IE83238B1 - Fusion proteins with monoclonal antibody, linker and beta glucuronidase for prodrug activation; preparation and use thereof - Google Patents

Description

PATENTS ACT, 1992 920630 FUSION PROTEINS WITH MONOCLONAL ANTIBODY, LINKER AND BETA GLUCURONIDASE FOR PRODRUG ACTIVATION; PREPARATION AND USE THEREOF HOECHST AKTIENGESELLSCHAFT The invention relates to fusion proteins for prodrug activation of the general formula huTuMAb-L-B—Gluc, where huTuMAb is a humanized or human tumor—specific monoclonal antibody, a fragment or a derivative thereof, L is linker, and B—Gluc comprises human B—glucuronidase. These fusion proteins are prepared by genetic manipulation. huTuMAb ensures the specific localization of tumors, L connects huTuMAb to B—Gluc in such a way that the specific properties of the two fusion partners are not impaired, and B-Gluc activates a suitable prodrug com- pound by elimination of glucuronic acid, where a virtually autologous system for use in humans is provided by the humanized or human fusion partners.

Combination of prodrug and tumor—specific antibody-enzyme conjugates for use as therapeutic agents is described in the specialist literature. This has entailed injection of antibodies which are directed against particular tissue and to which a prodrug-cleaving enzyme are covalently bonded, into an animal which contains the transplanted tissue, and subsequently administering a prodrug compound which can be activated by the enzyme. The action of the antibody-enzyme conjugate which is anchored in the tissue converts the prodrug compound into the cytotoxin which exerts a cytotoxic effect on the transplanted tissue.

WO 88/07378 describes a therapeutic system which contains two components and. is composed of an antibody-enzyme component. The use of non—mammalian enzymes for the preparation of the antibody-enzyme conjugate is described in this case, and that of endogenous enzymes is ruled out because of the non-specific release of active substance.

Since the exogenous enzymes are recognized as foreign antigens by the body, the use thereof is associated with the disadvantage of an immune response to these non- endogenous substances, on the basis of which the enzyme immobilized on the antibody is inactivated and, possibly, the entire conjugate is eliminated. Furthermore, in this case p-bis-N—(2-chloroethyl)-amino—benzylglutamic acid and derivatives thereof are used as prodrug, the chemical half-life thereof being only 5.3 to 16.5 hours. The chemical instability of a prodrug compound is a disad- vantage because of the side effects to be expected.

EP A2—O 302 473 likewise describes a therapeutic system containing two components, in which the antibody—enzyme conjugate which is localized on the tumor tissue cleaves a prodrug compound to give a cytotoxic active substance.

The combined use, which is described herein inter alia, of etoposide 4'-phosphate and derivatives thereof as prodrug and antibody—immobilized alkaline phosphatases to liberate the etoposides is a disadvantage because of the presence of large amounts of endogenous alkaline phospha- tases in serum. DE A1-38 26 562 describes how etoposide 4'-phosophates have already been used alone as therapeutic antitumor agent, with the phosphatases present in serum liberating the etoposide from the prodrugs.

The present invention is described by the patent claims and explained in more detail below. huTuMAbs coupled via L to B—Gluc and prepared by genetic manipulation represent a particularly advantageous, because virtually autologous, system. The catalytic activity of B-Gluc in the fusion protein at pH 7.4 (i.e. under physiological conditions) is significantly higher than that of the native enzyme when the fusion protein is bound to the antigen via the V region.

It has been found that a chemical modification of the fusion proteins, in particular partial or complete oxidation of the carbohydrate structures, preferably with subsequent reductive amination, results in an increased half-life. Enzymatic treatment of the fusion proteins according to the invention with alkaline phosphatase from, for example, bovine intestine or E. coli has in general not resulted in a significant increase in the half—life.

The present invention relates to fusion proteins of the formula huTuMAb—L—B-Gluc (I) where huTuMAb is a humanized or human tumor-specific monoclonal antibody or a fragment thereof, preferably the MAbs EP-Al-O 388 914. The antibody fragment huTuMAb described in particularly preferably contains the humanized MAb fragment with the VL and V" genes shown in Table 3.

Tab. 3 50 caactgcaggagagcggtccaggtcttgtgagacctagccagaccctgagcctgacctgc GlnLeuGlnGluSezGlyProGlyLeuValA.rgPr:oSerGlnTh.rLeuSe:I.euTh:Cy 110 " accg-tgtctggcttcaccatcagcagtggttatagctggcactgggtgagacagccacct ’I.'hrVa.lSezGlyPhe'I'hrIleS erSezGly'1‘yrSezTrpEis TzpVa.'LArgG.'Lr£roP ro _ 13 0 . 15 O 17 0 ggacgaggtcttgag-tggattggatacatacagtacagtggtatcactaactacaacccc GlyArgGlyLeuGluTrpIleGly1‘yrIleGlnTyrSerGlyI1eThrAsn1'yx:Asn.P:o 230 tctctcaaaagtagagtgacaatgctggtagacaccagcaagaaccagttcagcctgaga SerLeuLysSe:A.rgVal':hd«!etLeuVa.J.A5pThrSerI.ysAsnGln.P hes erI.euZ-Lrg _ 290 ctcagcagcgtgacagccgccgacaccgcggtctattattgtgcaagagaagactatgat I2euSerSezValTh:AlaAlaAspTh:1LlaValTyrTyrCysAlaA:gGluAspTy:B.sp ' 330 350 taccactggtacttcgatgtctggggtcaaggcagcctcgtcacagtctcctca Tyrfiis'1‘rp':yrEheAspVal'1'rpGlyGlnGlySerLeuValTh::ValSerSer .fllQ 30 50 ggtgtccact:ccgacatccagatgacccagagcccaagcagcctgagcgccagcgtggqt GlyVa.lEisSe:AspIleGJ.nMetThzGlnSerProSerSerLeuSe:A.‘LaSe::Va.lGly 7 0 . 9 0 110 , gacagagtgaccatcacctqtagtaccagctcgagtgtaagttacatgcactggtaccag AspArgValTh.rIle1'hrCysSer'I'hrSerSerSerVa.lSez:'l‘y:MetEisTrpTyrGln 130 150 170 cagaagccagqtaaggctccaaagctgctgatctacagcacatccaacctggcttctggt GlnLysProGlyLysAlaProLys LeuI.euIle1‘yrSe::‘1‘h::Se:AsnI.euAla.Se:Gly. . 210 ' . 230 gtgccaagcagatt cagcggtagcggtagcggtaccgacttcaccttcaccatcagcagc Val? ro SeJ:ArgPheSezGlySe::GlySe::Gly!.'h.:AspPhe ':hrPheTh.:IleSe:S er 290 ctccagccagaggacatcgccacct actactgccat cagtggaqtaqttatcccacgtt C LeuGlnP roG.‘Lu.Asp Ile.Ala1'hr’ry:’1‘yrCysEisGJ.nTrpSerSerTy:P to 1'h:P he ggccaaggqaccaagqtggaaatcaaacgt GlyGlnGlyThrLysVa.lGluI leLysA1:g' L is a peptide linker and contains a hinge region of an immunoglobulin which is linked via a peptide sequence to the N-terminus of the mature enzyme .

B—Gluc is the complete amino-acid sequence of human B-glucuronidase or, in the relevant gene con- structs, the complete CDNA (Oshima A. et al., Proc. Natl. Acad. Sci. USA 84, (1987) 685-689).

The constructs suitable for the expression of the fusion proteins according to the invention have a CH1exon and at least one hinge exon in the regions coding for the huTuMAb; constructs are those in which these parts derive from a antibody fragment particularly preferred human IgG3 C gene. Suitable for the expression of the fusion proteins according to the invention are constructs, as described for example in Example (I), where the corresponding light chain of the humanized TuMAb is coexpressed in order, in this way, to obtain an huTuMAb portion which is as similar as possible to the original TuMAb in the binding properties. Finally, the invention relates to processes for the preparation by genetic manipulation of the abovementioned fusion proteins, to the purification thereof and to the use thereof as pharmaceuticals. Fusion proteins as describe can be used for prodrug activation in oncoses.

In another embodiment, the fusion proteins according to the invention are chemically modified in order to achieve an increased half—life and thus an improved localization of tumors. The fusion proteins are preferably treated with an oxidizing agent, for example periodate, which generally results in partial or complete cleavage of the carbohydrate rings and thus in an alteration in the carbohydrate structure. This alteration generally results in an increased half-life. It is furthermore advantageous to derivatize, in a second reaction step, existing aldehyde groups, for example by reductive amination. The partial or complete destruction of the aldehyde groups generally results in a reduction in possible side reac- tions with, for example, plasma proteins. Accordingly, it is advantageous for the fusion proteins according to the invention to be oxidized in a first reaction step, for example with periodate, and to be reductively aminated in a second reaction step, for example with ethanolamine and cyanoborohydride.

The following examples describe the synthesis by genetic manipulation of a particularly preferred fusion protein according to the invention, the derivatization thereof and the demonstration of the ability of the two fusion partners to function.

Example (A): The starting material was the plasmid pGEM4-HUGPl3 (Fig. A). pGEM4—HUGPl3 contains a CDNA insert which contains the complete coding sequence for the human B-glucuronidase enzyme (Oshima et al. loc. cit.). All the techniques used were .taken from Maniatis et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor USA (1989).

Example (B): The plasmid pGEM4—HUGPl3 was cut with the restriction endonucleases Pstl and SalI, and the 342bp-long Pstl/SalI fragment which harbors the Notl restriction cleavage site was isolated. The Pstl/Sall fragment was cloned into the Pstl/Sall-cleaved vector pTZ (Fig. B.l) and the clone pTZBGlc35O was isolated (Fig. B.2).

Example (C): The plasmid clone pTZBGlc35O was cleaved with Pstl, and the double-stranded DNA fragment BGlc linker, which is composed of the oligonucleotides BGlc linker l and BGlc linker 2 (Tab. 1) and has cohesive Pstl ends, was ligated into the opened Pstl cleavage site.

Tab. 1 GCG GCG GCG GCG GTG CA CCG CCG CCG CCG CTG CA The clone pTZBGlc370 in which the B-glucuronidase frag- ment is extended at its 5' end by the DNA fragment BGlc linker and which has lost the previously present PST I cleavage site but has acquired instead at its 5' end a new Pst I cleavage site was isolated.

Example (D): The plasmid clone pTZBGlC37O was cleaved with Pst I and ligated to the hinge—linker fragment which is composed of the hinge oligonucleotides 1 and 2b and which has two cohesive Pst I ends (Tab. 2). This results in the Pst I cleavage site at the 5' end of the BGlc37O fragment being destroyed. The plasmid clone pTZBGlc42O in which the BGlc insert is extended at the 5' end by the hinge-linker fragment H was isolated (Fig. D).

Tab. 2 Hm e 1 H o: ' - GAG CCC AAAVTCT TGT GAC ACA CCT CCC CCG TGC CCA CGG TGC CCA GTT GCA Hm 2 li y ACT GGG CAC CGT GGG CAC GGG GGA GGT GTG TCA CAA y GAT TTG GGC TCT GCA Example (E): The plasmid pTZBGlc42O was cleaved with Pstl and Sall, and the 420bp IgG3c F(ab')2 2H_(EP—A2—O 352 761, Fig. 3, ibidem), which insert was isolated. The plasmid contains the CH;exon and two hinge exons of a human IgG3 C gene was completely cleaved with Sall and partially cleaved with Pstl. The isolated 42obp insert was ligated to this Sall/Pstl (part.) cleaved plasmid, and the plasmid clone which contains the CH1 exon, a hinge exon and the BGlc42O fragment, that is to say carries the genetic information of two hinge exons between CH1 exon and B-glucuronidase, was isolated (pUC CH1 + H + BGlc420) (Fig. E).

Example (F): The plasmid pGEM4-HUGPl3BGlc was cleaved with Sall, and the l750bp Sall fragment fronxthe B-glucuronidase cDNA.was isolated. The isolated l750bp Sall fragment was ligated to the Sall-cleaved plasmid pUC CH1 + H + BGlc420. The plasmid clone pUC CH1/BGluc which contains a fusion gene composed of a CH1 exon, a hinge exon and a fusion exon between a hinge exon and the human B-glucuronidase cDNA was isolated (Fig. F).

Example (G): The expression vector pABstop (Fig. I.l) was cleaved with HindIII and Sall. The plasmid pUC CH1 + H + HuBG1c was cleaved completely with HindIII and partially with Sall, and the CH1 + H + huBGlc insert was isolated. The CH1 + H + huBGlc insert was ligated to the HindIII/Sall- cleaved pABstop, and the clone pABstop CH1 + H + huBGlc was isolated (Fig. G).

Example (H): The pABstop vector pABstop BW 431/26 hum V", which con- tains the humanized version of the VH gene of the anti-CEA MAb BW 431/26 (Bosslet K. et al., Eur. J. Nucl.

Med. 14, (1988) 523-528) (see Tab. 3 for the sequences of the humanized VH and VK gene), was cleaved with HindIII and BamH1, and the insert which contains the signal exon and the V" exon was isolated. The plasmid clone pABstop CH1 + H + huBGlc was cleaved with HindIII and ligated to the HindIII/BamHl 431/26 hum VH fragment. After ligation at room temperature for 2 h, the ligation was stopped by incubation at 70°C for 10', and the ends which were still free were filled in with Klenow polymerase and dNTPs.

Further ligation was then carried out overnight. After transformation, the clone BABStop 431/26 hum VH huBGlc1H which contains an immunoglobulin F(ab')2 gene with a hinge exon, which is fused to the coding region of human B—glucuronidase, was isolated with the aid of restriction mapping and nucleic acid sequence analysis (Fig. H).

Example (I): The clone pABStop 431/26 hum V" huBGlc1H was transfectéd together with a plasmid clone which carries the light chain of humanized BW 431/26 (Fig. I) and two plasmids which carry a neomycin— (Fig. K) and a methotrexate- resistance gene (Fig. L) into BHK cells. A fusion protein which has both the antigen—binding properties of MAb BW 431/26hum and the enzymatic activity of human B-glucuronidase was expressed.

Example J: Demonstration of the antigen-binding properties and of the enzymatic activity of the 431/26hum\QhuBG1c 1H fusion protein The ability of the 431/26hum VduiBGlc 1H fusion protein to bind specifically to the epitope defined by 431/26 on CEA (carcinoembryonic antigen) and, at the same time, to exert the enzymatic activity of human B—glucuronidase was determined in a specificity/enzvme activity assay. This assay is carried out as described below: - Polystyrene (96—well) microtiter plates (U shape, Type B, supplied by Nunc, Order No. 4-60445) are incubated with purified CEA (1-5 ug of CEA/ml, 75 pl of this per well) or with GIT mucin (same amount as CEA) at R.T. overnight.

— The non-adsorbed antigen is removed by aspiration and washed 3 >< with 0.05 M tris/citrate buffer, pH 7.4.

— The microtiter plates are left to stand at R.T. with the opening facing downwards on cellulose overnight.

- The microtiter plates are incubated with 250 pl of % strength casein solution in PBS, pH 7.2, per well (blocking solution) at 20°C for 30 minutes.

- During the blocking, the substrate is made up. The amount of substrate depends on the number of super- natants to be assayed. The substrate is made up fresh for each assay. -methylumbelliferyl B-D—glucuronides (Order No.: M-9130 from Sigma), 2.5 mM in 200 mM sodium acetate buffer, pH 5.0, with 0.01% BSA.

— Substrate: — The blocking solution is removed by aspiration, and in each case 50 ul of BHK cell supernatant which contains the fusion protein are loaded onto the microtiter plate coated with CEA or GIT mucin (that is to say the sample volume required is at least 120 ul).

— Incubation at R.T. is then carried out for 30 minutes.

— The plates are washed 3 x with ELISA washing buffer (Behring, OSEW 96).

- The substrate is loaded in (50 ul/well) and in- cubated at 37°C for 2 hours. The plate is covered because of the possibility of evaporation.

— After 2 hours, 150 ul of stop solution are pipetted into each well (stop solution = 0.2 M glycine + 0.2% SDS, pH 11.7).

— Evaluation can now be carried out under a UV lamp (excitation energy 380 nm) or in a fluorescence measuring (Fluoroscan II, ICN Biomedicals, Cat. No.: 78O0). instrument It was possible to show using this specificity/enzyme activity assay that fluorescent 4-methylumbelliferol was detectable in the wells coated with CEA when the enzyme activity was determined at pH 5, the catalytic optimum (Tab. 4).

Table 4: Dilution out of fusion protein cell culture supernatant (B73/2) on CEA and GIT mucin Substrate in various solutions Dilution 0.2 M sodium PBS, pH 7.2, PBS, pH 7.2 steps acetate buffer on CEA on GIT mucin + 0.01% BSA, pH 5, on CEA Concen- trated 9118 2725 115.7 1:2 7678 2141 93.37 1:4 4662 1195 73.39 1:8 2927 618.5 60.68 1:16 1657 332.1 53.69 1:32 853 168.2 40.44 1:64 425 99.26 48.21 1:128 192.5 57.89 47.48 Determination of the conversion rate at pH 7.2 showed that at this physiological pH that of the fusion protein was still = 25% of the conversion rate at pH 5. No significant methylumbelliferol liberation was measurable on the negative control plates coated with GIT mucin and measured at pH 5. This finding shows that the humanized V region of the 431/26hum VghuBGlc 1H fusion protein has retained its epitope specificity, and the B—glucuronidase portion of the fusion protein is able, like the native human enzyme, to cleave the 8-glucuronide of 4—methyl- umbelliferol. _ 13 - Example K: Demonstration of the functional identity of the V region. of the 431/26hun1\QhuflG1c 1H fusion protein with that of the humanized MAb BW 431/26 and that of the murine MAb BW 431/26 It was shown in Example J that the 431/26hum VguiBGlc 1H fusion protein has a certain CEA—binding potential and B—glucuronidase activity. The antigen—specific com- petetive assay described hereinafter provides information on the identity of the CEA epitopes which are recognized by the competing molecules, and on the interaction epitope/fusion strength of the protein and epitope/antibody reactions.

This assay is carried out as described below: — Polystyrene 96—well microtiter plates (U shape, Type B, supplied by Nunc, Order No. 4-60445) are in- cubated with purified CEA (1-5 ug of CEA/ml, 75 ul of this per well) or with GIT mucin (same amount as CEA) at R.T. overnight.

- The non-adsorbed antigen is removed by aspiration and washed 3 >< with 0.05 M tris/citrate buffer, pH 7.4.

— The microtiter plates are left to stand at R.T. with the opening facing downwards on cellulose overnight.

— The microtiter plates are incubated with 250 pl of 1% strength casein solution in PBS, pH 7.2, per well (blocking solution) at R.T. for 30 minutes. — 50 ul of the MAb BW 431/26 in a concentration of ng/ml are mixed with 50 pl of l0-fold concentrated supernatant of the humanized MAb BW 431/26 or of the fusion protein, as well as serial 2 X dilutions. - 50 ul aliquots of these mixtures are pipetted into _ 14 _ the wells of microtiter plates coated with CEA or GIT mucin.

The microtiter plates are incubated at R.T. for 30 minutes.

The plates are then washed 3 x with ELISA washing buffer (supplied by Behringwerke AG, OSEW 96, 250 pl).

Then 50 pl of a 1:250-diluted goat anti—mouse Ig Order No. antibody which is coupled to alkaline phosphatase (Southern Order No.: -04) are added.

Biotechnology Associates, After incubation at R.T. for 30 minutes and washing 3 times, the substrate reaction is carried out as follows: Add 30 pl of 0.1 mM NADP per well (dissolve 7.65 mg in 100 ml of 20 mM tris; 0.1 mM MgSO4, pH 9.5); the solution can be stored at -20°C for several months.

Incubate at R.T. for 30 minutes.

Make up the enhancer system during the incubation with NADP: (5 ml per plate) parts of INT (dissolve 2.5 mg/ml in 30% strength ethanol in an ultrasonic bath; always make up fresh) + 1 part of PBS, pH 7.2 + 1 part of diaphorase (1 mg/ml PBS, pH 7.2) + 1 part of ADH (0.5 mg/ml PBS, pH 7.2) add 50 pl of the enhancer system when the extent of reaction is as required, stop the reaction with 0.1 N H2804, 100 pl per well measure at 492 nm in a TITERTEKG MULTISCAN (blank = 50 pl of NADP + 50 pl, 100 pl of 0.1 N HZSOQ of enhancer solution + NADP - supplied by Sigma, Order No. N—O505 INT ADH - supplied by Sigma, Order No. I-8377 — supplied by Sigma, Order No. A-3263 Diaphorase — supplied by Sigma, Order No. D-23 Reduction of the extinction in this antigen—specific competetive assay means that there is competition between the molecules competing with one another for epitopes which are the same or lying very close together spatially.

The inhibition data which are obtained show that both the fusion protein 431/26hum Vfiuificlc 1H and the humanized MAb 431/26 block binding of the murine MAb BW 431/26 to its CEA epitope. 50% inhibition is reached at a 200 molar excess of the relevant competitors. The conclusion from this is that the avidity of the fusion protein for the CEA epitope is comparable with that of the humanized MAb 431/26. Furthermore, the fusion protein and the humanized MAb bind to the same epitope or to an epitope which lies spatially very near to that defined by the murine MAb BW 431/26 on CEA.

Example L: Demonstration of the tissue specificity of the 431/26hum Vahupslc 21-I fusion protein Example J showed, inter alia, that the 431/26hum VghuBGlc 1H fusion protein is able to bind to purified CEA.

Example K showed that the V region of the fusion protein is able to compete with the V region of murine BW 431/26 for the same, or a very close, epitope. The indirect immunohistochemical assay which is specific for B—g1ucuronidase and is described hereinafter can be used to determine the microspecificity of the fusion protein on cryopreserved tissues. _ 16 _ The assay is described below: pm-thick frozen sections are placed on slides and dried in air for at least 30 minutes.

The slides are subsequently fixed in acetone at —20°C for 10 seconds.

The slides are washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes. -100 ul of fusion protein—containing BHK cell supernatant (concentrated or diluted in tris/BSA, pH 7.4) is applied to each section and incubated in a humidity chamber at R.T. for 30 minutes.

The slides are washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes. ul of hybridoma supernatant of the murine anti-B- glucuronidase Nm¢> BW 2118/157 are added. to each section, and the slides are incubated in a humidity chamber at R.T. for 30 minutes.

The slides are then washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes. -100 ul of bridge Ab (rabbit-antimouse IgG diluted 1:100 in human serum, pH 7.4) are applied to each section and incubated in a humidity chamber at R.T. for 30 minutes.

The slides are then washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.

Subsequently 20-100 ul of APAAP complex (mouse anti- AP diluted 1:100 in tris/BSA, pH 7.4) are applied to each section and incubated in a humidity chamber at R.T. for 30 minutes.

The slides are then washed in tris-NaC1 washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.

The substrate for alkaline phosphatase is made up as follows (100 ml of substrate solution sufficient for one glass cuvette): Solution 1: 3.7 g of NaCl .7 g of tris base (dissolve in 75 ml of distilled water) +266 mlofpropanediol buffer, pH 9.75, adjust with Hcl + 42.9 mg of levamisole = clear, color- less solution Solution 2: Dissolve 21.4 mg of sodium nitrite in 535 pl of distilled water = clear, colorless solution Solution 3: Dissolve 53.5 mg of naphthol AS biphosphate in 642 pl of dimethylformamide (DMF) = clear, yellowish solution - Add 368 pl of 5% strength new fuchsin solution to solution 2 (sodium nitrite) and leave to react for 1 minute (stopclock) to give a clear, brown solution — Add solution 2 (sodium nitrite with new fuchsin) and solution 3 (naphthol AS biphosphate) to solution 1 (tris/NaCl/propanediol buffer) = clear, yellowish solution — adjust to pH 8.8 with HCl = cloudy, yellowish solution - filter solution and place on the slide and leave to react on a shaker for 15 minutes = solution becomes cloudy. — wash slide in tris/NaCl buffer, pH 7.4, for 10 minutes — wash slide in distilled water for 10 minutes - after drying in air for 2 hours, the slides are sealed in Kaiser's glycerol/gelatin at 56°C.

Specific binding of the fusion protein was demonstrated under the light microscope by the red coloration of the epitope—positive tissue sections. Comparative _ 18 - investigations with the murine MAb BW 431/26, which was detected by the indirect APAAP technique (Cordell et al., J. Histochem. Cytochem. ;;, 219, 1984), revealed that the tissue specificity of the fusion protein agreed exactly with that of the murine MAb BW 431/26, i.e. that there is identity both of the reaction type in the individual specimen and of the number of positive and negative ‘findings from a large number of different carcinomas and normal tissue.

Example M: Purification of the 431/26humn\QhuBG1c 1H fusion protein Murine and humanized MAbs can be purified by immuno- affinity chromatography methods which are selective for the Fc part of these molecules. Since there is no Fc part in the 431/26hum \@huBGlc 1H fusion protein, it was necessary to develop an alternative highly selective immunoaffinity chromatography method. Besides the selec- tivity of this method to be developed, it is necessary for the isolation conditions to be very mild in order not to damage the B-glucuronidase, which is very labile in the acidic and in the alkaline range.

The principle of the method comprises purification of the fusion protein from supernatants from transfected BHK cells using an anti—idiotype MAb directed against the humanized V region. The preparation of such MAbs is known from the literature (Walter et al., Behring Inst. Mitt., 82, 182-192, 1988). This anti—idiotype MAb can be both murine and humanized. The MAb is preferably immobilized on a solid phase so that its V region has not been damaged. Examples of this are known from the literature (Fleminger et al., Applied Biochem. Biotechnol., 23, 123- 137, 1990; Horsfall et al., JIM 104, 43-49, 1987). _l9_ The anti-idiotype MAb thus immobilized on the solid phase by known methods binds very efficiently the fusion protein to be purified from transfected BHK cells, for example at pH 7, but has the surprising property that it no longer binds the fusion protein when the pH is lowered by only 2.5, to pH 5.5. This mild pH elution technique has no adverse effect on the fusion protein, either in its ability to bind to CEA or in its enzymatic activity (for methods, see Example J). Tab. 5 shows the OD values and fluorogenic units (FU) of the individual fractions from a purification using the solid phase—immobilized, anti-idiotype MAb BW 2064/34.

Table 5: _ 20 _ Anti—idiotype affinity chromatography OD in FU in % pH Chromatography procedure Fractions 1-5 1 0 7.2 Preliminary washing of the column with PBS, pH 7.2 6-142 20 0 7.2 Sample loading 143-162 1 0 7.2 Washing of the column with PBS, pH 7.2 0 7.2 O 7.2 0 7.2 0 6.8 6.1 5.7 40 5.6 80 5.5 100 5.4 Elution with PBS, ' 80 5.3 pH 4.2 60 5.2 40 5.2 5.1 5.1 5.1 5.0 5.0 O 5.0 fraction = 18 ml/h) = 2 ml The FU values are indicated as ). collection for 6.6 min (at pumping rate of of the highest value (fraction _ 21 - The elution of the fusion protein was measured as protein by measurement of the OD at 280 nm. In addition, the isolated fractions were examined for specific binding to CEA and simultaneous enzyme activity in the specificity/ enzyme activity assay (Example J). The values show that all the specific binding and enzyme activity was con- centrated in one peak (peak eluted from around pH 5.0 to pH 5.6). The conclusion from this is that the thus described method of anti—idiotype affinity chromatography is a very efficient and selective purification technique for the 431/26hum VghuBGlc 1H fusion protein.

Example N: Gel chromatography of the fusion proteins The supernatants from the BHK cells secreting the 431/26hum V" huBGlc lH fusion protein (B 70/6, B 74/2, B 72/72, B 73/2) were removed, sterilized by filtration and subjected to analytical gel filtration. For this, a TSK G3000 SW—XL column (7.8 X 300 mm) was equilibrated with 0.1 M sodium phosphate buffer, pH 6.7, + 0.02% NaNy pl of the supernatant were loaded on, and elution was carried out with a flow rate of 0.6 ml/min. Starting with an elution time of 9 min (exclusion volume 9.5 min), fractions (0.3 min each) were collected and assayed for B-glucuronidase activity.

For this 25 pl of the particular fraction were mixed with 75 ul of substrate solution (2.5 mM 4—methylumbelliferyl B—glucuronide in 200 mM sodium acetate buffer, pH 5, + 0.1 mg/ml BSA) and incubated at 37°C for 2 hours. The reaction was then stopped with 1.5 ml of 0.2 M glycine/0.2% SDS solution, pH 11.7, and the fluorescent label liberated by the glucuronidase was quantified in a Hitachi fluorometer (with excitation wavelength of 360 nM _ 22 _ and emission wavelength of 450 nM).

Result: All 4 constructs show a single main activity peak between fractions 4 and 6 (Table 6). This corresponds to reten- tion times of about 10.2 — 10.8 min. The fusion proteins with glucuronidase activity in the supernatants thus have retention times which are of the same order of magnitude as those of chemically prepared antibody—B—glucuronidase constructs (10.4 min). The retention time for the free enzyme are 11.9, and for the free antibody is 12.3 min.

Table 6: Gel filtration of various fusion proteins 37°C, 120 min .875 mM; Incubation: 25 pl, Substance concentration: 0.1 mg/ml BSA Each fraction 0.3 min; start at 9 min Liberated label/assay (FU) Fractions B70/6 B74/2 B72/72 B73/2 1 11 17 15 15 2 22 35 44 38 3 125 97 873 1014 4 1072 196 2959 3994 1588 165 2206 3141 6 1532 120 1133 1760 7 941 103 581 926 8 710 69 376 723 9 500 108 302 626 123 316 613 11 320 107 263 472 12 "254 91 210 456 13 224 57 146 357 14 190 65 134 332 171 52 83 294 16 167 44 99 243 17 100 38 73 217 18 129 34 55 179 19 75 45 48 155 66 41 36 129 21 118 22 93 23 78 24 61 24 26 51 _ 24 _ Example 0: Molecular characterization of the 431/26 hum V; hupG1c1H fusion protein The fusion proteins were purified by anti-idiotype affinity chromatography in Example M. Aliquots from the peak eluted at pH 5.5 were electrophorized under non- reducing and reducing conditions in a 10% SDS PAGE and immunostained in a Western blot using anti-idiotype MAbs or with anti—B—glucuronidase MAbs (Towbin and Gordon (1979), Proc. Natl. Acad. Sci. USA 76: 4350-4354).

Under non—reducing conditions with the 431/26 hum VH huBGlc1H fusion protein, a main band of = 125 kDa and a band of 250 kDa were detected and were detactable both by anti-idiotype MAb and by anti—B-glucuronidase MAb in the Western blot. Under reducing conditions there was no detectable immunostaining either by the anti-idiotype or by the anti~B—glucuronidase MAbs. A 100 kDa and a 25 kDa band were detected in the reducing SDS PAGE. However, these molecules analyzed under denaturing conditions are, according to TSK G 3000 SW-XL gel filtration under native conditions in the form of a higher molecular weight product which has a molecular weight of = 250. kDa (Example N). Diagrammatic representations of the 431/26 hum VH1NJBGlClH fusion protein are shown in Fig. M. Figure kDa light chain and Mb shows the monomer which has a a = 100 kDa heavy chain. This monomer and a dimer linked by inter-heavy chain disulfide bridges can be detected under denaturing conditions (Fig. Ma). Under native conditions, the fusion protein is in the form of a dimer of = 250 kDa, with or without inter—heavy chain disulfide bridges (Fig. Mc).

EXAMPLE P: Chemical modification of the fusion protein The fusion protein purified as in Example N (110 ug/ml) was adjusted to pH 4.5 and mixed with sodium periodate (final concentration 1. mM). After incubation at room temperature in the dark for 1 hour, the sodium periodate was removed by gel chromatography, and the fusion protein was then readjusted to pH 8. Addition of ethanolamine to a final concentration of 0.1 M was followed by incubation at 4°C for a further‘ 3 hours, then sodiunx cyanoboro— hydride (final concentration 5 mM) was added and in- cubated for 30 min (reduction). This was followed by another gel filtration to remove the reducing agent and to change the buffer of the fusion protein. The chemical modification had no effect on the functional activity of the fusion protein. Tab. 7 shows the change in the plasma concentrations of unmodified and modified fusion protein in the nude mouse. The elimination of the fusion protein slowed down by the from the plasma is greatly modification.

Table 7: Plasma levels of fl-glucuronidase activity in the nude mouse B—Glucuronidase fusion protein t Treated Untreated [min] % activity % activity 0 100 100 54 76 60 22 240 40 4 480 1 1380 19 1440 1 5880 3 EXAMPLE Q: Enzymatic treatment of the fusion protein ug of fusion protein (Example N) in 0.01 M tris/HCl, 0.15 M NaC1 were incubated with 1 unit of soluble alkaline phosphatase (E. coli) or immobilized alkaline phosphatase (bovine intestine) at room temperature for h. Tab. 8 shows the change in the plasma concentration of untreated and treated fusion protein in the nude mouse. The elimination is not significantly affected by the enzyme treatment. ..27_ Table 8: Plasma levels of B—glucuronidase activity in the nude mouse B—Glucuronidase fusion protein AP AP t (bovine intestine, (E. coli) immobil.) [min] untreated treated treated [%] [%] [%] 0 100 100 100 78 76 65 44 57 53 60 35 36 35 240 22 27 22 1440 4 5 5 AP = alkaline phosphatase Example R: Pharmacokinetics and tumor retention of the 431/26 hum V, huflG1c 1H fusion protein By way of example, 5 X 4 ug of purified fusion protein which was mixed with 100 ug of HSA/ml were injected in unmodified (Example N) and chemically modified form (Example P) i.v. at 24-hour intervals into CEA-expressing nude mice harboring human tumors. After defined time intervals, 3 animals in each case were sacrificed by cervical dislocation. The organs were removed, weighed and mixed with 2 ml of 1% strength BSA in PBS, pH 7.2.

The tissue and cells from these organs were then broken down in a Potter (10 strokes) and the amount of functionally active fusion protein was determined in the supernatant after centrifugation of the suspension at 3000 rpm and RT for 10' (Heraeus Labofuge GL, Type 2202) in the specificity/ enzyme activity assay (see Example J). The data from a representative experiment are shown in Tab. 9. It is clearly evident that the chemically1nodified fusion protein, which has a tl/2B of = 4}» specifically accumulates in the tumor from 2 3 days after completion of the repetitive injection phase. The unmodified fusion protein, which has a tl/2B of==2O min, showed no significant accumulation in the tumor under the same experimental conditions.

It may be concluded from these data that the hu 431 B—Gluc fusion protein is able to bind in vivo to CEA—positive tumors and to remain there as enzymatically active molecule over long time periods (> 9 days). The time the prodrug is administered in this system should be between day 3 and after completion of the fusion protein injection. mHo.o . m.o v.o N.H mH.o m.H q.vm mam m.o ma H.m n v.q Ha q.mm mp v.vv mmfi vw I m.mm m.mv ».mw «N oofi oofi oofi oofi oofi oofi oofi m mewmam ®CHuW®uCH xmcuflm cwwamm mcsq H®>HQ uoeze COHuU®mCH .>.H umma cmmuo no uoszu mo m\>uH>fluo< w . uwuwm Anv GEAR wusoc vm mo mHm>uwucH um wmsoe uwm cwwuoum coflmsm mo on v x m mo :oHuomm:H .>.H AH oum N2. uwmumocmx MEOCHUHMU :omEoum :mE:: m>HuflwoQn um magma -30..

Example S: Isoelectric focusing of the 431/26 hum V5 huflGlc 1}! fusion protein The fusion protein purified by anti—idiotype affinity chromatography (Example N) was subjected to isoelectric focusing in the Pharmacia Fast System by the method of Righetti et a1. (1979). It emerged from this that the isoelectric point of the molecule lies in a pH range from 7.35 to 8.15.

EXAMPLE T: Demonstration that a cytostatic prodrug can be cleaved by It was shown in Example J that the B-glucuronidase portion of the fusion protein is able, like the native human enzyme, to cleave the B-glucuronide of 4-methylumbelliferol. In the investigations which are described hereinafter, the substrate used for the enzymatic cleavage was a B-glucuronide, linked via a spacer group, of the cytostatic daunomycin. The specific procedure for these investigations was as follows: mg of the compound N-(4-hydroxynitrobenzyloxy— carbonyl)daunorubicin B—D—glucuronide (prodrug), which is described in French Patent.Application (No. d'Enregistrement National: 9105326) were dissolved in 1nfl.of Zonmdphosphate buffer, pH 7.2. 35 ul of the fusion protein (Example N) or of human B—glucuronidase (total concentration in each case 6.5 U/ml; 1 U = cleavage of 1 umol of 4-methyl- umbelliferol/min at 37°C) were pipetted into 5 pl portions of this substrate solution and incubated in the dark at °C. Samples (5 ul) of the incubation mixture were removed _ 31 _ after various times and immediately analyzed by high pressure liquid chromatography under the following conditions: Column: Nucleosil 100 RP 18, 5 um particle diameter, 125 x 4.6 mm Mobile phase: Gradient of solution A (lOO% acetonitrile) and solution B (20 mM phosphate buffer pH 3.0) min: 30% solution A l5 min: 70% solution A min: 70% solution A Flow rate: 1 ml/min Detection: fluorescence, excitation 495 nm, emission 560 nm Data analysis: Beckman System Gold Software The retention time of the starting compound (prodrug) under these chromatography conditions was ll min. The compound produced during the incubation (drug) had a retention time of 8.9 min, identical to daunomycin (DNM, analysis of a standard under the same conditions). The kinetics of the cleavage of the starting compound by the fusion protein and human B—glucuronidase are shown in Tab. 11 and Tab. 10 respectively.

The half-life of the cleavage of the prodrug by the fusion protein was 2.3 h. Cleavage by human B-glucuronidase took place with a half-life of 0.8 h. As already demonstrated in Example J, the results of the investigations show that the B—glucuronidase portion of the fusion protein is functionally active and able to cleave B-glucuronides. The kinetics of the elimination of the glucuronide portion and the liberation of the drug (daunomycin) from the prodrug -32.. used show a rate comparable in magnitude to human 8—glucuronidase, so that the substrate specifity of the fusion protein essentially agrees with that of human B-glucuronidase.

Table 10: Kinetics of prodrug cleavage by B-glucuronidase (human, recombinant) t’ Prodrug DNM min area % area % 0 99.2 0.8 57 36.0 64.0 130 10.3 89.7 227 9.3 90.7 Table 11: Kinetics of prodrug cleavage by 8-glucuronidase (fusion protein) t Prodrug DNM min area % area % O 98.9 1.1 50 81.1 18.9 135 51.7 48.3 190 33.0 67.0 247 22.0 78.0 317 12.4 87.6

Claims (2)

1.Patent claims A fusion protein for prodrug activation of the formula huTuMAb—L-B-Gluc, where huTuMAb is a tumor—binding fragment of a humanized tumor—specific monoclonal antibody, which fragment contains parts of the heavy chain which are associated with the light chain of the antibody, L is a peptide linker, and B—Gluc is human B—glucuronidase, and in which the antibody fragment consists of huTuMAb regions encoded by a VB exon and.at least one hinge exon, and the peptide linker L contains a region encoded by a hinge exon. A fusion protein as claimed in claim 1, in which the antibody fragment consists of huTuMAb regions encoded by a V“ exon, a CH] exon and two hinge exons. A fusion protein as claimed in either of claims 1 to 2, where the antibody fragment huTuMAb consists of amino acid sequences as shown in Tab. 3. A fusion protein as claimed in any of claims 1 to 3, in which L is a peptide linker encoded by a DNA as shown in Tab. 1 and Tab.

2. A fusion protein as claimed in any of claims 1 to 4, containing 2 or 3 hinge regions of a human IgG3 C gene. A plasmid which contains a CDNA coding for a fusion protein as claimed in any of claims 1 to 5. A transformed eukaryotic cell which is transformed with a plasmid as claimed in claim 6. A process for the preparation of a fusion protein as claimed in any of claims 1 to 5, which comprises expressing the fusion protein in a transformed cell by means of a plasmid, and isolating this fusion protein via anti-idiotype monoclonal antibodies. A fusion protein obtainable by expression of a fusion protein as claimed in any of claims 1 to 5 in a transformed eukaryotic cell as claimed in clain17 and subsequently treating the isolated fusion protein with an oxidizing agent. A fusion protein obtainable by reductive amination of a fusion protein as claimed in claim 9. A fusion protein as claimed in any of claims 1 to 5 and 9 to 10 for use as pharmaceutical. The use of a fusion protein as claimed in any of claims 1 to 5 and 9 to 10 for producing a pharmaceutical suitable for prodrug activation for oncoses. A fusion protein as claimed in claim 1, substantially as hereinbefore described and exemplified. A process for the preparation of a fusion protein as claimed in claim 1, substantially as hereinbefore described and exemplified. A. fusion. protein as claimed in claiwl 1, whenever prepared by a process claimed in a preceding claim. F. R. KELLY & co., AGENTS FOR THE APPLICANTS.