IE20090464U1 - SWI5 gene as a diagnostic target for the identification of fungal and yeast species - Google Patents

Abstract

ABSTRACT The invention relates to the SW15 gene, the corresponding RNA, specific probes, primers and oligonucleoticles related thereto and thereto and their use in diagnostic ztssays to detect and/or discriminate between fungal and yeast species.

Description

Field of the Invention Title SW15 gene as a cl ication of fungal and yeast species.

T he present invention relates to nucleic acid primers and probes for use in the identification of one or more fungal and yeast species. More specifically the invention relates to the SW15 gene, the corresponding RNA, specific probes, primers and oligonucleotides related thereto and their use in diagnostic assays to detect and/ or discriminate between fungal and yeast species.

Background to the Invention Yeast and fungal infections represent a major cause of morbidity and mortality among iminunocompromised patients. The number of immunocompromised patients at risk of yeast and fungal infection continues to increase each year, as does the spectrum of fungal and yeast agents causing disease. Mortality from fungal infections. particularly invasive fungal infections, is 30% or greater in certain risk groups. The array of available anti-fungal agents is growing; however, so too is the recognition of both intrinsic and emerging resistance to antifungal drugs. These factors are contributing to the increased need for cost containment in laboratory testing and have led to laboratory consolidation in testing procedures.

Invasive fungal infections are on the increase. In 2003. it was estimated that there were 9 million at risk patients of which 1.2 million developed infection. Candida spp. and A.»'/wergillzis spp. now rank as the most prominent pathogens infecting immunosupressed patients. in particular, infections are common in the urinary tract, the respiratory system and the bloodstream, at the site of insertion of stents, catheters and orthopaedic joints.

Approximately. 10% of the known Candida spp. have been implicated in human infection. Invasive candidiasis occurs when candida enters the bloodstream and it is estimated to occur at a frequency of 8/ 1 00,000 population in the US with a mortality rate of 40%. Candida albicans is the 4'" most common cause of bloodstream infection.

Aspergillosis usually begins as a pulmonary infection that can progress to a life- thrcatcning invasive infection in some patients and has a mortality rate of greater than Emerging mycoses agents include Fusarium, Scedosporitmr, Zygomycetes and lmmunocoinpromised patients including transplant and surgical patients, neonates. cancer patients, diabetics and those with HIV/A[Ds are at high risk of developing invasive fungal infections (Datamonitor report: Stakeholder opinion -Invasive fungal infections. options outweigh replacements 2004). A large number of severe cases of sepsis are reported each year. Despite improvements in its medical management. sepsis still constitutes one of the greatest challenges in intensive care medicine.

Microorganisms (bacteria, fungi and yeast) responsible for causing sepsis are traditionally detected in hospital laboratories with the aid of microbiological culture methods with poor sensitivity (25-32%), which are very time—consumingt generally taking from two to five days to complete, and up to eight days for the diagnosis of fungal infections. Definitive diagnosis of infection caused by yeasts or fungi is usually based on either, the recovery and identification of a specific agent from clinical specimens or microscopic demonstration of fungi with distinct morphological features.

However. there are numerous cases where these methods fail to provide conclusive proofas to the infecting agent. In these instances, the detection of specific host antibody responses can be used, although again this can be affected by the immune status ofthc patient. Time is critical in the detection and identification of bloodstream infections typically caused by bacteria and fungi. Effective treatment depends on finding the source of infection and making appropriate decisions about antibiotics or antifungals quickly and efficiently. Only after pathogens are correctly identified can targeted therapy using a specific antibiotic or anti—fungal begin. Many physicians would like to sec the development of better in vitro amplification and direct detection diagnostic techniques for the early diagnosis of yeast and fungi (“Stakeholder Insight: Iiiitasitre V/imgal in/ec'li<)ns", Datamonitor, Jan 2004). Recently Rochem launched a real time PC R based assay ( Septifastlm), for the detection of bacterial, fungal and yeast DNA in clinical samples. Therefore, there is a clear need for the development of novel rapid diagnostic tests for clinically significant bacterial and fungal pathogens for bioanalysis applications in the clinical sector. This has led the current inventors to identify novel fungal and yeast nucleic acid targets for application in Nucleic Acid Diagnostics (N AD) tests.

Fungal and yeast nucleic acid based diagnostics have focused heavily on the ribosomal RNA (rRNA) genes, RNA transcripts, and their associated DNA / RNA regions. The rRNA genes are highly conserved in all fungal species and they also contain divergent and distinctive intergenic transcribed spacer regions. Ribosomal rRNA comprises three genes: the large sub-unit gene (2238). the small sub-ttnit gene (188) arid the 588 gene.

The 28S and 18S rRNA genes are separated by the 5.88 rRNA and two internal transcribed spacers (ITS1 and ITS2). Because the ITS region contains a high number of sequence polymorphisms, numerous researchers have concentrated their efforts on these as targets (Atkins and Clark, 2004). rRNA genes are also multicopy genes with >10 copies within the fungal genome.

A number of groups are working on developing new assays for fungal and yeast infections. U S2004044l93 relates to, amongst a number of other aspects, the transcription factor CaTEC1 of Candida albicans; inhibitors thereof. and methods for the diagnosis and therapy ofdiseases which are connected with a Candida infection; and also diagnostic and pharmaceutical compositions which contain the nucleotide sequences. proteins, host cells and/or antibodies. WOO183824 relates to hybridization assay probes and accessory oligonucleotides for detecting ribosomal nucleic acids from Ccmdidu ulbicans and/or Candida dzibliniensfs. U S60l7699 and US5426026 relate to a set of DNA primers, which can be used to amplify and speciate DNA from five medically important Candida species. US 6747137 discloses sequences useful for diagnosis ofCandida infections. EP 0422872 and US 5658726 disclose probes based on 18S rRNA genes. and US 5958693 discloses probes based on 28S rRNA. for diagnosis of a range of yeast and fungal species. US 6017366 describes sequences based on chitin synthase gene for use in nucleic acid based diagnostics for a range of Candida species.

It is clear though, that development of faster. more accurate diagnostic methods are required. particularly in light of the selection pressure caused by modern anti-microbial treatments which give rise to increased populations of resistant virulent strains with mutated genome sequences. Methods that enable early diagnosis of microbial causes of infection enable the selection of a specific narrow spectrum antibiotic or antifttngal to treat the infection (Datamonitor report: Stakeholder opinion -Invasive fungal infections. options outweigh replacements 2004; Datamonitor report: Stakeholder Opinion-Sepsis. under reaction to an overreaetion, 2006’).

SW15 is a transcription factor that activates genes involved in mitosis/Gap 1 tinterphase) switch and is expressed in G1 phase ofthe cell cycle ( Butler and Tliiele 1991; Aerne et ul.. 1998: Akamatsu er a1., 2003; El1ermeiereIa!., 2004; MacCallum er a1., 2006). There are 128 SW15 sequences available in NCBI GenBank database including sequences for 6 Aspcrgillus spp. SW15 sequences and l SW15 sequence for Neosartoryafischeri. PCR ra V- lEo9o-464 4 primers were designed and applied to generate sequence information for the SW15 gene in Aspcr'giI/zts spp. SW15 is present in some Candida spp. e.g. C. glabratu but not others eg. C". uihicans (MacCallurn er al.. 2006). Therefore, the potential exists to use SW15 for the molecular identification of selected Candida spp.

Definitions "Synthetic oligonucleotide" refers to molecules of nucleic acid polymers of 2 or more nucleotide bases that are not derived directly from genomic DNA or live organisms. The term synthetic oligonucleotide is intended to encompass DNA, RNA, and DNA/RNA hybrid molecules that have been manufactured chemically, or synthesized enzymatically in virm.

An "oligonucleotide“ is a nucleotide polymer having two or more nucleotide subunits covalently joined together. Oligonucleotides are generally about 10 to about I00 nucleotides. The sugar groups ofthe nucleotide subunits may be ribose, deoxyribose. or modified derivatives thereof such as 0Me. The nucleotide subunits may be joined by linkages such as phosphodiester linkages, modified linkages or by non-nucleotide moieties that do not prevent hybridization of the oligonucleotide to its complementary target nucleotide sequence. Modified linkages include those in which a standard phosphodiester linkage is replaced with a different linkage. such as a phosphorothioate linkage. a methylphosphonate linkage. or a neutral peptide linkage. Nitrogenous base analogs also may be components of oligonucleotides in accordance with the invention.

A "target nucleic acid" is a nucleic acid comprising a target nucleic acid sequence. A "target nucleic acid sequence," "target nucleotide sequence" or "target sequence" is a specific deoxyribonucleotide or ribonucleotide sequence that can be hybridized to a complementary oligonucleotide.

An "oligonucleotide probe" is an oligonucleotide having a nucleotide sequence sufficiently complementary to its target nucleic acid sequence to be able to form a detectable hybrid probettarget duplex under high stringency hybridization conditions.

An oligonucleotide probe is an isolated chemical species and may include additional nucleotides outside of the targeted region as long as such nucleotides do not prevent hybridization under high stringency hybridization conditions. Non-complementary sequences. such as promoter sequences, restriction endonuclease recognition sites, or sequences that confer a desired secondary or tertiary structure such as a catalytic active site can be used to facilitate detection using the invented probes. An oligonucleotide (_I\ IE 0 9 0 4 6 4 5 probe optionally may be labelled with a detectable moiety such as a radioisotope, a fl uoresccnt moiety, a chemiluminescent, a nanoparticle moiety, an enzyme or a ligand. which can be used to detect or confirm probe hybridization to its target sequence.

Oligonucleotide probes are preferred to be in the size range of from about 10 to about I00 nucleotides in length, although it is possible for probes to be as much as and above about 500 nucleotides in length, or below 10 nucleotides in length.

A "hybrid" or a "duplex" is a complex formed between two single-stranded nucleic acid sequences by Watson-Crick base pairings or non-canonical base pairings between the complementary bases. "Hybridization" is the process by which two complementary strands of nucleic acid combine to form a double-stranded structure ( "hybrid" or "duplex"). A "fungus" or "yeast" is meant any organism of the kingdom Fungi, and preferably. is directed towards any organism of the phylum Ascomycota.

"Complementarity" is a property conferred by the base sequence of a single strand of DNA or RNA which may form a hybrid or double-stranded DNA:DNA, RNA:RNA or DNA:RNA through hydrogen bonding between Watson-Crick base pairs on the respective strands. Adenine (A) ordinarily complements thymine (T) or uracil (U). while guanine (G) ordinarily complements cytosine (C).

The term “stringency" is used to describe the temperature, ionic strength and solvent composition existing during hybridization and the subsequent processing steps. Those skilled in the art will recognize that “stringency” conditions may be altered by varying those parameters either individually or together. Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands fomiing a hybrid. Stringency conditions are chosen to maximize the difference in stability between the hybrid formed with the target and the non-target nucleic acid.

With “high stringency“ conditions. nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences (for example, hybridization under “high stringency" conditions, may occur between homologs with about 85-100% identity, preferably about 70-100% identity). With medium stringency conditions, nucleic acid base pairing will occur between nucleic acids with an intermediate frequency of complementary base sequences (for example, hybridization under “medium stringency" conditions may occur between homologs with t.) O IEOQO464 0 about 50-70% identity). Thus. conditions of “weak” or “low" stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less.

‘High stringency’ conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of SXSSPE (43.8g/l NaCl. 6.9 g/l Nal-I3PO4H;O and 1.85 g/l EDTA. ph adjusted to 7.4 with NaOH), 0.5% SDS, 5xDenhardt's reagent and l00itg/ml denatured salmon spemt DNA followed by washing in a solution comprising 0. l XSSPE. l.0%SDS at 42° C . when a probe of about 500 nucleotides in length is used.

“Medium stringency‘ conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of SXSSPE (43.8 g/l NaC.l, 6.9 gll N3H3PO4H3O and 1.85 g/l EDTA, pl-l adjusted to 7.4 with NaOH), 0.5% SDS, 5xDenhardt’s reagent and 100 pg/ml denatured salmon sperm DNA followed by washing in a solution comprising LOXSSPE. 1.0% SDS at 42° C. when a probe of about 500 nucleotides in length is used. ‘l.ow stringency’ conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of SXSSPE (43.8 g/l NaCl. 6.9 g/l Nal-I;PO4H;O and 1.85 g/l EDTA. pH adjusted to 7.4 with NaOH), 0.1% SDS, 5xDenhardt‘s reagent [50xDenhardt’s contains per 500ml: 5g Ficoll (Type 400. Pharamcia), S g BSA (Fraction V; Sigma)] and 100 pg/ml denatured salmon sperm DNA followed by washing in a solution comprising SXSSPE, 0.l% SDS at 42° C, when a probe of about 500 nucleotides in length is used.

In the context of nucleic acid in-vim) amplification based technologies, “stringency” is achieved by applying temperature conditions and ionic buffer conditions that are particular to that in-vitro amplification technology. For example, in the context of PC R and real-time PCR, “stringency” is achieved by applying specific temperatures and ionic buffer strength for hybridisation of the oligonucleotide primers and, with regards to real- time PCR hybridisation of the probe/s, to the target nucleic acid for in~vitr0 amplification of the target nucleic acid.

One skilled in the art will understand that substantially corresponding probes of the invention can vary from the referred-to sequence and still hybridize to the same target nucleic acid sequence. This variation from the nucleic acid may be stated in terms ofa percentage of identical bases within the sequence or the percentage of perfectly complementary bases between the probe and its target sequence. Probes of the present invention substantially correspond to a nucleic acid sequence if these percentages are Ix) an IEo9o454 7 from about 100% to about 80% or front 0 base mismatches in about 10 nucleotide target sequence to about 2 bases mismatched in an about 10 nucleotide target sequence. In preferred embodiments, the percentage is from about 100% to about 85%. In more preferred embodiments, this percentage is from about 90% to about 100%; in other preferred embodiments, this percentage is from about 95% to about 100% By "suftieiently complementary" or "substantially complementary" is meant nucleic acids having a sufficient amount of contiguous complementary nucleotides to form, under high stringency hybridization conditions. a hybrid that is stable for detection.

The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequenccs that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (Le. . 90%, 91%, 92%, 93%, 94%, 95%. 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below. or by manual alignment and visual inspection (see. e.g.. NCBI web site at ncbi.nlm.nih.gov/BLAST/ or the like). Such sequences are then said to be “substantially identical.“ This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions. as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-1 00 amino acids or nucleotides in length.

For sequence comparison, typically one sequence acts as a reference sequence. to which test sequences are compared. When using a sequence comparison algorithm. test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary. and sequence algorithm program parameters are designated.

Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

A “comparison window,“ as used herein. includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to , usually about 50 to about 200, more usually about 100 to about 150 in which 21 sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, eg. by the local homology algorithm of Smith & Waterman. Adv. Appl. Math. 2:482 (1981). by the homology alignment algorithm of Needleman & Wunsch,J. Mol. Biol. 481443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat 7. Acad. Sci. USA 8522444 (1988), by computerized implementations of these algorithms (GAP. BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr, Madison. WI). or by manual alignment and visual inspection (see, e. g, C'um>m Protocols‘ in Molecular Biology (Ausubel er al., eds. 1987-2005, Wiley lnterscienceyi).

A preferred example of algorithm that is suitable for detennining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et aI., Nuc. Acids Res. 253389-3402 (1977) and Altschul et u!.. .1.

Mo/. Bio/. 215;403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPS) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul er al. , .s'upra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPS containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased.

Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues: always > 0‘) and N (penalty score for mismatching residues: always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative—scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W. T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 1 I, an expectation (E) of 10, M=S. N=- 4 and a comparison of both strands. For amino acid sequences, the BLASTI’ program uses as defaults a wordlength of 3, and expectation (E) of l0, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff. Proc. Nari. Acad. Sci. USA 89:l09l5 (1989)) alignments (B) of 50, expectation (E) of 10. M=5_. N=-4, and a comparison of both strands.

“Nucleic acid” refers to deoxyribonucleotides or riboiiucleotides and polymers thereof in either single— or double-stranded form. and complements thereof. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid. and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation. phosphorothioates, phosphoramidates. methyl phosphonates, chiral-methyl phosphonates, 2—0—methy1 ribonucleotides, peptide—iiucleic acids (PNAsl.

By "nucleic acid hybrid" or "probe:target duplex" is meant a structure that is a double- strandcd, hydrogen-bonded structure. preferably about 10 to about l00 nucleotides in length. more preferably 14 to 50 nucleotides in length, although this will depend to an extent on the overall length of the oligonucleotide probe. The structure is sufficiently stable to be detected by means such as chemiluminescent or fluorescent light detection. auloradiography, electrochemical analysis or gel electrophoresis. Such hybrids include RN/\:RNA, RNA:DNA, or DNA:DNA duplex molecules.

"RNA and DNA equivalents" refer to RNA and DNA molecules having the same complementary base pair hybridization properties. RNA and DNA equivalents have different sugar groups (ie, ribose versus deoxyribose), and may differ by the presence of uracil in RNA and thymine in DNA. The difference between RNA and DNA equivalents do not contribute to differences in substantially corresponding nucleic acid sequences because the equivalents have the same degree of complementarity to a particular sequence.

By "preferentially hybridize" is meant that under high stringency hybridization conditions oligonucleotide probes can hybridize their target nucleic acids to form stable $0904 probeztarget hybrids (thereby indicating the presence of the target nucleic acids) without forming stable probetnon-target hybrids (that would indicate the presence of non-target nucleic acids from other organisms). Thus. the probe hybridizes to target nucleic acid to a sufficiently greater extent than to non-target nucleic acid to enable one skilled in the art to accurately detect the presence of (for example Candida) and distinguish these species from other organisms. Preferential hybridization can be measured using techniques known in the art and described herein.

By "thcranostics" is meant the use of diagnostic testing to diagnose the disease, choose the correct treatment regime and monitor the patient response to therapy. The theranostics of the invention may be based on the use of an NAD assay of this invention on samples, swabs or specimens collected from the patient.

Object of the Invention It is an object of the current invention to provide sequences and/or diagnostic assays to detect and identify one or more fungal and yeast species. The current inventors have used the SW15 gene sequence to design primers and probes that are specific to A.rpei'giIlz:s SW15 genes. Such primers may allow the detection of yeast and fungal species and also allow distinction between Candida and Aspergillus species, foe example.. The current invention further provides for primers and probes that may allow discrimination between different Candida spp. and among different Aspcrgillus spp..

Summary of the Invention The present invention provides for a diagnostic kit for detection and identification of fungal rand yeast species, comprising an oligonucleotide probe capable of binding to at least a portion of the SW15 gene or its corresponding mRNA. The oligonucleotide probe may have a sequence substantially homologous to or substantially complementary to at least a portion of the SW15 gene or its corresponding mRNA. It will thus be capable of binding or hybridizing with a complementary DNA or RNA molecule. The SW15 gene may be a fungal SW15 gene. The SW15 gene may be yeast SW15 gene. The nucleic acid molecule may be synthetic. The kit may comprise more than one such probe. In particular, the kit may comprise a plurality of such probes. in addition the kit may comprise additional probes for other organisms, such as, for example, bacterial species or viruses.

The identified sequences are suitable not only for in vitro DNA/RNA amplification based detection systems but also for signal amplification based detection systems.

IEOQO4 l I Furthermore. the sequences of the invention identified as suitable targets provide the advantages of having significant intragenic sequence heterogeneity in some regions. which is advantageous and enables aspects of the invention to be directed towards group or species-specific targets, and also having significant sequence homogeneity in some regions, which enables aspects of the invention to be directed towards genus-specific fungal and yeast primers and probes for use in direct nucleic acid detection technologies. signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies for fungal and yeast diagnostics. The SWI5 sequences allow for multi-test capability and automation in diagnostic assays.

One of the advantages of the sequences of the present invention is that the intragenic SW15 nucleotide sequence diversity between closely related fungi and yeast enables specific primers and probes for use in diagnostics assays for the detection of fungi and yeast to be designed. The SW15 nucleotide sequences, both DNA and RNA can be used with direct detection, signal amplification detection and in vitro amplification technologies in diagnostics assays. The SW15 sequences allow for multi-test capability and automation in diagnostic assays.

The kit may further comprise a primer for amplification of at least a portion ofthc SWIS gene. Suitably. the kit comprises a forward and a reverse primer for a portion of the SWl5 gene.

The portion ofthe SW15 gene may be equivalent to a region of SW15 equivalent to bp positions I-2319.

Equivalent positions to base pair position 1 to base pair position 2319 in A. _/imzigatus can be found in other organisms, but not necessarily in the same position.

The portion of the SW15 gene may be equivalent to two regions of the SWl5 gene in _.4.s-pergillm spp. equivalent to base pair position 38 to base pair position 472 in A. filIl1lg(III(.$' (region 1) and from base pair position 1423 to 1627 base pair position in A. _/imrigcints‘ (region 3).

Equivalent positions to base pair position 38 to base pair position 472 and from base pair position 1423 to 1627 in A. fumigatus can be found in other organisms. but not necessarily in the same position.

The kit may also comprise additional probes.

The probe may have a sequence selected from the group SEQ ID NO I7. 18, 42, 45, 43, 51, 54, 61. 64. or 67 or a sequence substantially homologous to or substantially complementary to those sequences which can also act as a probe for the SW15 gene.

The kit may comprise at least one forward in vitro amplification primer and at least one reverse in vi!/'0 amplification primer. Such primers may include a forward primer which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID N03: 1, 3. 5, 7. 9. ll, 1115.36.38.40, 43, 46, 49, 52, 55, 58, 59, 62 or 65 and/or a reverse primer which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NOS: 2, 4, 6, 8, I0, 12, 14, I6. 37. 39. 41, 44. 47, 50. 53. 56. 57. 60, 63 or 66. or a sequence being substantially homologous or complementary thereto which can also act as a forward or reverse amplification primer.

The diagnostic kit may be based on direct nucleic acid detection technologies. signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies is selected from one or more of Polymerase Chain Reaction (PCR), Ligasc Chain Reaction (LC R). Nucleic Acids Sequence Based Amplification (NASBAL Strand Displacement Amplification (SDA), Transcription Mediated Amplilication (TMA), Branched DNA technology (bDNA‘) and Rolling Circle Amplification Technology (RCAT) /I. or other in virro enzymatic amplification technologies.

The invention also provides a nucleic acid molecule selected from the group consisting of SEQ ID N01 to SEQ ID NO. 95 and sequences substantially homologous thereto. or substantially complementary to a portion thereofand having a function in diagnostics based on the SW15 gene. The nucleic acid molecule may comprise an oligonucleotide having a sequence substantially homologous to or substantially complementary to a portion ofa nucleic acid molecule ofSEQ ID NO.1 to SEQ ID NO. 95. The invention also provides a method of detecting a target organism in a test sample comprising the steps of: ti) Mixing the test sample with at least one oligonucleotide probe as defined above under appropriate conditions; and (ii i hybridizing under high stringency conditions any nucleic acid that may be present in the test sample with the oligonucleotide to form a probe:target duplex; and IE0904 (iii) determining whether a probeztarget duplex is present; the presence of the duplex positively identifying the presence of the target organism in the test sample.

The nucleic acid molecule and kits of the present invention may be used in a diagnostic assay to detect the presence of one or more fungal and/or yeast species, to measure fungal and/or yeast titres in a patient or in a method of assessing the efficacy of a treatment regime designed to reduce yeast and/or fungal titre in a patient or to measure fungal and/or yeast contamination in an environment. The environment may be a hospital. or it may be a food sample. an environmental sample e. g. water, an industrial sample such as an in—process sample or an end product requiring bioburden or quality assessment.

The kits and the nucleic acid molecule of the invention may be used in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the SW15 gene function. The disruptive agent may be selected from the group consisting of antiscnse RNA. PNA, and siRNA.

In some embodiments of the invention. a nucleic acid molecule comprising a species- specific probe can be used to discriminate between species of the same genus.

The oligonucleotides of the invention may be provided in a composition for detecting the nucleic acids of fungal and yeast target organisms. Such a composition may also comprise buffers, enzymes, detergents. salts and so on, as appropriate to the intended use of the compositions. It is also envisioned that the compositions, kits and methods of the invention. while described herein as comprising at least one synthetic oligonucleotide. may also comprise natural oligonucleotides with substantially the same sequences as the synthetic nucleotide fragments in place of, or alongside synthetic oligonucleotldcs.

The invention also provides for an in vilro amplification diagnostic kit for a target fungal and/or yeast organism comprising at least one forward in vitro amplification primer and at least one reverse in iiilro amplification primer, the forward amplification primer being selected from the group consisting of one or more of or a sequence being substantially homologous or complementary thereto which can also act as a forward amplification primer, and the reverse amplification primer being selected from the group consisting of one or more ofor a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer. lEo90454 M The invention also provides for a diagnostic kit for detecting the presence of candidate fungal and/or yeast species, comprising one or more DNA probes comprising a sequence substantially complementary to, or substantially homologous to the sequence of the SW15 gene of the candidate fungal and/or species.

A kit useful for detecting an Aspergillus or Candida glabrata SW15 polynucleotidc comprises an oligonucleotide probe selected from SEQ ID NOS: 17,18, 42. 45, 48. 51. 54. 61, 64, or 67 or a probe which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID N03: 17,18, 42, 45, 48, 51, 54. 61. 64. or 67. The kit may further comprise a forward primer selected from SEQ ID NOS: 1, 3, 5. 7, 0. l1.13,l5,36_, 38, 40, 43, 46. 49, 52, 55, 58. 59, 62 or 65 or a probe which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID N03: 1, 3, 5, 7, 9, 11, I3, 15, 36, 38. 40, 43, 46, 49, 52, 55, 58, 59, 62 or 65 and/or a reverse primer selected from SEQ ID N03: 2. 4, 6, 8, I0, 12, 14. 16, 37, 39. 41, 44. 47, 50. 53, 56, 57, 60, 63 or 66 or a probe which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NOS: 2, 4. 6, 8, I0, 1114.16.37.39. 41, 44, 47. 50, 53, 56. 57. 60. 63 or 66.

A kit for detecting or identifying a Aspcrgillus fumigatus SW15 polynucleotidc comprises an oligonucleotide probe selected from SEQ ID N0: 17 or 18 or 42 and 54 or a sequence which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 17 or 18 or 42 and 54 and further comprises a forward primer selected from SEQ ID NO: 43, 55, 58 or a sequence which preferentially hybridi/es to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 43. 55. 58 and a reverse primer which is selected from SEQ ID NO: 44. 56. 57 or a sequence which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 44. 56. 57.

A kit for detecting or identifying a Aspergillus [lavus SW15 polynucleotide comprises an oligonucleotide probe selected from SEQ ID NO: 45, 61 and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ II) NO: 45, 61 and further comprises a forward primer selected from SEQ ID NO: 46. 5‘) and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 46, 59 and a reverse primer selected from SEQ ID NO: 47, 60 and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 47. 60.

A kit for detecting or identifying a Aspergillus niger SW15 polynucleotide comprises an oligonucleotide probe selected from SEQ ID NO: 48, 67 and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 48. 67 and further comprises a forward primer selected from SEQ ID NO: 48, 65 and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 48, 65 and a reverse primer selected from SEQ ID NO: 49, 66 and sequences which preferentially hybridizcs to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 49, 66.

A kit for detecting or identifying a Aspergillus terreus SW15 polynucleotide comprises an oligonucleotide probe selected from SEQ ID NO: 51, 64 and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 51, 64 and further comprises a forward primer selected from SEQ ID NO: 52. 63 and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 52, 62 and a reverse primer selected from SEQ ID NO: 53, 63 and sequences which preferentially hybridizes to the same nucleotide sequence as is preferentially hybridized by SEQ ID NO: 53, 63.

The present invention also provides for one or more synthetic oligonucleotidcs having a nucleotide sequence substantially homologous to or substantially complementary to one or more ofthe group consisting ofthe SWI5 gene or mRNA transcript thereof, the fungal SW l5 gene or mRNA transcript thereof. the yeast SW15 gene or mRNA transcript thereof. one or more of SEQ ID NO I-SEQ ID NO 95.

The nucleotide may comprise DNA. The nucleotide may comprise RNA. The nucleotide may comprise a mixture of DNA, RNA and PNA. The nucleotide may comprise synthetic nucleotides. The sequences of the invention (and the sequences relating to the methods. kits compositions and assays of the invention) may be selected to be substantially homologous to a portion of the coding region of the SW15 gene. The gene may be a gene from a target fungal and/or yeast organism. The sequences of the invention are preferably sufficient so as to be able to form a probeztarget duplex to the portion of the sequence.

The invention also provides for a diagnostic kit for a target fungal or yeast organism comprising an oligonucleotide probe substantially homologous to or substantially complementary to an oligonucleotide of the invention (which may be synthetic). It will be appreciated that sequences suitable for use as in vitro amplification primers may also IEOQO464 be suitable for use as oligonucleotide probes: while it is preferable that amplification primers may have a complementary portion of between about 15 nucleotides and about nucleotides (more preferably about 15~about 23. most preferably about 20 to about 23). oligonucleotide probes of the invention may be any suitable length. The skilled person will appreciate that different hybridization and or annealing conditions will be required depending on the length, nature & structure (eg. Hybridization probe pairs for Li ghtCycler. Taqman 5’ exonuelease probes. hairpin loop structures etc. and sequence of the oligonucleotide probe selected.

Kits and assays of the invention may also be provided wherein the oligonucleotide probe is immobilized on a surface. Such a surface may be a bead, a membrane, a column. dipstick. a nanoparticle, the interior surface of a reaction chamber such as the well of a diagnostic plate or inside ofa reaction tube, capillary or vessel or the like.

The target fungal organism may be selected from the group consisting ofA.fi1nzigaIus, /V._/isc'l1cri. A ,c1a1/atlas. A Jziger, A. terreus, A .flavz4s, A .ver5ic010r and A. nitlulcins .

The target yeast organisms may be the Candida species C. glabrata, Under these circumstances. the amplification primers and oligonucleoticle probes of the invention may be designed to a gene specific or genus specific region so as to be able to identify one or more, or most. or substantially all of the desired organisms of the target yeast organism grouping.

The target fungal organisms may be an Aspergillus species for given set of primers already experimentally demonstrated, and more preferably, selected from the group consisting ofA.y/iumigarzzs, A .clavaIu.s*. A .niger. A. Ierreus, A flavus, A .Ve/'.s‘ico/or and A. nit/ufcrm'._ The test sample may comprise cells of the target fungal and/or yeast organism. The method may also comprise a step for releasing nucleic acid from any cells of the target fungal or yeast organism that may be present in said test sample. Ideally. the test sample is a lysate of an obtained sample from a patient (such as a swab, or blood, urine, saliva. a bronchial lavage, dental specimen, skin specimen, scalp specimen, transplant organ biopsy. stool, mucus, or discharge sample). The test samples may be a food sample. a water sample. an enviromnental sample. an end product, end product or in-process industrial sample.

The invention also provides for the use of any one of SEQ ID NO.l to SEQ ID NO. 35 in a diagnostic assay for the presence of one or more yeast or fungal species. The species may be selected from the group consisting of C. glabrata, Afzmzigatus.

NA/ischeri, A davarus, A .niger, A. rerreus, A jlavzrs. A .versicol0r and A. nia’z1lam' The invention also provides for kits for use in clinical diagnostics, theranostics. food safety diagnostics, industrial microbiology diagnostics. environmental monitoring. veterinary diagnostics, bio-terrorism diagnostics comprising one or more of the synthetic oligonucleotides of the invention. The kits may also comprise one or more articles selected from the group consisting of appropriate sample collecting instruments. reagent containers, buffers. labelling moieties. solutions. detergents and supplementary solutions. The invention also provides for use of the sequences, compositions. nucleotide fragments, assays. and kits of the invention in theranostics. Food safety diagnostics. Industrial microbiology diagnostics, Environmental monitoring. Veterinary diagnostics. Bio-terrorism diagnostics.

The nucleic acid molecules, composition, kits or methods may be used in a diagnostic nucleic acid based assay for the detection of fungal and/or yeast species.

The nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure fungal and/or yeast titres in a patient. The titres may be measured in virm.

The nucleic acid molecules, composition. kits or methods may be used in a method of assessing the efficacy of a treatment regime designed to reduce fungal and/or yeast titre in a patient comprising assessing the fungal and/or yeast titre in the patient (by in vivo methods or in vilro methods) at one or more key stages of the treatment regime. Suitable key stages may include before treatment. during treatment and after treatment. The treatment regime may comprise an antifungal agent. such as a pharmaceutical drug.

The nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure potential fungal and/or yeast contamination, for example. in a hospital.

The nucleic acid molecules, composition, kits or methods may be used in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the SW15 gene function. Suitable disruptive agents may be selected from the group consisting of antisense RNA, PNA. siRNA.

Brief descriptioglf the Figures Figure 1: Selected primer binding sites in the SW15 gene of Aspergil/us fzmzigams. The regions (1. 2 and 3) ofinterest are underlined (Position of Region 1: 38 to 472. Position of Region 2: l034-1241. Position of Region 3: 1423-1627). .

Figure 2: Binding site ofA.fumigatus probe Pl-AspSWIS-1 (underlined and bolded) in the amplified fragment of SW15 (Region 1 ofinterest). PCR primes AspSWl5-l- l-'//\spS W15-l-R are highlighted.

Figure 3: Binding site of A. fumigatus probe Pl -AspSWl5-3 (underlined and bolded) in the amplified fragment of SW15 (Region 3 of interest). PCR primers AspSWl5 F/AspSWI5R are highlighted.

Figure 4: Resulting amplification plot from real-time PCR assay for A. ‘/irirzigatzir based on region I of the SW15 gene with TaqMan probe Pl-AspSWl5-l. Specificity of the assay was tested against a panel of DNA from 6 closely related Aspergillus species and I0 ( t’://iicrzm. The 3 A. fir/nigatus strains tested were detected and no cross-rcaction was observed with DNA from the other species tested.

Figure 5: Resulting amplification plot from real-time PCR assay for A. fzmzigatus based on region 3 of the SW15 gene with TaqMan probe P1-AspSWIS-3. Specificity of the assay was tested against a panel of DNA from 6 closely related Aspergillus species and C '. alliicam. The 3 A. fiimigalus strains tested were detected and no cross-reaction was observed with DNA from the other species tested.

Figure 6: Exclusivity of the SWi5 assays for A. firmigatus, A. flaws, A. niger and A. re/‘rem’. Bxelusivity assays were preformed with thermocycling conditions which included denaturalion and annealing at 95 "C for 5 seconds and 60 °C for 10 seconds for cycles. The probes detected only the species for which they were designed, with no cross-reaction observed.

Figure 7: Limit of detection of the A. fumigatus Afum_SWl5_l assay The LOD of the /1. ‘ )‘i1nrigutu.\' assay Afum_SWI5_l was preformed with annealing at 95 °C for 5 seconds and 60 "C for 10 seconds for 50 cycles.

Figure 8: Limit of detection of the SW15 A. terreus. Aterr_SWI5_l assay The results show the LOD for the A. terreus Aterr_SWI5_l assay.

The therniocycling conditions included annealing at 95 °C for 5 seconds and 60 °C for seconds for 50 cycles. An LOD ofl05 cell equivalents per reactionwas obtained.

Figure 9: Limit of detection of A. fumigarus Afum_SWI5_2: Graphs show the results obtained for the LOD assays preformed on ,4 _/i171’!/.g£'lIll.\' Afum_SWl5_2 assay. Results shown in graph 21 were obtained following denaturation and annealing annealing for 95°C for 10 secs and 60 °C for 30 sees for 50 cycles respectively. The results shown in graph b were obtained following denaturation and IE 0 9 0 4 5 4 l9 annealing at 95 "C for 5 secs and 60 °C for 20 sees, for 40 cycles. The LOD obtained was 100 cell equivalent.

Figure Ill: Limit of detection for the SWI5_2 assays for A. flavus, A. niger and A. terreus.

Annealing was 95 °C for 5 sees and 60 “C for 10 sees. for 45 cycles. A. niger assay shown in graph c was the only successful assay with a LOD of 10 cell equivalents.

Figure 11 Master alignment of SWI5 sequence information.

Detailed Description of the Invention Example 1 Materials and Methods Cell Culture .4spergi‘/I245 species were cultured in Sabouraud broth (4% wt/vol glucose, 1% wt/vol peptone, 1.5 % agar) or agar for 3-4 days at 25°C.

DNA Extraction Aspcrgillzrs spp. were pre-treated with lyticase or zymolase enzymes prior to DNA isolation. DNA was isolated from Apergillus spp. using the MagNA Pure System (Roche Molecular Systems) in combination with the MagNA pure Yeast and Bacterial isolation kit Ill according to the manufacturers protocol.

DNA sequencing of SW15 gene regions in Aspergillus spp.

The publicly available sequences of the SW15 genes for Aspergillus species were acquired from the NCBI GenBank database and aligned using Clustal W. Combinations of PC R primers were used to amplify sub ~regions of SW15 in Aspergillus species equivalent bp I to hp 2319 ofAsperg£Ilusfumigatus. For example, PCR Primers /\spSWl5-I -F/Asp SW15-I-R were designed to amplify a region in Awergillzis spp. equivalent to bp position 38 to 472 in A. fiunigarzrs XM_749401.l (Region 1, Figure 1).

PCR primers AspSWI5F/AspSWI5R were designed to amplify a region in .~tspcrgillu.s* spp. equivalent to bp position 1034 to 1241 in A. fumigalus (Region 2, Figure 1), AspSWI5F/AspSWI5R were designed to amplify a region in A.s'pcrgilIu5 spp. equivalent to bp position 1423 to 1627 in A. fumigatus XM_74<)40 l .l (Region 3, Figure l). The SW15 gene regions were amplified in a range of Aspcrgi//its spp. iCycler BioRad PCR machine or the PTC200 Peltier thermocycler (MJ Research) using the reagents outlined in Table 2 and the thermocycling conditions described in IE 0 9 0 4 6 4 20 Table 3 or modifications thereof. The PC R reaction products were purified with Roche High Pure PC R Product Purification kit or with the EXOSAP-IT kit (USB) according to the manufacturers’ instructions sent for sequencing to Sequiserve, Germany and sequenced using the forward amplification primer AspSWl5F or AspSWl5F.

DNA sequence information was generated as follows: Aspergillus region 1 sequence information was generated for 5 Aspergillus species (A fumigatus, A. m'dulan.s', A. clavarus. /'11 nfgcr, A. flavus) and Neosartoryajischeri. Aspergiilus region 3 sequence information was generated for 3 Aspergillus species (A. fimzigalus, A. nidulans, A. niger) and Ncosartoryafischeri.

Table 1: PCR primers designed to amplify SWIS gene regions in Aspergillus spp .

Primer Name Primer Sequence AspSW|5F ATCGACAACATCGTCGGCAGA AspSWl5-I-R GCTGTTGCTGTTGCATCAO/\TT AspSWl5-°-F TAGCCGCCATGCCAAGC AspS WISR CCAGTCTCTTTGATAGAAGCA AspSW|SF CGTGGACATGACCTG AAGC AspSWI5R GTCTCTCCTCCAACTCTGG I F ATGTTAGCCAATCCAC IR ATTCCAGGCACCG F CTTGAGGGCCAAATC R CTCGTCCTTTCAATCC F ACTATGCCTCGTCG R AGCGAATACATTGCC -‘ AC AAACCATATGAATGTC R GCAGGCTCGGTT SF CCTCGAGAAGATCGT SR C TAGC AGTCC ATGAAG Table 2: PCR reagents used to amplify the SW15 gene regions in Aspergillus spp PCR Reaction Mix SAMPLE x 1 I0 x Buffer( 100 mM Tris HCl, 15 mM MgCl3, 500 mM KCl 5 },ll pH 8.3) dNTP‘s Mix, Roche (l0mM dNTP) 1 ul Primer Forward primer (l0p.M) 1 til Primer Reverse primer (10ttM) 1 Ill Polymerase TaqP0l, Roche IU/ul l 111 H30 Amgen/Accugene 36-39 pl Genomic DNA Template 2-5 pl TOTAL VOLUME 50 pl lEo9o4e4 Table 3: PC R reaction conditions applied to amplify the SW15 gene regions in Aspergillus spp.

PCR Thermal profile Lid preheating was ON Step Temp Time I 94°C 1 min °C-59°C 1 min X 35 3 72°C 1 min °C 7 min °C Hold Table 4: TaqMan probes(5'-FAM and 3'-BHQI labels) based on the SW15 gene regions in Afumigatus.

Table 5: Real-time PCR reagents Probe Name Probe Sequence P1-AspSWl5- I CCAAAGTTCCTACCCTTCCAGCAC P1—AspSWI5-3 C TGACTCGGC ACAGACAAC GAGGA Table 6: Real-time PCR thermocycling conditions Preparation of PCR Reaction Mix SAMPLE Lig|iICycler®FastStar1DNA Master HybProbe, Roche Cat. 03 003 248 00 x I HybProb mix I0 x cone. {Red cap) 2 pl MgCl3 stock solution (Blue cap) (Final cone. in reaction is 3 mM) l.6 pl Probe Pl -A.~;pSWl5 or Pl—AspSWl5-3 2 pl Primer Forward AspSWl5-I-F or AspSWl5F 1 pl Primer Reverse AspSWl5-I-R or AspSW|SR 1 pl H30 PCR—gradc l(J.4 pl Template 2 pl TOTAL VOLUME 20 pl PCR Thermal profile Cycle Step Temp Time Activation 1 95°C 10 min Amplification 1 95°C 10 sec X 50 - 20 sec °C °C 10 sec Cooling 1 40°C Hold l5 Primer and Probe Design The publicly available sequence information available for the SW15 gene in Axpcrgillus spp. was aligned with the newly generated sequence infomiation for the SW15 gene in to LA :4- A.rper'giI/11$ spp. and analysed using bioinformatics tools. Species-specific probes were designed based on the compiled SW15 sequence information for Aspcrgi/[usfimrigarus (regions I and 3) (Table 4). Figures 2 and 3 show the relative positions of the PCR primers and TaqMan DNA probes for the amplification and detection of A.fumiguIu.s'.

Real-time PCR The specificity of the TaqMan probes for the identification of A. fumiga/us was demonstrated in real-time PC R assays on the LightCycler using the reagents and thcrmocycling conditions outlined in Tables 5 and 6. For the A. fumigcrrus assay based on the SWIS gene region 1, PCR primers AspSWI5-l-F/AspSWI5~1-R were combined with 'l‘aqMan probe, P1-AspSWI5-l. For the A. fumigarus assay based on the SW15 gene region 3. PCR primers AspSWISF/AspSWI5R were combined with 'l'aqMan probe. PI —AspSWI5-3.

The specificity of the assays for the detection of A. fumigatus was confirmed by including DNA from a range of closely related Aspergillus species and C c1/br'can.5' in the A. fimzigarus real-time PCR assays. The assays detected A. fumigarus but did not detect or ct0ss~react with DNA from C. albicans or any other Aspergillus species tested.

Figures 4-5 show the A. fumigazzrs real—time PCR assays based on SW15 regions I and 3 and the specificity of the assays for .4. fimzigalzrs.

Example 2 Additional primers to amplify A. nidulans, A. niger and A. terreus were designed. These primers produced PCR products from these species which were sequenced. The primer sequences are outlined in Table 7. AnigSWl5 primer set were designed to amplify positions 43 to 512 to produce a PCR product of469bp in length. AterrSWlS primer set amplified positions 44 to 450 producing a PCR product of469bp and AnidSW1S primer amplified positions 40 to 510 creating PCR products of 406bp.

Thirty strains representing 8 Aspergillus species (Table 8) have been successfully sequenced with four different primer sets.

Table 7: PCR primers designed to amplify SW15 gene regions in Aspergillus spp .

AnigSWlS_l F CAACACAGGCGGC AnigSWI5_lR TCTGTTGTTGTTGCATC AierrswIs_i F AACATCGAAGGCAGA AlerrSWl5_3R CTGCATCATGTTGAGG AnidSWI5_| F CGTCAACATCGACG AnidSWl5_l R TGCTGTTGAATGAGATT Table 8: Initial panel used to generate SWI5 sequences Species name Number 01 strains Strain numbers A. fumigatus 5 5059359+2010+4185+419 A. flavus 3 2008-t-117.62-+110 S5 A. niger 5 5184+329399+2864+554+2828+2599+121 A. terreus 3 383+5677+307 A. candidus 0 «- Ar clavatus 3 513B+1348+7944 A. glaucus 2 117314+542 A. nidulans 4 589+7063+80B+67O A. versicolo! O -- Lil. fischeri 3 19912+1085*241525 Thirty sequences representing 8 species of Aspergillus were generated. These sequences are listed in Appendix 1. Alignments were produced using the C lustul W software and homology and sequence differences were identified (Fig 11).

Results Primer and probe design: The sequence information generated was aligned using Clustal W. Potential primers and probes for real~time PCR assays were designed to amplify and detect A. fmnigalus-, A.

)’I¢n‘H.s'. A. niger and A. terreus. These primers and probes are outlined in Table 9. These assays were evaluated on the LC480.

The assays which included the probes Afum_SWl5_1. Aflav_SWlSg]r Anig_SWlS_l and Aterr_SWIS_1 proved to be specific, under thermocycling condtitions which included annealing at 95"C for 10 seconds and 60 °C for 30 seconds for 50 cycles (Fig 6). The species tested in the assays were A. fumigatus A. flavus A. niger A rcrrcus A. cam/idu.s' A. clavarus A. glaucus A. nidulans A. versicolor N. fischeri.

To investigate the LOD of these assays cycling conditions of 95“C for 5 seconds and 60 °C for 10 seconds for 50 cycles were tested. This was done in an effort to reduce the overall assay time. A LOD of 10 cell equivalents was obtained for the A. _fimiigaIu.r.

Afum_SWlS assay (Figure 7). However. the other three assays did not perform as well.

The A. Ierrcu.s~, Aterr_SWI5_1 assay produced a LOD of 105 cell equivalents. (Figure 8). A. nigcr and A. flavus assays did not produce a LOD. (Data not shown).

To improve the assays, new primers and probes (Table 9) were designed for the detection of the SW15 target in the species of interest. The detection limit for the new A. '/t1)1I1'gc'l!l(.$‘ assay Afum_SWl5_2 was found to be 2.5 cell equivalents per reaction under lhermocycling condtitions which included annealing at 95°C for I0 seconds and 60 "C for 30 seconds for 50 cycles.(Figure 9a).

When the annealing times of the Afum_SWI5_2 assay were reduced. an LOD of 100 cells per reaction (Figure 9b) was obtained. The A. niger assay Anig_SWl5_2 showed potential with a detection limit of 5 cells per reaction (Figure 10).

Table 9: Probes and primers for real-time PCR assays for the detection of the SW15 target.

Oligo name Sequence 5'-3' Aium_SWl5__1 ccgtctttgacctcagaaaga Alum_SW|5_1 F cccaatictcgca at Alum_SWl5__1 R ccgg atgattcg ca AtIav_SWI5_1 tgcaacagcaacactalgct Aflav_SWl5_1 F agaccgtgcaagat AfIav_SWl5_1 R ggtttgcaattcttca Anig_SWl5_1 cctgtglgtagcgcagc Anig_SWI5_1I5' acagtacegcagc Anig_SWi5_1 R cttccggggtgaa Aterr_SW|5_1 cgatctctacatgttcaacgac Aterr_SWI5_1 F cgaaagctccct Aterr_SWI$_1 R ccgtctgcggtc Afurn_SWl5_2 attccttgctggaggagaaca Afum_SWl5_2F gcacgatgggaccgt Afum_SWI5_2R gattgcgagaaltggg Afum_SWl5_3R ccgattgcgagaatlggg Afum_SW|5_3F acgatgggaccgt AfIav_SWI5_2F gtctctacacatgcaacgatcgc Aflav__SWl5_2R tgcattaccaggggacctgtt Aflav_SWl5_2 tgtgcaagatgglaaccttctaaat Aterr_SWl5_2F gaccatgcacgatggtaacgtt Aterr_SW|5_2R glgggtccgaaacgttgca Aterr__SWI5_2 agacggtgatgggagaagl Anig_SW|5_2F atccatgcaagatggtac Anig_SWls_2R ctacacacaggtatcgtt Anig_$WI5_2 tgctcggggacagcca Id In Table I0 Thcrmocycling conditions LC480 thermocycling conditions Step Temp Time UNG 50°C 2 min Denaturation 95°C 1 min 4°.5°cyC'°s Cycling 95°C 5-10secs °C 10-30secs Cooling 40°C 1-Zmins Table 11: Initial exclusivity panel for the SWIS assays A. fumigalux 2078 Species nztmv ,4. flmtusl I 7 .4. nigger 2599 A. Ierreus 2729 ,4. camlitlux 56 7. 65 . clavarus 23 9! . gluucus I I 7314 . nitlulrms 7063 LI:."J.I;.}.. . verxicolor 2916 /V. flsclteri 214525 Discussion The number of yeast and fungal infections among immunocomprised patients is escalating. Contributing to this increase is the growing resistance of many yeast and fungal species to antifungal drugs. There is therefore a need to develop a fast, accurate diagnostic method to enable early diagnosis of fungal and yeast species. Early diagnosis will enable the selection ofa specific narrow spectrum antibiotic or antifungal to treat the infection. The current invention provides for sequences and/or diagnostic assays to detect and identify one or more fungal and yeast species. The current inventors have exploited the sequence of the SW15 gene in Aspergillus species to design primers and probes specific for regions of this gene. The SW15 gene encodes a zinc finger DNA- binding protein required transcriptional activation of genes expressed in Gl-phase and at the G 1/M boundary. The sequence is conserved among closely related yeast and L) vs /5 0 9 0 4 6 4 26 fungal species. The SW15 sequence has significant intragenic sequence heterogeneity in some regions, while having significant homogeneity in others, a trait which makes SW15 an ideal candidate for the design of primers and probes directed towards the detection of yeast and fungal species specific targets and for the detection of genus specific diagnostic targets respectively. The current invention allows the detection of yeast and fungal species.

The words “comprises/comprising” and the words “having/including“ when used herein with reference to the present invention are used to specify the presence of stated features. integers, steps or components but does not preclude the presence or addition of one or more other features, integers, steps. components or groups thereof.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments. may also be provided in combination in a single embodiment. Conversely, various features of the invention which are. for brevity. described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination.

The invention provides sequences and/or diagnostic assays to detect and identify one or more yeast or fungal species. The current inventors have used the SW15 gene sequence to design primers and probes that are specific to Aspergillus and C andidu glabrata SW15 polynucleotide sequences. Such primers not only allow the detection of yeast and fungal species but also allow identification of Aspergillus species and discrimination between Aspergillus species and Candida glabrata. The current invention further provides for primers and probes that allow identification of As‘pergil/Its‘ species and Candida glabrara.

All patents. patent applications. publications, and accession numbers cited herein are incorporated by reference in their entireties. in so far as any sequence disclosed herein differs from its counterpart in the attached sequence listing in PatentIn3.3 software, the sequences within this body of text are to be considered as the correct version.

SEQ IDs N or x= any nucleotide; w=a/t, m=a/e, r=a/g, k=g/t, s=c/g, y=c/I, h=a/t/c, v=a’g/c. d=a/g/t. b=g/t/c. In some cases, specific degeneracy options are indicated in parenthesis: e.g.: (a/gt) is either A or G.

A qlaucus sequence information References: AumeBLJdmwnAL1bwUH,bmwmnLH Swifi controls a novel wave of cyclin synthesis in late mitosis. Mol Biol Cell. 1998 Apr;9(4):945-56.

Akamatsu Y, Dziadkowiec D, Ikeguchi M. Shinagawa H, Iwasaki H.

Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proc Natl Acad Sci U S A. 2003 Dec 23;l00(26):1S770-5. Epub 2003 Dec 8.

Butler G. Thiele DJ.

ACE2. an activator of yeast metallothionein expression which is homologous to SWl5.Mol Cell Biol. 1991 .Ian;l ltI):476~85.

MacCallum DM, Findon [-1, Kenny CC, Butler G, Haynes K, Odds FC.

Different consequences of ACE2 and SW15 gene disruptions for virulence of pathogenic and nonpathogenic yeasts. Infect Immun. 2006 Sep;74(9):5244-8.

Ellcrmcier C. Schmidt H, Smith GR.

Swi5 acts in meiotic DNA joint molecule fomiation in Schizosaccharomyces pombe. Genetics. 2004 Dec;l68(4): 1891-8. Epub 2004 Sep 30.

Claims (5)

Claims

1. I. A diagnostic kit for a fungal or yeast species comprising an oligonucleotide probe capable of binding to at least a portion of the SWI5 gene or its corresponding mRNA.

2. A kit as claimed in any ofclaims 1 to 3 wherein the portion ofthe SWJ5 gene is selected from:- a portion ofthe region ofthe gene from base pair position I to base pair position 2319 of the Aspcrgillus SW15 gene, a portion of the region of the gene from base pair position 38 to base pair position 472, or from base pair position 1423 to base pair position 1627 of the Aspcrgillus SWl5 gene. a portion ofthe region ofthe gene from base pair position 1 to base pair position 23 I9, from base pair position 38 to base pair position 472, and from base pair position I423 to base pair position l627 of the Aspergi/[us SW15 gene,

3. A kit as claimed in claim 1 or 2 comprising a probe selected from SEQ ID NO I7, I3. 42, 45, 48, 51, 54, 61, 64, or 67 or sequences substantially similar or complementary thereto which can also act as a probe, and/or a forward primer selected from the group consisting of SEQ ID NO 1, 3, 5, 7, 9, ll, 13. I5, 36, 38, 40, 43, 46, 49, 52, 55. 58. 59, 62 or 65, or sequences substantially similar or complementary thereto which can also act as a forward amplification primer and/or a reverse primer selected from the group consisting ofSEQ ID NO 2, 4, 6, 8, I0, 12, I4, 16. 37, 39, 41, 44, 47. 50, S3, 56. 57, 60, 63 or 66. sequences substantially similar or complementary thereto which can also act as a reverse amplification primer.

4. A nucleic acid molecule selected from the group consisting of: SEQ ID NO I through SEQ ID NO 95 and sequences substantially homologous or substantially complementary thereto or to a portion thereof and having a function in diagnostics based on the SW15 gene.

5. A kit substantially as described herein with reference to the Examples and/or the accompanying drawings.