IE67651B1

IE67651B1 - Polypeptides

Info

Publication number: IE67651B1
Application number: IE155490A
Authority: IE
Inventors: David James Ballance
Original assignee: Delta Biotechnology Ltd
Priority date: 1989-04-29
Filing date: 1990-04-27
Publication date: 1996-04-17
Also published as: GB8909916D0; GB2246783B; IE901554L; ZA903237B; FI104255B; AU5564690A; GB9119043D0; FI104255B1; GB2246783A; WO1990013653A1; EP0470165A1; CA2015687C; AU630450B2; HU904413D0; CA2015687A1; KR920701451A; KR100227167B1; IL94243A0; JP2781459B2; HUT61049A

Abstract

A fusion polypeptide comprising, as at least part of the N-terminal portion thereof, an N-terminal portion of HSA or a variant thereof and, as at least part of the C-terminal portion thereof, another polypeptide except that, when the said N-terminal portion of HSA is the 1-n portion where n is 369 to 419 or a variant thereof, then the said polypeptide is one of various specified entities, including the 585 to 1578 portion of human fibronectin or a variant thereof. The HSA-like portion may have additional N-terminal residues, such as secretion leader sequences (signal sequences). The C-terminal portion is preferably the 585-1578 portion of human plasma fibronectin. The N-terminal and C-terminal portions may be cleavable to yield the isolated C-terminal portion, with the N-terminal portion having served to facilitate secretion from the host.

Description

The present invention relates to fusion polypeptides where two individual polypeptides or parts thereof are fused to form a single amino acid chain. Such fusion may arise from the expression of a single continuous coding sequence formed by recombinant DNA techniques.

Fusion polypeptides are known, for example those where a polypeptide which is the ultimately desired product of the process is expressed with an N-terminal leader sequence which encourages or allows secretion of the polypeptide from the cell. An example is disclosed in EP-A-116 201 (Chiron).

Human serum albumin (HSA) is a known protein found in the blood. EP-A-147 198 (Delta Biotechnology) discloses its expression in a transformed host, in this case yeast. Our earlier application EP-A-322 094 discloses N-terminal fragments of HSA, namely those consisting of residues 1-n where n is 369 to 419, which have therapeutic utility. The application also mentions the possibility of fusing the C-terminal residue of such molecules to other, unnamed, polypeptides.

One aspect of the present invention provides a fusion polypeptide comprising, as at least part of the N-terminal portion thereof, an N-terminal portion of HSA or a variant thereof and, as at least part of the C-terminal portion thereof, another polypeptide except that, when the said Nterminal portion of HSA is the 1-n portion where n is 369 to 419 or a variant thereof then the said polypeptide is (a) the 585 to 1578 portion of human fibronectin or a variant thereof, (b) the 1 to 368 portion of CD4 or a variant thereof, (c) platelet derived growth factor, or a variant thereof, (d) transforming growth factor, or a variant thereof, (e) the 1-261 portion of mature human plasma fibronectin or a variant thereof, (f) the 278-578 portion of mature human plasma fibronectin or a variant thereof, (g) the 1-272 portion of mature human von Willebrand's Factor or a variant thereof, or (h) alpha-1-antitrypsin or a variant thereof.

The M-terminal portion of HSA is preferably the said 1-n portion, the 1-177 portion (up to and including the cysteine), the 1-200 portion (up to but excluding the cysteine) or a portion intermediate 1-177 and 1-200.

The term human serum albumin (HSA) is intended to include (but not necessarily to be restricted to) known or yet-to-be-discovered polymorphic forms of HSA. For example, albumin Naskapi has Lys-372 in place of Glu-372 and pro-albumin Christchurch has an altered pro-sequence. The term variants is intended to include (but not necessarily to be restricted to) minor artificial variations in sequence (such as molecules lacking one or a few residues, having conservative substitutions or minor insertions of residues, or having minor variations of amino acid structure). Thus polypeptides which have 80%, preferably 85%, 90%, 95% or 99%, homology with HSA are deemed to be variants. It is also preferred for such variants to be physiologically equivalent to HSA; that is to say, variants preferably share at least one pharmacological utility with HSA. Furthermore, any putative variant which is to be used pharmacologically should be non-immunogenic in the animal (especially human) being treated.

Conservative substitutions are those where one or more amino acids are substituted for others having similar properties such that one skilled in the art of polypeptide chemistry would expect at least the secondary structure, and preferably the tertiary structure, of the polypeptide to be substantially unchanged. For example, typical such substitutions include asparagine for glutamine, serine for asparagine and arginine for lysine. Variants may alternatively, or as well, lack up to ten (preferably only one or two) intermediate amino acid residues (ie not at the termini of the said N-terminal portion of HSA) in comparison with the corresponding portion of natural HSA; preferably any such omissions occur in the 100 to 359 portion of the molecule (relative to mature HSA itself) (if present). Similarly, up to ten, but preferably only q one or two, amino acids may be added, again in the 100 to 369 portion for preference (if present). The term physiologically functional equivalents also encompasses larger molecules comprising the said sequence plus a further sequence at the N-terminal (for example, pro-HSA, pre-pro-HSA and met-HSA).

Clearly, the said another polypeptide in the fusion compounds of the invention cannot be the remaining portion of HSA, since otherwise the whole polypeptide would be HSA, which would not then be a fusion polypeptide.

Even when the HSA-like portion is not the said 1-n portion of HSA, it is preferred for the non-HSA portion to be one of the said (a) to (h) entities.

The 1 to 368 portion of CD4 represents the first four disulphide-linked immunoglobulin-like domains of the human T lymphocyte CD4 protein, the gene for and amino acid sequence of which are disclosed in D. Smith et al (1987 ) Science 328, 1704-1707. it is used to combat HIV infections.

The sequence of human platelet-derived growth factor (PDGF) is described in Collins et al (1985) Nature 316, 748-750. Similarly, the sequence of transforming growth factors β (TGF-β) is described in Derynck et al (1985) Nature 316, 701-705. These growth factors are useful for wound-healing.

A cDNA sequence for the 1-261 portion of Fn was disclosed in EP-A-207 751 (obtained from plasmid pFH6 with endonuclease PyuII). This portion binds fibrin and can be used to direct fused compounds to blood clots.

A cDNA sequence for the 278-578 portion of Fn, which contains a collagen-binding domain, was disclosed by R.J.

Owens and F.E. Baralle in 1986 E.M.3.O.J. 5, 2825-2830.

This portion will bind to platelets. δ The 1-272 portion of von Willebrand's Factor binds and stabilises factor VIII. The sequence is given in Bontham et al, Nucl. Acids Res. 14 , 7125-7127.

Variants of alpha-l-antitrypsin include those disclosed by Rosenburg et al (1984) Nature 312, 77-80. In particular, the present invention includes the Pittsburgh variant (Met35θ is mutated to Arg) and the variant where Pro^7 and Met^58 are mutated to alanine and arginine respectively. These compounds are useful in the treatment of septic shock and lung disorders.

Variants of the non-HSA portion of the polypeptides of the invention include variations as discussed above in relation to the HSA portion, including those with conservative amino acid substitutions, and also homologues from other species.

The fusion polypeptides of the invention may have Nterminal amino acids which extend beyond the portion corresponding to the N-terminal portion of HSA. For example, if the HSA-like portion corresponds to an Nterminal portion of mature HSA, then pre-, pro-, or prepro sequences may be added thereto, for example the yeast alpha-factor leader sequence. The fused leader portions of WO 90/01063 may be used. The polypeptide which is fused to the HSA portion may be a naturally-occurring polypeptide, a fragment thereof or a novel polypeptide, including a fusion polypeptide. For example, in Example 3 below, a fragment of fibronectin is fused to the HSA portion via a 4 amino acid linker.

It has been found that the amino terminal portion of the HSA molecule is so structured as to favour particularly efficient translocation and export of the fusion compounds of the invention in eukaryotic cells.

A second aspect of the invention provides a transformed host having a nucleotide sequence so arranged as to express a fusion polypeptide as described above. By so arranged, we mean, for example, that the nucleotide sequence is in correct reading frame with an appropriate RNA polymerase binding site and translation start sequence and is under the control of a suitable promoter. The promoter may be homologous with or heterologous to the host. Downstream (3') regulatory sequences may be included if desired, as is known. The host is preferably yeast (for example Saccharomyces spp., e.g. S. cerevisiae; Kluyveromyces spp., e.g. K. lactis; Pichia spp.; or Schizosaccharomyces spp., e.g. S. pombe) but may be any other suitable host such as E. coli, B. subtilis, Aspergillus spp., mammalian cells, plant cells or insect cells.

A third aspect of the invention provides a process for preparing a fusion polypeptide according to the first aspect of the invention by cultivation of a transformed host according to the second aspect of the invention, followed by separation of the fusion polypeptide in a useful form.

A fourth aspect of the invention provides therapeutic methods of treatment of the human or other animal body comprising administration of such a fusion polypeptide.

In the methods of the invention we are particularly concerned to improve the efficiency of secretion of useful therapeutic human proteins from yeast and have conceived the idea of fusing to amino-terminal portions of HSA those proteins which may ordinarily be only inefficiently secreted. One such protein is a potentially valuable wound-healing polypeptide representing amino acids 585 to 1578 of human fibronectin (referred to herein as Fn 5851578). As we have described in a separate application (filed simultaneously herewith) this molecule contains cell spreading, chemotactic and chemokinetic activities useful in healing wounds. The fusion polypeptides of the present invention wherein the C-terminal portion is Fn 585-1578 can be used for wound healing applications as biosynthesised, especially where the hybrid human protein will be topically applied. However, the portion representing amino acids 585 to 1578 of human fibronectin can if desired be recovered from the fusion protein by preceding the first amino acid of the fibronectin portion by amino acids comprising a factor X cleavage site. After isolation of the fusion protein from culture supernatant, the desired molecule is released by factor X cleavage and purified by suitable chromatography (e.g. ion-exchange chromatography). Other sites providing for enzymatic or chemical cleavage can be provided, either by appropriate juxtaposition of the N-terminal and C-terminal portions or by the insertion therebetween of an appropriate linker.

At least some of the fusion polypeptides of the invention, especially those including the said CD4 and vWF fragments, PDGF and a^AT, also have an increased half-life in the blood and therefore have advantages and therapeutic utilities themselves, namely the therapeutic utility of the non-HSA portion of the molecule. In the case of a^AT and others, the compound w.ill normally be administered as a one-off dose or only a few doses over a short period, rather than over a long period, and therefore the compounds are less likely to cause an immune response.

EXAMPLES : SUMMARY Standard recombinant DNA procedures were as described by Maniatis et al (1982 and recent 2nd -edition) unless otherwise stated. Construction and analysis of phage Ml3 recombinant clones was as described by Messing (1983) and Sanger et al (1977).

DNA sequences encoding portions of human serum albumin used in the construction of the following molecules are derived from the plasmids mH0B12 and pDBD2 (EP-A-322 094, Delta Biotechnology Ltd, relevant portions of which are reproduced below) or by synthesis of oligonucleotides equivalent to parts of this sequence. DNA sequences encoding portions of human fibronectin are derived from the plasmid pFHDELl, or by synthesis of oligonucleotides equivalent to parts of this sequence. Plasmid pFHDELl, which contains the complete human cDNA encoding plasma fibronectin, was obtained by ligation of DNA derived from plasmids pFH6, 16, 54 , 154 and 1 (EP-A-207 751; Delta Biotechnology Ltd).

This DNA represents an mRNA variant which does not contain the 'ED' sequence and had an 89-amino acid variant of the III-CS region (R.J. Owens, A.R. Kornblihtt and F.E. Baralle (1986) Oxford Surveys on Eukaryotic Genes 3 141160). The map of this vector is disclosed in Fig. 11 and the protein sequence of the mature polypeptide produced by expression of this cDNA is shown in Fig. 5.

Oligonucleotides were synthesised on an Applied Biosystems 380B oligonucleotide synthesiser according to the manufacturer's recommendations (Applied Biosystems, Warrington, Cheshire, UK).

An expression vector was constructed in which DNA encoding the HSA secretion signal and mature HSA up to and including the 387th amino acid, leucine, fused in frame to DNA encoding a segment of human fibronectin representing amino acids 585 to 1578 inclusive, was placed downstream of the hybrid promoter of EP-A-258 067 (Delta Biotechnology), which is a highly efficient galactoseinducible promoter functional in Saccharomyces cerevisiae.

The codon for the 1578th amino acid of human fibronectin was directly followed by a stop codon (TAA) and then the S. cerevisiae phosphoglycerate kinase (PGK) gene transcription terminator. This vector was then introduced into S. cerevisiae by transformation, wherein it directed the expression and secretion from the cells of a hybrid molecule representing the N-terminal 387 amino acids of HSA C-terminally fused to amino acids 585 to 1578 of human fibronectin.

In a second example a similar vector is constructed so as to enable secretion by S. cerevisiae of a hybrid molecule representing the N-terminal 195 amino acids of HSA Cterminally fused to amino acids 585 to 1578 of human fibronectin.

Aspects of the present invention will now be described by way of example and with reference to the accompanying drawings, in which: Figure 1 (on two sheets) depicts the amino acid sequence currently thought to be the most representative of natural HSA, with (boxed) the alternative C-termini of HSA(l-n); Figure 2 (on two sheets) depicts the DNA sequence coding for mature HSA, wherein the sequence included in Linker 3 is underlined; Figure 3 illustrates, diagrammatically, the construction of mH0B16; Figure 4 illustrates, diagrammatically, the construction of pHOB31; Figure 5 (on 6 sheets) illustrates the mature protein sequence encoded by the Fn plasmid pFKDELl; Figure 6 illustrates Linker 5, showing the eight constituent oligonucleotides; Figure pDBDF2; 7 shows schematically the construction of plasmid 10 Figure pDBDF5; 8 shows schematically the construction of plasmid Figure pDBDF9; 9 shows schematically the construction of plasmid Figure 10 shows schematically the construction of plasmid Figure 11 shows a map of plasmid pFHDELl.

DBDF12, using plasmid pFHDELl; and EXAMPLE 1 : HSA 1-387 FUSED TO Fn 585-1578 The following is an account of a preparation of plasmids comprising sequences encoding a portion of HSA, as is disclosed in EP-A-322 094.

The human serum albumin coding sequence used in the construction of the following molecules is derived from the plasmid M13mpl9.7 (EP-A-201 239, Delta Biotech- nology Ltd. ) or by synthesis of oligonucleotides equivalent to parts of this sequence. Oligonucleotides were synthesised using phosphoramidite chemistry on an Applied Biosystems 380B oligonucleotide synthesizer according to the manufacturer's recommendations (AB Inc., Warrington, Cheshire, England).

An oligonucleotide was synthesised (Linker A) which represented a part of the known HSA coding sequence (Figure 2) from the Pstl site (1235-1240, Figure 2) to the codon for valine 381 wherein that codon was changed from GTG to GTCs Linker 1 D P H E C Y 5' GAT CCT CAT GAA TGC TAT 3' , ACGT CTA GGA GTA 1247 CTT ACG ATA A K V F D E F K GCC AAA GTG TTC GAT GAA TTT AAA. CGG TTT CAC AAG CTA CTT AAA TTT 1267 P CTT L GTC V 3' GGA CAG 5' Linker 1 was ligated into the vector M13mpl9 (Norrander et al, 1983) which had been digested with Pstl and Hindi and the ligation mixture was used to transfect E.coli strain XLl-Blue (Stratagene Cloning Systems, San Diego, CA) . Recombinant clones were identified by their failure to evolve a blue colour on medium containing the chromogenic indicator X-gal (5-bromo-4-chloro-3-indolyl-£D-galactoside) in the present of IPTG (isopropylthio-βgalactoside). DNA sequence analysis of template DNA prepared from bacteriophage particles of recombinant clones identified a molecule with the required DNA sequence, designated mH0B12 (Figure 3).

IS Ml3mpl9.7 consists of the coding region of mature HSA in M13mpl9 (Norrander et al, 1983) such that the codon for the first site thus: amino acid of HSA, GAT, overlaps a unique Xhol Asp Ala 5' C T C G A GAT GCA 3' 3' G A G C T C T A C G T •5' Xhol (EP-A-210 239) . Ml3xnpl9. 7 was digested with Xhol and made flush-ended by SI-nuclease treatment and was then ligated with the following oligonucleotide (Linker 2): Linker 2 · rpTTTAfpCCA^GCrpTGGAfpAAAAGA 3' 3' AGAAAATAGGTTCGAACCTATTTTCT 5' Hindlll The ligation mix was then used to transfect E. coli XL1Blue and template DNA was prepared from several plaques and then analysed by DNA sequencing to identify a clone, pDBDl (Figure 3), with the correct sequence.

A 1.1 kb HindiII to Pstl fragment representing the 5' end of the HSA coding region and one half of the inserted oligonucleotide linker was isolated from pDBDl by agarose gel electrophoresis. This fragment was then ligated with double stranded mHQ3X2 previously digested with Hindlll and Pstl and the ligation mix was then used to transfect E.coli XLl-Blue. Single stranded template DNA was prepared from mature bacteriophage particles of several plaques. The DNA was made double stranded in vitro by extension from annealed sequencing primer with the Klenow fragment of DNA polymerase I in the presence of deoxynucleoside triphosphates. Restriction enzyme analysis of this DNA permitted the identification of a clone with the correct configuration, mH0B15 (Figure 3).

The following oligonucleotide (Linker 3) represents from the codon for the 382nd amino acid of mature HSA (glutamate, GAA) to the codon for lysine 389 which is followed by a stop codon (TAA) and a Hindlll site and then a BamHl cohesive end: Linker 3 EEPQNLIKJ ' GAA GAG CCT CAG ΑΛΤ TTA ATC AAA TAA GCTTG 3' 3’ CTT CTC GGA GTC TTA AAT TAG TTT ATT CGAACCTAG 5' This was ligated into double stranded mH0B15, previously digested with Hindi and BamHI. After ligation, the DNA was digested with Hindi to destroy all non-recombinant molecules and then used to transfect E.coli XLX-Blue.

Single stranded DNA was prepared from bacteriophage particles of a number of clones and subjected to DNA sequence analysis. One clone having the correct DNA sequence was designated mHOBIS (Figure 3).

A molecule in which the mature HSA coding region was fused 1q to the HSA secretion signal was created by insertion of Linker 4 into BamHI and Xhol pDBD2 (Figure 4). digested M13mpl9 Linker 4 M K w V S F 5' GATCC ATG AAG TGG GTA AGC TTT G TAG TTC ACC CAT TCG AAA I S L ATT TCC CTT L CTT TAA AGG GAA GAA F L F S TTT CTC TTT AGC AAA GAG AAA TCG s A V ft. S R G V ν’ TCG GCT Γρτ» ip TCC AGG GGT GTG TTT AGC CGA ΑΤΑ AGG TCC CCA CAC AAA R R CG 3' GCAGCT 5' In this linker the codon for the fourth amino acid after the initial methionine, ACC for threonine in the HSA prepro leader sequence (Lawn et al, 1981), has been changed to AGC for serine to create a HindiII site.

A sequence of synthetic DNA representing a part of the known HSA coding sequence (Lawn et al., 1981) (amino acids 382 to 387, Fig. 2), fused to part of the known fibronectin coding sequence (Kornblihtt et al., 1985) (amino acids 585 to 640, Fig. 2), was prepared by synthesising six oligonucleotides (Linker 5, Fig. 6). The oligonucleotides 2, 3, 4, 6, 7 and 8 were phosphorylated using T4 polynucleotide kinase and then the oligonucleotides were annealed under standard conditions in pairs, i.e. 1+8, 2+7, 3+6 and 4+5. The annealed oligonucleotides were then mixed together and ligated with mH0B12 which had previously been digested with the restriction enzymes Hindi and EcoRI. The ligation mixture was then used to transfect Ξ.coli XLl-Blue (Stratagene Cloning Systems, San Diego, CA). Single stranded template DNA was then prepared from mature bacteriophage particles derived from several independent plaques and then was analysed by DNA sequencing. A clone in which a linker of the expected sequence had been correctly inserted into the vector was designated pDBDFl (Fig. 7). This plasmid was then digested with Pstl and EcoRl and the approx. 0.24kb fragment was purified and then ligated with the 1.29kb BamHI-Pstl fragment of pDBD2 (Fig. 7) and BamHI + ScoRl digested pUC19 (Yanisch-Perron, et al. , 1985) to form pDBDF2 (Fig.. 7).

A plasmid containing a DNA. sequence encoding full length human fibronectin, pFHDELl, was digested with EcoRl and Xhol and a 0.77kb EcoRl-Xhol fragment (Fig. 8) was isolated and then ligated with EcoRl and Sail digested Ml3 mpl8 (Norrander et al., 1983) to form pDBDF3 (Fig. 8).

The following oligonucleotide linker (Linker 6) was synthesised, representing from the Pstl site at 4784-4791 of the fibronectin sequence of EP-A-207 7 51- to the codon for tyrosine 1578 (Fig. 5) which is followed by a stop codon (TAA), a Hindlll site and then a BamHI cohesive end: Linker 6 G p D Q T w M T I E G L GGT CCA GAT CAA ACA GAA m rpn A AA ACT ATT GAA GGC TTG A CGT CCA GGT CTA ^rprfi TGT CTT TAG TGA TAA 0ΦΦ CCG AAC Q P T V S Y Stop CAG ccc ACA GTG GAG TAT TAA GCTTG GTC GGG TGT CAC CTC ATA ATT CGAACCTAG This linker was then ligated with Pstl and Hindlll digested pD3DF3 to form pDBDF4 (Fig. 8). The following DNA fragments were then ligated together with Bqlll digested pKV50 (EP-A-258 067) as shown in Fig. 8: 0.68kb EcoRI-BamHl fragment of pDBDF4, 1.5kb BamHI-StuI fragment of pDBDF2 and the 2.2kb StuI-EcoRI fragment of pFHDELl. The resultant plasmid pDBDFS (Fig. 8) includes the promoter of EP-A-258 067 to direct the expression of the HSA secretion signal fused to DNA encoding amino acids 138 7 of mature HSA, in turn fused directly and in frame with DNA encoding amino acids 585-1578 of human fibronectin, after which translation would terminate at the stop codon TAA. This is then followed by the Scerevisiae PGK gene transcription terminator. The plasmid also contains sequences which permit selection and maintenance in Escherichia coli and S.cerevisiae (EP-A-258 067) .

This plasmid was introduced into S. cerevisiae S150-2B (leu2-3 leu2-112 ura3~52 trpl-289 his3- 1) by standard procedures (Beggs, 1978). Transformants were subsequently analysed and found to produce the HSA-fibronectin fusion protein.

EXAMPLE 2 : HSA 1-195 FUSED TO Fn 585-1578 In this second example the first domain of human serum albumin (amino acids 1-195) is fused to amino acids 5851578 of human fibronectin.

The plasmid pDBD2 was digested with BamHI and Bglll and the 0.79kb fragment was purified and then ligated with BamHI-digested M13mpl9 to form pDBDF6 (Fig. 9). The following oligonucleotide: '-C C A A A G CTCGAGGAACTTC G-3' was used as a mutagenic primer to create a Xhol site in pDBDF6 by in vitro mutagenesis using a kit supplied by Amersham International PLC. This site was created by changing base number 696 of HSA from a T to a G (Fig. 2). The plasmid thus formed was designated pDBDF7 (Fig. 9). The following linker was then synthesised to represent from this newly created Xhol site to the codon for lysine 195 of HSA (AAA) and then from the codon for isoleucine 585 of fibronectin to the ends of oligonucleotides 1 and 8 shown in Fig. 6.

Linker 7 D E L R D E G K A S S A K TC GAT GAA CTT CGG GAT GAA GGG AAG GCT TCG TCT GCC AAA A CTT GAA GCC CTA CTT CCC TTC CGA AGC AGA CGG TTT I T E T P S Q P N S H ATC ACT GAG ACT CCG AGT CAG C TAG TGA CTC TGA GGC TCA GTC GGG TTG AGG GTG G This linker was ligated with the annealed, oligonucleotides shown in Fig. 3, i.e. 2+7, 3+6 and 4+5 together with Xhol and EcoRI digested pDBDF7 to form pDBDF8 (Fig. 9). Note that in order to recreate the original HSA DNA sequence, and hence amino acid sequence, insertion ox linker 7 and the other oligonucleotides into pDBDF7 does not recreate the Xhol site.

The 0.83kb BamHI-Stul fragment of pD3DF8 was purified and then was ligated with the O.SSkb EcoRl-BamHI fragment of pDBDF2 and the 2.22kb StuI-EcoRI fragment of pFHDELl into i BqlII-diqestad pKVSO to form pDBDF9 (Fig. 9). This plasmid is similar to pDBDFS except that it specifies only residues 1-195 of HSA rather than 1-387 as in pD3DF5.

When introduced into S.cerevisiae S150-2B as above, the plasmid directed the expression and secretion of a hybrid molecule composed of residues 1-195 of HSA fused to residues 585-1578 of fibronectin.

EXAMPLE 3 : HSA 1-387 FUSED TO Fn 585-1578, AS CLEAVABLE MOLECULE In order to facilitate production of large amounts of residues 585-1578 of fibronectin, a construct was made in which DNA encoding residues 1-387 of HSA was separated from DNA encoding residues 585-1578 of fibronectin by the sequence I E G R ATT GAA GGT AGA TAA CTT CCA TCT which specifies the cleavage recognition site blood clotting Factor X. Consequently the secreted product can be treated with Factor X and fibronectin part of the molecule can be separated HSA part.

To do this two oligonucleotides were synthesised annealed to form Linker 8.

Linker 8 for the purified then the from the and then Ξ Ξ P Q N L I E G 10 GAA GAG CCT CAG AAT TTA ATT GAA GGT CTT CTC GGA GTC TTA AAT TAA CTT CCA R I T E T P S Q P AGA ATC ACT GAG ACT CCG AGT CAG C TCT TAG TGA CTC TGA GGC TCA GTC GGG 1 5 N S H TTG AGG GTG G This linker was then ligated with the oligonucleotides shown in Fig. 6, i.e. 2+7, 3+6 annealed and 4+5 into Hindi andEcoRI digested mH0B12, to form pDBDFlO (Fig. 10). The plasmid was then digested with Pstl and EcoRl and the roughly 0.24kb fragment was purified and then ligated with the 1.29kb BamHI-Pstl fragment of pDBD2 and BamHI and EcoRl digested pUC!9 to form pDBDFl? (Fig.

). The 1.5kb BamHI-Stul fragment of pDBDFl7 was then ligated with the O.SSkb EcoRl-BamHI fragment of pDBDF4 and the 2.22kb StuI-EcoRl fragment of pFHDELl into Bglll-digested pKVSO to form pDBDF12 (Fig. 10). This plasmid was then introduced into S.cerevisiae S150-2B. The purified secreted fusion protein was treated with Factor X to liberate the fibronectin fragment representing residues 585-1578 of the native molecule.

REFERENCES Beggs, J.D. (1978) Nature 275, 104-109 Kornblihtt et al. (1985) EMBO J. 4_, 1755-1759 Lawn, R.M. et al. (1981) Nucl. Acid. Res. 9, 6103-6114 Maniatis, T, et al. (1982) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Messing, J. (1983) Methods Enzymol. 101, 20-78 Norrander, J. et al. (1983) Gene 26, 101-106 Sanger, F. et al. (1977) Proc. Natl. Acad. Sci. USA 7 4, 5463-5467 Yanisch-Perron, C. (1985) Gene 22' 103-119

Claims

1. , A fusion polypeptide comprising, as at least part of the N-terminal portion thereof, an N-terminal portion of HSA or a variant thereof and, as at least part of

2. A fusion polypeptide according to Claim 1 additionally comprising at least one N-terminal amino acid extending beyond the portion corresponding to the N-terminal portion of HSA. 5

3. A fusion polypeptide according to Claim 1 or 2 wherein there is a cleavable region at the junction of the said N-terminal and C-terminal portions.

4. A fusion polypeptide according to any one of the preceding claims wherein the said C-terminal portion 5. 10.

5. A transformed or transfected host having a nucleotide sequence so arranged as to express a fusion polypeptide according to any one of the preceding 15 claims. 5 the C-terminal portion thereof, another polypeptide except that, when the said N-terminal portion of HSA is the 1-n portion where n is 36 9 to 419 or a variant thereof then the said polypeptide is (a) the 585 to 1578 portion of human fibronectin or a variant

6. A process for preparing a fusion polypeptide by cultivation of a host according to Claim 5, followed by separation of the fusion polypeptide in a useful form.

7. A fusion polypeptide according to any one of Claims 1 to 4 for use in therapy.

8.

9.

10. Is the 585 to 1578 portion of human plasma fibronectin or a variant thereof. 10 thereof, (b) the 1 to 368 portion of CD4 or a variant thereof, (c) platelet derived growth factor or a variant thereof, (d) transforming growth factor β or a variant thereof, (e) the 1-261 portion of mature human plasma fibronectin or a variant thereof, (f) 15 the 278-578 portion of mature human plasma fibronectin or a variant thereof, (g) the 1-27 2 portion of mature human von Willebrand's Factor or a variant thereof, or (h) alpha-1-antitrypsin or a variant thereof.

11. A fusion polypeptide according to Claim 1, substantially as hereinbefore described and exemplified. A transformed or transfected host according to Claim 5, substantially as hereinbefore described and exemplified. A process for preparing a fusion polypeptide according to Claim 1, substantially as hereinbefore described and exemplified . A fusion polypeptide according to Claim 1, whenever prepared by a process claimed in a preceding claim.