IES85507Y1 - EIF2y gene as a diagnostic target for the identification of fungal and yeast species - Google Patents

Abstract

ABSTRACT The current invention relates to a diagnostic kit for a yeast or fungal species eoinprising at least one oligonucleotide probe capable of binding to at least a portion 01‘ the el I-‘Zy gene or its corresponding mRNA.

Description

Field of the Invention The present invention relates to nucleic acid primers and probes to detect one or more fungal and yeast species. More specifically the invention relates to the elF2y gene (also known as the H-‘-2 gene). the corresponding RNA, specific probes, primers and oligonucleotides related thereto and their use in diagnostic assays to detect and/ or discriminate between fungal and yeast species.

Background to the Ilwgntion Yeast and fungal infections represent a major cause of morbidity and mortality among iminunocomprornised patients. The number ofimmunocompromised patients at risk ofyeast and fungal infection continues to increase each year, as does the spectrum of fungal and yeast agents causing disease. Mortality from fungal infections, particularly invasive fungal infections, is 30% or greater. in certain risk groups. The array ofavailable antifungal agents is growing; however, so too is the recognition of both intrinsic and emerging resistance to antifungal drugs.

These factors are contributing to the increased need for cost containment in laboratory testing and have led to laboratory consolidation in testing procedures.

Invasive fungal infections are on the increase. In 2003, it was estimated that there were 9 million at risk patients, of which l.2 million developed infection. Candida spp. and ,‘l.\'[.7<¢’I‘}1i//16 spp. now rank as the most prominent pathogens infecting immunosupressed patients. In particular. infections are common in the urinary tract, the respiratory system and the bloodstream. at the site ofinsertion ofstents, catheters and orthopaedic joints. Approxiinatcly.

I0"/u of the known Candida spp. have been implicated in human infection. Invasive candidiasis occurs when candida enters the bloodstream and it is estimated to occur at a frequency of /I 00,000 population in the US with a mortality rate of40%. Candida albicans is the 4"‘ most common cause ofbloodstream infection. Aspergillosis usually begins as a pulmonary infection that can progress to a life-threatening invasive infection in some patients and has a mortality rate of greater than 90%. Emerging mycoses agents include Fusarium, Scedrzsporitz/21, Zygornycercs and 7'ri'c/iosporon spp. (“Stakeholder lnsiglrI.' In vastve fungal infections“, Datamonitor, Jan 3004). lnimunocompromised patients, including transplant and surgical patients, neonates, cancer patients, diabetics and those with HIV/AIDS are at high risk ofdeveloping invasive fungal infections (Datamonitor report: Stakeholder opinion -Invasive fungal infections. options outweigh replaceinents 2004). A large number ofscvere cases of sepsis are reported each year.

Despite improvements in its medical management. sepsis still constitutes one ofthe greatest challenges in intensive care medicine. Microorganisms (bacteria, fungi and yeast) responsible for causing sepsis are traditionally detected in hospital laboratories with the aid of microbiological culture methods with poor sensitivity (25-82%), which are very time- consuming, generally taking from two to live days to complete, and up to eight days for the diagnosis of fungal infections. Definitive diagnosis of infections caused by yeast or fungi is usually based on either. the recovery and identification ofa specific agent from clinical specimens or microscopic demonstration of fungi with distinct morphological features. llowever, there are numerous cases where these methods fail to provide conclusive proofas to the infecting agent. In these instances, the detection of specific host antibody responses can be used. although again this can be affected by the immune status of the patient. Time is critical in the detection and identification of bloodstream infections typically caused by bacteria, yeasts or fungi. liffeetive treatment depends on finding the source of infection and making appropriate decisions about antibiotics or antifungals quickly and efficiently. Only after pathogens are correctly identified can targeted therapy using a specific antibiotic or antifungal begin. Many pliysicians would like to see the development of better in vitro amplification and direct detection diagnostic techniques for the early diagnosis of yeast and fungi (“Stakeholder lnsig/ii: lriimii.-c fmigul iiifec-Imus”, Datamonitor, Jan 2004). Recently Roche“ launched a real time PCR based assay (Scptifast"“), for the detection of bacterial, fungal and yeast DNA in clinical samples.

Therefore. there is a clear need for the development of novel rapid diagnostic tests for clinically significant bacterial and fungal pathogens for bioanalysis applications in the clinical sector. This has led the current inventors to identify novel fungal and yeast nucleic acid targets for application in Nucleic Acid Diagnostics (NADV) tests.

Fungal and yeast nucleic acid based diagnostics have focused heavily on the ribosomal RNA (rRNA‘l genes, RNA transcripts, and their associated DNA / RNA regions. The rRNA genes are highly conserved in all fungal species and they also contain divergent and distinctive intergenie transcribed spacer regions. Ribosomal rRNi\ comprises three genes: the large sub—unit gene (288), the small sub-unit gene (I85) and the 5.85 gene. The 288 and I33 rRNA genes are separated by the 5.38 rRNA and two internal transcribed spacers (lTSl and ITSZ). Because the ll‘S region contains a high number of sequence polymorphisms, numerous researchers have concentrated their efforts on these as targets (Atkins and Clark, 2004). rRNA genes are also multicopy genes with >l 0 copies within the fungal genome.

A number of groups are working on developing new assays for fungal and yeast infections.

US2004044 l 93 relates to, amongst a number of other aspects, the transcription factor CaTECl of (‘anu’i'du ulbicans; inhibitors thereof, and methods for the diagnosis and therapy of diseases which are connected with a Candida infection; and also diagnostic and pharmaceutical compositions which contain the nucleotide sequences, proteins, host cells and/or antibodies.

W001 83824 relates to hybridization assay probes and accessory oligonucleotides for detecting ribosomal nucleic acids from Candida albicans and/or Candida dubliniensis. US60l 7699 and US5426026 relate to a set of DNA primers, which can be used to amplify and speciate DNA from live medically important Candida species. US 6747l37 discloses sequences useful for diagnosis ofCandida infections. EP 0422872 and US 5658726 disclose probes based on I83 rRNA genes, and US 5958693 discloses probes based on 28S rRNA, for diagnosis ofa range of yeast and fungal species. US 6017366 describes sequences based on chitin synthase gene for use in nucleic acid based diagnostics for a range ofCandida species.

It is clear though, that development of faster, more accurate diagnostic methods are required, particularly in light ofthe selection pressure caused by modern antimicrobial treatments which give rise to increased populations ofresistant virulent strains with mutated genome sequences.

Methods that enable early diagnosis of microbial causes of infection enable the selection ofa specific narrow spectrum antibiotic or antifungal to treat the infection (Datamonitor report: Stakeholder opinion -Invasive fungal infections, options outweigh replacements 2004; Datznnonitor report: Stakeholder Opinion-Sepsis, under reaction to an overreaction, 2006). liukaiyotie initiation factor 2 (elF2) is a heterotrimcr composed ofthree subunits elF2a|pha te|F2u). e|F2beta (elF2|3) and elF2gamma lelF2y). elF2 is the eukaryotic translation initiation factor 2, which is a heterotrimeric G-protein required for GTP-dependent delivery ofinitiator IRNA to the ribosome. The elF2 gamma subunit (eii'2y) has a similar amino acid sequence to prokaryotic translation elongation factor EF-Tu which was patented as molecular diagnostics targets for micro-organisms (Alone and Dever, 2006; Dorris er a1., I995; Erickson at a/., 1996 and I997).

There are currently I 7| sequences ofelF2y available in NCBI GcnBank database including 3 Candida spp. including 2 annotated elF2y sequences for C . albicans and one hypothetical protein for C". glabrata with 78% homology to C. albicans eIF2y and 6 Aspcrgillz/5 spp. sequences, 3 annotated as elF2y and 3 hypothetical sequences. The published sequences are approximately 1600 base pairs in length providing a number ofsequence regions that are suitable for PCR primer and probe design for species identification of Candida and .»t.s-ptzrgillzis spp. For (Ymdida, the inventors focussed on the region ofthe elF2 gamma gene equivalent to base pair (bp) position 713 to bp position I040 in C. albicans. For Aspergii/us, the inventors designed primers to amplify the region ofthc clF2y gene equivalent to bp position l'.Zl to bp position 374 in Aspergillus_/imzigutus.

Definitions "Synthetic oligonucleotide" refers to molecules of nucleic acid polymers of? or more nucleotide bases that are not derived directly from genomic DNA or live organisms. The term synthetic oligonucleotidc is intended to encompass DNA, RNA, and DNA/RNA hybrids that have been manufactured chemically, or synthesized enzymatically in virro.

An "o|igonuclcotide" is a nucleotide polymer having two or more nucleotide subunits covalently joined together. Oligonucleotides are generally about 10 to about 100 nucleotides. The sugar groups of the nucleotide subunits may be ribose. deoxyribose, or modified derivatives thereof such as OMe. The nucleotide subunits may be joined by linkages such as phosphodiesler linkages, modified linkages or by non-nucleotide moieties that do not prevent hybridization of the oligonucleotide to its complementary target nucleotide sequence. Modified linkages include those in which a standard phosphodiester linkage is replaced with a different linkage, such as a phospliorothioate linkage. a methylphosphonate linkage, or a neutral peptide linkage.

Nitrogenous base analogs also may be components ofoligonucleotides in accordance with the invention. /\ "target nucleic acid" is a nucleic acid comprising a target nucleic acid sequence. A "target nucleic acid sequence," "target nucleotide sequence" or "target sequence" is a specific deo,\'_vribonucleotide or ribonucleotide sequence that can be hybridized to a complementary oligonucleotide.

An "oligonucleotide probe" is an oligonucleotide having a nucleotide sequence sufticiently complementary to its target nucleic acid sequence to be able to form a detectable hybrid probe;target duplex under high stringency hybridization conditions. An oligonucleotide probe is an isolated chemical species and may include additional nucleotides outside ofthc targeted region as long as such nucleotides do not prevent hybridization under high stringency hybridization conditions. Non-complementary sequences, such as promoter sequences. restriction endonuclease recognition sites, or sequences that confer a desired secondary or tertiary structure such as a catalytic active site can be used to facilitate detection using the invented probes. An oligonucleotide probe optionally may be labelled with a detectable moiety such as 21 radioisotope, a fluorescent moiety, a chemiluminescent, a nanoparticle moiety. an enzyme or a ligand, which can be used to detect or confirm probe hybridization to its target sequence. Oligonucleotide probes are preferred to be in the size range of from about l0 to about I00 nucleotides in length, although it is possible for probes to be as much as and above about 500 nucleotides in length. or below 10 nucleotides in length.

A "hybrid" or a "duplex" is a complex formed between two single-stranded nucleic acid sequences by Watson-Crick base pairings or non-canonical base pairings between the complementary bases. "Hybridization" is the process by which two complementary strands of nucleic acid combine to form a double-stranded structure ("hybrid" or "duplex"l. A "fungus" or "yeast" is meant any organism of the kingdom Fungi, and preferably, is directed towards any organism ofthe phylum Ascomycota .

"Complementarity" is a property conferred by the base sequence ofa single strand of DNA or RNA which may fonn a hybrid or double-stranded DNA:DNA, RNA:RNA or DNA:RNA through hydrogen bonding between Watson-Crick base pairs on the respective strands. Adenine (A) ordinarily complements thymine (T) or uracil (U), while guanine (G) ordinarily complements cytosine (C).

The term "stringency" is used to describe the temperature, ionic strength and solvent composition existing during hybridization and the subsequent processing steps. Those skilled in the art will recognize that “stringency“ conditions may be altered by varying those parameters either individually or together. Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands forming a hybrid. Stringency conditions are chosen to maximize the difference in stability between the hybrid formed with the target and the non—target nucleic acid.

With “high stringency" conditions, nucleic acid base pairing will occur only between nucleic acid tragmcnts that have a high frequency of complementary base sequences (for exainple. hybridization under “high stringency” conditions, may occur between homologs with about 85- l00% identity, preferably about 70-l00% identity). With medium stringency conditions. nucleic acid base pairing will occur between nucleic acids with an intemiediate frequency of complemcntaiy base sequences (for example, hybridization under “medium stringency" conditions may occur between homologs with about 50-70% identity). Thus, conditions of "weak" or "low" stringency are often required with nucleic acids that are derived from organisms that are genetically diverse. as the frequency ofcomplementary sequences is usually less.

‘High stringency’ conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of SXSSPE (43.8g/I NaCl, 6.9 g/l N8HgPO4H2O and L85 g/I l:‘D'l‘A, ph adjusted to 7.4 with NaOH), 0.5% SDS, 5xDenhardt‘s reagent and l0Oug/ml denatured salmon sperm DNA followed by washing in a solution comprising O.lxSSPE, I.0%SDS at 42° C. when a probe olabout 500 nucleotides in length is used.

“Medium stringency’ conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of SXSSPE (43.8 g/I NaCl. 6.9 g/I NaH2PO4H;O and L85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS. 5xDenhardt‘s reagent and 100 ug/ml denatured salmon sperm DNA followed by washing in 3 solution Comprising l .0XSSPE, l.O% SDS at 42° C, when a probe oliabout 500 nucleotides in length is used.

‘Low stringency‘ conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of SXSSPE (43.8 g/I NaCl, 6.9 g/l NaH2PO4H3O and L35 g/l EDTA. pH adjusted to 7.4 with NaOH), 0.1% SDS, 5xDenhardt‘s reagent [50xDenhardt‘s contains per 500ml: 5g Ficoll (Type 400. Pharamcia). 5 g BSA (Fraction V; Sigma)] and W0 pg/ml I.) IJ1 ‘.44 ® K. J L!- denaturcd salmon sperm DNA followed by washing in a solution comprising SxSSPE, 0. I % SDS at 42° C. when a probe of about 500 nucleotides in length is used.

In the context of nucleic acid in-vitro amplification based technologies, “stringency“ is achieved by applying temperature conditions and ionic buffer conditions that are particular to that in-vilro anrplitication technology. For example, in the context of PCR and real-time PCR, “stringency" is achieved by applying specific temperatures and ionic buffer strength for hybridisation of the oligonncleotide primers and, with regards to real—time PCR hybridisation of the probe/s. to the target nucleic acid for in-virro amplification ofthe target nucleic acid.

One skilled in the art will understand that substantially corresponding probes of the invention can vary from the referred-to sequence and still hybridize to the same target nucleic acid sequence. lhis variation from the nucleic acid may be stated in terms ofa percentage of identical bases within the sequence or the percentage of perfectly complementary bases between the probe and its target sequence. Probes ofthc present invention substantially correspond to a nucleic acid sequence ifthese percentages are from about 100% to about 80% or from 0 base niismatchcs in about I0 nucleotide target sequence to about 2 bases mismatched in an about It) nucleotide target sequence. In preferred embodiments, the percentage is from about l00% to about 85%. In more preferred embodiments, this percentage is from about 90% to about 100%; in other preferred embodiments, this percentage is from about 95% to about l00% By "stitliciently complementary" or "substantially complementary" is meant nucleic acids having a sufficient amount of contiguous complementary nucleotides to form, under high stringency hybridization conditions, a hybrid that is stable for detection. Substantially complementary to can also refer to sequences with at least 90% identity to, eg, 95, 96, 97, 98. , or 100% identity to, a given reference sequence.

The terms “idcntical“ or percent “identity,” in the context oftwo or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specilied percentage ofamino acid residues or nucleotides that are the same (tl.t’., 90%, 91%, 92%, 93%. 94%, 95%, 96%, 97%, 93%, 99%, or higher identity over a specified region. when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site at ncbi.nlm.nih.gov/Bl.AST/ or the like). Such sequences are then said to be “substantially identical." This definition also refers to. or may be applied to. the compliment of 2! test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably. identity exists over a region that is at least about amino acids or nucleotides in length, or more preferably over a region that is 50-I00 ammo acids or nucleotides in length.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared, When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated. ifnecessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

A “comparison window.” as used herein, includes reference to a segment of any one of the number ofcontiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about I00 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well- known in the an. Optimal alignment of sequences for comparison can be conducted, eg. by the local homology algorithm of Smith & Waterman. Adv. Appl. Math. 2:482 ti l98l ), by the homology alignment algorithm of Needleman & Wunseh, J. Mol. Biol. 43:443 (l 970), by the search for similarity method of Pearson & Lipman, Proc. Nat ‘I. Acad. Sci. USA 852444 (I088). by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr.. Madison. WI), or by manual alignment and visual inspection (see, e.g,, Current Proroc-015 in /tl'u1c(rm'ar /Eiologv (Ausube| el 01., eds. I987-2005. Wiley lnterscience)).

A preferred example ofalgorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul er ul.. Nllc’. Acids Res. 25:3389-3402 (I977) and Altschul et a/., J. Mol. Biol. 2152403-4|0 (I990). respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins ofthc invention.

Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (l-lSl’s) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word ofthe same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul at CI/n‘S1I{)"(’)~ These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are Ix.) ‘Jr calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > O) and N (penalty score for mismatching residues; always < 0}.

For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension oflhe word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end ofeither sequence is reached. The BLAST algorithm parameters W, T, and X detennine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of l I, an expectation (E) of l0, M=5, N=-4 and a comparison ofboth strands.

I-‘or amino acid sequences, the BLASTP program uses as defaults a wordlength of}, and expectation (E) ofl0, and the BLOSUM62 scoring matrix (see Henikoff& Henikoff, Proc.

Nut/. /l(.‘clc/. Sci. USA 89: l09l5 (1989)) alignments (B) of50, expectation (E) of IO, M=S, N=-4, and a comparison of both strands.

“Nucleic acid“ refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single— or double—stranded fomi, and complements thereof. The tenn encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages. which are synthetic. naturally occurring, and non-naturally occurring, which have similar binding propenies as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates. methyl phosphonates. chiral-methyl phosphonates, 2-O-methyl ribonucleotidcs. peptide-nucleic acids (PNAS).

By "nucleic acid hybrid" or "probeztarget duplex" is meant a structure that is a double-stranded, hydrogen-bonded structure, preferably about It) to about I00 nucleotides in length, more preferably [4 to 50 nucleotides in length, although this will depend to an extent on the overall length ofthe oligonucleotide probe. The structure is sufficiently stable to be detected by means such as chemiluminescent or fluorescent light detection, autoradiography, electrochemical analysis or gel electrophoresis. Such hybrids include RNA:RNA, RNA:DNA, or DNA;DNA duplex molecules.

"RNA and DNA equivalents" refer to RNA and DNA molecules having the same complementary base pair hybridization properties. RNA and DNA equivalents have different sugar groups (ie., ribose versus deoxyribose), and may differ by the presence ofuracil in RNA and thymine in DNA. The difference between RNA and DNA equivalents do not contribute to differences in substantially corresponding nucleic acid sequences because the equivalents have the same degree of complementarity to a particular sequence. ha 6 By "preferentially hybridize" is meant that under high stringency hybridization conditions oligonucleotidc probes can hybridize their target nucleic acids to form stable probenargct hybrids (thereby indicating the presence ofthe target nucleic acids) without forming stable probeznon-target hybrids (that would indicate the presence of non-target nucleic acids from other organisms). Thus, the probe hybridizes to target nucleic acid to a sufliciently greater extent than to non-target nucleic acid to enable one skilled in the art to accurately detect the presence of (for example Candida) and distinguish these species from other organisms.

Preferential hybridization can be measured using techniques known in the art and described herein.

By "theranosiics" is meant the use ofdiagnostic testing to diagnose the disease, choose the correct treatment regime and monitor the patient response to therapy. The theranostics ofthe invention may be based on the use of an NAD assay ofthis invention on samples, swabs or specimens collected from the patient.

Object ofthe Invention It is an object of the current invention to provide sequences and/or diagnostic assays to detect and identify one or more yeast and fungal species. The current inventors have made use ofthe cll’2y gene sequence to design primers that are specific to Candida elF2 7 genes and to /lspe/‘gi//its elF2y genes. Such primers not only allow the detection of yeast and fungal species but also allow distinction between Candida and Aspergillus spp. This has an advantage over the prior art in that if one wants to identify a fungal pathogen in a sample, which contains Candida as a commensali the approach of using universal primers may not be successful‘ There is a strong possibility that the Candida will out-compete the fungal pathogen in the amplification process and will be preferentially amplified, resulting in failure to detect the disease-causing pathogen. The current invention further provides for primers and probes that allow discrimination between different Candida species and among difierent Aspergillus species.

Summagj of the Invention The present invention provides for a diagnostic kit for detection and identification ofyeast and/or fungal species, comprising at least one oligonucleotide probe capable of binding to at least a portion ofthe elF2 7 gene or its corresponding mRNA. The oligonucleotide probe may have a sequence substantially homologous to or substantially complementary to a portion olithe cll"2 7 gene or its corresponding mRNA. It will thus be capable of binding or hybridizing with a complementary DNA or RNA molecule. The e|F2 7 gene may be a fungal elF2 V gene. The ell-"2 y gene may be a yeast elF2 y gene. The nucleic acid molecule may be synthetic. to '1» The portion ofthe elF2 7 gene may be equivalent to a portion of the region ofthe gene from base pair position 718 to I040 of C. a1bicanselF2 7 gene. The portion ofthe elF2 7 gene may be equivalent to a portion of the region ofthe gene from base pair position 790 to 934 oft". ulbicans elF2 7 gene. The portion of the elF2 7 gene may be equivalent to a portion ofthe region ofthe gene from base pair position 872 to 972 of C. glabrala elF2 7 gene. The portion of the elF2 7 gene may be equivalent to a portion ofthe region ofthe gene from base pair position l5l to 274 of C. parapsilosis elF2 7 gene. The portion ofthe elF2 7 gene may be equivalent to a portion ofthe region of the gene from base pair position I40 to 270 of C. iropicalis e|F2 7 gene.

The portion ofthe eIF2 7 gene may be equivalent to a portion ofthe region olthe gene from base pair position I I5 to 224 ofC. krusei elF2 7 gene. The portion ofthe clF2 7 gene may be equivalent to a portion ofthe region ofthe gene from base pair position 12] to 374 of .«t.fimn'gutu.s' elF2 7 gene. The portion ofthe elF2 7 gene may be equivalent to a portion olthe region of the gene from base pair position I64 to 261 ofA.,/imrigatus ell-‘2 7 gene. The portion of the ell-‘2 7 gene may be equivalent to a portion of the region ofthe gene from base pair position I55 to 352 of/4 flavus elF2 7 gene. The portion ofthe elF2 7 gene may be equivalent to a portion ofthe region ofthe gene from base pair position 92 to I89 ofA. niger e|F2 7 gene. The portion of the elF2 7 gene may be equivalent to a portion of the region of the gene from base pair position I49 to 246 OIA. terreus ell-‘2 7 gene. A skilled person will appreciate that sequences equivalent to these regions can be found in other organisms, but not necessarily in the same position.

The oligonucleotide probe may have a sequence of SEQ ID NO I, 2, 84, 85, 86, 37, 38, I03, I09. I I0, I l 1, 125 or 138, or a sequence substantially homologous to or substantially complementary to those sequences, which can also act as a probe for the elF2 7 gene.

The kit may comprise more than one such probe. in particular the kit may comprise a plurality ofsuch probes. In addition the kit may comprise additional probes for other organisms, such as, for example. bacterial species or viruses.

The kit may further comprise at least one primer for amplification of at least a portion of the elF2 7 gene. Suitably the kit may comprise at least one forward in wire amplification primer and/ or at least one reverse in virro amplitication primer, the forward amplification primer having :1 sequence selected from the group comprising SEQ ID NO 3, 5, 89, 91.93, 95, 97, I04, I05, I12, I I3, II4, H5, 116, I I7, H8, H9. I20, 135 or I36 or a sequence being substantially lioinologous or complementary thereto which can also act as a forward amplification primer for the e|F2 7 gene, and/ or the reverse amplification primer having a sequence selected from the group comprising SEQ ID NO 4, 6, 90,92, 94, 96, 98, 106, I07, l2l, I22, I23, 124 or I37 or a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer for the elF2 7 gene.

A kit useful for detecting a Candida ell-‘.27 polynucleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID NOs: 1, 84, 85, 86, 87, 38 or I38 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID N03: I , 84, 85, 86, 87, 88 or I38. The kit may further comprise at least one forward primer selected from the group comprising SEQ ID N05: 5. 89, 9|. 93. 95. 97, 135 or 136 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID N09: 5, 89, 9], 93, 95, 97, I35 or 136 and/or a reverse primer selected from the group comprising SEQ ID NOS: 6, 90, 92, 94, 96, 98, 137 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NOS: 6, 90, 92, 94. 96, 98 or 137.

A kit for detecting or identifying a Candida a/(‘cans elF2y polynucleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID NO: I, 84 or I38 or which preleretitially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I. 84 or I38 and further comprises at least one forward primer selected from the group comprising SEQ ID N0: 5, 39, I35 or I36 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 5, 89, I35 or 136 and/or at least one reverse primer selected from the group comprising SEQ ID NO: 6, 90 or l37.or which preferentially liybridizes to the same nucleotide sequence as is preferentially hybriclized by SEQ ID NO: 6. 90. or I37.

A kit for detecting or identifying a Candida glabrala eIF2y polynucleotide comprises at least one oligonucleolide probe selected from the group comprising SEQ ID NO: 85 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 85 and further comprises at least one forward primer selected from the group comprising SEQ ID NO: 9| or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 9| and/or at least one reverse primer selected from the group comprising SEQ ID NO; 92 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 92.

A kit tor detecting or identifying a Candida parapsflosis elF2y polynueleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID NO: 86 or which preferentially liybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 86 and further comprises at least one forward primer selected from the group comprising SEQ ID NO: 93 or which preferentially hybridizes to the same nucleotide sequence r.) in as is preferentially hybridized by SEQ ID NO: 93 and/or at least one reverse primer selected from the group comprising SEQ ID NO: 94. or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 94.

A kit for detecting or identifying a Candida tropicalis eIF2y polynucleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID NO: 87 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 87 and further comprises at least one forward primer selected from the group comprising SEQ ID NO: 95 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 95 and/or at least one reverse primer selected from the group comprising SEQ ID NO: 96 or which preferentially hybridizes to the saute nucleotide sequence as is preferentially hybridized by SEQ ID NO; 96. /\ kit for detecting or identifying a Candida /rrusei eIF2y polynucleotide comprises at least one oligonuclcotide probe selected from the group comprising SEQ ID NO: 88 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 88 and further comprises at least one forward primer selected from the group comprising ID NO: 97 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 97 and/or at least one reverse primer selected from the group comprising SEQ ID NO: 98 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 98.

A diagnostic kit for detecting or identifying an Aspergillus elF2'y polynucleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID N05: 2, I03, I09, I I0. I I I or I25 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NOSI 2, I08, I09, I 10, I I I or I25. The kit may further comprise at least one forward primer selected from the group comprising SEQ ID N05: 3, I04.

I05, I I2. II3, II4, H5, 116, II7, I18, I I9 or I20 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NOS: 3, I04, I05, I I2, I I3.

I I4, I I5. I I6. I I7, I I8, I I9 or 120 and/or at least one reverse primer selected from the group comprising SEQ ID NOS: 4, 106, I07. l2I, I22, I23 or I24 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NOS: 4. I06, I07.

IZI. 122.123 or 124.

A kit for detecting or identifying a Aspergillusfziniigarus eIF2y polynucleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID NO: 2, I I I or I25 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 2, I I I or I25 and further comprises at least one forward primer I3 selected from the group comprising SEQ ID NO: 3, I12, I I3, H5, H7, II9, or 120 or which prcfcrentiztlly hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 3, I I2, I I3. I15. II7, I19, or 120 and/or at least one reverse primer selected from the group comprising SEQ ID NO: 4 ,I 06, I2 I , I23, I24 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 4 ,l 06. I21. I23. I24.

A kit for detecting or identifying a Aspergi/{usfluvus eIF2y polynucleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID NO: I10 or which preferentially liybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I I0 and further comprises at least one forward primer selected from the group coinprising SEQ ID NO: I04 or I I4 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 104 or I I4 and at least one reverse primer selected from the group comprising SEQ ID NO: 106 122, or I23 or which preferentially hybridi/.es to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I06 l22.or I23 A kit for detecting or identifying a Aspergiiliis niger eIF2y polynucleotide comprises at least one oligonucleotide probe selected from the group comprising SEQ ID NO: 108 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I08 and further comprises at least one forward primer selected from the group comprising SEQ ID NO: I04. II4, I I6 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I04. I I4, I I6 and at least one reverse primer selected from the group comprising SEQ ID NO: 107. I22, I23 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I07. I22. 123.

A kit for detecting or identifying a Aspergil'Ius ten-ens eIF2y polynueleolide comprises at least one oligonuclcotide probe selected from the group comprising SEQ ID NO: I09 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I09 and further comprises at least one forward primer selected from the group comprising SEQ ID NO: I05, I I5, I I8 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I05, ll5. I I8 and at least one reverse primer selected from the group comprising SEQ ID NO: I07, I22 or I23 or which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: I07, I22 or I23. lhe iclcntitied sequences are suitable not only for in vilro DNA/RNA amplification based detection systems but also for signal amplification based detection systems. Furthermore. the sequences ofthe invention identified as suitable targets provide the advantages ofhaving significant intragenic sequence heterogeneity in some regions, which is advantageous and enables aspects ofthe invention to be directed towards group or species-specific targets, and also having significant sequence homogeneity in some regions. which enables aspects ofthc invention to be directed towards genus—spcciflc yeast and fungal primers and probes for use in direct nucleic acid detection technologies, signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies for yeast and fungal diagnostics. The e|F2 7 sequences allow for multi-test capability and automation in diagnostic assays.

One otthe advantages ofthe sequences of the present invention is that the intragcnic elF2 y nucleotide sequence diversity between closely related yeast and fungal species enables specific primers and probes for use in diagnostics assays for the detection of yeast and fungi to be designed. The elF2 y nucleotide sequences, both DNA and RNA can be used with direct dcwcuon.Qgna|amphficafiondewcfionandinvHn)mnphficafiontechmfiogmshidmgnosucs assays. The elF2 y sequences allow for multi-test capability and automation in diagnostic assays.

The kit may further comprise at least one primer for amplification of at least a portion ofthe cl|“2 7 gene. Suitably the kit comprises a forward and a reverse primer for a portion ofthe elF2 y gene.

The portion ofthe elF2 ‘y gene may be equivalent to a portion ofthe region of the gene from base pair position 7| 8 to base pair position 1040 of the elF2 y gene in C. albicans. Particularly prel‘crrcd are kits comprising a probe for a portion of the elF2 7 C.albicans gene and / or a probe fora portion orthe region ofthe gene equivalent to base pair position 718 to base pair position I040 of the elF2 y gene in C. albicans. Sequences equivalent to base pair position 718 to base pair position 1040 can be found in other organisms, but not necessarily in the same position.

The portion of the e[F2 7 gene may be equivalent to a portion ofthe region oftlie gene from base pair position l2l to base pair position 374 in Aspergillusfumtgalus. Particularly preferred. are kits comprising a probe for a portion ofthe elF2 ‘y Afumigatus gene and / or a probe for a portion of the region ofthe gene equivalent to base pair position I2] to base pair position 374 in AspcI'gi/lzrsyfirrnigatus. Sequences equivalent to base pair position l2l to base pair position 374 can be found in other organisms, but not necessarily in the same position. The kit may also comprise additional primers or probes. The primer may have a sequence selected from the group SEQIDFND3thmugHoSEQlDFK)6orasammweammammHyhomomgmntoor substantially complementary to those sequences, which can also act as a primer for the elF2 y gcnc.

'J I The kit may comprise at least one forward in vitro amplification primer and at least one reverse in rilru amplilication primer, the forward amplification primer having a sequence selected from the group consisting of SEQ ID N03 or SEQ ID NO 5.or a sequence being substantially homologous or complementary thereto which can also act as a forward amplification primer for the clF2 y gene. and the reverse amplification primer having a sequence selected from the group consisting of SEQ ID NO 4 or SEQ ID NO 6 or a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer for the elF2 y gene.

The diagnostic kit may be based on direct nucleic acid detection technologies, signal ainplitication nucleic acid detection technologies, and nucleic acid in virro amplification tcchnologies is selected from one or more of Polymerase Chain Reaction (PCR), Ligase Chain Reaction tl,CR), Nucleic Acids Sequence Based Amplification (NASBA), Strand Displacement Aniplitication tSDA), Transcription Mediated Amplification (TMA), Branched DNA technology (bDNA) and Rolling Circle Amplification Technology (RCAT) )\ or other in virro enzymatic amplification technologies.

The invention also provides a nucleic acid molecule selected from the group consisting of SEQ ID N01 to SEQ ID NO. I35, preferably SEQ ID NO. I through to 74 and SEQ ID NO. 84 through to I35. and sequences substantially homologous thereto, or substantially complementary to a portion thereof and having a function in diagnostics based on the elF2 y gene. The nucleic acid molecule may comprise an oligonucleotide having a sequence substantially homologous to or substantially complementary to a portion ofa nucleic acid molecule ofSEQ ID NO.l to SEQ ID NO. I35, preferably SEQ ID NO. I through to 74 and SEQ ID NO. 84 through to I35. The invention also provides a method ofdetecting a target organism in a test sample comprising the steps of: (i) mixing the test sample with at least one oligonucleotide probe as defined above under appropriate conditions‘. and (ii) hybridizing under high stringency conditions any nucleic acid that may be present in the test satnple with the oligonucleotide to form a probe:target duplex; and (iii) determining whether a probeztarget duplex is present; the presence ofthe duplex positively identifying the presence of the target organism in the test sample.

The nucleic acid molecule and kits of the present invention may be used in a diagnostic assay to detect the presence of one or more yeast and/or fungal species, to measure yeast and/or lungal titres in a patient or in a method of assessing the efficacy c-fa treatment regime designed to reduce yeast and/or fungal titre in a patient or to measure yeast and/or fungal contamination in an environment. The environment may be a hospital, or it may be a food sample, an environmental sample e.g. water, an industrial sample such as an in-process sample or an cnd product requiring bioburden or quality assessment.

The kits and the nucleic acid molecule of the invention may be used in the identification and/or characteri7ation ofone or more disruptive agents that can be used to disrupt the ell-“2 y gene function. The disruptive agent may be selected from the group consisting ofantisense RNA, PNA, and siRNA.

In some embodiments ofthe invention, a nucleic acid molecule comprising a species-specific probe can be used to discriminate between species of the same genus.

The oligonuclcotides ofthe invention may be provided in a composition for detecting the nucleic acids ofyeast and fungal target organisms. Such a composition may also comprise buffers, enzymes, detergents, salts and so on, as appropriate to the intended use of the compositions. It is also envisioned that the compositions, kits and methods of the invention, while described herein as comprising at least one synthetic oligonucleotide, may also comprise natural oligonucleotides with substantially the same sequences as the synthetic nucleotide f ragmcnts in place of, or alongside synthetic oligonucleotides.

The invention also provides for an in virro amplification diagnostic kit for a target ycast and/or fungal organism comprising at least one forward in vitro amplification primer and at least one reverse in 1')!I'() amplification primer, the forward amplification primer being selected from the group consisting of one or more ofa sequence being substantially homologous or complementary thereto which can also act as a forward amplification primer. and the reverse amplification primer being selected from the group consisting of one or more ofor a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer.

The invention also provides for a diagnostic kit for detecting the presence ofcandidate yeast and/or fungal species, comprising one or more DNA probes comprising a sequence substantially complementary to, or substantially homologous to the sequence ofthe elF2 y gene ofthe candidate yeast and/or fungal species. The present invention also provides for one or more synthetic oligonucleotides having a nucleotide sequence substantially homologous to or substantially complementary to one or more ofthe group consisting of the elF2 y gene or mRN A transcript thereof‘, the yeast and or fungal elF2 y gene or mRNA transcript thereof. the yeast elF2 y gene or mRNA transcript thereof. one or more ofSEQ ID NO I-SEQ ll) NO I35, preferably SEQ ID NO. 1 through to 74 and SEQ ID NO. 84 through to 135.

The nucleotide may comprise DNA. The nucleotide may comprise RNA. The nucleotide may comprise a mixture of DNA, RNA and PNA. The nucleotide may comprise synthetic nucleotides. The sequences of the invention (and the sequences relating to the methods. kits compositions and assays ofthe invention") may be selected to be substantially homologous to a portion of the coding region oftbe ell-"2 7 gene. The gene may be a gene from a target yeast or fungal organism. The sequences of the invention are preferably sufficient so as to be able form a probettarget duplex to the portion of the sequence.

The invention also provides for a diagnostic kit for a target yeast or fungal organism comprising an oligonucleolide probe substantially homologous to or substantially complementary to an oligonuelcotide of the invention (which may be synthetic). It will be appreciated that sequences suitable for use as in virro amplification primers may also be suitable for use as oligonucleotide probes: while it is preferable that amplification primers may have a complementary portion of between about 15 nucleotides and about 30 nucleotides (more preferably about lS—about 23, most preferably about 20 to about 23), oligonucleotide probes ofthe invention may be any suitable length. The skilled person will appreciate that different hybridization and or annealing conditions will be required depending on the length, nature & structure (eg. Hybridization probe pairs for LightCyc|er, Taqman S’ exonuclease probes, hairpin loop structures etc. and sequence of the oligonuclcotide probe selected.

Kits and assays ofthe invention may also be provided wherein the oligonucleotide probe is imtnobilized on a surface. Such a surface may be a bead. a membrane, a column, dipstick, a nanoparticle, the interior surface ofa reaction chamber such as the well ofa diagnostic plate or inside ofa reaction tube, capillary or vessel or the like.

The target yeast or fungal organism may be selected from the group consisting of C. albicam, C. g/ubrulu, C. /rrusei, C. par'ap.riIosi.s', C. !ropica1i.r, C. dubliniensis, C. gui/licrmrmdii, C.

II0l‘l'£’glcIl.$‘In', C. famata, C. haemulom", C. kefvr, C. urilis, C. wswarzallzii, C . Izmir:/zicze and C. ct‘/fL—'rr‘i, .4.jzimz‘gaIus, IV.fis'cheri, A .c!avams, A niger. A. Ierreus. A .flavus, A .ver.xt'c0/or and A. nidzr/(rm; The target yeast organisms may be a Candida species for the given set of primers already experimentally demonstrated, and more preferably, selected from the group consisting oft‘. ulhiccms, C. g/ubrula, C. krusei. C. parapsilosis, C. dubliniensis and C. tropic(1li.s', C. guillimnomfii. C . rz0rvegt'ensi3. C. _ famata, C. huemuloni, C. kefyr, C. utilis. C. viswctrtatlrii, C. /trxilrtitirw and C. Ciffirii.

Under these circumstances, the amplification primers and oligonucleolide probes ofthe invention may be designed to a gene specific or genus specific region so as to be able to identify one or more. or most, or substantially all ofthe desired organisms ofthe target yeast organism grouping.

The target fungal organisms may be an Aspergillus species for given set of primers already experimentally demonstrated, and more preferably. selected from the group consisting of A./iuiiigcrlt/s, .-’V.fl.scheri, A .cIavatus, A JIig(!I‘, A. Ierreus, A flavus, A .ver.s'ic0/orumir-ll. n It/ll/(‘Ill.\'.

K.» KJ1 The test sample may comprise cells of the target yeast and/or fungal organism. The method may also comprise a step for releasing nucleic acid from any cells of the target yeast or fungal organism that may be present in said test sample. Ideally, the test sample is a lysate ofan obtained sample from a patient (such as a swab, or blood, urine. saliva, a bronchial lavage dental specimen, skin specimen, scalp specimen, transplant organ biopsy, stool, mucus, or discharge sample). The test samples may be a food sample, a water sample an environmental sample, an end product, end product or in-process industrial sample.

The invention also provides for the use of any one of SEQ ID NO.l to SEQ ID NO. 135, prelerahly SI-Q ID NO. 1 through to 74 and SEQ ID NO. 84 through to 135, in a diagnostic assay for the presence of one or more yeast or fungal species. The species may be selected from the group consisting of C. albicans, C. g/abrara, C. krusei, C. parapsilosis. C. tropicalis, C. c/it/’)IiIriczz.\*is, C. guilliermondii, C. norvegiensis, C. famala, C. haemulom, C‘ kefirr, C. uIi'li'.t. C. w’.tn'(inc1Ilti"i, C. Iusitaniae, C. cifferii, A.fumr'garus, Nfischeri, A .cIavaIu.9. A .niger, .4. tarrcus.

A flaim, A mcrsicolor and A. niduians.

The invention also provides for kits for use in theranostics. food safety diagnostics, industrial microbiology diagnostics, environmental monitoring, veterinary diagnostics. bio-terrorism diagnostics comprising one or more ofthe synthetic oligonucleotides ofthe invention. The kits may also comprise one or more articles selected from the group consisting of appropriate sample collecting instruments, reagent containers, buffers, labelling moieties. solutions, detergents and supplementary solutions. The invention also provides for use of the sequences, compositions, nucleotide fragments. assays, and kits of the invention in clinical diagnostics, thcranosties, Food safety diagnostics, Industrial microbiology diagnostics, linvironmental monitoring, Veterinary diagnostics, Bio—terrorism diagnostics.

The nucleic acid molecules, composition, kits or methods may be used in a diagnostic nucleic acid based assay for the detection of yeast and/or fungal species.

The nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure yeast and/or fungal titres in a patient. The titres may be measured in vim).

The nucleic acid molecules, composition, kits or methods may be used in a method olassessing the efficacy ofa treatment regime designed to reduce yeast and/or fungal titre in a patient comprising assessing the yeast and/or fungal titre in the patient (by in viva methods or in vilro methods) at one or more key stages of the treatment regime. Suitable key stages may include before treatment, during treatment and after treatment. The treatment regime may comprise an antifungal agent, such as a pharmaceutical drug.

The nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure potential yeast and/or fungal contamination, for example, in a hospital.

The nucleic acid molecules, composition. kits or methods may be used in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the elF2 y gene function. Suitable disruptive agents may be selected from the group consisting ofantisense RNA. PN/\t siRNA.

The current invention will now be described with reference to the following figures. It is to be understood that the following detailed description and accompanying figures, are exemplary and explanatory only and are intended to provide a further explanation of the present invention, as claimed and not to limit the scope of the invention in any way.

Bricfdescription of the Figures Figure 1: Primers binding sites (grey highlights) and probe (bold text) in e|F2y of Candida uibicuns (.\’M_7l5569. 1). The amplified region of interest is underlined. (Position of the region ofintcrest: 7| 8-I040).

Figure 2: Primers binding sites (grey highlights) and probe (bold text) in elF2y ol‘,4.rpergi!Iz/.2 _fmnigaIux (X/l«I_74697-1.2). The amplified region of interest is underlined. (Position ofthe region ofinterest: 121-374).

Figure 3: Amplification plot from Real-time PCR assay for C. albicans based on the elF2 y gene with TaqMan probe Pl-CanelF2. Specificity ofthe assay was tested using a panel of DNA from 4 other Candida species and Aspergillmfumigalus. The 3 C, albicans strains tested were detected and no cross-reaction was seen with DNA from the other Candida species and A. ‘/irlrrigrtlus.

Figure 4: Amplification plot from Rea|—time PCR assay forA.fumigaIus based on the ell-'2 7 gene with TaqMan probe Pl-AspelF2. Specificity ofthe assay was tested against a panel oi‘ DNA from 6 closely related Aspergillus species and C. albicans. The 3 A.fzmn‘gatu.i' strains were detected and no cross-reaction was seen with DNA from the other Aspwtzil/tr.t‘ spp and C. ulf7i«:an.s.

Figure 5: (SEQ ID NO: 99) Primers binding sites (grey highlights) and probe (bold text) in e|F2y ol‘(,'ant'/ida albicans (XM_7l 5569. I ). The amplified region ofinterest is underlined.

(Position ofthe region ofinterest: 664-! 040).

Figure 6: (SEQ ID NO: 100) Primers binding sites (grey highlights) and probe (bold text) in e|F2~,' ol‘ ( 'ancIz'da glabrata (XM_4476 l 0.1 ). The amplified region of interest is underlined.

(Position ofthe region ofinterest: 872-972) Figure 7: (SEQ ID NO: I01) Primers binding sites (grey highlights) and probe (bold text) in ell-‘Z7 ot’ (‘andida parapxilosis (CBS 604 generated sequence). The amplified region of interest is underlined. (Position ofthe region ofinterest: l5 l-274).

Figure 8: (SEQ ID NO: 102) Primers binding sites (grey highlights) and probe (bold text) in ell-‘By ol‘('u/idida rropicalis (CBS 94 generated sequence). The amplified region of interest is underlined. (Position ofthe region of interest: l40-270) Figure 9: (SEQ ID NO: I03) Primers binding sites (grey highlights) and probe (bold text) in eIF'.‘y ol‘ (‘amI'ida krusei (CBS 573 generated sequence). The amplified region of interest is underlined. (Position ofthe region of interest: I l5-224) Figure 10: Amplification plot from Real-time PCR assay for C. albicans based on the elF2 y gene with TaqMan probe ALEF2. Specificity ofthe assay was tested using a panel ol‘ DNA from 14 C. albicans strains and 19 other Candida species. (a) The 14 C. ulbicarzs strains tested were detected. (b) No cross-reaction was seen with DNA from 19 the other Candida species.

Signal obtained only from (+) control. (0) Sensitivity ofthe assay was tested using a various inputs of template DNA from C. albicans. The LOD of the assay was found to be between 1-5 cell equivalents.

Figure ll: Amplification plot from Real-time PCR assay for C. glabrata based on the elF2y gene with 'l‘aqMan probe GlabA. Specificity ofthe assay was tested using a panel of DNA from C. glubrata strains, l9 other Candida species, Aspergillztsfllmigatus and Sacc/turomyces ccrei=i'.s'r'ae. (a) The 10 C. glabrata strains tested were detected. (b) No cross-reaction was seen with DNA from 19 the other Candida species or with Aspergillus fumigatus or Saccharomycec c'ercvi.s‘iae. Signal obtained only from (+) control. (c) The LOD of the assay was found to be ~ 2 cell equivalents.

Figure 12: Amplification plot from Real-time PCR assay for C. parapsilosis based on the ell-‘2 7 gene with TaqMan probe ParA. Specificity ofthe assay was tested using a panel of DNA from I2 C /rurapsilosis strains. l9 other Candida species, Aspergiilusfimzigatzm and Sacc/rurom_yces cerevisiae. (a) The l2 C . parapsilosis strains tested were detected. (b) No cross- reaction was seen with DNA from the other 19 Candida species or with Aspergil/zmfit/mgarus or Sacchuromyccs cerevisiae. Signal obtained only from (+) control. (c) The l.OD of the assay was found to be ~ 10 cell equivalents.

Figure 13: Amplification plot from Real-time PCR assay for C. tropicalis based on the elF2 y gene with TaqMan probe TropicA. Specificity ofthe assay was tested using a panel of DNA from I2 C tropicalis strains, 19 other Candida species, Aspergillzzsjitmigatus and .S'ucc/mronzyccs cerevisiae. (a) The 12 C. tropicalis strains tested were detected. (b) No cross- reaetion was seen with DNA from the other l9 Candida species or with Aspergillusfuinigarru or Succlmrnnrires cerevisiae. Signal obtained only from (+) control. (c) The LOD of the assay was found to be ~ 20 cell equivalents.

Figure 14: Amplification plot from Rea|~time PCR assay for C. krusei based on the e|F2y gene with TauMan probe KrusA. Specificity ofthe assay was tested using a panel of DNA from 9 C. lt1'lt.\'c’t strains, 19 other Candida species, Aspergillusfimiigatus and .S‘accharomyce.x cerewsicw. (a) the 9 C’. /trt1.s‘ei strains tested were detected. (b) No cross-reaction was seen with DNA from the other 19 Candida species or with Aspergi/lusfimzigalus or Saccharomyces cerevisiae. Signal obtained only from (+) control. (c) The LOD of the assay was found to be ~ 2 cell equivalents.

Figure 15: (SEQ ID NO: 50) Primers binding sites (grey highlights) and probe (bold text) in clF2y ot‘Aspergi1lus fumigarus (7273 generated sequence). The amplified region of interest is underlined. (corresponding to base pair positions 164-261 of published sequence).

Figure 16: (SEQ ID NO: 122) Primers binding sites (grey highlights) and probe (bold text) in e|F2y oi‘.-tspcrgillusflavus (I l7.62 generated sequence). The amplified region of interest is underlined. (corresponding to base pair positions 135-252 of published sequence).

Figure 17: (SEQ ID N0: 58) Primers binding sites (grey highlights) and probe (bold text) in e|F2y ohtspergi/[us niger (6727 generated sequence). The amplified region of interest is underlined (corresponding to base pair positions 92-1 89 of published sequence).

Figure 18: (SEQ ID NO: 64) Primers binding sites (grey highlights) and probe ( bold text) in ell-‘By ol‘AspergiIIzts rerreus (S677 generated sequence). The amplified region of interest is underlined. (corresponding to base pair positions 149-246 of published).

Detailed Description of the Invention Materials and Methods Cell Culture A collection of geographically distinct strains ofclinieally relevant Candida species was obtained from a number of culture collections.Candr‘da species were cultured in Sabouraud broth (4% wt/vol glucose, 1% wt/vol peptone, I,5 % agar) for 48 hours at 37"C in a shaking incubator. Aspergillus species (A.fumigatus, A.flavus, A. niger and Aterruous and other closely related species) were cultured in Sabouraud broth (4% wt/vol glucose, 1% wt/vol peptone, 1.5 % agar) or agar for 3-4 days at 25°C.

DNA Extraction Cells from (‘undida and Aspergillus spp. were pretreated with lyticase or zyinolase enzymes prior to DNA isolation. DNA was isolated from Candida and Apergillus spp. using the MagNA Pure System (Roche Molecular Systems) in combination with the MagNA pure Yeast and Bacterial isolation kit III or with the Qiagen Plant kit-according to manufacturers instructions.

Sequencing of elF2 y gene of Candida and Aspergillus species The publicly available sequences of the clF2 genes of Candida or Aspergillus species were acquired from the NCBI database and aligned using Clustal W.

The PCR primer set CanelF2-F/CanelF2-R was designed to amplify the e|F2y gene region in Cimdit/u spp. equivalent to nucleotide position 718 to nucleotide position 1040 in C. albimns (XM_7l5S69.l). (Table 1, Figure l), The PCR primer set AspelF2-F/AspelF2-R was designed to amplify a region of the elF2y gene in Aspergillus species equivalent to nucleotide position ill to nucleotide position 374 in A.frm1igaIus(XM_74697-4.2). (Table I ). The elF2 gene regions were amplified in a range of C'andia'a and Aspergillzrs spp. by conventional PCR on the iCycler Biokad PCR machine or the PTC200 Peltier thermocycler (MJ Research) using the reagents outlined in Table 2 and the thermocycling conditions described in Table 3. in order to generate sequence information, a total of 72 strains representing 20 Candida species were tested for amplification with this primer set by conventional PCR on the iCyc|er BioRad PCR machine.

PCR products were generated for 15 Candida species. C. albicans, C. glabrara. C. krusei, C pr:mp.i'i1o5i.s', C. tropicalis, C. dubliniensis, C. guillierlnondii. C. norvegieizxis, C. fumara, C. hawnuloni, C. kefvr, C. uliiis, C. viswanarlrii, C, Iusitaniae and C. crfler‘ii. and 7 Aspergillus specicst/I. fimzigalzrs. A. clavalus. A. niger, A. Ierreus, A. flavus, A. versicnlor, A. niduluns) and ,-Vim-ui'Ior_v(:/ischeri). The PCR reaction products were purified with Roche High Pure PCR Product Purification kit or with the ExoSAP-IT kit (USB) according to the manufacturers’ instructions and subsequently sequenced by Sequiserve using the forward amplification primer C2uiclF2-F or AspelF2—F.

DNA sequence information was generated for IS Candida species. (C. albicans. C. glubrata, C. /rrus~er', (I. parapsilosis. C . tropicalis, C. dub/iniensis. C. guillierniondii, C. !?0I‘\!(’gi€II.5'i.\‘. C. fauna/u. C. haemuloni, C. kefvr. C. ulilis, C. vrswanathii, C Jusitaniae and C.cifferii.- and 7 Aspergillus species(A.fim1iga!us, A. clavams, A. niger, A. lerreus, A. flaws, /l. vcr.s1c0/or, A. nm’ulans) and Neosartoryafischeri.

Table 1: PCR primers designed to amplify the eIF2 y gene regions in Camlida and Aspergillus spp PCR Reaction Mix SAMPLE x 1 I0 X Buffer (100 mM Tris HCl, I5 mM MgC|3, 500 mM KCI 5 pl pH 8.3) dNT|"s Mix, Roche (l0mM dNTP) 1 pl Primer Forward CanelF2-F or Aspell-“Z-F (l0pM) 1 pl Primer Reverse CanelF2-R or Aspell72—R (l0pM) I ul lfi/merase TaqPol, Roche lU/pl 1 pl H20 Amgen/Accugene 36-39 pl DNA Template 2- S til [LOT/1.l. VOLUME 50 ul Table 2: PCR reagents used to amplify the elF2 7 gene regions in Candida and Aspergillus spp.

Primer Name Primer Sequence AspelF2-F CTTAAGTCTGCGATGAAGA /\spelF2-R GTAATGTTACGCTCCAACTC Cane|F2-I-‘ GCTGCCATTGAAATTATGAA J Canell*‘2-R GAACCACCTGCAACACC PCR Thermal profile Lid preheatifliwas ON Step Temp Time °C l min °C ,51°C I min X35 ‘3 72°C 1 min °C 7 min F 8°C Hold Table 3: PCR thermocycling conditions used to amplify eIF2 y gene regions in C. albicuns and A. fumigarus.

Probe Name Probe Sequence J PI —CanclF2 CGATAATGCTCCGATCGTGCCTA Pl -Aspc|F2 CGCTCACACCTCTGTCGCCCGAA Table 4: TaqMan probes (with 5'-FAM and 3'-BHQ1) based on eIF2 7 gene for C. albicans and A. fumigatus.

Preparation of PCR Reaction Mix SAMPLE X I ll_ybProb mix 10 x conc.(LightCycler®FaslStartDNA Master HybProbc 2 pl Kit) M;gC]3s1ock solution (Final cone. in reaction is 3 mM) 1.6 1,11 Probe PI-Can<:lF2 or Pl-AspelF2 2 pl Primer Forward CanelF2-F or AspelF2-F 1 pl Primer Reverse Canell-*2-R or AspelF2-R I pl H30 PCR-grade 104,11 Tcmplale 2 ul TOTAL VOLUME Z0p| Table 5: Real-time PCR reagents FPCR Thermal profile Cycle St Temp Time 9|) Aclixiation l 95°C I0 min Amplification I 95°C 10 sec X 50 2 62 or 65°C 20 sec 3 70°C I0 sec Cooling I 40°C Hold The PCR was performed with LightCyc|er® Roche Table 6:Real-time PCR thermocycling conditions RESULTS Primer and Probe Design The publicly available sequences for the elF2y gene in Candida spp. was aligned with the newly generated sequence information for the elF2y gene in Candida spp. and analyzed using bioinformatics tools. The publicly available sequence information for the elF2y gene in .»tspergillii.s‘ spp. was aligned with the newly generated sequence information for the elF2y gene in .»'1.\‘peI'gi}/111' spp. and analyzed using bioinformatics tools. Species—specific probes were designed based on the compiled elF2y sequence information for Candida albicans and Aspcrgi//rmg/imrigatus (Table 4).

Real-time PC R I-ignres I-2 show the relative positions ofthc PCR primers and TaqMan DNA probes for the amplification and detection of C. albicans and A. fumigatus.The specificity of the ’l‘aqM an probes for the identification ot'C. albi(~an_r and A. fumigatus was demonstrated in real-tiine PC R assays on the LightCycler using the reagents and thermocycling conditions outlined in Tables 5 and 6. For the C. albicans assay based on the elF2y gene, PCR primers Cane|F2- F/t.‘anel|"2-R were combined with TaqMan probe, P l-CanelF2. The specificity ofthe assay for the detection of C albicans was confirmed by including DNA from a range ofclosely related Candida species and A. fumigazus in the C. albicans real-time PCR assay. The assay detected three C. albicans strains tested but did not detect or cross-react with DNA from any other Candida species tested or with A. fumigatus DNA. Figure 3 shows the C. alhicans rcal-time PC R assay and the specificity of the assay for C. albicans.

For the .1. _/iunigatus assay based on the ell~‘2y gene PCR primers AspelF2—F/Aspe|F2—R were combined with 'l'aqMan probe, Pl-AspelF2. The specificity ofthe assay for the detection of/1. _fuim'ga1ux was confirmed by including DNA from a range of closely related Aspergillus species and C ulhicans in the A. fzmzigarus real-time PCR assay. The assay detected A. fumigatus but did not detect or cross-react with DNA from C. albicans or any other Aspergillus species tested. Figure 4 shows the A. fumigalus real-time PCR assay and the specificity of the assay for .»'l. fill)!/gflfllb‘.

Candida spp Er_i@r and Probe Design lhe publicly available sequences for the elF’.Zy gene in Candida spp. were aligned with the newly generated sequence information for the elF2'y gene in Candida spp. and analysed using bioinformatics tools. Species-specific probes were designed based on the compiled elI72y sequence information for Candida albicans, Candida glabrata, Candida kru.rci, Candida l'I'r)pi('a/LS’ and Candida parapsilosis (Table 7 and 8).Figures 5-9 show the relative positions of the PC R primers and TaqMan DNA probes for the amplification and detection of Candida albiccms, (‘andia'a glabrala, Candida krusei, Candida tropicalis and Candida parapsi/om‘.

Primer Name Primer Sequence 5’->3’ CEF1 F 5‘-ATCTATCATTCAGTTTATTAGAG-3‘ CEFZF S’-CATTCAGTTTATTAGAGGTAC-3‘ CF-.FR‘3 5’-CAGTAAAGTCTCTCATTG-3‘ Probe Name Probe Sequence 5’->3’ ALEFI FAM —TGCCG/KTAATGCTCCG ATC- BHQI Table 7: Additional primer and probes designed and tested for use in C. albicam‘ specific assay iilwobe Name Probe Sequence S‘->3‘ A LEF2 6FAM-ATAATGCTCCGATCGTGCCTA-—BHQI G|abA 6FAM—C/\AGAGATTTCATGCTTTCTCCAC--BHQ1 ParA 6FAM-CGTAAACTCAATACCAGTTCCAGTC-—BHQI Tropic/\ 6FAM-TGTCAATTATATCCCAGTTCCATTGA--BHQ1 L KrusA 6FAM-CATGTGTATGGTCAAGTCTATTCCT--BI IQ] J Table 8: 'I‘aqMan probes (with 5'-FAM and 3'-BHQI) based on elF2y gene for C. albicans, I0 C. glabmta, C. parapsilosis, C . tropicalis, and C. krusei.

Primer Name Primer Sequence S’->3’ CEF3F S’—TCAGCCTTGGAACAC-3’ CEFR] 5’-TTGGCACAGGTATGTAG3’ GlabFl 5‘-TCgTgAAg/XCTATCCCTQ-3’ GlabR1 S‘-ATCGATTTCAGCACCTGG-3‘ ParaFi S‘-TATCgACgCCgTCAATC-3’ ParaR| S‘-ATCAACgTCAgCACCAg-3‘ TropicF I 5 ’-ACATCGATGCCGTTAACC-3' TropicRl 5‘-CAAGTCTTCGACATCGGA-3‘ KrusFl S‘-CCCAATTTCTGCTCAGTTG-3‘ KrusR| 5‘-CACCAGGCTTATTAACATCG-3‘ J Table 9: Real Time PCR primers based on elF2D gene for C‘. albicans, C. glabram, C.

I5 pamp.ciIo.ri.s‘, C. tropicalis, and C. krusei.

Real Time PCR The specificity of the TaqMan probes for the identification of Candida aibicam, (.‘u/it/Ida glahz-am. Candida krusei. Candida tropicalis and Candida parapsilosis was demonstrated in real-time PCR assays on the LightCyc|er using the thermocycling conditions outlined in Table I0 (:1) & (b) (C. albicans). to ‘J: Amplification Protocol Amplification Protocol (3) (h) '_’C}‘ °°"‘““9“‘°" M‘)? (Z03 PCR conditions: Mn2+ (zos) A >0 C 3 mm 2 50°C 2 min =1 °C ‘ mi" 9 95°C 1 min :2: °C SCC l t)“C 30 sec 45 cycles 60.C 105:; 45 cycles 40°C 2 lTllll 1 cycle 400C 2 min I cyde Table 10: Initial amplification conditions for evaluation of C. glablram, C. parapsilusis, C. /trusei and C. rmpicalis assay performance.

For the C. albicans assay based on the clF2y gene, following evaluation of the primers and probes listed in Table 7 and 3, PCR primers CEF3F/CEFRI were combined with TaqMan probe, Al,l:‘F2. The specificity of the assay for the detection of C. albicans was confirmed by including DNA from a range of closely related Candida species in the C‘. a/bicam real-time PC R assay. The assay detected fourteen C. albicans strains tested but did not detect or cross- react with DNA from any other I9 Candida species tested. Sensitivity of the assay was tested using various inputs of template DNA from C. albicans. The LOD of the assay was found to be between 1-5 cell equivalents (Fig. I0).

For the C’. giabrata assay based on the elF2y gene, PCR primers GlabFl/G|abRl were combined with TaqMan probe, GlabA. The specificity of the assay for the detection of C. glubrula was confirmed by including DNA from a range of closely related Candida species, Sacclmrnnzyces cerevisiae and A. fzunigatus in the C. glabrata real-time PC R assay. The assay detected ten L‘. glabrata strains tested but did not detect or cross-react with DNA from any other I0 Candida species tested or with S. cerevisiae or A. fumigatus DNA. lnitial sensitivity ofthe assay was tested using various inputs of template DNA from C. glabrata. The LOD of the assay was Found to be ~ 2 cell equivalents (Fig. l I).

For the ('_ purapsilosis assay based on the elF2y gene, PCR primers Paral"l/l’araRI were combined with TaqMan probe, ParA. The specificity of the assay For the detection of C. ptrrap.s-i!o.w;s' was confirmed by including DNA from a range of closely related Candida species, S1rcc'liuromyce5 cerevisiae and A. fumigatus in the C. parapsilosis real—time PCR assay. The assay detected twelve C. parapsilosis strains tested but did not detect or cross-react with DNA from any other 19 Candida species tested or with S. cerevisiae or A. funiigatux DNA. Initial sensitivity of the assay was tested using various inputs of template DNA from C‘. parapsi‘losis.

The LOT) ofthe assay was found to ~10 cell equivalents (Fig. 12).

For the L’. Impicalis assay based on the clF2y gene, PCR primers TropicFl/TropicRl were combined with TaqMan probe, TropicA. The specificity of the assay for the detection of C.

Irupicalis‘ was confirmed by including DNA from a range of closely related Candida species, Sac-c/rut-rmi_vc'c5 cerevisiae and A. fumigatus in the C. rropicalis real—time PCR assay. The assay detected twelve C. tropicalis strains tested but did not detect or cross—react with DNA from any other I9 Candida species tested or with S. c-erewsicze or Afumigatus DNA. initial sensitivity of the assay was tested using various inputs of template DNA from C. tropicalis. The LOD of the assay was found to ~ 20 cell equivalents (Fig. l3).

For the C. /(ru.\‘ei assay based on the elF2y gene, PCR primers KrusFl/KrusRl were combined with TaqMan probe, KrusA. The specificity of the assay for the detection of C. Itrusei was confirmed by including DNA from a range of closely related Candida species. Sacc*/Iuroutvces‘ ccrcvisiuc and A. fumigatus in the C. krusei real—time PCR assay. The assay detected nine C. ki-riser‘ strains tested but did not detect or cross-react with DNA from any other I9 Candida species tested or with S. cerevisiae or A. funzigatus DNA. Initial sensitivity of the assay was tested using various inputs of template DNA from C. Itrusei. The LOD of the assay was found to ~ 2 cell equivalents (Fig. 14).

Asgergillus sgp l;imcr and Probe Design The publicly available sequence information for the e1F2‘y gene in Aspergi/[us spp. was aligned with the newly generated sequence information for the elF2y gene in A.spergilhis spp. and analyzed using bioinforniatics tools (Figure lS-18). Primers and probes were designed to amplify and detect Aspergillus species. Primers were designed which could amplify more than one species of interest. EF2_l_fow was designed to amplify A. fzurzigaizix and A. Ierrcus .|-‘.F2_24fow was designed to amplify A. fluvus and A. niger. EF2_l_rev was designed to amplify A. fimiigatus. EF2_3_rev was designed to amplify A. flavus, A. niger and A. terreus. l-,F2_7_fow was designed to amplify A. niger and A. flaws. EF2_8_fow was designed to amplify A. Ierreus. EF2_9 fow was designed to amplify A. fumigarus. EF2_5 rev was designed to amplify A. fumigarus. A. flavux, and A. rcrreux. EF2_6_rev was designed to amplify A.niger Primers and probes used in these assays are listed in Table I 1.

Oligo name Sequence 5’-3’ EF2 I fow cagccgaagcg EF2 2 fow cagcccaagcg EF2 3 fow agccgaagcgYc EF2 4 fow agcccaagcggcc EF2 5 fow agccgaagcgtcc EF2 6 fow agccgaagcgccc EF2 7 fow agcccaagcggccaga EF2_8_fow agccgaagcgcccaga EF2_9_fow agccgaagcgtccagaac EF2 I0 fow agcgccccctgclcc EF2 ll fow cccgagcagcccgacc EF2 I rev cgtgtgcgacgt EF2 3 rev cgtgagcgagtg EF2 4 rev cgtgwgcgacgt EF2 5 rev ggcctggcgcgcaat EF2 6 rev ggcttggcgcgcaat EF2 7 rev cglgtgcgacgtgtccg A.nig EF2 1 atccegagactctggacct A.terr EF2 I cgacgcrtacccctctgt A.flav EF2 I cagaccccgctaccctt A.fum EF2 1 acgctcacacctctgtc A.fum EF2 2 cgacgctcacacctctgtc Table I1: Probes and primers designed for real time PCR assays for the detection of EIFZ target in Aspcrgillus spp.

Real Time PCR Assay exclusivity was investigated with the panel outlined in Table 12.

Species name A. fumigatus 110.46 A. flavus 117.62 A. niger 2599 A. terreus 2729 4. candidus 102.13 A. claw-atus 1348 4 .glaucus 117314 . nidulans 670 .4. versicolor 1916 N. flscheri 2| I590 Table I2:PaneI for assay exclusivity evaluation Step Temp Time UNG 50°C 2 min Denaturation 95°C l min Cycling 95°C 5-l0secs 40 or 45 or 50 cycles °C I0-30secs Cooling 40°C l-Zmins Table I3. Thermocycling conditions Evaluation ofassav exclusivity’ The initial evaluation of assay exclusivity was investigated with the panel outlined in Table I2 and the primers and probes outlined in Table I3. The results of these assays performed with annealing, lll‘nCS of 95 °C for 10 seconds and 60 °C for 30 seconds for 50 cycles show that the assays were specific for exclusive detection of only the species for which they were designed.

The .'l._/hn-‘H5. A. niger and A. terreur assays were tested for inclusivity with nine available in- house strains ofeach species. EF2_7_fow and EF2_5_rev were used in the A./Iavus assay. l'-.F2_7_fow and EF2_6_rev primer pair for the A. mgcr assay and EF2_8_f0w and EF2_5_rev included in the A. terreus assay. The annealing conditions of95 °C for 5 seconds and 60 °C for It) seconds for 45 cycles were applied to each assay. All strains were detected by the relevant spccilic probe tl"ig I9).

The same primer combinations and thermocyeling conditions were used in the LOD assays for A. fltIl’Il.S’, A ./tiger and A. Ierreus. The LOD for each of the three assays were found to be 5 cell equivalents per reaction. (Fig 20) The same assay conditions were used to test the exclusivity ofthe A._/Iavus, A. niger and A.

Icrrcu:s' assays. Each of the three assays was found to be specific, detecting only the species of interest with no cross-reactivity with other closely related Aspergillus species included in the assay. All samples were tested in triplicate. (Fig. 2|).

L()D of the ,4._/imzigams assay was performed under thermocycling conditions which included for the Afzmzigatzis annealing conditions of95 °C for 10 seconds and 60 °C for 30 seconds for cycles. The LOD for this assay was found to be I0-I cell equivalents (Fig. 22 .

Discussion The number of yeast and fungal infections among immurtocomprised patients is escalating.

Contributing to this increase is the growing resistance of many yeast and fungal species [0 antifungal drugs. There is therefore a need to develop a fast, accurate diagnostic method to Ix) an enable early diagnosis ofyeast and fungal species. Early diagnosis will enable the selection ofa specific narrow spectrum antibiotic or antifungal to treat the infection. The current invention provides for sequences and/or diagnostic assays to detect and identify one or more yeast and fungal species. The current inventors have exploited the sequence ofthe elF2 y gene in Candida and Aspcrgillus species to design primers and probes specific for regions of this gene. The elF2 y sequence has significant intragenic sequence heterogeneity in some regions, while having significant homogeneity in others, a trait, which makes elF2 y an ideal candidate for the design of primers and probes directed towards the detection of yeast and fungal species specific targets and for the detection ofgenus specific diagnostic targets respectively.

The current invention allows the detection ofyeast and fungal species but also allows distinction between Candida and Aspergillux species. It is a further object ofthe invention to allow the discrimination between different Candida species and different Aspergi//us species.

The words "comprises/comprising" and the words “having/including" when used herein with reference to the present invention are used to specify the presence of stated features. integers, steps or components but does not preclude the presence or addition of one or more other lcattires. integers, steps, components or groups thereof.

It is appreciated that certain features ofthc invention. which are, for clarity, described in the context ofscparate embodiments, may also be provided in combination in a single embodiment.

Conversely, various features ofthe invention, which are. for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination.

In so far as any sequence disclosed herein differs from its counterpart in the attached sequence listing in l’aten1ln3.3 software, the sequences within this body oftext are to be considered as the correct version.

SEQ IDs Sites of probes. oligonucleotides etc. are shown in bold and underlined.

N or x: any nucleotide; w=a/t, m=a/c, r=a/g, k=g/t, s=c/g, y=c/t, h=a/t/c, v=a/g/c, d=a/g/t, h=g/t/c. In some cases, specific degeneracy options are indicated in parenthesis: e.g.: (a/g) is either /\ or G.

SEQ ID NO]: Pl—CanelF2: SEQ ID NO.2: Pl-AspelF2: References Alone PV. Dever TE.

Direct binding of translation initiation factor elF2gamma-G domain to its (JTl’ase- activating and GDP-GTP exchange factors e|F5 and elF2B epsilon. J Biol Chem. 2006 May 5;28l(| 8):l2636-44. Epub 2006 Mar 7.

Dorris DR. [Erickson FL, Hannig EM.

Mutations in GCDI I, the structural gene for e[F-2 gamma in yeast, alter translational regulation of GCN4 and the selection ofthe start site for protein synthesis. EMBO J.

I995 May l5;l4(l0):2239-49 Erickson I-‘L. Harding LD, Dorris DR. Hannig EM.

Functional analysis of homologs oftranslation initiation factor Zgamma in yeast. Mol Gen Genet. I997 Feb 27;253(6):7l I-9.

Erickson FL, llannig EM.

Ligand interactions with eukaryotic translation initiation factor 2: role ofthe gamma- subunit. EMBO J. 1996 Nov 15;! 5(22):63l I-20.

Claims (5)

Claims

1. I. A diagnostic kit for a yeast or fungal species comprising at least one oligonucleotide probe capable of binding to at least a portion ofthe e[F2 7 gene or its corresponding mRNA.

2. A kit as claimed in claim I, wherein the portion ofthe elF2 7 gene is equivalent to a ponion otthc region ofthe gene from base pair position 718 to 1040 ofC. albicuns elF2 7 gene. from base pair position 790 to 934 of C. albicanx elF2 ‘)1 gene, from base pair position 872 to 972 oi‘ C. g/ubrara eIF2 7 gene, from base pair position 151 to 274 of C . par’ap.si!o.si.i c|F2 it gone, from base pair position 140 to 270 of C. rropicalis elF2 7 gene, from base pair position I IS to 224 of(’. krusei elF2 7 gene, from base pair position 12] to 374 of,4.N/izrtrigazim‘ ell-"2 y gene, from base pair position 164 to 261 ofxt.fium'gutus e|F2 y gene, from base pair position I55 to 252 olfil .j/uvus elF2 y gene, from base pair position 92 to 189 ofA. niger elF2 3/ gene, or from base pair position 149 to 246 ofA. Ierreus elF2 y gene.

3. A kit as claimed in claim I or 2 comprising a probe selected from the group comprising SIEQ ID NO: 1.2. 84, 85. 86, 87, 88, I08. I09, I I0, I l I, I25 or, I38 or sequences substantially similar or complementary thereto which can also act as a probe, and/or a forward primer selected from the group comprising ofSEQ ID NO 3, 5, 89, 9|, 93, 95, 97, I04, I05, I I2, H}. I I4. I I5, II6. ll7, I18, II9, I20, 135 or 136, or scqucnces substantially similar or complementary thereto which can also act as a forward amplification primer and/or a reverse primer selected from the group consisting of SEQ ID NO 4, 6, 90, 92, 94, 96, 98, I06, I07. I21. I22. I23. I24, or I37, sequences substantially similar or complementary thereto which can also act as it reverse amplification primer.

4. A nucleic acid molecule selected from the group consisting of: SEQ ID NO I through SEQ ll) N() 73 and SEQ ID NO. 84 to I38 and sequences substantially homologous or substantially complementary thereto or to a portion thereof and having a Function in diagnostics based on the clF2 y gene.

5. A kit substantially as described herein with reference to the examples and/or the accompanying figures.