magnetico 12. Traferire il surnatante in dei nuovi pozzetti 11. Incubate for 2 minutes at room temperature on the magnetic rack 12. Transfer the supernatant to new wells

9. QUANTIFICAZIONE IN REAL-TIME CON CURVA DI MELTING 9. REAL-TIME QUANTIFICATION WITH MELTING CURVE

● Utilizzare il “Protocollo Kapa Biosystem per Light Cycler” ● Use the "Kapa Biosystem Protocol for Light Cycler"

● Diluizione dei campioni da quantificare tra 1:100 e 1:1000 ● Dilution of the samples to be quantified between 1: 100 and 1: 1000

● Usare il foglio di calcolo fornito dal Kit ● Use the spreadsheet provided by the Kit

10. NORMALIZZAZIONE DELLA LIBRERIA E CARICAMENTO (su piattaforma per next-generation sequencing con amplificazione a ponte e sequenziamento per sintesi—Illumina MiSeq) 10. LIBRARY NORMALIZATION AND LOADING (on platform for next-generation sequencing with bridge amplification and sequencing for synthesis - Illumina MiSeq)

● A seconda della concentrazione delle librerie normalizzazione delle librerie a 2nM (Caricare 10 pM)-a 4nM (preferibilmente tra 10 e 15 pM). È necessario quantificare il pool per stabilire quanto caricare. ● Depending on the concentration of the libraries normalization of libraries at 2nM (Load 10 pM) -to 4nM (preferably between 10 and 15 pM). You need to quantify the pool to determine how much to load.

● usare uno spike-in (preferibilmente quello del PhiX Sequencing Control V3 (prodotto da Illumina) in un percentuale compresa fra 5 e 30 % (preferibilmente al 10%) ● use a spike-in (preferably that of PhiX Sequencing Control V3 (manufactured by Illumina) in a percentage between 5 and 30% (preferably 10%)

Effettuare la fase di confronto automatico. Carry out the automatic comparison phase.

S’intende che quanto sopra è stato descritto a titolo esemplificativo e non limitativo, per cui eventuali varianti di natura pratico-applicativa s’intendono rientranti nell’ambito protettivo dell’invenzione come sopra descritto e nel seguito rivendicato. It is understood that the above has been described by way of non-limiting example, so any variants of a practical-applicative nature are understood to fall within the protective scope of the invention as described above and claimed hereinafter.

Claims (10)

RIVENDICAZIONI 1. Oligonucleotide isolato scelto nel gruppo consistente nelle seguenti sequenze di acido nucleico: SEQ ID NO:1; SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; e SEQ ID NO:8. CLAIMS 1. Isolated oligonucleotide selected from the group consisting of the following nucleic acid sequences: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; and SEQ ID NO: 8. 2. Uso di un oligonucleotide isolato in accordo con la rivendicazione precedente come primer per l’amplificazione tramite PCR. 2. Use of an isolated oligonucleotide in accordance with the previous claim as a primer for amplification by PCR. 3. Kit per lo screening mutazionale del dominio tirosin-chinasico di BCR-ABL comprendente almeno un oligonucleotide isolato in accordo con la rivendicazione 1. 3. Kit for mutational screening of the tyrosine kinase domain of BCR-ABL comprising at least one isolated oligonucleotide according to claim 1. 4. Kit in accordo la rivendicazione precedente, comprendente almeno una coppia di oligonucleotidi isolati in accordo con la rivendicazione 1 in cui detta coppia è scelta nel gruppo consistente nelle seguenti coppie oligonucleotidi isolati: SEQ ID NO:1 e SEQ ID NO:5; SEQ ID NO:2 e SEQ ID NO:6 SEQ ID NO:3 e SEQ ID NO:7; e SEQ ID NO:; e SEQ ID NO:8. Kit according to the preceding claim, comprising at least one pair of isolated oligonucleotides according to claim 1 wherein said pair is selected from the group consisting of the following isolated oligonucleotide pairs: SEQ ID NO: 1 and SEQ ID NO: 5; SEQ ID NO: 2 and SEQ ID NO: 6 SEQ ID NO: 3 and SEQ ID NO: 7; and SEQ ID NO :; and SEQ ID NO: 8. 5. Kit in accordo con la rivendicazione precedente, comprendente i seguenti oligonucleotidi isolati: SEQ ID NO:1; SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; e SEQ ID NO:8. 5. Kit according to the preceding claim, comprising the following isolated oligonucleotides: SEQ ID NO: 1; SEQ ID NO: 2; SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 6; SEQ ID NO: 7; and SEQ ID NO: 8. 6. Kit in accordo con una qualsiasi rivendicazione da 3 a 5, ulteriormente comprendente i seguenti oligonucleotidi isolati SEQ ID NO:9; SEQ ID NO:10; e/o SEQ ID NO: 11. Kit according to any one of claims 3 to 5, further comprising the following isolated oligonucleotides SEQ ID NO: 9; SEQ ID NO: 10; and / or SEQ ID NO: 11. 7. Kit in accordo con una qualsiasi rivendicazione da 3 a 6, in cui ognuno degli oligonucleotidi isolati è in soluzione in una relativa soluzione ed ha una relativa concentrazione di 90-110 µM. 7. Kit according to any one of claims 3 to 6, wherein each of the isolated oligonucleotides is in solution in a relative solution and has a relative concentration of 90-110 µM. 8. Metodo per lo screening mutazionale del dominio tirosin-chinasico di BCR-ABL comprendente le seguenti fasi: - predisporre un primo campione di cDNA, che è purificato, amplificato e ottenibile tramite retrotrascrizione di mRNA, relativo al gene BCR-ABL di un paziente, e successiva amplificazione e purificazione; - suddividere il primo campione di cDNA purificato in una prima, una seconda, una terza ed una quarta relativa aliquota; aggiungere alla prima aliquota gli oligonucleotidi isolati SEQ ID NO:1 e SEQ ID NO:5 ottenendo una prima miscela; aggiungere alla seconda aliquota gli oligonucleotidi isolati SEQ ID NO:2; e SEQ ID NO:6 ottenendo una seconda miscela; aggiungere alla terza aliquota gli oligonucleotidi isolati SEQ ID NO:3; e SEQ ID NO:7 ottenendo una terza miscela; ed aggiungere alla quarta aliquota gli oligonucleotidi isolati SEQ ID NO:4; e SEQ ID NO:8 ottenendo una quarta miscela; - amplificare tramite PCR, separatamente, la prima, la seconda, la terza e la quarta miscela per ottenere, rispettivamente, un primo, un secondo, un terzo e un quarto campione amplificato comprendente, rispettivamente, un primo, un secondo, un terzo, ed un quarto amplicone di detto primo campione di cDNA; - purificare detti primo, secondo, terzo e quarto campione amplificato ottenendo un primo, un secondo, un terzo e un quarto campione amplificato e purificato; - determinare la concentrazione del primo, del secondo, del terzo, e del quarto amplicone nei rispettivi primo, secondo, terzo, e quarto campione amplificato e purificato; - normalizzare il primo, il secondo, il terzo, e il quarto campione amplificato e purificato per ottenere un relativo campione normalizzato comprendente il primo, il secondo, il terzo, e il quarto amplicone alla stessa concentrazione; - effettuare un sequenziamento di detto campione normalizzato con un sequenziatore, che è: ad amplificazione a ponte, sequenziamento per sintesi e rilevazione con rilevatore a fluorescenza, ottenendo una pluralità di sequenze di nucleoditi amplificate, sequenziate e rilevate. - confrontare automaticamente ogni sequenza di detta pluralità di sequenze amplificate, sequenziate e rilevate allineandola ad una sequenza di riferimento avente numero di accesso: X16416.1, data base: NCBI Genbankn, versione 228.0; indicandone ogni variazione di nucleotidi o di codoni di nucleotidi, rispetto a detta sequenza di riferimento e il numero di volte in cui tale variazione è stata individuata. 8. Method for mutational screening of the BCR-ABL tyrosine kinase domain comprising the following steps: - prepare a first sample of cDNA, which is purified, amplified and obtainable by reverse transcription of mRNA, relative to the BCR-ABL gene of a patient, and subsequent amplification and purification; - dividing the first sample of purified cDNA into a first, second, third and fourth relative aliquot; add to the first aliquot the isolated oligonucleotides SEQ ID NO: 1 and SEQ ID NO: 5 obtaining a first mixture; add to the second aliquot the isolated oligonucleotides SEQ ID NO: 2; and SEQ ID NO: 6 obtaining a second blend; add the isolated oligonucleotides SEQ ID NO: 3 to the third aliquot; and SEQ ID NO: 7 obtaining a third blend; and add to the fourth aliquot the isolated oligonucleotides SEQ ID NO: 4; and SEQ ID NO: 8 obtaining a fourth blend; - amplify by PCR, separately, the first, second, third and fourth mix to obtain, respectively, a first, second, third and fourth amplified sample comprising, respectively, a first, a second, a third, and a fourth amplicon of said first cDNA sample; - purifying said first, second, third and fourth amplified sample obtaining a first, second, third and fourth amplified and purified sample; - determine the concentration of the first, second, third, and fourth amplicons in the respective first, second, third, and fourth amplified and purified samples; - normalize the first, second, third, and fourth amplicon samples to obtain a relative normalized sample comprising the first, second, third, and fourth amplicon at the same concentration; - carry out a sequencing of said normalized sample with a sequencer, which is: bridged amplification, sequencing by synthesis and detection with a fluorescence detector, obtaining a plurality of amplified, sequenced and detected nucleodite sequences. - automatically comparing each sequence of said plurality of amplified, sequenced and detected sequences by aligning it with a reference sequence having access number: X16416.1, database: NCBI Genbankn, version 228.0; indicating any variation of nucleotides or nucleotide codons, with respect to said reference sequence and the number of times such variation has been identified. 9. Metodo in accordo con la rivendicazione precedente, in cui detta fase di predisposizione del primo campione di cDNA comprende le fasi di retrotrascrivere l’mRNA cellulare del paziente ottenendo un corrispondente cDNA; aggiungere a quest’ultimo l’oligonucleotide isolato SEQ ID NO:9 e l’oligonucleotide isolato SEQ ID NO:11, se il punto di fusione delle sequenze dei geni BCR e ABL sul cDNA del paziente è e1A2, o l’oligonucleotide isolato SEQ ID NO:10, se detto punto di fusione delle sequenze dei geni BCR e ABL è e13a2 o e14a2; e amplificare tramite PCR. 9. Method in accordance with the previous claim, in which said step of preparation of the first sample of cDNA includes the steps of reverse-transcribing the patient's cellular mRNA obtaining a corresponding cDNA; add to the latter the isolated oligonucleotide SEQ ID NO: 9 and the isolated oligonucleotide SEQ ID NO: 11, if the melting point of the sequences of the BCR and ABL genes on the patient's cDNA is e1A2, or the isolated oligonucleotide SEQ ID NO: 10, if said melting point of the BCR and ABL gene sequences is e13a2 or e14a2; and amplify by PCR. 10. Metodo in accordo con una qualsiasi rivendicazione da 8 a 9, in cui la fase di sequenziamento è effettuata contemporaneamente su una pluralità di campioni normalizzati relativa ad una corrispondente pluralità di pazienti diversi utilizzando per ogni campione normalizzato di detta pluralità di campioni normalizzati un differente gruppo di reagenti oligonucleotidici, aventi relative specifiche sequenze nucleotidiche, per accoppiare gli ampliconi di detto campione normalizzato ad un supporto solido previsto in detto sequenziatore, ed in cui la fase di confronto di ogni sequenza di detta pluralità di sequenze amplificate, sequenziate e rilevate comprende una fase di individuazione del relativo paziente in base alle specifiche sequenze nucleotidiche del gruppo di reagenti utilizzato per accoppiare i relativi ampliconi a detto supporto solido. 10. Method according to any one of claims from 8 to 9, in which the sequencing step is carried out simultaneously on a plurality of normalized samples relating to a corresponding plurality of different patients using for each normalized sample of said plurality of normalized samples a different group of oligonucleotide reagents, having relative specific nucleotide sequences, for coupling the amplicons of said normalized sample to a solid support provided in said sequencer, and in which the comparison step of each sequence of said plurality of amplified, sequenced and detected sequences comprises a identification of the relative patient on the basis of the specific nucleotide sequences of the group of reagents used to couple the relative amplicons to said solid support.
IT102018000020299A 2018-12-20 2018-12-20 ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL IT201800020299A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
IT102018000020299A IT201800020299A1 (en) 2018-12-20 2018-12-20 ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
IT102018000020299A IT201800020299A1 (en) 2018-12-20 2018-12-20 ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL

Publications (1)

Publication Number Publication Date
IT201800020299A1 true IT201800020299A1 (en) 2020-06-20

Family

ID=66049464

Family Applications (1)

Application Number Title Priority Date Filing Date
IT102018000020299A IT201800020299A1 (en) 2018-12-20 2018-12-20 ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL

Country Status (1)

Country Link
IT (1) IT201800020299A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010051204A2 (en) * 2008-10-31 2010-05-06 Quest Diagnostics Investments Incorporated Bcr-abl variants
US20120171670A1 (en) * 2010-12-29 2012-07-05 Quest Diagnostics Investments Incorporated Bcr-abl1 splice variants and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010051204A2 (en) * 2008-10-31 2010-05-06 Quest Diagnostics Investments Incorporated Bcr-abl variants
US20120171670A1 (en) * 2010-12-29 2012-07-05 Quest Diagnostics Investments Incorporated Bcr-abl1 splice variants and uses thereof

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
"Genbank", Database accession no. X16416.1
DATABASE EMBL [online] 22 October 2018 (2018-10-22), "Sequence 48 from patent US 10023841.", XP002791992, retrieved from EBI accession no. EM_PAT:MI871654 Database accession no. MI871654 *
DATABASE Geneseq [online] 17 July 2014 (2014-07-17), "Human abl gene-specific sequencing primer, SEQ ID 18.", XP002791990, retrieved from EBI accession no. GSN:BBG43299 Database accession no. BBG43299 *
DATABASE Geneseq [online] 2 August 2012 (2012-08-02), "Human ABL gene exon 6 specific reverse PCR primer, SEQ ID 18.", XP002791987, retrieved from EBI accession no. GSN:AZW42777 Database accession no. AZW42777 *
DATABASE Geneseq [online] 2 June 2016 (2016-06-02), "ABL1 gene specific forward amplification PCR primer, SEQ ID 6.", XP002791991, retrieved from EBI accession no. GSN:BCO95457 Database accession no. BCO95457 *
DATABASE Geneseq [online] 24 July 2003 (2003-07-24), "PCR primer F2 for DNA encoding human Abl kinase.", XP002791989, retrieved from EBI accession no. GSN:ABX95824 Database accession no. ABX95824 *
DATABASE Geneseq [online] 30 August 2012 (2012-08-30), "Human BCR-ABL1 gene sequencing primer, SEQ ID 18.", XP002792147, retrieved from EBI accession no. GSN:AZX82334 Database accession no. AZX82334 *
DATABASE Geneseq [online] 6 January 2011 (2011-01-06), "Human BCR-ABL gene PCR forward primer, SEQ ID 22.", XP002792146, retrieved from EBI accession no. GSN:AYL68905 Database accession no. AYL68905 *
DATABASE Geneseq [online] 7 August 2008 (2008-08-07), "Human protein tyrosine kinase PCR primer #523.", XP002791988, retrieved from EBI accession no. GSN:ARW68055 Database accession no. ARW68055 *
S. SOVERINI: "Unraveling the complexity of tyrosine kinase inhibitor-resistant populations by ultra-deep sequencing of the BCR-ABL kinase domain", BLOOD, vol. 122, no. 9, 29 August 2013 (2013-08-29), pages 1634 - 48
S. SOVERINI: "Unraveling the complexity of tyrosine kinase inhibitor-resistant populations by ultra-deep sequencing of the BCR-ABL kinase domain", BLOOD, vol. 122, no. 9, 29 August 2013 (2013-08-29), pages 1634 - 48, XP002791993 *
SOVERINI SIMONA ET AL: "In chronic myeloid leukemia patients on second-line tyrosine kinase inhibitor therapy, deep sequencing of BCR-ABL1 at the time of warning may allow sensitive detection of emerging drug-resistant mutants.", BMC CANCER 02 08 2016, vol. 16, 2 August 2016 (2016-08-02), pages 572, XP002791994, ISSN: 1471-2407 *

Similar Documents

Publication Publication Date Title
EP2875131B1 (en) A method of normalizing biological samples
US20180142290A1 (en) Blocking oligonucleotides
JP5307538B2 (en) UGT1A1 gene amplification primer set, UGT1A1 gene amplification reagent containing the same, and use thereof
EP3607065B1 (en) Method and kit for constructing nucleic acid library
JP5224526B2 (en) Gene amplification primer set, gene amplification reagent containing the same, and use thereof
US11674137B2 (en) Adaptor for sequencing DNA at ultratrace level and use thereof
WO2018050722A1 (en) Methods for labelling nucleic acids
ES2406734T3 (en) Specific targets and use procedures
EP2025764B1 (en) Probe for detection of mutation in abl gene and use thereof
KR101875199B1 (en) Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping
JP2015500012A (en) Methods and kits for characterizing RNA in compositions
EP2984183B1 (en) Nanoprobe-based genetic testing
JPWO2009011297A1 (en) Probe for detecting mutation in JAK2 gene and use thereof
US20180291369A1 (en) Error-proof nucleic acid library construction method and kit
WO2008066163A1 (en) Primer set for amplification of cyp2c9 gene, reagent for amplification of cyp2c9 gene comprising the same, and use of the same
KR102559124B1 (en) Composition for amplifying FLT3 gene and Uses thereof
EP2990493A1 (en) Primer reagent for amplifying alk fusion gene, alk fusion gene amplification reagent kit including the same, and alk fusion gene amplification method and alk fusion gene analysis method using the same
IT201800020299A1 (en) ISOLATED OLIGONUCLEOTIDE, ITS USE AS PCR PRIMER, METHOD AND KIT FOR MUTATIONAL SCREENING OF THE THYROSIN-KINASIC DOMAIN OF BCR-ABL
KR101724130B1 (en) Biomarkers for Diagnosing Intestinal Behcet&#39;s Disease and Uses Thereof
JP4491276B2 (en) Method and kit for detecting the presence of a single nucleotide polymorphism in a target DNA sequence
CN111485024B (en) Primer combination for individual feature identification and application thereof
CN102766681A (en) Probe, polymorphism detection method, method of evaluating drug efficacy or tolerance, disease prediction method and reagent kit
JP6205216B2 (en) Mutation detection probe, mutation detection method, efficacy determination method, and mutation detection kit
WO2008066161A1 (en) Primer set for amplification of nat2 gene, reagent for amplification of nat2 gene comprising the same, and use of the same
JP2020534817A (en) Multiple detection of short nucleic acids