CA2062047C - Fusion proteins for prodrug activation, the preparation and use thereof - Google Patents
Fusion proteins for prodrug activation, the preparation and use thereof Download PDFInfo
- Publication number
- CA2062047C CA2062047C CA002062047A CA2062047A CA2062047C CA 2062047 C CA2062047 C CA 2062047C CA 002062047 A CA002062047 A CA 002062047A CA 2062047 A CA2062047 A CA 2062047A CA 2062047 C CA2062047 C CA 2062047C
- Authority
- CA
- Canada
- Prior art keywords
- fusion protein
- hutumab
- beta
- gluc
- region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
- A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6891—Pre-targeting systems involving an antibody for targeting specific cells
- A61K47/6899—Antibody-Directed Enzyme Prodrug Therapy [ADEPT]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01031—Beta-glucuronidase (3.2.1.31)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Animal Behavior & Ethology (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Epidemiology (AREA)
- Nanotechnology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medical Informatics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to fusion proteins for prodrug activation of the general formula huTuMAb-L-.beta.-Gluc, where huTuMAb is a humanized or human tumor-specific monoclonal antibody or a fragment thereof, L is linker, and .beta.-Gluc comprises human .beta.-glucuronidase. These fusion proteins are prepared by genetic manipulation. huTuMAb ensures the specific localization of tumors, L connects huTuMAb to .beta.-Gluc in such a way that the specific properties of the two fusion partners are not imparied, and .beta.-Gluc activates a suitable prodrug compound by elimination of glucuronic acid, where a virtually autologous system for use in humans is provided by the humanized or human fusion partners.
Description
~~~~AV 47 BEHRING'WERKE ASTIENGESELLSCHAFT HOE 91/B 004 - Ma 876 Dr. Lp/Bi Description Fusion proteins for prodrug activation, the preparation and use thereof The invention relates to fusion proteins for prodrug activation of the general formula huTuMAb-L-P-G1uc, where huTuMAb is a humanized or human tumor-specific monoclonal antibody, a fragment or a derivative thereof, L is linker, and p-Gluc comprises human p-glucuronidase. These fusion proteins are prepared by genetic manipulation.
huTuMAb ensures the specific localization of tumors, L
connects huTuMAb to p-Gluc in such a way that the specific properties of the two fusion partners are not impaired, and fl-Gluc activates a suitable prodrug com-pound by elimination of glucuronic acid, where a virtually autologous system for use in humans is provided by the humanized or human fusion partners.
Combination of prodrug and tumor-specific antibody-enzyme conjugates for use as therapeutic agents is described in the specialist literature. This has entailed injection of antibodies which are directed against particular tissue and to which a prodrug-cleaving enzyme is covalently bonded, into an animal which contains the transplanted tissue, and subsequently administering a prodrug compound which can be activated by the enzyme. The action of the antibody-enzyme conjugate which is anchored in the tissue converts the prodrug compound into the cytotoxin which exerts a cytotoxic effect on the transplanted tissue.
WO 88/07378 describes a therapeutic system which contains two components and is composed of an antibody-enzyme component. The use of non-mammalian enzymes for the preparation of the antibody-enzyme conjugate is described in this case, and that of endogenous enzymes is ruled out because of the non-specific release of active substance.
Since the exogenous enzymes are recognized as foreign antigens by the body, the use thereof is associated with the disadvantage of an immune response to these non-endogenous substances, on the basis of which the enzyme immobilized on the antibody is inactivated and, possibly, the entire conjugate is eliminated. Furthermore, in this case p-bis-N-(2-chloroethyl)-amino-benzylglutamic acid and derivatives thereof are used as prodrug, the chemical half-life thereof being only 5.3 to 16.5 hours. The chemical instability of a prodrug compound is a disadvantage because of the side effects to be expected.
EP A2-0 302 473 likewise describes a therapeutic system containing two components, in which the antibody-enzyme conjugate which is localized on the tumor tissue cleaves a prodrug compound to give a cytotoxic active substance.
The combined use, which is described herein inter alia, of etoposide 4'-phosphate and derivatives thereof as prodrug and antibody-immobilized alkaline phosphatases to liberate the etoposides is a disadvantage because of the presence of large amounts of endogenous alkaline phospha-tases in serum. DE A1-38 26 562 describes how etoposide 4'-phosophates have already been used alone as therapeutic antitumor agent, with the phosphatases present in serum liberating the etoposide from the prodrug.
it has been found that huTuMAbs coupled via L to p-Gluc and prepared by .genetic manipulation represent a particularly advantageous, because virtually autologous, system. It has additionally been found that the catalytic activity of p-Gluc in the fusion protein at pH 7.4 (i.e.
physiological conditions) is significantly higher than that of the native enzyme when the fusion protein is bound to the antigen via the V region. Furthermore, a fusion protein with only one hinge region (see Fig. P and Example 0) can be generated by genetic manipulation in high yield because most of the product which is formed - 3 20'~~1..,04rd results as one band (in this case with molecular weight 125,000) and can easily be purified by affinity chronma-tography with anti-idiotype .fiiAbs or anti-glucuronidase MA bs.
It has furthermore been found that a chemical modification of the fusion proteins, in particular partial or complete oxidation of the carbohydrate structures, preferably with subsequent reductive amination, results in an increased half-life. Enzymatic treatment of the fusion proteins according to the invention with alkaline phosphatase from, for example, bovine intestine or E. coli has in general not resulted in a significant increase in the half-life.
Consequently, the invention relates to fusion proteins of the formula huTuMAb-L-p-Gluc ( I ) where huTuMAb is a humanized or human tumor-specific monoclonal antibody or a fragment or a derivative thereof, and preferably comprises the MAbs described in EP-A1-0 388 914. The fusion proteins according to the invention particularly prefer-ably contain the humanized MAb fragment with the VL and VH genes shown in Table 3.
L is a linker and preferably contains a hinge region of an imrnunoglobulin which is linked via a peptide sequence to the N-terminus of the mature enzyme.
B-Gluc is the complete amino-acid sequence of human p-glucuronidase or, in the relevant gene con-structs, the complete cDNA (Oshima A. et al., Proc. Natl. Acad. Sci. USA 84, (1987) 685-689.
Furthermore preferred are constructs with a CIHl exon and a hinge exon in the antibody part, and particularly preferred constructs are those in which these parts - 4 - 2 0;
derive from a human IgG3 C gene. Most preferred are constructs, as described in Example (I), where the cor-responding light chain of the Y:kumanized TuMAb is co-expressed in order, in this way, to obtain an huTuMAb portion which is as similar as possible to the original TuMAb in the binding properties. Finally, the invention relates to processes for the preparation by genetic manipulation of the abovementioned fusion proteins, to the purification thereof and to the use thereof as pharmaceuticals. Fusion proteins as described can be used for prodrug activation in oncoses.
In another embodiment, the fusion proteins according to the invention are chemically modified in order to achieve an increased half-life and thus an improved localization of tumors. The fusion proteins are preferably treated with an oxidizing agent, for example periodate, which generally results in partial or complete cleavage of the carbohydrate rings and thus in an alteration in the carbohydrate structure. This alteration generally results in an increased half-life. It is furthermore advantageous to derivatize, in a second reaction step, existing aldehyde groups, for example by reductive amination. The partial or complete destruction of the aldehyde groups generally results in a reduction in possible side reac-tions with, for example, plasma proteins. Accordingly, it is advantageous for the fusion proteins according to the invention to be oxidized in a first reaction step, for example with periodate, and to be reductively aminated in a second reaction step, for example with ethanolamine and cyanoborohydride.
The following examples describe the synthesis by genetic manipulation of a particularly preferred fusion protein according to the invention, the derivatization thereof and the demonstration of the ability of the two fusion partners to function.
huTuMAb ensures the specific localization of tumors, L
connects huTuMAb to p-Gluc in such a way that the specific properties of the two fusion partners are not impaired, and fl-Gluc activates a suitable prodrug com-pound by elimination of glucuronic acid, where a virtually autologous system for use in humans is provided by the humanized or human fusion partners.
Combination of prodrug and tumor-specific antibody-enzyme conjugates for use as therapeutic agents is described in the specialist literature. This has entailed injection of antibodies which are directed against particular tissue and to which a prodrug-cleaving enzyme is covalently bonded, into an animal which contains the transplanted tissue, and subsequently administering a prodrug compound which can be activated by the enzyme. The action of the antibody-enzyme conjugate which is anchored in the tissue converts the prodrug compound into the cytotoxin which exerts a cytotoxic effect on the transplanted tissue.
WO 88/07378 describes a therapeutic system which contains two components and is composed of an antibody-enzyme component. The use of non-mammalian enzymes for the preparation of the antibody-enzyme conjugate is described in this case, and that of endogenous enzymes is ruled out because of the non-specific release of active substance.
Since the exogenous enzymes are recognized as foreign antigens by the body, the use thereof is associated with the disadvantage of an immune response to these non-endogenous substances, on the basis of which the enzyme immobilized on the antibody is inactivated and, possibly, the entire conjugate is eliminated. Furthermore, in this case p-bis-N-(2-chloroethyl)-amino-benzylglutamic acid and derivatives thereof are used as prodrug, the chemical half-life thereof being only 5.3 to 16.5 hours. The chemical instability of a prodrug compound is a disadvantage because of the side effects to be expected.
EP A2-0 302 473 likewise describes a therapeutic system containing two components, in which the antibody-enzyme conjugate which is localized on the tumor tissue cleaves a prodrug compound to give a cytotoxic active substance.
The combined use, which is described herein inter alia, of etoposide 4'-phosphate and derivatives thereof as prodrug and antibody-immobilized alkaline phosphatases to liberate the etoposides is a disadvantage because of the presence of large amounts of endogenous alkaline phospha-tases in serum. DE A1-38 26 562 describes how etoposide 4'-phosophates have already been used alone as therapeutic antitumor agent, with the phosphatases present in serum liberating the etoposide from the prodrug.
it has been found that huTuMAbs coupled via L to p-Gluc and prepared by .genetic manipulation represent a particularly advantageous, because virtually autologous, system. It has additionally been found that the catalytic activity of p-Gluc in the fusion protein at pH 7.4 (i.e.
physiological conditions) is significantly higher than that of the native enzyme when the fusion protein is bound to the antigen via the V region. Furthermore, a fusion protein with only one hinge region (see Fig. P and Example 0) can be generated by genetic manipulation in high yield because most of the product which is formed - 3 20'~~1..,04rd results as one band (in this case with molecular weight 125,000) and can easily be purified by affinity chronma-tography with anti-idiotype .fiiAbs or anti-glucuronidase MA bs.
It has furthermore been found that a chemical modification of the fusion proteins, in particular partial or complete oxidation of the carbohydrate structures, preferably with subsequent reductive amination, results in an increased half-life. Enzymatic treatment of the fusion proteins according to the invention with alkaline phosphatase from, for example, bovine intestine or E. coli has in general not resulted in a significant increase in the half-life.
Consequently, the invention relates to fusion proteins of the formula huTuMAb-L-p-Gluc ( I ) where huTuMAb is a humanized or human tumor-specific monoclonal antibody or a fragment or a derivative thereof, and preferably comprises the MAbs described in EP-A1-0 388 914. The fusion proteins according to the invention particularly prefer-ably contain the humanized MAb fragment with the VL and VH genes shown in Table 3.
L is a linker and preferably contains a hinge region of an imrnunoglobulin which is linked via a peptide sequence to the N-terminus of the mature enzyme.
B-Gluc is the complete amino-acid sequence of human p-glucuronidase or, in the relevant gene con-structs, the complete cDNA (Oshima A. et al., Proc. Natl. Acad. Sci. USA 84, (1987) 685-689.
Furthermore preferred are constructs with a CIHl exon and a hinge exon in the antibody part, and particularly preferred constructs are those in which these parts - 4 - 2 0;
derive from a human IgG3 C gene. Most preferred are constructs, as described in Example (I), where the cor-responding light chain of the Y:kumanized TuMAb is co-expressed in order, in this way, to obtain an huTuMAb portion which is as similar as possible to the original TuMAb in the binding properties. Finally, the invention relates to processes for the preparation by genetic manipulation of the abovementioned fusion proteins, to the purification thereof and to the use thereof as pharmaceuticals. Fusion proteins as described can be used for prodrug activation in oncoses.
In another embodiment, the fusion proteins according to the invention are chemically modified in order to achieve an increased half-life and thus an improved localization of tumors. The fusion proteins are preferably treated with an oxidizing agent, for example periodate, which generally results in partial or complete cleavage of the carbohydrate rings and thus in an alteration in the carbohydrate structure. This alteration generally results in an increased half-life. It is furthermore advantageous to derivatize, in a second reaction step, existing aldehyde groups, for example by reductive amination. The partial or complete destruction of the aldehyde groups generally results in a reduction in possible side reac-tions with, for example, plasma proteins. Accordingly, it is advantageous for the fusion proteins according to the invention to be oxidized in a first reaction step, for example with periodate, and to be reductively aminated in a second reaction step, for example with ethanolamine and cyanoborohydride.
The following examples describe the synthesis by genetic manipulation of a particularly preferred fusion protein according to the invention, the derivatization thereof and the demonstration of the ability of the two fusion partners to function.
Example (A):
The starting material was the plasmid pGEM4-HUGP13 (Fig. A). pGEM4-HUGP13 contains a cDNA insert which contains the complete coding sequence for the human p-glucuronidase enzyme (Oshima et al. loc. cit.). All the techniques used were taken from Maniatis et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor USA (1989).
Example (B):
The plasmid pGEM4-HUGP13 was cut with the restriction endonucleases PstI and Sa1I, and the 342bp-long PstI/Sall fragment which harbors the NotI restriction cleavage site was isolated. The Pstl/SalI fragment was cloned into the PstI/Sall-cleaved vector pTZ (Fig. B.1) and the clone pTZpGlc350 was isolated (Fig. B.2).
Example (C):
The plasmid clone pTZpG1c350 was cleaved with Pstl, and the double-stranded DNA fragment pGlc linker, which is composed of the oligonucleotides pGlc linker 1 and pG1c linker 2(Tab. 1) and has cohesive Psti ends, was ligated into the opened Pstl cleavage site.
The starting material was the plasmid pGEM4-HUGP13 (Fig. A). pGEM4-HUGP13 contains a cDNA insert which contains the complete coding sequence for the human p-glucuronidase enzyme (Oshima et al. loc. cit.). All the techniques used were taken from Maniatis et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor USA (1989).
Example (B):
The plasmid pGEM4-HUGP13 was cut with the restriction endonucleases PstI and Sa1I, and the 342bp-long PstI/Sall fragment which harbors the NotI restriction cleavage site was isolated. The Pstl/SalI fragment was cloned into the PstI/Sall-cleaved vector pTZ (Fig. B.1) and the clone pTZpGlc350 was isolated (Fig. B.2).
Example (C):
The plasmid clone pTZpG1c350 was cleaved with Pstl, and the double-stranded DNA fragment pGlc linker, which is composed of the oligonucleotides pGlc linker 1 and pG1c linker 2(Tab. 1) and has cohesive Psti ends, was ligated into the opened Pstl cleavage site.
Tab. 1 BC-Ic Ll11k2r 1:
" .. .. .. .. , . ..
C r . r C.: ~ C i C C a ..
%..+ ~: ~.._ ~:
13 CiC L !ri{{c"'r 2:
C,r,: CV,.u C,.d... CV.: C7G CJ"l The clone pTZpG1c370 in which the p-glucuronidase frag-ment is extended at its 5' end by oligonucleotide I and which has lost the previously present Pstl cleavage site but has acquired instead at its 5' end a new Pstl cleavage site was isolated (Fig. C).
Example (D):
The plasmid clone pTZpG1c370 was cleaved with PstI and ligated to the hinge-linker fragment which is composed of the hinge oligonucleotides 1 and 2b and which has two cohesive PstI ends (Tab. 2). This results in the PstI
cleavage site at the 5' end of the pG1c370 fragment being destroyed. The plasmid clone pTZpG1c420 in which the pGlc insert is extended at the 5' end by the hinge linker H
was isolated (Fig. D).
" .. .. .. .. , . ..
C r . r C.: ~ C i C C a ..
%..+ ~: ~.._ ~:
13 CiC L !ri{{c"'r 2:
C,r,: CV,.u C,.d... CV.: C7G CJ"l The clone pTZpG1c370 in which the p-glucuronidase frag-ment is extended at its 5' end by oligonucleotide I and which has lost the previously present Pstl cleavage site but has acquired instead at its 5' end a new Pstl cleavage site was isolated (Fig. C).
Example (D):
The plasmid clone pTZpG1c370 was cleaved with PstI and ligated to the hinge-linker fragment which is composed of the hinge oligonucleotides 1 and 2b and which has two cohesive PstI ends (Tab. 2). This results in the PstI
cleavage site at the 5' end of the pG1c370 fragment being destroyed. The plasmid clone pTZpG1c420 in which the pGlc insert is extended at the 5' end by the hinge linker H
was isolated (Fig. D).
-7 - 20 62 lfij 47 Tab. 2 -~iric i CII'c~
G~.G CCC 7 C i i C; G.;C ~Cn CC ; Crc CC: 7 GC CC;, C" 7 cC CC A c<< cC
'irco ~~~ Clicc~
AC 7 GG C CA C C: 7 GCG C~C G"C Cn A CG; G7 G TC C"A
Cr,i 77 C CIG C Il.i CCAv Example (E):
The plasmid pTZpG1c420 was cleaved with PstI and SaII, and the 420bp insert was isolated. The plasmid IgG3c F(ab')2 2H (EP-A2-0 352 761, Fig. 3, ibidem), which contains the CH1 exon and two hinge exons of a human IgG3 C gene was completely cleaved with SalI and partially cleaved with PstI. The isolated 420bp insert was ligated to this Sall/PstI (part.)-cleaved plasmid, and the plasmid clone which contains the CH1 exon, a hinge exon and the pG1c420 fragment, that is to say carries the genetic information of two hinge exons between CH1 exon and p-glucuronidase, was isolated (pUC CH1 + H + pG1c420) (Fig. E) -s- 2 0 Tab. 3 4 31 /2 6 yE htmm caactgcaggagagcggtccaggtcttgtgagacctagccagaccctgagcctgacctc G1nI.euGlnGluSerGlyProGlyLeuValAsgProSerGlnThrLeuSerLeuThr(:~
accgtgtctggcttcaccatcagcagtggttatagctggcactgggtgagacagccacc ThrValSexGlyPheThrIleSe.rSerGlyTyrSerTrp.S.isTxpValArgGlnProP3 ggacgaggtcttgagtggattggatacatacagtacagtggtatcactaactacaaccc GlyArgGlyLeuGluTrplleGlyTyrIleGlaTyrSerGlylleThrAsaTyrAsnPi tctctcaaaagtagagtgaca.atgctggtagacaccagcaagaaccagttcagcctgac SerLeuLysSerArgValThrMetLeuValAspThrSerLysAsnGlnPheSerLeulU
ctcagcagcgtgacagccgccgacaccgcggtctattattgtgcaagagaagactatg;
LeuSerSerValThrAlaAlaAspThrAlaValTyrTyrGysAlaArgGluAspTyrA
taccactggtacttcgatgtctggggtcaaggcagcctcgtcacagtctcctca TyrHisTrpTyrPheAspVa.lTrpGlyGlnGlySerLeuValThrValSerSer 431/26 VK hL~i ggtgtccactccgacatccagatgacccagagcccaagcagcctgagcgccagcgtggc GlyValHisSerAspIleGlnMetThrGlnSerProSerSerLeuSerAlaSerVa1G:
gacagagtgac cat cac ctgtagtaccagctcgagtgtaagttacatgcactggtacci AspArgValThrlleThzt'ysSerThrSerSerSerValSerTyrtrSetHisTrpTyrG:
cagaagccaggtaaggctccaaagctgctgatctacagcacatccaacctggcttctgc G1nLysProGlyLysAlaProLysLeuLeulleTyrSerThrSerAsnLeuAlaSerG:
gtgccaagcagattcagcggtagcggtagcggtaccgacttcacettcaccatcagca<
ValProSerArSPheSerGlySerGlySerGlyThrAspPheThrPheThrIleSerSe ctccagccagaggacatcgccacctactactgccatcagtggagtagtta*_cccacgtt LeuGlnProGluAsplleAlaThrTyrTyrCysH.isGlnTrpSerSerTyrProThrP2 ggccaagggaccaaggtggaaatcaaacgt G1yGlnGlyThrI.ysValGlulleLysArg Example (F):
The plasmid pGEM4-HUGP13flGlc was cleaved with SaII, and the 1750bp SalI fragment from the p-glucuronidase cDNA was isolated. The isolated 1750bp Sall fragment was ligated to the SalI-cleaved plasmid pUC CH1 + H+pG1c420. The plasmid clone pUC CHl + H+ hupGlc which contains a fusion gene composed of a CH, exon, a hinge exon and a fusion exon between a hinge exon and the human p-glucuronidase cDNA was isolated (Fig. F).
Example (G):
The expression vector pABstop (Fig. I was cleaved with HindIIl and SalI. The plasmid pUC CH1 + H + hupGlc was cleaved completely with HindIiI and partially with Sall, and the CH, + H + hupGlc insert was isolated. The CH1 + H + hupGlc insert was ligated to the HindIII/SalI-cleaved pABstop, and the clone pABstop CH1 + H + hupGlc was isolated (Fig. G).
Example (H):
The pABstop vector pABstop BW 431/26 hum VH, which con-tains the humanized version of the V. gene of the anti-CEA MAb BW 431/26 (Bossiet R. et al., Eur. J. Nucl.
Med. 14, (1988) 523-528) (see Tab. 3 for the sequences of the humanized V$ and V. gene), was cleaved with HindliI
and BamHl, and the insert which contains the signal exon and the Vs exon was isolated. The plasmid clone pABStop CH1 + H + hupGlc was cleaved with HindIil and ligated to the HindIII/BamHi 431/26 hum V. fragment. After ligation at room temperature for 2 h, the ligation was stopped by incubation at 70 C for 10', and the ends which were still free were filled in with Klenow polymerase and dNTPs.
Further ligation was then carried out overnight. After transformation, the clone pABStop 431/26 hum V. hupGlclH
which contains an immunoglobulin F(ab')Zgene with a hinge exon, which is fused to the coding region of human - 10 - ~~~~047 p-glucuronidase, was isolated with the aid of restriction mapping and nucleic acid sequence analysis (Fig. H).
Example (I):
The clone pABStop 431/26 hum V. hupGlclH was transfected together with a plasmid clone which carries the light chain of humanized BW 431/26 (Fig. z) and two plasmids which carry a neomycin- (Fig. I~) and a methotrexate-resistance gene (Fig. L) into BHK cells. A fusion protein which has both the antigen-binding properties of MAb BW 431/26hum and the enzymatic activity of human p-glucuronidase was expressed.
Example (J):
Demonstration of the antigen-binding properties and of the enzymatic activity of the 431/26 hum $hupGlc 1H
fusion protein The ability of the 431/26 hum VShupGlc 1H fusion protein to bind specifically to the epitope defined by 431/26 on CEA (carcinoembryonic antigen) and, at the same time, to exert the enzymatic activity of human p-glucuronidase was determined in a specificity/enzyme activitygssay. This assay is carried out as described below:
- Polystyrene (96-well) microtiter plates (U shape, Type B, supplied by Nunc, Order No. 4-60445) are incubated with purified CEA (1-5 pg of CEA/ml, 75 pl of this per well) or with GIT mucin (same amount as CEA) at R.T. overnight.
- The non-adsorbed antigen is removed by aspiration and washed 3 x with 0.05 M tris/citrate buffer, pH 7.4.
- The microtiter plates are left to stand at R.T. with the opening facing downwards on cellulose overnight.
- The microtiter plates are incubated with 250 pl of 1% strength casein solution in PBS, pH 7.2, per well (blocking solution) at 20 C for 30 minutes.
- During the blocking, the substrate is made up. The amount of substrate depends on the number of super-natants to be assayed. The substrate is made up fresh for each assay.
- Substrate: 4-methylumbelliferyl ~-D-glucuronide (Order No.: M-9130 from Sigma), 2.5 mM in 200 mM
sodium acetate buffer, pH 5.0, with 0.01% BSA.
- The blocking solution is removed by aspiration, and in each case 50 l of BHR cell supernatant which contains the fusion protein are loaded onto the microtiter plate coated with CEA or GIT mucin (that is to say the sample volume required is at least 120 l).
- Incubation at R.T. is then carried out for 30 minutes.
- The plates are washed 3 x with ELISA washing buffer (Behring, OSEW 96).
- The substrate is loaded in (50.u1/well) and in-cubated at 37 C for 2 hours. The plate is covered because of the possibility of evaporation.
- After 2 hours, 150 pl of stop solution are pipetted into each well (stop solution = 0.2 M glycine + 0.2%
SDS, pH 11.7).
- Evaluation can now be carried out under a UV lamp (excitation energy 380 nm) or in a fluorescence measuring instrument (Fluoroscan II, ICN
Biomedicals, Cat. No.: 78-611-00).
It was possible to show using this specificity/enzyme activity assay that fluorescent 4-methylumbelliferol was detectable in the wells coated with CEA when the enzyme activity was determined at pH 5, the catalytic optimum (Tab. 4).
- 12 - 20 ~ N 67 Table 4:
Dilution out of fusion protein cell culture supernatant (B73/2) on CEA and GIT mucin Substrate in various solutions Dilution 0.2 M sodium PBS, pH 7.2, PBS, pH 7.2 steps acetate buffer on CEA on GIT mucin + 0.01% BSA, pH 5, on CEA
Concen-trated 9118 2725 115.7 1:2 7678 2141 93.37 1:4 4662 1195 73.39 1:8 2927 61B.5 60.68 1:16 1657 332.1 53.69 1:32 853 168.2 40.44 1:64 425 99.26 48.21 1:128 192.5 57.89 47.48 Determination of the conversion rate at pH 7.2 showed that at this physiological pH that of the fusion protein was still = 25% of the conversion rate at pH 5. No significant methylumbelliferol liberation was measurable on the negative control plates coated with GIT mucin and measured at pH 5. This finding.shows that the humanized V region of the 431/26hum VghupGlc 1H fusion protein has retained its epitope specificity, and the p-glucuronidase portion of the fusion protein is able, like the native human enzyme, to cleave the p-glucuronide of 4-methyl-umbelliferol.
Example (K):
Demonstration of the functional identity of the V region of the 431/26hum Vhu,BGlc 1H fusion protein with that of the humanized MAb BW 431/26 and that of the murine ltAb BW
It was shown in Example (J) that the 431/26hum VehupGlc 1H
fusion protein has a certain CEA-binding potential and p-glucuronidase activity. The antigen-specific com-petetive assay described hereinaft+er provides information on the identity of the CEA epitopes which are recognized by the competing molecules, and on the strength of the epitope/fusion protein and epitope/antibody interactions.
This assay is carried out as described below:
- Polystyrene 96-well microtiter plates (U shape, Type B, supplied by Nunc, Order No. 4-60445) are incubated with purified CEA (1-5 g of CEA/ml, 75 l of this per well) or with GIT mucin (same amount as CEA) at R.T. overnight.
- The non-adsorbed antigen is removed by aspiration and washed 3 x with 0.05 M tris/citrate buffer, pH 7.4.
- The microtiter plates are left to.stand at R.T. with the opening facing downwards on cellulose overnight.
- The microtiter plates are incubated with 250 pl of 1% strength casein solution in PBS, pH 7.2, per well (blocking solution) at R.T. for 30 minutes.
- 50 ;41 of the MAb BW 431/26 in a concentration of 5 ng/ml are mixed with 50 pl of 10-fold concentrated supernatant of the humanized MAb BW 431/26 or of the fusion protein, as well as serial 2 x dilutions.
- 50 pl aliquots of these mixtures are pipetted into the wells of microtiter plates coated with CEA or GIT mucin.
- The microtiter plates are incubated at R.T. for 30 minutes.
- The plates are then washed 3 x with ELISA washing buffer (supplied by Behringwerke AG, Order No.
OSEW 96, 250 pl).
- Then 50 l of a 1:250-diluted goat anti-mouse Ig antibody which is coupled to alkaline phosphatase (Southern Biotechnology Associates, Order No.:
1010-04) are added.
- After incubation at R.T. for 30 minutes and washing 3 times, the substrate reaction is carried out as follows:
- Add 30 l of 0.1 mM NADP per well (dissolve 7.65 mg in 100 ml of 20 mM tris; 0.1 mM MgSO41 pH 9.5); the solution can be stored at -20 C for several months.
- Incubate at R.T. for 30 minutes.
- Make up the enhancer system during the incubation with NADP: (5 ml per plate) 2 parts of INT (dissolve 2.5 mg/ml in 30% strength ethanol in an ultrasonic bath; always make up fresh) + 1 part of PBS, pH 7.2 + 1 part of diaphorase (1 mg/ml PBS, pH 7.2) + 1 part of ADH (0.5 mg/ml PBS, pH 7.2) - add 50 pl of the enhancer system - when the extent of reaction is as required, stop the reaction with 0.1 N HZS0,,, 100 l per well - measure at 492 nm in a TITERTEFC MULTISCAN (blank = 50 ul of NADP + 50 l, of enhancer solution +
100 pl of 0.1 N H2SO4) NADP - supplied by Sigma, Order No. N-0505 INT - supplied by Sigma, Order No. 1-8377 ADH - supplied by Sigma, Order No. A-3263 Diaphorase - supplied by Sigma, Order No. D-2381 Reduction of the extinction in this antigen-specific competetive assay means that there is competition between the molecules competing with one another for epitopes which are the same or lying very close together spatially.
The inhibition data which are obtained show that both the fusion protein 431/26hum VHhupGlc 1H and the humanized MAb 431/26 block binding of the murine MAb BW 431/26 to its CEA epitope. 50% inhibition is reached at a 200 molar excess of the relevant competitors. The conclusion from this is that the avidity of the fusion protein for the CEA epitope is comparable with that of the humanized - 15 - 2~'~?~ A.
MAb 431/26. Furthermore, the fusion protein and the humanized MAb bind to the same epitope or to an epitope which lies spatially very near to that defined by the murine MAb BW 431/26 on CEA.
Example (L):
Demonstration of the tissue specificity of the 431/26hum V,hupGlc 1H fusion protein Example (J) showed, inter alia, that the 431/26hum VHhupGlc 1H fusion protein is able to bind to purified CEA.
Example (K) showed that the V region of the fusion protein is able to compete with the V region of murine BW 431/26 for the same, or a very close, epitope. The indirect immunohistochemical assay which is specific for p-glucuronidase and is described hereinafter can be used to determine the microspecificity of the fusion protein on cryopreserved tissues.
The assay is described below:
- 6 m-thick frozen sections are placed on slides and dried in air for at least 30 minutes.
- The slides are subsequently fixed in acetone at -20 C for 10 seconds.
- The slides are washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- 20-100 l of fusion protein-containing BHK cell supernatant (concentrated or diluted in tris/BSA, pH 7.4) is applied to each section and incubated in a humidity chamber at R.T. for 30 minutes.
- The slides are washed in tris/NaCI washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- 50 pl of hybridoma supernatant of the murine anti-p-glucuronidase MAb BW 2118/157 are added to each section, and the slides are incubated in a humidity - 16 - 2D6>047 chamber at R.T. for 30 minutes.
- The slides are then washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- 20-100 l of bridge Ab (rabbit-antimouse IgG diluted 1:100 in human serum, pH 7.4) are applied to each section and incubated in a htunidity chamber at R.T.
for 30 minutes.
- The slides are then washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- Subsequently 20-100 l of APAAP complex (mouse anti-AP diluted 1:100 in tris/BSA, pH 7.4) are applied to each section and incubated in a humidity chamber at R.T. for 30 minutes.
- The slides are then washed in tris-NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- The substrate for alkaline phosphatase is made up as follows (100 ml of substrate solution sufficient for one glass cuvette):
Solution 1: 3.7 g of NaCl 2.7 g of tris base (dissolve in 75 ml of distilled water) + 26.8 ml of propanediol buffer, pH 9.75, adjust with HC1 + 42.9 mg of levamisole ~ clear, color-less solution Solution 2: Dissolve 21.4 mg of sodium nitrite in 535 pl of distilled water ~ clear, colorless solution Solution 3: Dissolve 53.5 mg of naphthol AS BI
phosphate in 642 l of dimethylformamide (DMF) * clear, yellowish solution - Add 368 pl of 5% strength new fuchsin solution to solution 2 (sodium nitrite) and leave to react for 1 minute (stopclock) to give a clear, brown solution - Add solution 2 (sodium nitrite with new fuchsin) and solution 3 (naphthol AS BI phosphate) to solution 1 (tris/NaCl/propanediol buffer) ~ clear, yellowish solution - adjust to pH 8.8 with HC1 =~ cloudy, yellowish solution - filter solution and place on the slide and leave to react on a shaker for 15 minutes ~ solution becomes cloudy.
- wash slide in tris/NaCl buffer, pH 7.4, for 10 minutes - wash slide in distilled water for 10 minutes - after drying in air for 2 hours, the slides are sealed in Kaiser's glycerol/gelatin at 56 C.
Specific binding of the fusion protein was demonstrated under the light microscope by the red coloration of the epitope-positive tissue sections. Comparative investiga-tions with the murine M.Ab BW 431/26, which was detected by the indirect APAAP technique (Cordell et al., J. Histochem. Cytochem. 32, 219, 1984), revealed that the tissue specificity of the fusion protein agreed exactly with that of the murine MAb BW 431/26, i.e. that there is identity both of the reaction type in the individual specimen and of the number of positive and negative findings from a large number of different carcinomas and normal tissue.
Example (M):
Purification of the 431/26hum V,~hupGlc 1H fusion protein Murine and humanized MAbs can be purified by immuno-affinity chromatography methods which are selective for the Fc part of these molecules. Since there is no Fc part in the 431/26hum VHhupGlc 1H fusion protein, it was necessary to develop an alternative highly selective immunoaffinity chromatography method. Besides the selec-tivity of this method to be developed, it is necessary for the isolation conditions to be very mild in order not to damage the p-glucuronidase, which is very labile in the acidic and in the alkaline range.
The principle of the method comprises purification of the fusion protein from supernatants from transfected BHK
cells using an anti-idiotype MAb directed against the humanized V region. The preparation of such MAbs is known from the literature (Walter et al., Behring Inst. Mitt., 82, 182-192, 1988). This anti-idiotype MAb can be both murine and humanized. The MAb is preferably immobilized on a solid phase so that its V region has not been damaged. Examples of this are known from the literature (Fleminger et al., Applied Biochem. Biotechnol., 23, 123-137, 1990; Horsfall et al., JIM 104, 43-49, 1987).
The anti-idiotype MAb thus immobilized on the solid phase by known methods binds very efficiently the fusion protein to be purified from transfected BHK cells, for example at pH 7, but has the surprising property that it no longer binds the fusion protein when the pH .is lowered by only 1.5, to pH 5.5. This mild pH elution technique has no adverse effect on the fusion protein, either in its ability to bind to CEA or in its enzymatic activity (for methods, see Example J). Tab. 5 shows the OD values and fluorogenic units (FU) of the individual fractioris from a purification using the solid phase-immobilized, anti-idiotype MAb BW 2064/34.
Table 5:
Anti-idiotype affinity chromatography OD in ~ PU in $ pH Chromatography procedure Fractions 1-5 1 0 7.2 Preli_minary washing of the column with PBS, pH 7.2 6-142 20 0 7.2 Sample loading 143-162 1 0 7.2 Washing of the column with PBS, pH 7.2 163 1 0 7.2 164 1 0 7.2 165 1 0 7.2 166 1 0 6.8 167 2 10 6.1 168 5 20 5.7 169 16 40 5.6 170 23 80 5.5 171 26 100 5.4 Elution with PBS, 172 24 80 5.3 pH 4.2 173 19 60 5.2 174 14 40 5.2 175 10 30 5.1 176 8 25 5.1 177 6 20 5.1 178 3 10 5.0 179 2 5 5.0 180 1 0 5.0 1 fraction = collection for 6.6 min (at pumping rate of 18 m1Jh) =2m1 The FU values are indicated as % of the highest value (fraction 171).
ho ~ is d S.f The elution of the fusion protein was measured as protein by measurement of the OD at 280 nm. In addition, the isolated fractions were examined for specific binding to CEA and simultaneous enzyme activity in the specificity/
enzyme activity assay (Example J). The values show that all the specific binding and enzyme activity was con-centrated in one peak (peak eluted from around pH 5.0 to pH 5.6). The conclusion from this is that the described method of anti-idiotype affinity chromatography is a very efficient and selective purification technique for the 431/26hum VHhupGlc 1H fusion protein.
Example (N):
Gel chromatography of the fusion proteins The supernatants from the BHR cells secreting the 431/26hum VH hupGlc 1H fusion protein (B 70/6, B 74/2, B 72/72, B 73/2) were removed, sterilized by filtration and subjected to analytical gel filtration. For this, a TSK G3000 SW-XL column (7.8 x 300 mm) was equilibrated with 0.1 M sodium phosphate buffer, pH 6.7, + 0.02% NaN3, 20 pl of the supernatant were loaded on, and elution was carried out with a flow rate of 0.6 ml/min. Starting with an elution time of 9 min (exclusion volume 9.5 min), fractions (0.3 min each) were collected and assayed for p-glucuronidase activity.
For this 25 l of the particular fraction were mixed with 75 l of substrate solution (2.5 mM 4-methylumbelliferyl p-glucuronide in 200 mM sodium acetate buffer, pH 5, +
0.1 mg/ml BSA) and incubated at 37'C for 2 hours. The reaction was then stopped with 1.5 ml of 0.2 M
glycine/0.2% SDS solution, pH 11.7, and the fluorescent label liberated by the glucuronidase was quantified in a Hitachi fluorometer (with excitation wavelength of 360 nm and emission wavelength of 450 nm).
Result:
All 4 constructs show a single mai:n activity peak between fractions 4 and 6 (Table 6). This corresponds to reten-tion times of about 10.2 - 10.8 min. The fusion proteins with glucuronidase activity in the supernatants thus have retention times which are of the same order of magnitude as those of chemically prepared antibody-p-glucuronidase constructs (10.4 min). The retention time for the free enzyme is 11.9, and for the free antibody is 12.3 min.
Table 6:
Gel filtration of various fusion proteins Incubation: 25 l, 37 C, 120 min Substance concentration: 1.875 mM; 0.1 ang/ml BSA
Each fraction 0.3 min; start at 9 min Liberated label/assay (FU) Fractions B70/6 B74/2 B72/72 B73/2 Example (0):
Molecular characterization of the 431/26 hum V. hupGlclH
fusion protein The fusion proteins were purified by anti-idiotype affinity chromatography in Example (M). Aliquots from the peak eluted at pH 5.5 were subjected to 10% SDS PAGE
electrophoresis under non-reducing and reducing condi-tions and immunostained in a Western blot using anti-idiotype MAbs or with anti-p-glucuronidase MAbs (Towbin and Gordon (1979), Proc. Natl. Acad. Sci. USA 76: 4350-4354).
Under non-reducing conditions with the 431/26 hum V.
hupGlc1H fusion protein, a main band of = 125 kDa and a band of 250 kDa were detected and were detactable both by anti-idiotype MAb and by anti-p-glucuronidase MAb in the Westerri blot. Under reducing conditions there was no detectable immunostaining either by the anti-idiotype or by the anti-p-glucuronidase MAbs. A 100 kDa and a 25 kDa band were detected in the reducing SDS PAGE. However, these molecules analyzed under denaturing conditions are, according to TSK G 3000 SW-XL gel filtration under native conditions in the form of a higher molecular weight product which has a molecular weight of - 250 kDa (Example N). Diagrammatic representations of the 431/26 hum V. hueG1c1H fusion protein are shown in Fig. M. Figure Mb shows the monomer which has a= 25 kDa light chain and a= 100 kDa heavy chain. This monomer and a dimer linked by inter-heavy chain disulfide bridges can be detected under denaturing conditions (Fig. Ka). Under native conditions, the fusion protein is in the form of a dimer of = 250 kDa, with or without inter-heavy chain disulfide bridges (Fig. Mc).
r,~~,r, 9 ,r3 I r h+ V ''~ t J ~-' ! 0 EXAMPLE ( P ) :
Chemical modification of the fusion protein The fusion protein purified as in Example (N) (110 g/ml) was adjusted to pH 4.5 and mixed with sodium periodate (final concentration 1 mM). After incubation at room temperature in the dark for 1 hour, the sodium periodate was removed by gel chromatography, and the fusion protein was then readjusted to pH B. Addition of ethanolamine to a final concentration of 0.1 M was followed by incubation at 4 C for a further 3 hours, then sodium cyanoboro-hydride (final concentration 5 mM) was added and in-cubated for 30 min (reduction). This was followed by another gel filtration to remove the reducing agent and to change the buffer of the fusion protein. The chemical modification had no effect on the functional activity of the fusion protein. Tab. 7 shows the change in the plasma concentrations of unmodified and modified fusion protein in the nude mouse. The elimination of the fusion protein from the plasma is greatly slowed down by the modification.
Table 7:
Plasma levels of p-glucuronidase activity in the nude mouse p-Glucuronidase fusion protein t Treated Untreated [min] % activity % activity EJAMPLE (Q);
Enzymatic treatment of the fusion protein 53 pg of fusion protein (Example N) in 0.01 M tris/HC1, 0.15 M NaCl were incubated with 1 unit of soluble alkaline phosphatase (E. coli) or immobilized alkaline phosphatase (bovine intestine) at room temperature for 20 h. Tab. 8 shows the change in the plasma concentration of untreated and treated fusion protein in the nude mouse. The elimination is not significantly affected by the enzyme treatment.
Table 8:
Plasma levels of p-glucuronidase activity in the nude mouse p-Glucuronidase fusion protein AP AP
t (bovine intestine, (E. coli) immobil.) [min] untreated treated treated AP = alkaline phosphatase Example (R):
Pharmacokinetics and tumor retention of the 431/26 hum VH
30 hupGlc 1H fusion protein By way of example, 5 x 4 pg of purified fusion protein 2 L) r, 9 td which was mixed with 100 pg of HSA/ml were injected in unmodified (Example N) and chemically modified form (Example P) i.v. at 24-hour intervals into CEA-expressing nude mice harboring human tumors. After defined time intervals, 3 animals in each case were sacrificed by cervical dislocation. The organs were removed, weighed and mixed with 2 ml of 1% strength BSA in PBS, pH 7.2.
The tissue and cells from these organs were then broken down in a Potter (10 strokes) and the amount of functionally active fusion protein was determined in the supernatant after centrifugation of the suspension at 3000 rpm and RT
for 10' (Heraeus Labofuge GL, Type 2202) in the specificity/
enzyme activity assay (see Example J). The data from a representative experiment are shown in Tab. 9. It is clearly evident that the chemically modified fusion protein, which has a tl/2p of = 4 h, specifically accumulates in the tumor from ;-- 3 days after completion of the repetitive injection phase. The unmodified fusion protein, which has a tl/2p of = 20 min, showed no significant accumulation in the tumor under the same experimental conditions.
It may be concluded from these data that the hu 431 p-Gluc fusion protein is able to bind in vivo to CEA-positive tumors and to remain there as enzymatically active molecule over long time periods (> 9 days). The time the prodrug is administered in this system should be between day 3 and 9 after completion of the fusion protein injection.
G~.G CCC 7 C i i C; G.;C ~Cn CC ; Crc CC: 7 GC CC;, C" 7 cC CC A c<< cC
'irco ~~~ Clicc~
AC 7 GG C CA C C: 7 GCG C~C G"C Cn A CG; G7 G TC C"A
Cr,i 77 C CIG C Il.i CCAv Example (E):
The plasmid pTZpG1c420 was cleaved with PstI and SaII, and the 420bp insert was isolated. The plasmid IgG3c F(ab')2 2H (EP-A2-0 352 761, Fig. 3, ibidem), which contains the CH1 exon and two hinge exons of a human IgG3 C gene was completely cleaved with SalI and partially cleaved with PstI. The isolated 420bp insert was ligated to this Sall/PstI (part.)-cleaved plasmid, and the plasmid clone which contains the CH1 exon, a hinge exon and the pG1c420 fragment, that is to say carries the genetic information of two hinge exons between CH1 exon and p-glucuronidase, was isolated (pUC CH1 + H + pG1c420) (Fig. E) -s- 2 0 Tab. 3 4 31 /2 6 yE htmm caactgcaggagagcggtccaggtcttgtgagacctagccagaccctgagcctgacctc G1nI.euGlnGluSerGlyProGlyLeuValAsgProSerGlnThrLeuSerLeuThr(:~
accgtgtctggcttcaccatcagcagtggttatagctggcactgggtgagacagccacc ThrValSexGlyPheThrIleSe.rSerGlyTyrSerTrp.S.isTxpValArgGlnProP3 ggacgaggtcttgagtggattggatacatacagtacagtggtatcactaactacaaccc GlyArgGlyLeuGluTrplleGlyTyrIleGlaTyrSerGlylleThrAsaTyrAsnPi tctctcaaaagtagagtgaca.atgctggtagacaccagcaagaaccagttcagcctgac SerLeuLysSerArgValThrMetLeuValAspThrSerLysAsnGlnPheSerLeulU
ctcagcagcgtgacagccgccgacaccgcggtctattattgtgcaagagaagactatg;
LeuSerSerValThrAlaAlaAspThrAlaValTyrTyrGysAlaArgGluAspTyrA
taccactggtacttcgatgtctggggtcaaggcagcctcgtcacagtctcctca TyrHisTrpTyrPheAspVa.lTrpGlyGlnGlySerLeuValThrValSerSer 431/26 VK hL~i ggtgtccactccgacatccagatgacccagagcccaagcagcctgagcgccagcgtggc GlyValHisSerAspIleGlnMetThrGlnSerProSerSerLeuSerAlaSerVa1G:
gacagagtgac cat cac ctgtagtaccagctcgagtgtaagttacatgcactggtacci AspArgValThrlleThzt'ysSerThrSerSerSerValSerTyrtrSetHisTrpTyrG:
cagaagccaggtaaggctccaaagctgctgatctacagcacatccaacctggcttctgc G1nLysProGlyLysAlaProLysLeuLeulleTyrSerThrSerAsnLeuAlaSerG:
gtgccaagcagattcagcggtagcggtagcggtaccgacttcacettcaccatcagca<
ValProSerArSPheSerGlySerGlySerGlyThrAspPheThrPheThrIleSerSe ctccagccagaggacatcgccacctactactgccatcagtggagtagtta*_cccacgtt LeuGlnProGluAsplleAlaThrTyrTyrCysH.isGlnTrpSerSerTyrProThrP2 ggccaagggaccaaggtggaaatcaaacgt G1yGlnGlyThrI.ysValGlulleLysArg Example (F):
The plasmid pGEM4-HUGP13flGlc was cleaved with SaII, and the 1750bp SalI fragment from the p-glucuronidase cDNA was isolated. The isolated 1750bp Sall fragment was ligated to the SalI-cleaved plasmid pUC CH1 + H+pG1c420. The plasmid clone pUC CHl + H+ hupGlc which contains a fusion gene composed of a CH, exon, a hinge exon and a fusion exon between a hinge exon and the human p-glucuronidase cDNA was isolated (Fig. F).
Example (G):
The expression vector pABstop (Fig. I was cleaved with HindIIl and SalI. The plasmid pUC CH1 + H + hupGlc was cleaved completely with HindIiI and partially with Sall, and the CH, + H + hupGlc insert was isolated. The CH1 + H + hupGlc insert was ligated to the HindIII/SalI-cleaved pABstop, and the clone pABstop CH1 + H + hupGlc was isolated (Fig. G).
Example (H):
The pABstop vector pABstop BW 431/26 hum VH, which con-tains the humanized version of the V. gene of the anti-CEA MAb BW 431/26 (Bossiet R. et al., Eur. J. Nucl.
Med. 14, (1988) 523-528) (see Tab. 3 for the sequences of the humanized V$ and V. gene), was cleaved with HindliI
and BamHl, and the insert which contains the signal exon and the Vs exon was isolated. The plasmid clone pABStop CH1 + H + hupGlc was cleaved with HindIil and ligated to the HindIII/BamHi 431/26 hum V. fragment. After ligation at room temperature for 2 h, the ligation was stopped by incubation at 70 C for 10', and the ends which were still free were filled in with Klenow polymerase and dNTPs.
Further ligation was then carried out overnight. After transformation, the clone pABStop 431/26 hum V. hupGlclH
which contains an immunoglobulin F(ab')Zgene with a hinge exon, which is fused to the coding region of human - 10 - ~~~~047 p-glucuronidase, was isolated with the aid of restriction mapping and nucleic acid sequence analysis (Fig. H).
Example (I):
The clone pABStop 431/26 hum V. hupGlclH was transfected together with a plasmid clone which carries the light chain of humanized BW 431/26 (Fig. z) and two plasmids which carry a neomycin- (Fig. I~) and a methotrexate-resistance gene (Fig. L) into BHK cells. A fusion protein which has both the antigen-binding properties of MAb BW 431/26hum and the enzymatic activity of human p-glucuronidase was expressed.
Example (J):
Demonstration of the antigen-binding properties and of the enzymatic activity of the 431/26 hum $hupGlc 1H
fusion protein The ability of the 431/26 hum VShupGlc 1H fusion protein to bind specifically to the epitope defined by 431/26 on CEA (carcinoembryonic antigen) and, at the same time, to exert the enzymatic activity of human p-glucuronidase was determined in a specificity/enzyme activitygssay. This assay is carried out as described below:
- Polystyrene (96-well) microtiter plates (U shape, Type B, supplied by Nunc, Order No. 4-60445) are incubated with purified CEA (1-5 pg of CEA/ml, 75 pl of this per well) or with GIT mucin (same amount as CEA) at R.T. overnight.
- The non-adsorbed antigen is removed by aspiration and washed 3 x with 0.05 M tris/citrate buffer, pH 7.4.
- The microtiter plates are left to stand at R.T. with the opening facing downwards on cellulose overnight.
- The microtiter plates are incubated with 250 pl of 1% strength casein solution in PBS, pH 7.2, per well (blocking solution) at 20 C for 30 minutes.
- During the blocking, the substrate is made up. The amount of substrate depends on the number of super-natants to be assayed. The substrate is made up fresh for each assay.
- Substrate: 4-methylumbelliferyl ~-D-glucuronide (Order No.: M-9130 from Sigma), 2.5 mM in 200 mM
sodium acetate buffer, pH 5.0, with 0.01% BSA.
- The blocking solution is removed by aspiration, and in each case 50 l of BHR cell supernatant which contains the fusion protein are loaded onto the microtiter plate coated with CEA or GIT mucin (that is to say the sample volume required is at least 120 l).
- Incubation at R.T. is then carried out for 30 minutes.
- The plates are washed 3 x with ELISA washing buffer (Behring, OSEW 96).
- The substrate is loaded in (50.u1/well) and in-cubated at 37 C for 2 hours. The plate is covered because of the possibility of evaporation.
- After 2 hours, 150 pl of stop solution are pipetted into each well (stop solution = 0.2 M glycine + 0.2%
SDS, pH 11.7).
- Evaluation can now be carried out under a UV lamp (excitation energy 380 nm) or in a fluorescence measuring instrument (Fluoroscan II, ICN
Biomedicals, Cat. No.: 78-611-00).
It was possible to show using this specificity/enzyme activity assay that fluorescent 4-methylumbelliferol was detectable in the wells coated with CEA when the enzyme activity was determined at pH 5, the catalytic optimum (Tab. 4).
- 12 - 20 ~ N 67 Table 4:
Dilution out of fusion protein cell culture supernatant (B73/2) on CEA and GIT mucin Substrate in various solutions Dilution 0.2 M sodium PBS, pH 7.2, PBS, pH 7.2 steps acetate buffer on CEA on GIT mucin + 0.01% BSA, pH 5, on CEA
Concen-trated 9118 2725 115.7 1:2 7678 2141 93.37 1:4 4662 1195 73.39 1:8 2927 61B.5 60.68 1:16 1657 332.1 53.69 1:32 853 168.2 40.44 1:64 425 99.26 48.21 1:128 192.5 57.89 47.48 Determination of the conversion rate at pH 7.2 showed that at this physiological pH that of the fusion protein was still = 25% of the conversion rate at pH 5. No significant methylumbelliferol liberation was measurable on the negative control plates coated with GIT mucin and measured at pH 5. This finding.shows that the humanized V region of the 431/26hum VghupGlc 1H fusion protein has retained its epitope specificity, and the p-glucuronidase portion of the fusion protein is able, like the native human enzyme, to cleave the p-glucuronide of 4-methyl-umbelliferol.
Example (K):
Demonstration of the functional identity of the V region of the 431/26hum Vhu,BGlc 1H fusion protein with that of the humanized MAb BW 431/26 and that of the murine ltAb BW
It was shown in Example (J) that the 431/26hum VehupGlc 1H
fusion protein has a certain CEA-binding potential and p-glucuronidase activity. The antigen-specific com-petetive assay described hereinaft+er provides information on the identity of the CEA epitopes which are recognized by the competing molecules, and on the strength of the epitope/fusion protein and epitope/antibody interactions.
This assay is carried out as described below:
- Polystyrene 96-well microtiter plates (U shape, Type B, supplied by Nunc, Order No. 4-60445) are incubated with purified CEA (1-5 g of CEA/ml, 75 l of this per well) or with GIT mucin (same amount as CEA) at R.T. overnight.
- The non-adsorbed antigen is removed by aspiration and washed 3 x with 0.05 M tris/citrate buffer, pH 7.4.
- The microtiter plates are left to.stand at R.T. with the opening facing downwards on cellulose overnight.
- The microtiter plates are incubated with 250 pl of 1% strength casein solution in PBS, pH 7.2, per well (blocking solution) at R.T. for 30 minutes.
- 50 ;41 of the MAb BW 431/26 in a concentration of 5 ng/ml are mixed with 50 pl of 10-fold concentrated supernatant of the humanized MAb BW 431/26 or of the fusion protein, as well as serial 2 x dilutions.
- 50 pl aliquots of these mixtures are pipetted into the wells of microtiter plates coated with CEA or GIT mucin.
- The microtiter plates are incubated at R.T. for 30 minutes.
- The plates are then washed 3 x with ELISA washing buffer (supplied by Behringwerke AG, Order No.
OSEW 96, 250 pl).
- Then 50 l of a 1:250-diluted goat anti-mouse Ig antibody which is coupled to alkaline phosphatase (Southern Biotechnology Associates, Order No.:
1010-04) are added.
- After incubation at R.T. for 30 minutes and washing 3 times, the substrate reaction is carried out as follows:
- Add 30 l of 0.1 mM NADP per well (dissolve 7.65 mg in 100 ml of 20 mM tris; 0.1 mM MgSO41 pH 9.5); the solution can be stored at -20 C for several months.
- Incubate at R.T. for 30 minutes.
- Make up the enhancer system during the incubation with NADP: (5 ml per plate) 2 parts of INT (dissolve 2.5 mg/ml in 30% strength ethanol in an ultrasonic bath; always make up fresh) + 1 part of PBS, pH 7.2 + 1 part of diaphorase (1 mg/ml PBS, pH 7.2) + 1 part of ADH (0.5 mg/ml PBS, pH 7.2) - add 50 pl of the enhancer system - when the extent of reaction is as required, stop the reaction with 0.1 N HZS0,,, 100 l per well - measure at 492 nm in a TITERTEFC MULTISCAN (blank = 50 ul of NADP + 50 l, of enhancer solution +
100 pl of 0.1 N H2SO4) NADP - supplied by Sigma, Order No. N-0505 INT - supplied by Sigma, Order No. 1-8377 ADH - supplied by Sigma, Order No. A-3263 Diaphorase - supplied by Sigma, Order No. D-2381 Reduction of the extinction in this antigen-specific competetive assay means that there is competition between the molecules competing with one another for epitopes which are the same or lying very close together spatially.
The inhibition data which are obtained show that both the fusion protein 431/26hum VHhupGlc 1H and the humanized MAb 431/26 block binding of the murine MAb BW 431/26 to its CEA epitope. 50% inhibition is reached at a 200 molar excess of the relevant competitors. The conclusion from this is that the avidity of the fusion protein for the CEA epitope is comparable with that of the humanized - 15 - 2~'~?~ A.
MAb 431/26. Furthermore, the fusion protein and the humanized MAb bind to the same epitope or to an epitope which lies spatially very near to that defined by the murine MAb BW 431/26 on CEA.
Example (L):
Demonstration of the tissue specificity of the 431/26hum V,hupGlc 1H fusion protein Example (J) showed, inter alia, that the 431/26hum VHhupGlc 1H fusion protein is able to bind to purified CEA.
Example (K) showed that the V region of the fusion protein is able to compete with the V region of murine BW 431/26 for the same, or a very close, epitope. The indirect immunohistochemical assay which is specific for p-glucuronidase and is described hereinafter can be used to determine the microspecificity of the fusion protein on cryopreserved tissues.
The assay is described below:
- 6 m-thick frozen sections are placed on slides and dried in air for at least 30 minutes.
- The slides are subsequently fixed in acetone at -20 C for 10 seconds.
- The slides are washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- 20-100 l of fusion protein-containing BHK cell supernatant (concentrated or diluted in tris/BSA, pH 7.4) is applied to each section and incubated in a humidity chamber at R.T. for 30 minutes.
- The slides are washed in tris/NaCI washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- 50 pl of hybridoma supernatant of the murine anti-p-glucuronidase MAb BW 2118/157 are added to each section, and the slides are incubated in a humidity - 16 - 2D6>047 chamber at R.T. for 30 minutes.
- The slides are then washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- 20-100 l of bridge Ab (rabbit-antimouse IgG diluted 1:100 in human serum, pH 7.4) are applied to each section and incubated in a htunidity chamber at R.T.
for 30 minutes.
- The slides are then washed in tris/NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- Subsequently 20-100 l of APAAP complex (mouse anti-AP diluted 1:100 in tris/BSA, pH 7.4) are applied to each section and incubated in a humidity chamber at R.T. for 30 minutes.
- The slides are then washed in tris-NaCl washing buffer, pH 7.4, with 0.1% BSA for 5 minutes.
- The substrate for alkaline phosphatase is made up as follows (100 ml of substrate solution sufficient for one glass cuvette):
Solution 1: 3.7 g of NaCl 2.7 g of tris base (dissolve in 75 ml of distilled water) + 26.8 ml of propanediol buffer, pH 9.75, adjust with HC1 + 42.9 mg of levamisole ~ clear, color-less solution Solution 2: Dissolve 21.4 mg of sodium nitrite in 535 pl of distilled water ~ clear, colorless solution Solution 3: Dissolve 53.5 mg of naphthol AS BI
phosphate in 642 l of dimethylformamide (DMF) * clear, yellowish solution - Add 368 pl of 5% strength new fuchsin solution to solution 2 (sodium nitrite) and leave to react for 1 minute (stopclock) to give a clear, brown solution - Add solution 2 (sodium nitrite with new fuchsin) and solution 3 (naphthol AS BI phosphate) to solution 1 (tris/NaCl/propanediol buffer) ~ clear, yellowish solution - adjust to pH 8.8 with HC1 =~ cloudy, yellowish solution - filter solution and place on the slide and leave to react on a shaker for 15 minutes ~ solution becomes cloudy.
- wash slide in tris/NaCl buffer, pH 7.4, for 10 minutes - wash slide in distilled water for 10 minutes - after drying in air for 2 hours, the slides are sealed in Kaiser's glycerol/gelatin at 56 C.
Specific binding of the fusion protein was demonstrated under the light microscope by the red coloration of the epitope-positive tissue sections. Comparative investiga-tions with the murine M.Ab BW 431/26, which was detected by the indirect APAAP technique (Cordell et al., J. Histochem. Cytochem. 32, 219, 1984), revealed that the tissue specificity of the fusion protein agreed exactly with that of the murine MAb BW 431/26, i.e. that there is identity both of the reaction type in the individual specimen and of the number of positive and negative findings from a large number of different carcinomas and normal tissue.
Example (M):
Purification of the 431/26hum V,~hupGlc 1H fusion protein Murine and humanized MAbs can be purified by immuno-affinity chromatography methods which are selective for the Fc part of these molecules. Since there is no Fc part in the 431/26hum VHhupGlc 1H fusion protein, it was necessary to develop an alternative highly selective immunoaffinity chromatography method. Besides the selec-tivity of this method to be developed, it is necessary for the isolation conditions to be very mild in order not to damage the p-glucuronidase, which is very labile in the acidic and in the alkaline range.
The principle of the method comprises purification of the fusion protein from supernatants from transfected BHK
cells using an anti-idiotype MAb directed against the humanized V region. The preparation of such MAbs is known from the literature (Walter et al., Behring Inst. Mitt., 82, 182-192, 1988). This anti-idiotype MAb can be both murine and humanized. The MAb is preferably immobilized on a solid phase so that its V region has not been damaged. Examples of this are known from the literature (Fleminger et al., Applied Biochem. Biotechnol., 23, 123-137, 1990; Horsfall et al., JIM 104, 43-49, 1987).
The anti-idiotype MAb thus immobilized on the solid phase by known methods binds very efficiently the fusion protein to be purified from transfected BHK cells, for example at pH 7, but has the surprising property that it no longer binds the fusion protein when the pH .is lowered by only 1.5, to pH 5.5. This mild pH elution technique has no adverse effect on the fusion protein, either in its ability to bind to CEA or in its enzymatic activity (for methods, see Example J). Tab. 5 shows the OD values and fluorogenic units (FU) of the individual fractioris from a purification using the solid phase-immobilized, anti-idiotype MAb BW 2064/34.
Table 5:
Anti-idiotype affinity chromatography OD in ~ PU in $ pH Chromatography procedure Fractions 1-5 1 0 7.2 Preli_minary washing of the column with PBS, pH 7.2 6-142 20 0 7.2 Sample loading 143-162 1 0 7.2 Washing of the column with PBS, pH 7.2 163 1 0 7.2 164 1 0 7.2 165 1 0 7.2 166 1 0 6.8 167 2 10 6.1 168 5 20 5.7 169 16 40 5.6 170 23 80 5.5 171 26 100 5.4 Elution with PBS, 172 24 80 5.3 pH 4.2 173 19 60 5.2 174 14 40 5.2 175 10 30 5.1 176 8 25 5.1 177 6 20 5.1 178 3 10 5.0 179 2 5 5.0 180 1 0 5.0 1 fraction = collection for 6.6 min (at pumping rate of 18 m1Jh) =2m1 The FU values are indicated as % of the highest value (fraction 171).
ho ~ is d S.f The elution of the fusion protein was measured as protein by measurement of the OD at 280 nm. In addition, the isolated fractions were examined for specific binding to CEA and simultaneous enzyme activity in the specificity/
enzyme activity assay (Example J). The values show that all the specific binding and enzyme activity was con-centrated in one peak (peak eluted from around pH 5.0 to pH 5.6). The conclusion from this is that the described method of anti-idiotype affinity chromatography is a very efficient and selective purification technique for the 431/26hum VHhupGlc 1H fusion protein.
Example (N):
Gel chromatography of the fusion proteins The supernatants from the BHR cells secreting the 431/26hum VH hupGlc 1H fusion protein (B 70/6, B 74/2, B 72/72, B 73/2) were removed, sterilized by filtration and subjected to analytical gel filtration. For this, a TSK G3000 SW-XL column (7.8 x 300 mm) was equilibrated with 0.1 M sodium phosphate buffer, pH 6.7, + 0.02% NaN3, 20 pl of the supernatant were loaded on, and elution was carried out with a flow rate of 0.6 ml/min. Starting with an elution time of 9 min (exclusion volume 9.5 min), fractions (0.3 min each) were collected and assayed for p-glucuronidase activity.
For this 25 l of the particular fraction were mixed with 75 l of substrate solution (2.5 mM 4-methylumbelliferyl p-glucuronide in 200 mM sodium acetate buffer, pH 5, +
0.1 mg/ml BSA) and incubated at 37'C for 2 hours. The reaction was then stopped with 1.5 ml of 0.2 M
glycine/0.2% SDS solution, pH 11.7, and the fluorescent label liberated by the glucuronidase was quantified in a Hitachi fluorometer (with excitation wavelength of 360 nm and emission wavelength of 450 nm).
Result:
All 4 constructs show a single mai:n activity peak between fractions 4 and 6 (Table 6). This corresponds to reten-tion times of about 10.2 - 10.8 min. The fusion proteins with glucuronidase activity in the supernatants thus have retention times which are of the same order of magnitude as those of chemically prepared antibody-p-glucuronidase constructs (10.4 min). The retention time for the free enzyme is 11.9, and for the free antibody is 12.3 min.
Table 6:
Gel filtration of various fusion proteins Incubation: 25 l, 37 C, 120 min Substance concentration: 1.875 mM; 0.1 ang/ml BSA
Each fraction 0.3 min; start at 9 min Liberated label/assay (FU) Fractions B70/6 B74/2 B72/72 B73/2 Example (0):
Molecular characterization of the 431/26 hum V. hupGlclH
fusion protein The fusion proteins were purified by anti-idiotype affinity chromatography in Example (M). Aliquots from the peak eluted at pH 5.5 were subjected to 10% SDS PAGE
electrophoresis under non-reducing and reducing condi-tions and immunostained in a Western blot using anti-idiotype MAbs or with anti-p-glucuronidase MAbs (Towbin and Gordon (1979), Proc. Natl. Acad. Sci. USA 76: 4350-4354).
Under non-reducing conditions with the 431/26 hum V.
hupGlc1H fusion protein, a main band of = 125 kDa and a band of 250 kDa were detected and were detactable both by anti-idiotype MAb and by anti-p-glucuronidase MAb in the Westerri blot. Under reducing conditions there was no detectable immunostaining either by the anti-idiotype or by the anti-p-glucuronidase MAbs. A 100 kDa and a 25 kDa band were detected in the reducing SDS PAGE. However, these molecules analyzed under denaturing conditions are, according to TSK G 3000 SW-XL gel filtration under native conditions in the form of a higher molecular weight product which has a molecular weight of - 250 kDa (Example N). Diagrammatic representations of the 431/26 hum V. hueG1c1H fusion protein are shown in Fig. M. Figure Mb shows the monomer which has a= 25 kDa light chain and a= 100 kDa heavy chain. This monomer and a dimer linked by inter-heavy chain disulfide bridges can be detected under denaturing conditions (Fig. Ka). Under native conditions, the fusion protein is in the form of a dimer of = 250 kDa, with or without inter-heavy chain disulfide bridges (Fig. Mc).
r,~~,r, 9 ,r3 I r h+ V ''~ t J ~-' ! 0 EXAMPLE ( P ) :
Chemical modification of the fusion protein The fusion protein purified as in Example (N) (110 g/ml) was adjusted to pH 4.5 and mixed with sodium periodate (final concentration 1 mM). After incubation at room temperature in the dark for 1 hour, the sodium periodate was removed by gel chromatography, and the fusion protein was then readjusted to pH B. Addition of ethanolamine to a final concentration of 0.1 M was followed by incubation at 4 C for a further 3 hours, then sodium cyanoboro-hydride (final concentration 5 mM) was added and in-cubated for 30 min (reduction). This was followed by another gel filtration to remove the reducing agent and to change the buffer of the fusion protein. The chemical modification had no effect on the functional activity of the fusion protein. Tab. 7 shows the change in the plasma concentrations of unmodified and modified fusion protein in the nude mouse. The elimination of the fusion protein from the plasma is greatly slowed down by the modification.
Table 7:
Plasma levels of p-glucuronidase activity in the nude mouse p-Glucuronidase fusion protein t Treated Untreated [min] % activity % activity EJAMPLE (Q);
Enzymatic treatment of the fusion protein 53 pg of fusion protein (Example N) in 0.01 M tris/HC1, 0.15 M NaCl were incubated with 1 unit of soluble alkaline phosphatase (E. coli) or immobilized alkaline phosphatase (bovine intestine) at room temperature for 20 h. Tab. 8 shows the change in the plasma concentration of untreated and treated fusion protein in the nude mouse. The elimination is not significantly affected by the enzyme treatment.
Table 8:
Plasma levels of p-glucuronidase activity in the nude mouse p-Glucuronidase fusion protein AP AP
t (bovine intestine, (E. coli) immobil.) [min] untreated treated treated AP = alkaline phosphatase Example (R):
Pharmacokinetics and tumor retention of the 431/26 hum VH
30 hupGlc 1H fusion protein By way of example, 5 x 4 pg of purified fusion protein 2 L) r, 9 td which was mixed with 100 pg of HSA/ml were injected in unmodified (Example N) and chemically modified form (Example P) i.v. at 24-hour intervals into CEA-expressing nude mice harboring human tumors. After defined time intervals, 3 animals in each case were sacrificed by cervical dislocation. The organs were removed, weighed and mixed with 2 ml of 1% strength BSA in PBS, pH 7.2.
The tissue and cells from these organs were then broken down in a Potter (10 strokes) and the amount of functionally active fusion protein was determined in the supernatant after centrifugation of the suspension at 3000 rpm and RT
for 10' (Heraeus Labofuge GL, Type 2202) in the specificity/
enzyme activity assay (see Example J). The data from a representative experiment are shown in Tab. 9. It is clearly evident that the chemically modified fusion protein, which has a tl/2p of = 4 h, specifically accumulates in the tumor from ;-- 3 days after completion of the repetitive injection phase. The unmodified fusion protein, which has a tl/2p of = 20 min, showed no significant accumulation in the tumor under the same experimental conditions.
It may be concluded from these data that the hu 431 p-Gluc fusion protein is able to bind in vivo to CEA-positive tumors and to remain there as enzymatically active molecule over long time periods (> 9 days). The time the prodrug is administered in this system should be between day 3 and 9 after completion of the fusion protein injection.
L, -w Ln ~ ~
to o to 00 1-1 Cl ~
m to 0 ~ Ln .1) o~~o o N C'i O N rl O H r-I .-a tG
>1 O . I
,,, PI ef u ' ' ' G T 1 CDQ
~1 O ~ O tG
rtl ~ N
m e i 0 ~ o I a o I i O U' r:; 4' to 44 M
~4 O M e4 ri Ga ts 0 o w ~r y ~ ~ a O N
1 O =.-1 =,A 0 ,rl ~ ~ H M u1 U N
dp W =.9 U N
}' $4 r -T v =,1 p 44 O . . .
O ~ ~D d+
O 0o N N
-PG
O
a) u1 >C 0 N 'H =.i O +J
O 0 ~ n .N =.-f .N 9 r. -.) 44 =rl Q) U ~tl M ef N to +J N N t~ rl n) r-, > N
ai H ~ ='1 1~ 0 N +J
~ ~ ~ ~ rd E ~ ==i E ~ ri E-i C
to o to 00 1-1 Cl ~
m to 0 ~ Ln .1) o~~o o N C'i O N rl O H r-I .-a tG
>1 O . I
,,, PI ef u ' ' ' G T 1 CDQ
~1 O ~ O tG
rtl ~ N
m e i 0 ~ o I a o I i O U' r:; 4' to 44 M
~4 O M e4 ri Ga ts 0 o w ~r y ~ ~ a O N
1 O =.-1 =,A 0 ,rl ~ ~ H M u1 U N
dp W =.9 U N
}' $4 r -T v =,1 p 44 O . . .
O ~ ~D d+
O 0o N N
-PG
O
a) u1 >C 0 N 'H =.i O +J
O 0 ~ n .N =.-f .N 9 r. -.) 44 =rl Q) U ~tl M ef N to +J N N t~ rl n) r-, > N
ai H ~ ='1 1~ 0 N +J
~ ~ ~ ~ rd E ~ ==i E ~ ri E-i C
- 28 - ' Example (S):
Isoelectric focusing of the 431/26 hum VH hupGlc 1H fusion protein The fusion protein purified by anti-idiotype affinity chromatography (Example N) was subjected to isoelectric focusing in the Pharmacia Fast System by the method of Righetti et al. (1979). It emerged from this that the isoelectric point of the molecule lies in a pH range from 7.35 to 8.15.
Example (T):
Demonstrati.on that a cytostatic prodrug can be cleaved by the 431/26 hum V. hupGlc 1H fusion protein It was shown in Example (J) that the p-glucuronidase portion of the fusion protein is able, like the native human enzyme, to cleave the p-glucuronide of 4-methylumbelliferol. In the investigations which are described hereinafter, the substrate used for the enzymatic cleavage was a p-glucuronide, linked via a spacer group, of the cytostatic daunomycin, The specific procedure for these investigations was as follows:
4 mg of the compound N-(4-hydroxy-3-nitrobenzyloxy-carbonyl)daunorubicin fl-D-glucuronide (prodrug), which is described in French Patent Application (No. d'Enregistrement National: 9105326) were dissolved in 1 ml of 20 mM phosphate buffer, pH 7.2. 35 pl of the fusion protein (Example N) or of human p-glucuronidase (total concentration in each case 6.5 U/ml; 1 U = cleavage of 1~amol of 4-methyl-umbelliferol/min at 37 C) were pipetted into 5 l portions of this substrate solution and incubated in the dark at 37 C. Samples (5 l) of the incubation mixture were removed after various times and immediately analyzed by high pressure liquid chromatography under the following conditions:
F~ry - 29 - 2 0r~ i~2 0 d Column:
Nucleosil 100 RP 18, 5 m particle diameter, 125 x 4.6 mm Mobile phase:
Gradient of solution A(100$ acetonitrile) and solution B
(20 mM phosphate buffer pH 3.0) 0 min: 30% solution A
min: 70% solution A
min: 70% solution A
Flow rate: 1 ml/min 10 Detection: fluorescence, excitation 495 nm, emission 560 nm Data analysis: Beckman System Gold Software The retention time of the starting compound (prodrug) under these chromatography conditions was 11 min. The compound produced during the incubation (drug) had a retention time 15 of 8.9 min, identical to daunomycin (DNM, analysis of a standard under the same conditions). The kinetics of the cleavage of the starting compound by the fusion protein and human fl-glucuronidase are shown in Tab. 11 and Tab. 10 respectively.
20 The half-life of the cleavage of the prodrug by the fusion protein was 2.3 h. Cleavage by human p-glucuronidase took place with a half-life of 0.8 h. As already demonstrated in Example ( J) , the results of the investigations show that the p-glucuronidase portion of the fusion protein is functionally active and able to cleave p-glucuronides. The kinetics of the elimination of the glucuronide portion and the liberation of the drug (daunomycin) from the prodrug used show a rate comparable in magnitude to human p-glucuronidase, so that the substrate specifity of the fusion protein essentially agrees with that of human p-glucuronidase.
2 0 2, 24 '13 Table 10:
Kinetics of prodrug cleavage by j9-glucuronidase (human, recombinant) t Prodrug ANM
min area ~ area ~
0 99.2 0.8 57 36.0 64.0 130 10.3 89.7 227 9.3 90.7 Table 11:
Kinetics of prodrug cleavage by p-glucuronidase (fusion protein) t Prodrug DNM
min area % area %
0 98.9 1.1 50 81.1 18.9 135 51.7 48.3 190 33.0 67.0 247 22.0 78.0 317 12.4 87.6
Isoelectric focusing of the 431/26 hum VH hupGlc 1H fusion protein The fusion protein purified by anti-idiotype affinity chromatography (Example N) was subjected to isoelectric focusing in the Pharmacia Fast System by the method of Righetti et al. (1979). It emerged from this that the isoelectric point of the molecule lies in a pH range from 7.35 to 8.15.
Example (T):
Demonstrati.on that a cytostatic prodrug can be cleaved by the 431/26 hum V. hupGlc 1H fusion protein It was shown in Example (J) that the p-glucuronidase portion of the fusion protein is able, like the native human enzyme, to cleave the p-glucuronide of 4-methylumbelliferol. In the investigations which are described hereinafter, the substrate used for the enzymatic cleavage was a p-glucuronide, linked via a spacer group, of the cytostatic daunomycin, The specific procedure for these investigations was as follows:
4 mg of the compound N-(4-hydroxy-3-nitrobenzyloxy-carbonyl)daunorubicin fl-D-glucuronide (prodrug), which is described in French Patent Application (No. d'Enregistrement National: 9105326) were dissolved in 1 ml of 20 mM phosphate buffer, pH 7.2. 35 pl of the fusion protein (Example N) or of human p-glucuronidase (total concentration in each case 6.5 U/ml; 1 U = cleavage of 1~amol of 4-methyl-umbelliferol/min at 37 C) were pipetted into 5 l portions of this substrate solution and incubated in the dark at 37 C. Samples (5 l) of the incubation mixture were removed after various times and immediately analyzed by high pressure liquid chromatography under the following conditions:
F~ry - 29 - 2 0r~ i~2 0 d Column:
Nucleosil 100 RP 18, 5 m particle diameter, 125 x 4.6 mm Mobile phase:
Gradient of solution A(100$ acetonitrile) and solution B
(20 mM phosphate buffer pH 3.0) 0 min: 30% solution A
min: 70% solution A
min: 70% solution A
Flow rate: 1 ml/min 10 Detection: fluorescence, excitation 495 nm, emission 560 nm Data analysis: Beckman System Gold Software The retention time of the starting compound (prodrug) under these chromatography conditions was 11 min. The compound produced during the incubation (drug) had a retention time 15 of 8.9 min, identical to daunomycin (DNM, analysis of a standard under the same conditions). The kinetics of the cleavage of the starting compound by the fusion protein and human fl-glucuronidase are shown in Tab. 11 and Tab. 10 respectively.
20 The half-life of the cleavage of the prodrug by the fusion protein was 2.3 h. Cleavage by human p-glucuronidase took place with a half-life of 0.8 h. As already demonstrated in Example ( J) , the results of the investigations show that the p-glucuronidase portion of the fusion protein is functionally active and able to cleave p-glucuronides. The kinetics of the elimination of the glucuronide portion and the liberation of the drug (daunomycin) from the prodrug used show a rate comparable in magnitude to human p-glucuronidase, so that the substrate specifity of the fusion protein essentially agrees with that of human p-glucuronidase.
2 0 2, 24 '13 Table 10:
Kinetics of prodrug cleavage by j9-glucuronidase (human, recombinant) t Prodrug ANM
min area ~ area ~
0 99.2 0.8 57 36.0 64.0 130 10.3 89.7 227 9.3 90.7 Table 11:
Kinetics of prodrug cleavage by p-glucuronidase (fusion protein) t Prodrug DNM
min area % area %
0 98.9 1.1 50 81.1 18.9 135 51.7 48.3 190 33.0 67.0 247 22.0 78.0 317 12.4 87.6
Claims (17)
1. A fusion protein for prodrug activation of the formula huTuMAb-L-.beta.-Gluc, where huTuMAb is a humanized tumor-specific monoclonal antibody or a tumor-binding fragment thereof, L is a linker, and .beta.-Gluc is human .beta.-glucuronidase, wherein the huTuMAb comprises a V H region, a CH1 region and a hinge region.
2. A fusion protein for prodrug activation of the formula huTuMAb-L-.beta.-Gluc, where huTuMAb is a humanized tumor-specific monoclonal antibody or a tumor-binding fragment thereof, L is a linker, and .beta.-Gluc is human .beta.-glucuronidase, wherein the huTuMAb comprises a V H region, a CH1 region and two hinge regions.
3. A fusion protein for prodrug activation of the formula huTuMAb-L-.beta.-Gluc, where huTuMAb is a humanized tumor-specific monoclonal antibody or a tumor-binding fragment thereof, L is a linker, and .beta.-Gluc is human .beta.-glucuronidase, wherein the huTuMAb comprises a V H region, a CH1 region and three hinge regions.
4. A fusion protein for prodrug activation of the formula huTuMAb-L-.beta.-Gluc, where huTuMAb is a humanized tumor-specific monoclonal antibody or a tumor-binding fragment thereof, L is a linker, and .beta.-Gluc is human .beta.-glucuronidase, wherein the huTuMAb comprises a V H region, a CH3 region and can associate with a modified light chain composed of V L and CH3 domain.
5. A fusion protein as claimed in any one of claims 1 to 4, where the huTuMAb portion derives from MAb BW 431/26.
6. A fusion protein as claimed in any one of claims 1 to 5, wherein L is a peptide linker and comprises a hinge region.
7. A fusion protein as claimed in any one of claims 1 to 6, in which L
contains a polypeptide spacer encoded by the nucleotide sequence selected from the group consisting of 5'GCG GCG GCG GCG GTG
CA3'; 5'CCG CCG CCG CCG CTG CA3'; 5'GAG CCC AAA TCT
TGT GAC ACA CCT CCC CCG TGC CCA CGG TGC CCA GTT
GCA3'; and 5'ACT GGG CAC CGT GGG CAC GGG GGA GGT
GTG TCA CAA GAT TTG GGC TCT GCA3'.
contains a polypeptide spacer encoded by the nucleotide sequence selected from the group consisting of 5'GCG GCG GCG GCG GTG
CA3'; 5'CCG CCG CCG CCG CTG CA3'; 5'GAG CCC AAA TCT
TGT GAC ACA CCT CCC CCG TGC CCA CGG TGC CCA GTT
GCA3'; and 5'ACT GGG CAC CGT GGG CAC GGG GGA GGT
GTG TCA CAA GAT TTG GGC TCT GCA3'.
8. A fusion protein as claimed in any one of claims 1 to 7, in which L
contains 1, 2 or 3 hinge regions of a human IgG3 C gene.
contains 1, 2 or 3 hinge regions of a human IgG3 C gene.
9. A plasmid which contains the cDNA for fusion proteins as claimed in any one of claims 1 to 8.
10. An isolated transformed eukaryotic cell which is transformed with a plasmid as claimed in claim 9.
11. A process for the preparation of fusion proteins as claimed in any one of claims 1 to 8, which comprises transforming an isolated cell with a plasmid according to claim 9, and isolating said fusion proteins via anti-idiotype MAbs.
12. A fusion protein as claimed in any one of claims 1 to 8, which fusion protein is treated with an oxidizing agent.
13. A fusion protein as claimed in claim 12, which fusion protein is reductively aminated in a second reaction step.
14. A process for the preparation of fusion proteins as claimed in claim 12, which comprises treating the fusion proteins as claimed in any one of claims 1 to 8 with an oxidizing agent.
15. A process for the preparation of fusion proteins as claimed in claim 13, which comprises the fusion proteins as claimed in any one of claims 1 to 8 being oxidized in a first reaction step and reductively aminated in a second reaction step.
16. A fusion protein as claimed in any one of claims 1-8, 12 and 13 for use as pharmaceutical for treatment of cancer.
17. A fusion protein as claimed in any one of claims 1-8, 12 and 13 for use as diagnostic aid for cancers.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DEP4106389.9 | 1991-02-28 | ||
| DE4106389A DE4106389A1 (en) | 1991-02-28 | 1991-02-28 | FUSION PROTEINS FOR PRODRUG ACTIVATION, THEIR PRODUCTION AND USE |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2062047A1 CA2062047A1 (en) | 1992-08-29 |
| CA2062047C true CA2062047C (en) | 2007-12-18 |
Family
ID=6426148
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002062047A Expired - Lifetime CA2062047C (en) | 1991-02-28 | 1992-02-28 | Fusion proteins for prodrug activation, the preparation and use thereof |
Country Status (12)
| Country | Link |
|---|---|
| EP (1) | EP0501215B1 (en) |
| JP (1) | JP3524933B2 (en) |
| KR (1) | KR100249576B1 (en) |
| AT (1) | ATE193326T1 (en) |
| AU (1) | AU660445B2 (en) |
| CA (1) | CA2062047C (en) |
| DE (2) | DE4106389A1 (en) |
| DK (1) | DK0501215T3 (en) |
| ES (1) | ES2149159T3 (en) |
| GR (1) | GR3033708T3 (en) |
| IE (1) | IE920630A1 (en) |
| PT (1) | PT501215E (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE4225853A1 (en) * | 1992-08-05 | 1994-02-10 | Behringwerke Ag | Granulocyte-binding antibody fragments, their production and use |
| DE4233152A1 (en) * | 1992-10-02 | 1994-04-07 | Behringwerke Ag | Antibody-enzyme conjugates for prodrug activation |
| DE4314556A1 (en) * | 1993-05-04 | 1994-11-10 | Behringwerke Ag | Modified antibody-enzyme conjugates and fusion proteins and their use in tumor-selective therapy |
| EP0647450A1 (en) * | 1993-09-09 | 1995-04-12 | BEHRINGWERKE Aktiengesellschaft | Improved prodrugs for enzyme mediated activation |
| GB9324807D0 (en) * | 1993-12-03 | 1994-01-19 | Cancer Res Campaign Tech | Tumour antibody |
| DE19513676A1 (en) | 1995-04-11 | 1996-10-17 | Behringwerke Ag | Cytoplasmic expression of antibodies, antibody fragments and antibody fragment fusion molecules in E. coli |
| EP0795334B1 (en) * | 1996-03-12 | 2006-02-01 | Sanofi-Aventis Deutschland GmbH | Prodrugs for the treatment tumors and inflammatory diseases |
| GB9709421D0 (en) * | 1997-05-10 | 1997-07-02 | Zeneca Ltd | Chemical compounds |
| US6361774B1 (en) | 1999-09-17 | 2002-03-26 | Immunomedics, Inc. | Methods and compositions for increasing the target-specific toxicity of a chemotherapy drug |
| CA2344440A1 (en) * | 1998-09-18 | 2000-03-30 | Immunomedics, Inc. | Antibody directed enzyme prodrug therapy (edept) with glucoronidase |
| US7232888B2 (en) | 2002-07-01 | 2007-06-19 | Massachusetts Institute Of Technology | Antibodies against tumor surface antigens |
| US7834258B2 (en) * | 2003-06-30 | 2010-11-16 | Mu-Hyeon Choe | Dimer of chimeric recombinant binding domain-functional group fusion formed via disulfide-bond-bridge and the processes for producing the same |
| RU2019123613A (en) | 2017-01-03 | 2021-02-05 | Ф. Хоффманн-Ля Рош Аг | BISPECIFIC ANTIGENBINDING MOLECULES CONTAINING ANTIBODY K4-1BB, CLONE 20N4.9 |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PT80662B (en) * | 1984-06-20 | 1986-12-09 | Sanofi Sa | Process to obtain anti-tumoral glycoprotein modified on its glycidic portions |
| FR2591895B1 (en) * | 1985-12-20 | 1988-08-26 | Sanofi Sa | LONG-LASTING IN VIVO IMMUNOTOXINS HAVING MODIFIED RICIN A CHAIN ON ITS POLYSACCHARIDE PATTERNS |
| GB8705477D0 (en) * | 1987-03-09 | 1987-04-15 | Carlton Med Prod | Drug delivery systems |
| NZ225599A (en) * | 1987-08-04 | 1991-09-25 | Bristol Myers Co | Antibody-enzyme conjugates and combinations with prodrugs for the treatment of tumour cells |
| DE3825615A1 (en) * | 1988-07-28 | 1990-02-01 | Behringwerke Ag | ANTIGENT CONSTRUCTS OF "MAJOR HISTOCOMPATIBILITY COMPLEX" CLASS I ANTIGENS WITH SPECIFIC CARRIER MOLECULES, THEIR PRODUCTION AND USE |
| ATE123414T1 (en) * | 1989-01-23 | 1995-06-15 | Akzo Nobel Nv | SITE-SPECIFIC IN-VIVO ACTIVATION OF THERAPEUTIC DRUGS. |
| DE3909799A1 (en) * | 1989-03-24 | 1990-09-27 | Behringwerke Ag | MONOCLONAL ANTIBODIES (MAK) AGAINST TUMOR ASSOCIATED ANTIGENS, THEIR PRODUCTION AND USE |
| WO1991008770A1 (en) * | 1989-12-11 | 1991-06-27 | Immunomedics, Inc. | Method for antibody targeting of diagnostic or therapeutic agents |
| DE4002888A1 (en) * | 1990-02-01 | 1991-08-08 | Behringwerke Ag | ANTHRACYCLIN-GLYCOSYL PRODRUGS, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE IN COMBINATION WITH FUNCTIONALIZED TUMOR-SPECIFIC ENZYME CONJUGATES |
-
1991
- 1991-02-28 DE DE4106389A patent/DE4106389A1/en not_active Withdrawn
-
1992
- 1992-02-10 AT AT92102197T patent/ATE193326T1/en active
- 1992-02-10 EP EP92102197A patent/EP0501215B1/en not_active Expired - Lifetime
- 1992-02-10 PT PT92102197T patent/PT501215E/en unknown
- 1992-02-10 DE DE59209839T patent/DE59209839D1/en not_active Expired - Lifetime
- 1992-02-10 DK DK92102197T patent/DK0501215T3/en active
- 1992-02-10 ES ES92102197T patent/ES2149159T3/en not_active Expired - Lifetime
- 1992-02-26 KR KR1019920002961A patent/KR100249576B1/en not_active IP Right Cessation
- 1992-02-27 IE IE063092A patent/IE920630A1/en not_active IP Right Cessation
- 1992-02-27 AU AU11251/92A patent/AU660445B2/en not_active Expired
- 1992-02-28 CA CA002062047A patent/CA2062047C/en not_active Expired - Lifetime
- 1992-02-28 JP JP07864492A patent/JP3524933B2/en not_active Expired - Lifetime
-
2000
- 2000-06-16 GR GR20000401398T patent/GR3033708T3/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| AU660445B2 (en) | 1995-06-29 |
| JPH07179500A (en) | 1995-07-18 |
| EP0501215A2 (en) | 1992-09-02 |
| DK0501215T3 (en) | 2000-09-18 |
| IE920630A1 (en) | 1992-09-09 |
| PT501215E (en) | 2000-10-31 |
| EP0501215A3 (en) | 1993-08-11 |
| EP0501215B1 (en) | 2000-05-24 |
| DE59209839D1 (en) | 2000-06-29 |
| ATE193326T1 (en) | 2000-06-15 |
| GR3033708T3 (en) | 2000-10-31 |
| DE4106389A1 (en) | 1992-09-03 |
| ES2149159T3 (en) | 2000-11-01 |
| KR100249576B1 (en) | 2000-03-15 |
| AU1125192A (en) | 1993-01-28 |
| CA2062047A1 (en) | 1992-08-29 |
| JP3524933B2 (en) | 2004-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2095836C (en) | Cytokine immunoconjugates | |
| US7273727B2 (en) | Fusion proteins for prodrug activation | |
| JP3171268B2 (en) | Therapeutic antibody-based fusion protein | |
| KR0183980B1 (en) | Bispecific and oligospecific mono-and oligovalent receptors, production and applications thereof | |
| JP3280376B2 (en) | Multivalent antigen binding protein | |
| US5650150A (en) | Recombinant antibody cytokine fusion proteins | |
| CA2062047C (en) | Fusion proteins for prodrug activation, the preparation and use thereof | |
| US7314753B2 (en) | Cytoplasmic expression of antibodies, antibody fragments and antibody fragment fusion proteins in E. coli | |
| JPS6221000B2 (en) | ||
| AU1193999A (en) | J-chain and analogues as epithelial cell targeting conjugates | |
| IE83238B1 (en) | Fusion proteins with monoclonal antibody, linker and beta glucuronidase for prodrug activation; preparation and use thereof | |
| US20230303709A1 (en) | Antibody Derivatives with Conditionally Enabled Effector Function | |
| JP2001511122A (en) | Novel drug targeting epithelial tissue | |
| US6475486B1 (en) | Glycosyl-etoposide prodrugs, a process for preparation thereof and the use thereof in combination with functionalized tumor-specific enzyme conjugates | |
| JP2000504218A (en) | Ligand-directed enzyme prodrug therapy | |
| US6610299B1 (en) | Glycosyl-etoposide prodrugs, a process for preparation thereof and the use thereof in combination with functionalized tumor-specific enzyme conjugates | |
| KR100387452B1 (en) | Bifunctional glycoproteins with modified carbohydrate complements and pharmaceutical preparations comprising the same | |
| US7241595B2 (en) | Glycosyl-etoposide prodrugs, a process for preparation thereof and the use thereof in combination with functionalized tumor-specific enzyme conjugates | |
| de Sutter et al. | A bifunctional murine:: Human chimeric antibody with one antigen-binding arm replaced by bacterial β-lactamase | |
| JP2000502071A (en) | Drug therapy | |
| CA2243533A1 (en) | Ligand directed enzyme prodrug therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| MKEX | Expiry |