IL91082A - In vitro synthesis of a human rhinovirus - Google Patents

Abstract

The invention relates to the in vitro synthesis of an infectious RNA of HRV2 and ''full-size'' clones of HRV2.

Description

In vitro Synthesis of a Human Rhinovirus BOEHRINGER INGELHEIM INTERNATIONAL GmbH C: 77960/3 - 2 - 91082/2 The present invention relates to the in vitro synthesis of an infectious RNA of HRV2 and so-called full size clones of HRV2, and is a selection invention of Applicant's Israel Patent No. 77896.

Human rhinoviruses are the main causes of colds (1) . Although there are more than a hundred antigenically different serotypes, all those which have hitherto been tested, with the exception of 10 serotypes, bind to the same receptor (2). The most recent progress in rhinovirus research, such as the determination of the nucleotide sequence of 4 serotypes and the determination of the crystalline structure of HRV14 , have indeed led to a better understanding of the variety of serotypes (3, 4, 5, 6, 7, 8), but it is still not possible to build up permanent or at least long-lasting immunity against rhinoviral infections. After the infection has occurred, antibodies against the strain in question can indeed be detected, but these do not confer any protection against other strains of rhinovirus. Preventative inoculation such as is possible for example, against polio or influenza viruses, is impossible, at least at present.

In order to develop effective therapies against rhinoviral infections it is therefore essential to analyse the viral occurrences taking place in the cell.

This requires a test system with which, for example, any changes in viral occurrences can be investigated.

An objective of the present invention was to provide a test system with which any mutations, deliberately produced at the DNA level, could be investigated.

We have found that synthesis of a cDNA copy of HRV2 makes it possible to transcribe in vitro infectious RNA. With this synthetic cDNA it is surprisingly possible to imitate the viral occurrences for HRV2 in vitro .

- - The present invention thus provides a plasmid comprising a cDNA molecule encoding an in vitro producible RNA molecule that exhibits half the infectivity of natural HRV2 RNA comprising, under the control of an RNA polymerase promotor, the complete HRV2 genome or such cDNA molecule analogues encoding HRV2 obtainable by specific mutations.

The present invention also relates to plasmids which comprise the complete cDNA for HRV2 under the control of an RNA polymerase promoter, the codons which code for amino acids located on the surface of an HRV2 virion or in the canyon thereof, being replaced by codons for other amino acids, particularly codons for amino acids which influence the binding characteristics in relation to a cell receptor.

Preferred plasmids contain only as many nucleotides as are required for initiation of the transcription in front of the first base pair of the cDNA. If T7 RNA polymerase is used, these may be, for example, two guanines .

It is advantageous if these plasmids are additionally provided with a restriction site occurring only once adjacent to the 3' terminus of the cDNA.

The present invention also, of course, relates to the RNA obtainable from these plasmids by transcription.

The plasmids according to the invention may be used, for example, to produce viral polypeptides, by transforming suitable host systems with these plasmids.

These viral polypeptides can then be used for therapeutic treatment, for example to stimulate the immune system and for binding and/or blocking of the cell receptors for rhinoviruses .

The effects of any mutations at the DNA level such as, for example, deletions, insertions and the exchange of base pairs can thus be investigated directly and in a quantitatively measurable way.

The findings arrived at using this test system are more readily generalised, on account of the much greater homology of HRV2 to the rhinoviruses sequenced hitherto than HRV14, than the full size clone of HRV14 which can be obtained according to Mizutani et al. (9) . Although this clone contained 21 nucleotides more than the - - 1 2/2 "native" DNA, it was possible to obtain infectious RNA with it. Racaniello et al. (18) were able to demonstrate that a complete cDNA copy of polio virus can produce infectious virus .

The present invention is directed to the in vitro preparation of a biologically active, highly infectious RNA coding for the human rhinovirus serotype 2(HRV2). Applicant's Israeli Patent No. 77896 and the corresponding European Patent Application No. 192 175, as well as Skern, . , et al. , Nucl. Acids Res., 13: 2111-2126 (1985), disclose the entire genomic sequence of HRV2. These publications also disclose that the genome consists of 7,102 nucleotides, 6,450 of which are allocated to a single open reading frame. The publications do not teach the in vitro synthesis of an infectious human rhinovirus by in vitro transcription from a single plasmid. The present invention requires that the claimed cDNA molecules of the invention be capable of encoding an in vitro producible RNA molecule that exhibits about half the infectivity of natural HRV2 RNA, and that they comprise the complete nucleotide sequence of the complete HRV2 genome and an additional transcription initiation site that is different from the natural transcription initiation site of the HRV2 nucleic acid sequence. This additional transcription initiation site, an RNA polymerase promotor, is used for in vitro transcription. Nowhere in the above publications is such RNA encoding capability or such an additional transcription initiation site disclosed or suggested.

The invention will now be described by way of non-limiting examples with reference to the accompanying drawings. The following description may contain subject matter which exceeds the scope of the claim, but is being included for the sake of clarity and better understanding. The matter depicted in the various figures is as follows: Fig. 1 Diagrammatic representation of the composition of the complete cDNA copy of HRV2 which is under the control of a T7 RNA polymerase promoter. The fragments which were ligated together in each portion are shown by continuous heavy lines. The numbers above the restriction sites relate to their position on the HRV2 map, apart from those above the Sac I and Asp 718 I sites, which indicate the ends of each cDNA clone. The following restriction sites are shown: A, Asp 718 I; B , Bam HI; H, Hpa I; P, Pst I; R, Eco RI ; S, Sac I; Se, Spe I; Sh, Sph I; Sm, Sma I. All the Asp 718 I and Sac I sites and those restriction sites which are marked with a dot originate from polylinkers of the vector. The T7 RNA polymerase promoter is marked with an arrow.

Fig. 2 Restriction map of the HRV2 genome.

Fig. 3 Sequence of the cloned HRV2 genome and the amino acid sequence derived therefrom.

Fig. 4 Diagrammatic representation of the subcloning of a fragment which is suitable for mutagenesis, and its back-cloning into the full size clone of HRV2 after mutagenesis. The mutated site is indicated by an "x" .

Fig. 5 Autoradiogram of gel electrophoresis. Separation of the viral coat proteins from different gradient fractions of a preparation of 35S-labelled virus particules of the mutant by comparison with the Wild type.

Fig. 6 Binding test of the HRV2 mutant. HeLa cell layers were pre-incubated with increasing concentrations of cold HRV2 (a) or HRV89 (b) . Then the amounts of 35S-labelled virus particles of the Wild type or the mutant which could still be bound were determined.

Up till now, the synthesis of a cDNA clone from which infectious RNA could be transcribed has not been described for any of the rhinoviruses belonging to the so-called minor receptor group.

Admittedly, cDNA clones of HRV2 have been described (6), but the average length of 0.5 kb is unsuitable for the construction of a complete cDNA.

The following procedure was therefore adopted to solve the problem according to the invention: The synthesis of the first strand of HRV2 RNA (5 g) was carried out as described (10) . This cDNA was then made double-stranded with RNase H and DNA polymerase 1, using the Amersham reagents. T4 DNA polymerase was used in order to decompose any overhangs.

After treatment with Eco RI methylase, Eco RI linkers were added and the cDNA was digested with Eco RI .

Molecules longer than 4 kb were isolated from a 1% agarose gel and ligated into the Eco RI site of the Bluescript plasmid (Stratagene, San Diego, California) . The recombinants were sequenced in order to discover whether all the regions of the HRV2 sequence are covered. The regions which were not covered were prepared either by chemical synthesis or by repeating the steps described above. The clones were then combined to form a complete cDNA molecule. At the 3' terminus of the complete cDNA of HRV2 , a RNA polymerase promoter suitable for transcription, such as the T7 RNA polymerase promoter or the SP6 RNA polymerase promoter, was added. In the present case cDNA recombinants ranging in size up to 6 kb were obtained (Fig. 1) .

Since, however, none of the clones contained the complete 5' terminus, a clone which contained nucleotides 1 to 471 and which had already been described earlier (plOO, (6)), was used to cover this region. 4 cDNA clones: plOO (with the larger Pst I fragment for nucleotides 1 - 471), pl9 (19 - 5101), pl5 (2125 -7102dA50) and pi (5373 - 7102dA50) were used to assemble a complete cDNA molecule which could be transcribed by the T7 RNA polymerase. The strategy shown in Fig. 1 was used in order to assemble two segments corresponding to the 5' and 3' parts of the molecule. For the 5' part, the 0.6 kb Bam Hl/Pst I fragment of clone 100 was incorporated in the Sac I/Pst I site of the Bluescript plasmid. This plasmid contains the T7 RNA polymerase promoter in addition to the polylinker. A synthetic, double stranded oligonucleotide which contained the nucleotides 1 to 9 of HRV2 and the correct overhanging ends, was used to enable ligation into the Sac I and Bam HI sites. The Bluescript Sac I site was chosen because it is closest to the T7 RNA polymerase promoter. The resulting plasmid was named plOOb and contains the nucleotides 1 - 471. It was opened up with Hpa I at nucleotide 226 of HRV2. The isolated 4.9 kb Hpa I/Sma I fragment of clone 19 was incorporated in order to arrive at clone 119 (nucleotides 1 to 5101) . This construction does indeed lead to a further insertion of nucleotides 226 to 471 of the HRV2 sequence between the Hpa ° /Sma ° I and Aspl restriction sites, but it is removed again in the subsequent cloning steps. (Fig. 1) .

A plasmid which contains the 3 ' part was subsequently assembled as follows: clones 1 and 15 were linked together, by replacing the 1.2 kb Spe I/Spe I fragment of clone 1 (the Spe 1 sites are in the polylinker and at position 6554 in the HRV2) by the 4.1 kb Spe I/Spe I fragment of clone 15; this resulted in clone 115 (nucleotides 2435 to 7102dA50) . It was not possible to use clone 15 directly since the polydA sequence was adjacent to the Sac I site of the polylinker. As a result, the cDNA was in the wrong orientation and could not therefore be ligated to the 5' half of the cDNA. In the in vitro synthesis of infectious RNA, a restriction cutting site which occurs only once in the plasmid after the polydA sequence (in this case about 50 nucleotides long) is helpful. The Asp 718 I at the end of the polylinker is best suited for this. The part of the polylinker which lay between the polydA sequence and the Asp 718 I site was therefore removed by opening up the plasmid 115 with Eco RI and digesting away the overhanging nucleotides with mung bean nuclease. The remaining part of the polylinker was removed by cleaving with Asp 718 I; the overhanging ends were filled with the klenow fragment of DNA polymerase I. The modified ends were then ligated to obtain clone 115m; this strategy regenerates the Asp 718 I site which is now adjacent to the polydA sequence.

The two halves of the HRV2 cDNA were then combined by means of the single Sph I site; the 1.2 kb Sph I/Asp 718 I fragment of clone 119 was replaced by the 3.2 kb Sph I/Asp 718 I fragment of the clone 115m and thus the clone pHRV2 was obtained.

During transcription of this plasmid after linearisation with Asp 718 I, an RNA is produced which includes the entire genome of HRV2. Certainly, at the 5' terminus, there are 16 additional nucleotides (which correspond to the sequence from the initiation site of the T7 RNA polymerase to the first base of the cDNA) and at the 31 terminus there are 5 additional nucleotides from the Asp 718 I site.

Transcription using T7 RNA polymerase was carried out by standard methods (11). The transcription mixture was used directly as an RNA solution without any further treatment. The quality of the RNA was tested on a 1.0% agarose gel containing 0.1% SDS; usually, more than 90% of the RNA were full length molecules. The RNA concentration was estimated using the method of Fleck and Begg (12) . The nucleoside triphosphates were removed by ethanol precipitation carried out twice in the presence of 800 mM ammonium acetate, the nucleic acids were dissolved in water and the RNA was hydrolysed with alkali. DNA and proteins were precipitated with perchloric acid. By subsequent spectrophotometric measurement of the nucleotide concentration, the initial RNA concentration could be estimated on the assumption that 90% of the RNA were full length molecules.

Hela cells (Ohio strain) were transfected using the DEAE dextran method (9) , using 300 μΐ of the transfection mixture with RNA, transcribed by Asp 718 I cut pHRV2 , for each plate. After 3 days the cells were stained with neutral red or crystal violet and investigated for the presence of plaques. Surprisingly, no infection could be found. The possible cause for this might be the additional nucleotides, although Mizutani and Colonno (9) had obtained an infectious RNA from a 21 nucleotides longer cDNA from HRV14. In order to determine the effects caused by the presence of the additional nucleotides at the 5' terminus, an alternative strategy was developed which reduces the additional sequence to only two G residues. Total elimination is impossible since the T7 RNA polymerase requires two G residues in positions +1 and +2. Van der erf et al. (11) were able to show that a Stu I site can be inserted accurately at the initiation site of the transcription of T7 polymerase by "site directed mutagenesis", by changing the sequence AGGGCG (the transcription starts with the first G) into AGGCCT, the two essential G's for transcription with the T7 RNA polymerase remaining untouched. The restriction enzyme Stu I cuts after the second G and produces smooth ends; therefore, the RNA transcript of a fragment which was cloned into this site contains only two additional Gs. Using an oligonucleotide directed mutagenesis kit made by Amersham, therefore, an Stu I site was inserted in the plasmid plOOb, and at the same time the opportunity was taken to produce single stranded DNA from Bluescript plasmids. The resulting plasmid 100b Stu I was digested with Stu I and Asp 718 I; the 7.0 kb Bam Hi/Asp 718 I fragment of pHRV2 was then incorporated using a synthetic double stranded oligonucleotide which contained the first nine nucleotides of the HRV2 sequence and corresponding ends, to enable correct insertion in the restriction sites. Sequencing of one of the candidates obtained showed that all contained more than one copy of the oligonucleotide. This was removed by restriction digestion with Bam HI, elution of the 10 kb fragment from an agarose gel and religation. One clone was shown to contain only one copy of the oligonucleotide; it was designated pHRV2/l.

Transcription and transfection were carried out as for pHRV2. When the cells were checked after 3 days, surprisingly plaques with an efficiency of 20-50 plaques^g were obtained. RNA from virus particles produced 100-200 plaques^g. The efficiency of the RNA transcribed in vitro thus corresponded approximately to half that obtained with viral RNA. By control transfection with pHRV2/l DNA it was possible to demonstrate clearly that the infection is dependent on RNA; in other words, the corresponding DNA did not produce any plaques.

Surprisingly, by contrast with the results obtained by Mizutani and Colonno for HRV14 (9) , the infectiousness of the RNA transcribed from these clones was dependent on the number of additional nucleotides. Only the full size clone, which contained not more than the additional two guanines at the 51 end needed for the transcription with T7 polymerase, yielded an infectious transcript .

The full size clone pHRV2/l prepared for the first time by means of the present invention and yielding in vitro infectious RNA presents the valuable opportunity of investigating the structural requirements for binding to the minor group receptor by specific mutagenesis.

This system can be used to investigate any mutations produced deliberately at the DNA level. In order to investigate the receptor binding sites, amino acids which satisfy the following criteria were replaced in the viral coat proteins of HRV2 : a. Suitable amino acid residues must be located on the surface of the virion or in the "canyon", a depression in the surface of the virus extending right round the five-fold axis of symmetry; this can be determined by comparison with the crystalline structure of HRV14 (5, 13) . b. Suitable amino acid residues should be conserved within a receptor group, and this can be determined by sequence comparisons with other serotypes (8) . c. The amino acid residues discovered according to (b) can only be specific for a receptor group if different amino acid residues are found in the other receptor group at the corresponding site of the sequence (sequence comparisons with representatives of the "major receptor group" 4, 3, 7) - The present invention encompass the preparation of a mutant in which an Arg (amino acid 180) in the VP3 of HRV2 has been replaced by a Thr. The following procedure was used for this: In order to obtain a plasmid which is of suitable size for the in vitro mutagenesis, a 0.4 kb fragment of full size cDNA was subcloned (Fig. 4) . The fragment includes the region from the Hindlll cutting site (nucleotide # 1982) to the PstI site (# 2422) , and was incorporated in the Pstl/Hindlll sites of the Bluescript plasmid (Stratagene, San Diego, California) .

In accordance with the information supplied by Stratagene, the single stranded DNA of the plasmid required for mutagenesis was produced and purified by means of a helper phage. Mutagenesis was carried out using a single stranded synthetic oligonucleotide (26 nucl.) with a sequence differing from the Wild type at the desired site. The sequence of the oligonucleotide runs as follows: 5 ' - CCCAGATGTAGATGTACCTGGTGATG -31 Using the in vitro mutagenesis kit produced by Amersham, the desired mutant was prepared in accordance with the manufacturer's instructions and examined by DNA sequencing using standard methods (14, 15). Since the presence of other PstI and Hindlll sites in the plasmid pHRV2/l made it impossible to clone back the Pstl-Hind!II fragment containing the mutation directly into the full size clone, it was first ligated in another subclone of pHRV2/l, which contains the sequence from the EcoRI site (# 743) to the Apal site (# 3458) in the Bluescript vector, by means of the Pstl/Hindlll cutting site (Fig. 4) .

The resulting plasmid was digested with EcoRI and Apal; the 2.7 kb fragment was used to replace the corresponding sequence in pHRV2/l, thus producing pHRV2/mRT. Transcription and transfection were carried out as described for pHRV2. Viruses were taken, from some plaques and a HeLa cell monolayer was infected therewith, 2x10' - 2X108 pfu/ml of medium being formed therewith in three days. The viruses produced were again replicated on HeLa cell monolayer, purified and pelleted by three centrifugation steps (10 min at 500 x g; 30 min at 20000 rpm, SW40; 60 min at 45000 rpm, SW50 rotor) . The viruses resuspended in physiological phosphate buffer (PBS: 137 mM NaCl, 2.7 mM KCl , 8.1 mM ΚΗ2ΡΟ<,, 1.5 mM Na2HP0 , pH 7.3) were used to produce 35S-labelled virus particles (16) . Analysis by means of a denaturing polyacrylamide gel (Fig. 5) showed no difference in the range of migration of the individual virus coat proteins in comparison with the Wild type.

In order to enable detection of any possible changes in the binding characteristics of the virus mutants to the host cell, binding tests were carried out as described by G. Abraham and R.J. Colonno (16) ; the period of incubation was 16 hours for pre-incubation with cold virus and 4 hours for incubation with 3S-labelled virus. HRV2 and HRV89 were used as cold virus; 35S-labelled HRV2 Wild type and mutant were compared (Fig. 6). No significant difference in the binding -characteristics of the virus mutant from that of the Wild type could be detected (Fig. 6). The RNA was isolated by phenol extraction (17) from about 1x10s purified virus particles of the mutant and the region containing the mutation was transcribed in cDNA. For the first strand synthesis, a synthetic oligonucleotide was used having the sequence 51 -CTTCTAATTTGAGCCATTTCTTG -3 · , and for the second strand synthesis the oligonucleotide 5 ' -TCTATTCCAGGTGAGGTT - 3 ' was used. The double-stranded cDNA was digested with PstI and Hindlll and ligated into the Bluescript vector. The plasmids obtained were sequenced. In this way it was possible to confirm that the virus mutant actually contains the desired change of sequence.

In this way, the amino acids and the regions of the virion which are essential for receptor binding can be determined .

In the light of the much greater homology of HRV2 for the other previously sequenced rhinoviruses than HRV14, it is to be expected that these results will be applied with greater certainty to rhinoviruses which belong to the so-called major receptor group.

BIBLIOGRAPHY 1. Stott, E. , J., and Killington, R.A. , Ann. Rev. Microbiol .. 26, 503-525 (1972) . 2. Colonno, R. J., Callahan, P. L. and Long, W.J. , J Virol. 57, 7-12 (1986). 3. Stanway,G., Hughes, P. J., Mountford, R. C. , Minor, Ph.D., and Almond, J.W., Nucl . Acids Res., 12, 7859-7875 (1984) . 4. Callahan, P. L. , Mizutani,S. and Colonno , R. J .. Proc . Natl. Acad. Sci. U.S.A.. 82, 732-736 (1985). 5. Rossmann,M.G. , Arnold, E., Erickson, J. W. , Frankenberger, E. A. , Griffith, J . P. , Hecht,H-J. , Johnson, J . E . , Kamer, G. , Luo , M. , Mosser, A. G. , Rueckert,R.R. , Sherry, B.A., and Vriend,G., Nature, 317 145-154 (1985) . 6. Skern,T., Sommergruber,W. , Blaas,D., Gruendler,P. Frauendorfer, F. , Pieler,C, Fogy, I., and Kuechler, E..Nucl. Acids Res.. 13, 2111-2126 (1985). 7. Duechler, M. , Skern, T. , Sommergruber, W. , Neubauer, Ch. , Gruendler, P., Fogy, I., Blaas, D. and Kuechler, E., Proc. Natl. Acad. Sci. U.S.A.. 84, 2605-2609 (1987) . 8. Hughes, P. J. , North, C. , Jellis, C.H. , Minor, P.D and Stanway, G. , J. Gen. Virol. 69, 49-58 (1988). 9. Mizutani, S., and Colonno, R.. J. ,J. Virol . , 56, 628-632 (1985) . 10. Skern, T. , Sommergruber, W. , Blaas, D. , Pieler, C and Kuechler, E..Virology, 136, 125-132 (1984). 11. Van der Werf, S., Bradley, J., Wimmer, E., Studier, W. , and Dunn, J.,J.,Proc. Natl. Acad. Sci. U.S.A., 83, 2330-2334 (1986) . 12. Fleck, A. and Begg , D .. Biochim. Biophys. Acta, 108, 333 - 339 (1965) . 13. Blaas, D. , Kiichler, E., Vriend, G. , Arnold, E., Luo, M. and Rossmann, M.G., Proteins: Structure, Function and Genetics 2: 263-272 (1987) 14. Maxam, A. and Gilbert, W. , Methods in Enzymology, Academic Press, New York 65: 499 - 560 (1980) . 15. Chen, E.Y. and Seeburg, P.H. DNA 4: 165 - 179 (1985) . 16. Abraham, G. and Colonno, R.J., J. Virol. 51, 340-345 (1984) . 17. Lee, Y.F., Kitamura, N. Nomoto, A. and Wimmer, E.J. Gen. Virol. 44, 311-322 (1979). 18. Racaniello, V.R., Baltimore, D. Science 214, 916-919 (1981) .

Claims (12)

- 16 - 91082/3 CLAIMS :

1. A plasmid comprising a cDNA molecule encoding an in vitro producible RNA molecule that exhibits half the infec-tivity of natural HRV2 RNA comprising, under the control of an RNA polymerase promotor, the complete HRV2 genome or such cDNA molecule analogues encoding HRV2 obtainable by specific muta ons .

2. A plasmid according to Claim 1 comprising the complete cDNA for HRV2 under the control of an RNA polymerase promoter, the codons which code for amino acids located on the surface of an HRV2 virion or in the canyon thereof as hereinbefore defined being replaced by codons for other amino acids.

3. A plasmid according to claim 2 in which the codons being replaced are codons for amino acids which influence the binding characteristics in relation to a cell receptor.

4. A plasmid according to any one of claims 1 to 3 , wherein the RNA polymerase is T7 RNA polymerase.

5. A plasmid according to any one of the preceding claims, comprising only as many nucleotides in front of the first base pair of the cDNA as are necessary for initiating transcription.

6. A plasmid according to claim 5, comprising only two guanines in front of the first base pair of the cDNA.

7. A plasmid according to one of the preceding claims, comprising a unique restriction site adjacent to the 3' end of the cDNA.

8. A plasmid according to claim 1 or claim 2 substantially as hereinbefore described. 91082/2 - 17 -

9. A plasmid according to claim 1 being the pHRV2/l plasmid as hereinbefore described.

10. RNA prepared by transcription from a plasmid according to any one of the preceding claims.

11. RNA according to claim 10 substantially as hereinbefore described.

12. A plasmid according to any one of claims 1 - 9 substantially as described in the specification. For the Applicants, DR. REINHOLD COHN AND PARTNERS BY: