HU229195B1 - Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2 - Google Patents

Description

The present invention relates to methods and compositions for preventing and treating the pathological consequences of PCV-2 induced myocarditis, abortion and intrauterine infection and post-weaning multisystemic wasting syndrome; and processes for preparing the compositions of the invention, and kits for preparing the compositions of the invention and carrying out the methods of the invention.

data

Serialization Prevention of Infections with Eirkovfons-3

FIELD OF THE INVENTION The present invention relates to DNA plasma plasmids and / or compositions for reducing viral load in porcine bronchi and intestine. Porcine origin ctrkovíra.s-2-ί (PCV-2) has recently been identified as an agent that has been consistently associated with porcine poplar disease, separation nanyi, tinnitus stools syndrome (PMWS) and Alisa 1998; mtsai. 1998). PCV-2 lime juice from infected pigs is genetically virtually identical and is well n-differentiated from PCV (CCL33, PCV-1), originally identified as a non-cytopathic contaminant in pigs (PK / 15). ) in renal cells (Meeham et al., $ 199; Ttscher et al., 1974). Naturally acquired or experimentally induced PCV-2 infection in pigs is characterized by advanced clinical weight loss, rapid breathing, respiratory distress and jaundice (Alias et al., $ 199; Allan et al., 1999; Ellis et al., 1998; Ellis et al., , 1999). Pathologic features that are directly associated with PCV-2 asphagene include free-eye, pathologic features include lymphadeuopathy, intestinal penumonta, hepatitis, and nephritis (Alilart et al., 1998; Allan et al., 1999; Ellis et al., 1998; , 1999). See also WO-A-99 / 1E21.4, WO-A, -00 / 81409, WO-A-99 / 297I7. and WO-A-99/29871 ... PCV-2 has not yet been linked directly to abortion or lesions in pregnant pigs.

So, so far, it has not been thrown to the PCV-2. causes tniocarditis and / or abortion and / or intrauterine infection.

Surprisingly, you have found that PCV-2 is a circulating agent for myocardial necrosis and / or abortion and / or intrauterine infection, and weaning is another, multisystemic atrophy! syndrome.

According to DoSnfo, PCV-2 immunoglobulin refers to live, attenuated or inactive PCV ~ 2, or subunit (s) of PCV-2, obtained in vivo by expression or expression, or at least one fragment containing the epitope of interest ( fragments), either by chemical synthesis or by recombinant expression of vttro, or the carrier (s) or epitope of the PCV-2 genome or carrier described herein or as described in the publications cited or incorporated herein by reference. ) containing and capable of expressing recombinant vectors.

A similar definition applies to other porcine pathogens of the immunnog: en.re.

By definition, an immunogenic composition is capable of eliciting a local or systemic immune response. The vaccine preparation has elicited a local or systemic protective response}. . The term "immunogenic composition" means "vaccine preparation" (as the first term may mean a protective composition),

According to a first aspect of the invention there is provided a first UNS plaque vector comprising at least 95% identical to the ORJPTS, porcine bronchi, and intestinal bulb of the ImplO1o strain PCV-2. PCV-2 for use in reducing viral load.

According to a second aspect of the invention there is provided an immunogenic composition for use in reducing porcine bronchial and pancreatic PCV-2 viral load, wherein the composition comprises the following;

a) a first DNA plasmid vector comprising a first nucleotide sequence comprising at least

It is 95% identical to the expressing signal of the viral strain PCV -2, and

Our file number is 96428-14192 / PA

5) a pharmaceutical composition which is a pharmaceutically acceptable carrier and / or vector and / or an essence and / or adjuvant.

According to a third aspect of the invention, the invention is directed to .xexapone

(a) a first DNA plasmid vector comprising a nucleic acid sequence of at least 95% identical to the ÖVRFBs of PCV-2 mAb in the λmpl and

h) pharmaceutically or pseudoprotein: the use of an acceptable carrier and / or vector and / or © sapiens and / or adjuvant in the preparation of a ferrogen formulation for use in reducing porcine bronchial and intestinal flora.

According to a fourth aspect of the invention there is provided a first DNA plasmid vector which contains a first nucleotide sequence containing at least 95% aztrnos with ÖRF13 of the strain PCV-2 lm.pl and: a second DNA plaque vector comprising a second nucleotide * sequence that is at least 95% identical to -ORF4-strain PCV-2 strain ImplO10 for use in reducing porcine viral load in PCV-2.

According to a fifth aspect of the invention there is provided an immuno-immunogenic composition for use in the viral load reduction of PCV-2 in porcine bronchi and pancreas, wherein the composition comprises:

a.) a first DNA plasmid vector comprising a first nucleotide sequence which is at least 95% identical to the ORf I3 of PCV-2 strain ImplO10;

b) a second DNA plasmid microarray comprising a second nucleotide sequence comprising at least 95% bn of the same number ImplOl6 strain PCV-2, ΔRF4 ~, and

«) Is a pharmaceutically acceptable or veterinarian acceptable carrier and / or vector and / or excipient and / or sdjravant

According to a sixth aspect of the invention there is provided

a) a first DNA plasmid vector comprising a first nucleotide sequence which is at least 9574 identical to the ORF13 of the strain Impl.ÖK1 in PCV-2,

b) a second DNA plasmid vector comprising a second .necleotide sequence which is at least 9574 identical to the ORP4 of PCV-2 strain hnp t Olo, and

c) the use of a pharmaceutically or veterinarily acceptable carrier and / or vector and / or exipient and / or adjuvant for the preparation of an immunogeric composition for use in reducing porcine bronchial and pulmonary artery viral load.

According to a seventh aspect of the invention there is provided a first platinum for use in a first aspect of the invention; an immunostaining composition for use in a second aspect of the invention; use of the first plasmid in a third aspect of the invention; the first and second plasmids for use in a fourth aspect of the invention; a phannnogen composition for use in a fifth aspect of the invention; or the use of the first and second plasmids according to a sixth aspect of the invention;

wherein the first nkleolide sequence is identical to the sequence of the ORFld of the Implole strain.

According to an eighth aspect of the invention, there is provided a first and a second plasmid for use according to a fourth or seventh aspect of the invention; an immunogenic composition for use according to a fifth or seventh aspect of the invention; or the first and the second. use of a plasmid according to a sixth or seventh aspect of the invention;

wherein the second makieodd sequence is identical to the sequence 0RF4 of the Implo110 strain.

Thus, in the development of the present invention, it is an object of the present invention to provide methods and / or formulations for PCV-2-induced myocarditis and / or abortion and / or uterine infection, as well as dissection-related, atrial atrophy. preventing and / or treating the syndrome and / or its pathological consequences; and the development of methods for formulating such formulations (which may also contain porcine parvovirus hundreds of PPYs as immunogens) and the use of PCV-2-thymogen to formulate such formulations.

A. Another object of the present invention is to use ECV-z immunogens for the preparation of compositions for the prevention and / or treatment of myocarditis and / or abortion and / or intrauterine infection,

Another object of the present invention is the isolation and characterization of novel 1103- (1103/1 P.2) and 1121 (1121/1 Pi) strains of PCV, and applications for the production of immunogens and antigens and antibodies for diagnostic purposes, PCV. of myocarditis and / or abortion and / or intrauterine infection, and post-weaning NMTS in connection with the syndrome and / or its pathological consequences.

The present invention relates to the inoculation of female pigs (e.g. sows, sows) with (at least one) PCV-2 immunoprecipitated composition (which composition may also contain porcine parvovirus derived immunogen); and / or before delivery and / or delivery (or during pregnancy; and / or before or after birth; and / or Repeatedly during life, PCV-vd associated, myocarditis and / or abortion and / or intrauterine infection, and post-weaning, multisystemic wasting syndrome, and preventing other pathological consequences associated with PCV-2, or eliciting an immunogenic or protective response to PCV-2, and thereby, post-weaning, coronary heart disease, and / or cystitis. 2 associated with the prevention of myocarditis and / or abortion and / or intrauterine infection and / or PCV-2've associated with other pathological sequelae.

Preferably at least one vaccine is administered prior to exhalation. Preferably, this is followed by another vaccination during delivery, for example around the middle of the delivery time (about 1 to 5 weeks gestation) and / or at the end of the delivery time (about 11 to 13 weeks gestation). Thus, according to the preferred order of the invention, they are fed. Then, a second vaccination may be given prior to each calving and / or during the delivery period, from the middle of the delivery time (at the ring of 6-8 weeks gestation) and / or at the end of the delivery period (approx. 11-13 weeks gestation edge), Preferably, the re-grafting is carried out only during the withdrawal period,

In another preferred embodiment of the invention, piglets, such as pigs from vaccinated females (e.g., vaccinated as discussed herein), are vaccinated during the first weeks of life, e.g., first and / or second and / or third and / or fourth and / or fifth week. More preferably, piglets are inoculated at first week or at three weeks of age (for example, at weaning). Moreover, more preferably, such pigs then receive two (2) and (4) four-weekly booster doses (after the first vaccination) φφ

Thus, atode piglets and female pigs (e.g., teas, "mse piglets") can be inhaled with the compositions of the invention and / or subjected to the methods of the invention.

Thus, the present invention relates to Inununogen or vaccine formulations containing Immunogens derived from 1 / 3β, I121-isid PCV strains, associated with porcine circovirus-2, msocarditis and / or vaginal abortion, and / or endometrial infection, syndrome, and other pathologies associated with PCV-2! consequences and / or treatment.

Further, the present invention relates to the use of PCV-hmmmogeo with porcine drcoviras-2 in asexal, mococarditis and / or abortion and / or intrauterine infection and post-weaning MSD. syndrome, and for the prevention and / or treatment of other pathological sequela associated with PCV < 2 > mmsmogenic or vaccinia.

Furthermore, the present invention also provides PCV-2-induced myocardial and / or abortion and / or intra-uterine systemic atrophy following myocardial infarction and / or abortion. for the prevention and / or treatment of a syndrome comprising a pharmaceutically or ophthalmologically acceptable carrier and / or carrier and / or excipient and / or an adjuvant and a PCV-2 immunogen.

The composition may further comprise at least pafogénből another sertéseredelu agents may porcine reproductive and respiratory syndrome (PKRS) virus, Afvcoptema ted '/ íesmon / ífehől, dcrtnoóoer / fos j ^ e' r <^ «g« w: cmá3éb6l ₅ £. from you, Aor / te / fe fomnehhepZíca, Pasteureíte wa / mete, Agxfjmfo / bm rtefopmhfo, Pseodorahies, swine cholera, serum influenza and porcine parvovlras. Thus, vector-based formulations may comprise at least one additional immunogen derived from porcine-derived paugene, e.g., a vector capable of expressing a sequence derived from this psagoge, wherein the vector may be a vector expressing an FCV-2 immunogen, expressing PCV2-s2I. a vector capable of containing a PCV-2 sequence or fragment; , and processes for producing any or all of the above,

The vector may comprise DNA vector pseudodidia, bacteria such as E, eo / d, virus such as baoleovirus, herpes virus, e.g. virus, avian influenza virus, canarypox virus, raccoon pox virus, and swine fever virus and the like, - The vector-based compositions may comprise a vector identified from FCV-2, preferably from any PCV-2 strain as described herein, and, in particular, ORF1-ORF3 from strain 11G3 of strain 1121 contains and is capable of expressing any of the ORF, such as OR.F4, GS.F7, OKFTS, and ORF1a; preferably, ORF4 and / or ŐRT 13 can be recombinantly produced with the immunogel (PCV-2-ß and / or porcine-edible pathogen) present in the formulations,

As used herein, plasmid refers to any DNA transcription unit in the form of a polynucleotide sequence comprising the PCV aze sequences to be expressed. Preferably, the plasmid contains elements necessary for expression; like oh? carrier, the circular plasmid form is preferred, either in the form of a snail chain or otherwise; linear fern is also within the scope of the invention,

The plasmid immunogen or plasmid vacuole delay may be administered by machine gun, Into the adjunct to the probe without subcutaneous injection, subcutaneously or intrathecally, or by other mucosal or vice versa, which allows a highly immunogenic response.

It will be appreciated that the expression product produced with the vectors or staining enzymes of the present invention can also be isolated and / or purified from infected or transfected cells; for example, for the preparation of pigs for administration; however, it may be advantageous not to isolate and / or sterilize the expression product from the cell among certain hymenopteries; for example, if the cell or part thereof is capable of enhancing the immunogenic activity of the poHpeptide. Techniques for Protein Assay and / or Isolation are known and can be used according to the invention for purification and / or isolation of PCV-2 and / or other products and / or subunits thereof derived from porcine pathogens, recombinant or vector without undue experimentation; Techniques may generally include: precipitation utilizing the advantage of the co-solubility of the protein of interest at various salt concentrations, precipitation with organic solvents, polymers and other materials, lithium-sulfur precipitation and selective denaturation: or fcronxsiogrsfsa using toner; immunoprecipitation, gel slit, electroelectric & mers, ultraviolet and isoelectric focusing and combinations thereof, among others.

The invention further relates to methods for serum-derived elecovirus-2 (PCV-2), myocarditis and / or abortion and / or intrauterine infections and / or weaning, tetanus atrophy. for the prevention and / or treatment of syndrome and / or RCV-2-vd associated with other pathological sequences in which an irrammogenic or protective response is induced by inducing PCV-2. opposed to porcine, wherein said administration to the porcine is of the above-mentioned composition of the invention.

Thus, the present invention relates to a method for treating multisystemic atrial syndrome and / or PCV-2 associated with porcine circovirus-2 (PCV-2) following myocarditis and / or abortion and / or intrauterine infection and / or weaning. for the prevention and / or treatment of a consequence of inducing an immune response or a pro-active response to PCV-2 in a pig comprising administering to the pig a pharmaceutically acceptable or a pharmaceutically acceptable carrier and / or excipient and / or adjuvant. imsumogést; The method may serve to prevent PCV-2-induced myocarditis and / or abortion and / or intrauterine infection by administering a pharmaceutical or a pharmaceutically acceptable carrier and a composition comprising PCV-2m immunogen. PCV-2 Maramogen may be attenuated, live, whole PCV-2 or deactivated PCV-2. The method may use a composition further comprising at least one immunogen derived from at least one additional gene for expression, for example, a vector capable of expressing such an immunogen or epitope; the at least one additional porcine pathogen can be derived, for example, from RRKS virus, AA-wg / maun /gOn.tteKmoozbio,. eo / foals, Pseudorabies, porcine cholera pathogen, Sonfeelleo venereal disease, .piriteavd / o typhoid, £ ysw & .ötrtx rw / ogr-tt / rte, or porcine pertussis pathogen. The method may use a vector which is a DNA vector plasmid, bacteria such as E. ceM, virus such as baculovirus, herpesvirus including Aujoszky's disease virus, adenovirus including swine saenovirusf, hbnvírvirsí, including poxvirus, avian influenza virus, cana *

rihhnlS-'Vhost or chickenpox virus and the like. The method® may include a vector-based composition comprising at least one sequence, fragment or epitope derived from an additional serine-derived pathogen, or a vector expressing such a sequence, n'aggregate or epitope, wherein the vector may be from <RTI ID = 0.0> PCV-2. vector, which expresses a sequence, fragment or epitope from. The process may use a vector as shown in Figures 1-13. One of the ORFs, for example one of the ORFs 4, 10 and 13; preferably in FIG.

and / or 13 with ORF and is capable of expressing it. The method is an immobilizer-based immunoblot, which incorporates a recombinant of one or more immune genes. In this process, sows and / or piglets are preferably vaccinated as described above.

In another preferred embodiment, the present invention provides a process for the preparation of any of the foregoing or compositions of the invention comprising admixing a pharmaceutically or a pharmaceutically acceptable carrier and a gifted adjuvant, PCV-2 immunization. The method further comprises transfecting or infecting a cell or host with a recombinant vector containing DNA encoding FCV-2-olumogene and expressing the hmnanogen; and optionally purifying and / or isolating the xxnunogen from the cell. Similarly, in the process, the PCV'-2 immunogen may be isolated and purified from FCV-2, or PCV-2 may be isolated from a sample.

The present invention provides a reagent kit for the preparation of any of the aforementioned or inventive compositions, or for carrying out any of the aforementioned or inventive processes, which is a pharmaceutically acceptable carrier or vehicle or excipient in a first container and a PCV container in a second container. It contains an active ingredient containing 2-smanoge, wherein the first and second vessels are packaged together and the reagent kit optionally contains instructions for mixing the ingredients of the composition and / or administering the composition.

In another preferred embodiment, the present invention provides a method of administering any of the above-mentioned or described compositions to male and / or female pigs; Prevention of FCV-2 transmission and treatment of myocarditis and / or abortion and / or intra-uterine infection associated with swine fever thrombosis and / or post-weaning multisystemic wasting syndrome and / or PCV-2 or overcoming it. The administration is preferably carried out as described above.

In the description of A, the term "comprising" may have the meaning "including" or it may be. US “liberty” is generally defined in the US Liberty Law. ("Cnraprising") has the same meaning.

Other aspects of the present invention (which are also within the scope of the claimed olfix) will become apparent from the following description or description thereof.

Porcine origin has been associated with post-weaning cfrfeovlnts-2 (FCV-2) in osteoporosis, with systemic atrophy syndrome (FMWS). As shown in Examples 1 and 2, the potential spectrum of PCV-2-associated disease is broadened by the vertical uptake and? associated reproductive damage.

The l. EXAMPLE 1 specifically describes the isolation of PCV-2 from a group of aboriginal piglets from a farm experiencing late abortions and stillbirths. Severe diffuse myocarditis was present in one of the pigs, which was associated with intensive immunohistochemical staining for PCV-2. Variable amounts of P € V ~ 2 -anigen were present in several fetuses in the liver, lungs and kidneys. No other agent could be detected in pigs associated with fetal lesions and abortion, such as seropositive:

Porcine Reproductive Respiratory Syndrome Controversial Encephalomiocarditis Virus and eaterovka

In Example 2, "coacrate" is shown to yield, within four years, a test of 39 abnormal abortions or reproductive lesions from well-cultured cultures tested positive for PCV-2 in two specimens that were have been associated with birth-deficient piglets and non-viable newborn piglets with severe diffusions: myocardial effusions, cardiac hypertrophy, and manifest chronic passive haemophilia. The two positive msitts were from the same farm but the sampling time was different. The presence of PCV-2 in rabbit heart pigs and other tissues confirmed by rmmunohistochemistry and isolation of pigs with the above mentioned lesions. and further, it is assumed that sexual as well as vertical transmission is responsible for the spread of the virus in the swine population.

Accordingly, vaccination of pigs, such as female pigs, such as sows or sows, with at least one of the PCV-2 immunogens (e.g., derived from at least one of: 1'mplO5S, ImplO10, imp999, ImpI1 I-4 & 2S5, λmp911). -48121, 1103, and 1121) (which composition may also comprise at least one immunoglobulin from at least one other porcine pathogen, such as at least one porcine psoriasis, where the vector may co-express both PCV-2 immunogens if a vector is used). , and may contain at least one immunogen derived from a porcine pathogen, such as, inter alia, PPV-mmumogen), in particular according to the immunization regimen described above, capable of PCV-2-associated myocarditis and / or abortion and / or intrauterine infection. , and post-weaning mtritis systemic wasting syndrome and PCV. 2-ascium, for the prevention of other pathological consequences.

Thus, the present invention relates to methods for the use of PCV-S-lummusogenous compositions of porcine myocarditis and / or abortion and / or abdominal infections associated with porcine ephemeral fevers-2 and post-weaning multisystemic wasting syndrome and / or ECV. Prevention of pathological sequelae, In particular, methods and compositions of the tmmunogen derived from strain 1103 and / or 1121 using the appropriate FCV-2 immunogen for the prevention of porcine tuberculosis and / or abortion and / or intrauterine infection associated with porcine eirkovhüS-2,

The present invention relates to the use of any known ECV-2 lyme or tmmunogen ® derived from or derived from PCV-2 associated tniofcaritis and / or abortion and / or intrauterine infection and post-weaning multisystemic atrophy syndrome and / or PCV-2. immunogenic or 'vaccine &lt; / RTI &gt; formulations for the prevention or treatment of other pathological sequelae associated with (such as Implol, Implol, b®p999, ImplOl 1-48285, ImplOU-48121, 1103 or' 1121), in particular, piglets, such as vaccines for female piglets, and more particularly, intended to be administered to female pigs, particularly pregnant sows, or sows that are pre-weaning; and rather according to the vaccination plan defined above.

More specifically, the use relates to the formulation of such compositions that are associated with PCV-2 in myocardial and / or abortion and / or intrauterine infection, and post-weaning multisystemic atrophy syndrome and / or vaginitis. PCV-2 is intended for the prevention or prophylaxis of other pathological sequelae associated with PCV-2, particularly since the preparation is intended for administration to piglets, such as vaccinated female piglets, and more particularly to female pigs, particularly pregnant sows or such sows. which. before the Hague; and even more according to the vaccination plan defined above.

The at least one immunomodulatory agent from said at least one other porcine pathogen may be those used in known vaccines or immunogenic formulations for use in pigs or as described in WO-98/03658.

The compositions of the invention may be prepared according to standard techniques well known to those skilled in the art of veterinary medicine and pharmacy. Such formulations may be administered in dosages in accordance with techniques well known to those skilled in the art of veterinary medicine, taking into account such factors as the age, sex, weight, head, and condition of the pig and the particular treatment employed and the route of administration. The formulations may be administered individually or may be administered simultaneously or sequentially with other formulations of the invention (e.g., other formulations containing PC V-syndrome). Thus, the invention also relates to mnkivaless or "cocktail" or combination preparations and methods for using them. In this regard, reference is made to 5,843,456; No. CSA, which is considered to be part of the ccitantant, which relates to anti-rabies and combination preparations and applications thereof,

The compositions of the invention may be used for parenteral or mucosal administration, preferably by hiiradermal or intranasal administration. intradermal administration, particularly by injection: may be carried out using a pond without milk. When mucosal administration is used, it may be oral, nasal or ocular.

in such compositions, the immunogen (s) may be admixed with a suitable carrier, diluent excipient such as sterile water, physiological sodium chloride, glucose and the like, and / or preferably. adjövártsssl. The compositions may also be lyophilized or frozen. The formulations may contain excipients, such as pH-modifying agents, adjuvants, preservatives, polymeric excipients for mucosal administration, and the like, depending on the route of administration and the composition desired.

In standard manuals, for example! EEWHGTONE PHARMACEVTICAL SCIENCE, 17th Edition (1985) suggests that suitable formulations may be prepared without undue experimentation. Suitable dosages may also be prepared as described below and as described in the cited publications.

Adjuvants are substances that can enhance the response to immunogens. Adjuvants may be, for example, alamininmol hydroside and ahunmylphosphine, sapomins such as Qoyl-A, water-in-water emulsion, oil-in-water emulsion, vfz-oilbm-vfebeo emulsion. Ethnosis can be based on extremely light, liquid paraffin oil (European Pharmaeopea type); isoprenol oil, such as squalene or squalene; they are oils obtained from oil oligomeric force, in particular salt butane or dock; esters of acids or alcohols containing a linear alkyl group, in particular vegetable oils, ethyl oleate, pKg &gt; glycol diacid (caprylateAapral), glyceryl trifapraprate / caprate) or propylene glycol diateate; esters of branched chain fatty acids or alcohols, in particular esters of isostearic acid. The oil is used in combination with emulsifiers to form an essence. The emulsifiers are preferably non-ionic semi-inactive substances, in particular sorbitan, mausld (e.g. in their case they may be ethoxylated and polyoxypmpylene-polyoxyoxyethylene copolymer blocks, in particular. See Hunter et al., "The Theory and Principal Application of Adjuvants" (eds., Stetvart-Tuli, DES), John Wifey and Sons, NY, 51-94 (1995) and Todd et al., Vaccine, 15, 564-570 (1995). 1997),

Λ * · * »♦ * * *

Φ Φ * · * *

Φφ ♦ «X *

ΦΦΦ

For example, you can use SET emulsion, described on page 147 in the eus book "Vaccine Design, The Subank and Adj avast Approach" (ed. M, Bovveil et al., Newtek Elenam Press, 1995), or use MF59 snmhdo, «Ivet is prayed in the same book on page 183.

Adjuvant ttatatete exemplifies a vaccine; a set of the following can be prepared: The 67 volumes of the aqueous phase containing hmmmogen are eluted with 2.3% (w / v) 11 IU (ethylene oxide) · -ethoxylated oleic acid and 28.1% (w / v) of paraffin oil (Eis-opesm Pharmaeopes) type) with the aid of an enzymatic judithoatixer;

An alternative method of emulsion preparation is to emulsify by pressurization on a high pressure bomogenizer 5% w / v, 2.5% w / w Plaronic® L121, 0.2% w / v oleic acid ester and 20EO ethoxylated alpha 92 3% by volume. an aqueous phase containing a mixture of temwnogen.

They can also be formulated with synthetic polymers (e.g., homo- and copolymers of lactic and glycolic acids, which can be used to produce microparticles that encapsulate the immeumogenes in capsules, see Elridge et al., 1993, Moh teanano 28: 287-294). ], cytokines such as ΙΕ-2 and IL-12 (see, for example, U.S. Pat. No. 5,334,379) and GMCSF, preferably porcine GMCSF (e) [celluloglycolic coli-stimulating factor grasulodts; see generally »in § 4,999,291. and U. S. Patent Nos. 5,401,663; see also Clark et al., Science 236: 1229 (1987); Grant et al. (1992) Drugs 53, 516]. Certain flavourants may be carried by expression with so-called immunogens and / or epitope (s); for example, cellulite, GMCSF (see, for example, Temaru and T & Csmats, Immunol. Target Biol. 73: 474-76 (1995), which relates to plasmids capable of encoding and expressing GM-CSF in porcine edema).

Further adjuvants include, for example, one of the following; polymers of acrylic or methacrylic acid and maleins & vashidddbö! and copolymers of alkene derivatives. Preferred adjuvant components are polytegies of acrylic or methacrylic acid, which are cross-linked, especially with the polyalkyl ether of sugars or p-alcohols. These compounds are also known as "carbomef" (Pharmeuropa Vol. 8, No. 2, June 1996). Report the number of specialist to reference 2,909,462. U.S. Pat. No. 4,123,125, wherein such acrylic softeners are cross-linked with a polysodoxylated compound having at least 3, preferably less than S, hydroxyl groups and substituted with at least 2 unsaturated aliphatic genes with hydroxyl hydrogens. Preferred radicals are those containing from 2 to 4 carbon atoms, such as νίηίΐ, allyl, and other ethenically depleted saturated radicals. The saturated radicals may themselves contain other substituents, such as methyl. The products sold under the name CatbopoW (BF Goodrich, Ohio, USA) are special. These are cross-linked with allyl saaateose or allyl pentaerythritol. Examples include Carhopol® 974P, 934P and 971P-1. Among the copolymers consisting of maleate acid and an alenylene derivative, EMA® (Monsanto) copolymers, which are co-copolymers of maleic acid anhydride and ethylene, are preferred. or cross-linked, e.g., divinyl ethers are cross-linked. For reference, see J. Fíelds et al. Natura 186,778-786 (1966),

Starting from their structure, polymers of acrylic or methacrylic acid and EMA® copolymers are preferably composed of the following basic units of the formula;

Κϊ φ * * ♦ φ * * φ φ ** φ * «* φ φ * #»

Ltd.

rj

C - (CH?

COOH

3 wherein R and K _{2 are the} same or different and are hydrogen or phenyl; x ~ 0 or i, preferably x - 1; y = 1 or 2, where x + y ~ 2.

EMA® copolymers χ - Θ and y-2. For carbon veins x ·· = * y - ’1.

The solubility of these polymers in water leads to an acidic solution which is neutralized, preferably at physiological pH, to form an adjuvant solution to which the actual vaccine is added. The carixml groups of the polymer are then partially contained in CGO-tata.

The adjuvant solution of the invention is prepared, particularly in the case of carbonic acid, preferably in distilled water, preferably in the presence of sodium chloride, to give an acidic solution. This stock solution is diluted by adding it to water or a substantial portion thereof, preferably physiological sodium chloride solution ($ g / l bCl), in one or several portions, simultaneously or in several portions simultaneously or thereafter neutralized (to pH 7.3-7.4), preferably with NaOH. This solution is at physiological pH η. applied by mixing with vocoit, which can be stored in foieg Uoftlizai, in liquid or frozen form

In the final vaccine kit, the polymer concentration is between 0.01% and 2% w / v, e.g. 0.06 to 1% w / v: contains iron, such as 0.1% to 0.6% w / v.

If desired, the person skilled in the art will be able to select the appropriate adjuvant and the amount thereof to be used in the immunological, hmmmogeo or vaccine composition of the present invention without undue experimentation.

Immunization or vaccine preparations according to the invention. they may be associated with at least one live attenuated, deactivated or subunit vaccine, or recombinant vaccine (e.g., as a vector or a DNA plasmid) capable of expressing at least one other porcine pathogen derived hormone gene or epitope of interest.

It is a further object of the present invention to provide formulations suitable for various methods of administration. Again, the effective dosage and mode of administration will be determined by factors such as age, sex, weight and tendency, known and not known. Needs unnecessary experimentation. Dosages of each active ingredient may be as high as those described in the cited publications and / or one or several hundred in the form of mono-immunogen or blind formulation. or in the range of 1000 gg, e.g. 1 µg to 1 mg-1 g; and inactivated (before liters inactivation) imatunogón or vakeinakeszttoésyhen IO ^': and shoot' between ^the TCID _5o, preferably IO * and ld ^and may range TCIDjo, EIO attenuated unntuöogén or v & keinakészitotényhen be between dose IIK and 10 * TCIDjo preferably shoot ' and Blue TCiD®.

- II ♦ φ «φφ X: ..% ΦΦΦ;

* * ΧΦ φ φ φφ φ φφ

Recombinant proteins or vectors may be administered in sufficient amounts to provide m vmo expression corresponding to the doses disclosed herein in the parent or cited publications. For example, in the case of viral suspensions, a suitable range can be determined empirically. The viral vector or recombinant of the invention may be injected into a pig or may be injected or traumatized into cells in an amount of at least 10 'pfu; preferably about lÖ * PFU and an amount of about 10 ^s "pfu Example approximately 10> pfu to about I0 ⁹ PFE include an amount, for example about 10 ^ft amounts, per dose, e.g., about 2 milliliters between PFE and körtllbelól one PIU. And if. more than one gene gene is expressed by more than one recombinant each of the recorubinants is administered in the same amount: or each recombinant can be administered as they are, cachexia and the total amount of the recombinants present.

Dosages used in the plasmid delays of the present invention may be those described and / or described herein. you quote: they were published in bulletins. For example, in plasmid preparations, the amount of each plasmid DNA from 1 µg to 2 µg, preferably from 50 µg to 1 mg, for DNA plasmid vectors can be read by one of ordinary skill in the art to determine other doses of the DNA plasmid. for use in the compositions of the invention without undue experimentation.

However, the dose of the compound (s), the concentration of the components therein, and the timing of administration of the composition (s) (which can induce an adequate amount of body fat) can be determined by a variety of methods, mini examples! evaluating the antibody in the serum, for example, by ELISA and / or using a seroneutralization assay and / or vaccination in pigs using an infection. No unnecessary experimentation is required to determine the dose, and can be made by the skilled artisan and the literature cited therein. The timing of successive administrations can be determined similarly using the description and procedures known to those skilled in the art.

PCV-2 immunomodulators are preferentially derived from PCV-2, or can they be produced? skeleton PCV-2 genes (nk) or fragments thereof or epitopes are recombinant expression vectors Methods for the production and use of expression vectors (or recombinants) or analogous methods are described in the following references.

4,603,112, 4,769,330, 5,174,993, 5,505,941, 5,328,683 ,, 5,494, §07, 4,722,848, 5,942,235, 5,264,773,

5,770,212; 5,942,235; 5,756,105; 5,760,599; 6,094,777; 5,990,091; 6,933,994; 5,869,312; 5,382,425. U.S. Patent Nos. VSA-A-5,198; WO 94/167, WO 96/3949 !. and WO 95/30018. number of international disclosure documents; Psoletti, PNAS USA 93: 11349-11353 (1996); Moss, ENAS USA 93, 1134-111348 (1996); Smith et al., VSA-bell Patent 4,745,951 (Recombinant Baoovirus); ed., Richardsoo, C.D., Methods and Molecular Biology 39, "Saouiovirus Expression Protoeols" (1995 Humana Press &); Srniih et al., Mol. Cell Bioi. X 2156-2165 (1983); Peonenk et al., 1984, Mol Biol 4: 399-406; European Patent Application EP 370 573; U.S. Patent Application Serial No. 920,197, filed October 16, 1996; EP No. 265785; 4,769,331. Patent No. VSA (Recombinant Herpes Virus); Rotzmsn, PNAS VSA 93, 11307-11312 (1996); Andre & ssky et al., PiMAS USA 93: 11313-11318 (1996); Rohcrtson et al. (1996) PNAS VSA 93, 11334-11340; Frolov et al., 1996, PfASAS VSA 93, 11371-11377; Kutson et al., .1. Virok 65: 3968-3075 (1991); 5,591,439., 5,552,143. U.S. Pat. 5VÖ 98/00166. International Publication No. 08 / 675,556. and OS / 675,566. U.S. Patent Application Serial No. ** (both filed July 3, 1996) (recombinant adenovirus); selfmhaas et al., Sewin &amp; rs in Viralogy 3: 237-52 (1993); Balfey et al., 1993, EMBO Journal 4: 3861-65; örahsm, Tibfecb 8, 85-8? (1990); Rrevec et al., 3. Geo. Waiting Room 70. 429 * 434; PCT WO 91/11525. Felgner et al., 1994, J. Biot Chern 269: 2550-2561; Science 258: 1745-49 (1993); MeCIetaeaís et al. PNAS USA. 93: 414-420 (1996); U.S. Patent Nos. 5,591,639; 5,589,466; and 5,580,859; WO-A-90/11892., WO-A-93 /: 19183, WO-A-94/217977, WO-A-95/13177, and WO-A-95/20660. number of international publication drinks; Taag et al., Natur. 356: 152-154 (1992); Furth et al., Anal, Eioehetn, 203, 365-368 (1992) (refers to DNA expression vectors, among others). See also WO 98/33510. neoazeifcıl disclosures; Ja et al., Diabetology 41, 736-739 (1998) (lentiviral expression system); U.S. Patent No. 4,394,448 to Sanford et al. (Procedure for DNA Insertion into Living Cells); U.S. Patent No. 5,677,178 to McCornúck et al. (Eitopathic viruses); 5,928,913. U.S. Patent No. 5,198 (for delivery of vectors for gene delivery); and viral vectors used in the present invention may be derived, for example, from porcine herpesvirus, such as Anjeszky's disease virus, porcine adenovirus, poxvirus, especially cowpox virus, madam virus, madam virus, madam virus. swine fever virus and D&S vectors (DNA plaque docs),

The expression product derived from PCV-2 gene (s) or portions thereof is useful for the production of antibodies, such as monoclonal or polyclonal antibodies, which are useful for diagnostic purposes. Similarly, b6i (or partial expression expressions) of the PCV ~ 2 gene (s) may be useful in diagnostic applications.

Further, one skilled in the art will be able to determine an epitope on a PCV-2 immunogen of interest or another self-immunogen derived from a porcine pathogen without undue experimentation, based on the description and knowledge known to those skilled in the art; see, for example, WO 98/4505. International Publication Number No. 2, in question, for general information to determine an epitope or epitope region of a protein, among others.

Preferred immunogenic or vaccinia formulations useful in the present invention are. may be: an immunogen or a blind formulation purified with a PCV-2 preparation, such as registration number, ECACC. (Eumpeaa Collseon of Celi Cultures, Center For Applied. Microbial &amp; Research, Salisbury, Wiltshbc S.P4 OJG, UK) obtained from purified strains of porcine circovirus virus obtained from deposited strains of rabbit v. (Imp. 1008 strain), No. ¥ 9710021.8. (fmp. strain 1010) and No. ¥ 97180217. (hnp.999 ~ strain) with registration number, deported on October 2, 1997, No. ¥ 98911608. M8285 strain) and No. ¥ 98011609, (strains imp, strain 1011-48121), which had been deposited on January 16, 1998, and No. 00812709. fi strain 3) and No. 80812710. ( 1121 strain), strains deposited on February 2, 2008; or an immanogenic or vaccine composition comprising porcine ctrkovlrast which is 6; vfe-o was cultured in and isolated from these cultures, and these cells were found to be infected with a serum-derived circovirus from a physiological sample or from a serum sample. can be isolated, in particular, from damaged tissue of porcine pigs with PMWS syndrome, for example, a composition for the production and isolation of a porcine zircovovirus from a porcine kidney cell line, such as FCV-Usa-free enzyme PR / 1S cell. vtox> exiractosome derived from cell culture, or its fck digest, is prepared or prepared from it. So they can use swine-derived ctrko virus as hntnunogen, A vaccine or hsmunogenic product tórtaisnazha? for example, weakened ,. él§. complete tamunogen (e. g., virgin), preferably in veterinary or pharmacologically acceptable adjuvant or diluent form, and in the form of a pharmaceutically acceptable or pharmaceutically acceptable adjuvant, and optionally stabilized lyophilisation. The isogen (e.g., virus) may be inactivated and the vaccine or ammunogenic composition may further comprise and / or optionally a pharmaceutically acceptable or excipient or diluent and optionally contain a veterinary or pharmaceutically acceptable adjuvant. 2-immunogens and / or mmmnogens from a number of porcine orthophthora (including PCV-2 or a number of PCV-2 strains and including PCV-1) and, optionally, other porcine origin. pathogen, for example, from FRRS virus, from Nabeeb, Acvtoctoeto / jupe, e. g. from Pseudorabsss, from Bordeaux, from Porcine Pathogens, from Pseudorabs, Pseudorabsss, Pseudorabs, Pseudorabsss, Pseudorabs, Pseudorabs, Pseudorabs, Pseudorabs, Pseudorabs, Pseudorabs, Pseudorabsss, Pseudorabs, Pseudorabs, Pseudorabsss 14,9, International Publication Number).

For the preparation of an antigenic preparation derived from ctrovirus, ciAoviresose. cells, especially cell lines, for example by passage with PR / horse cells. The culture supernatants or exirna can be purified, if necessary, by standard techniques.

attenuation: with respect to PCV-vd, it is noted that attenuation can be accomplished by commonly used methods, such as passage on cells, preferably by passage (e.g. 28-150, especially 48-180) on porcine cells, particularly cell lines such as PK715.

With regard to the ioaactivated vaccine, PCV and any fractions present, it is noted that. inactivation may be performed according to techniques known to those skilled in the art. Inactivation is preferably carried out by chemical means, for example! so that the antigen is a chemical agent, for example! formaldehyde (fbnsalis), paraformaldehyde,? -propiolactose or etheneintin or derivatives thereof, and / or physical treatment A preferred inactivation method according to the present invention is the treatment with a chemical agent, in particular ethylamine or B-propiolactol.

The immunogen in the vaccine or smirmogenic composition may be expressed using DNA (preferably encoding at least one epitope) or a fragment of the PCV-S nucleotide sequence, e.g., with the sequences L, 2, 3, 4, 6 or 7. 1-3, Figures 1-4, and 6-7, the jmnsogen in the vaccine or preparation of the vaccine can be expressed using a DNA fragment derived from a PCV-2 cell as shown in Figures 1-13. ORiFs, such as 4,?, 10, and 13 .RPs communicate one of the ORFs, the advantages of which are maintained by ORFs 4 and / or 13, especially those that are represented by · (derived from strains concreted above (as disclosed in WO-A-99/18214, see also Table 1 below). Thus, an immunogen or a portion thereof, such as a spitope of interest, can be obtained by expression of to vüAv, a recombinant cut. The vector may be further purified and / or pumped by conventional methods

The Immunogen contained in the vaccine or immuno-immunogenic composition may be made using an expression vector comprising DNA (preferably encoding at least one epitope) comprising a PCV tin nucleotide sequence or a fragment thereof; Examples of expressing v / vo are a, L, 2, 3, 4 and b. or SEQ ID NO: 7 (Figures 1-4 and 6-7). Similarly, an immunogen in a vaccine, immunogen, or immunological preparation may be vehicle-expressed using an expression vector which is a 1-13 ORF from FCV-2, e.g. and 13. One of the QRFs comprises an IGF-containing ORF, preferably 4 and / or 13, O8F, especially one derived from the above-described strains. Thus, a vaccine or an untntagular preparation may comprise an expression vector that expresses the Immune gene or a portion thereof, such as a rk viva capable of producing the subject in question.

The expression vector is leaked from any suitable vector, such as DNA plasmids. from bahtérhsmöbb, your examples are £. u., viruses such as baeufevirus, herpesvirus such as Aujeszky's fSle disease virus, adenoviruses, including porcine origin virus, rabid viruses, avian viruses, avian et al., U.S. Patent Application Serial No. 6,338,552, and U.S. Patent Application Serial No. 60 / 138,478, filed on svsrreud, both filed June 1, 1999, in particular a detailed description of the present invention, and more particularly, the examples, "DNA VACCINE-RCV 'and" FORCÍNE CÍRCOVÍRVS REC0M8INAKT POXVIRÜS VACCINE ", respectively, which are attached.

Accordingly, the present invention also relates to nucleic acid molecules and vectors containing them, and to expression products made using them, to compositions comprising such nucleic acid molecules and / or vectors and / or expression products, and to methods of making and using any or all of them. In particular, the present invention relates to OR.Fs and / or genomic fragments encoding the immunoglobulin or wild type, and nucleic acid molecules derived from strains 1103 and / or 1121, in particular 1-13, such as ORFs 4, 7, 10. and the 13RF, preferably the 4R and / or 13RR and their fragments, as well as vectors containing these nucleic acid mosaics, compositions containing these nucleic acid mothecules, vectors, or expression products produced by their use, such nucleic acid molecules. formulations containing suitable expression products, chain-limiting oligonucleotides or probes, and applications and methods according to said preferred embodiments of the invention for the detection, diagnosis, testing, immunogen or protective response of the like, and the like.

As mentioned above, antibodies may also be used in a preferred embodiment of the invention. The inventors of such antibodies have either basic or mooclotic antibodies; for example those mentioned above from circoviruses or those with the RCV-2 routine, e.g. or SEQ ID NO: 7 (Figures 1-4 and 6-7) encoding a polypeptide encoded by a DNA ptag fragment, or a CV-2 sequence, such as those shown in Figures 1, 2, 3, 4 6, or 7, from a polypeptide derived from the expression of a vector having the same coding sequence or a vector containing a DNA containing one of the DNA sequences 1-13. One skilled in the art can employ techniques for producing antibodies and producing monoclonal or polyclonal antibodies. Antibodies and. antigens may be used for diagnostic purposes.

The invention also relates to probes 1103 and / or 11.21, derived from the P <RTI ID = 0.0> V-2 ~ strain </RTI> and primers which are useful, for example, for the detection of PCV-2 DNA, in particular myocarollis and / or abortion and / or as well as for the amplification of FCV-2 DNA, for example

4 ». »φ

-15 »

Φ Φφφφ φφ * ♦ ♦

Φ · χ · φ φφφ φφ

Φ φ. ♦ φ χ »φ φφφ * φφ

Φ X 9 ΦΦΦ

X «φφφ φ * expression vector. A probe or ligation oligonucleotide can be of any size that is at least 8, preferably at least 1, more preferably 12, 13, 14 or 15, for example at least 29, for example at least 23 or 25, for example at least 2? or contains 30 nucleotides from the PCV-2 gene or the PCY2 gene which is an individual; PCV-2, and probably for these strains, or which occurs in PVV-2 and is at least conservative in PCV or Clovirus family, PCR or hybridization; primers or probes, and these are optimal; irritation, see K & jtmura Ós al, GATA 7 _f 71-79 (199Ö) reference. Hybridization is preferably carried out under highly stringent conditions in which the term "highly stringent" is understood by one of ordinary skill in the art (see, for example, Sambrook and Misak, "Molecnlar Cloning;" Laboraory MarmaT ', Cold Spriág. Harbor Lahoratory Press, Colá Sprrng Hatbor, NY, 1989). and Ed. Hatnes and I-Ighx, Nucleic Acid Hybridization IRL Éress, Oxford, UK, 1985). It will be appreciated that hybridization is carried out using well-established techniques, such as Ssauthem blot hybridization, Northern blot hybridization, in situ hybridization, and preferably Soutbent hybridization PCR amplifications by DNA reagents.

Like probes or chain-initiating oligonacleotides, the present invention provides peptides that are not full-length PCY-2 fibrils and can have an epithelial spread of at least 8, preferably at least 10, more preferably at least 12, 13, 14 or 15, contain, for example, at least 20, for example at least 23 or 25, for example at least 27 or 30, amisic acid from ECV-2, which is unique to PCV-2, and probably these strains, or which are present in PCV-2 and at least conservative in the PCV or eircovirus family. Alternatively, or further, the amino acids of the incomplete PCV-2 protein according to the invention may correspond to the ep stop region of the PCV-2 protein.

In the examples, the tdk &lt; RTI ID = 0.0 &gt; mutated &lt; / RTI &gt;rsókleotidok; ÖRP2, 1381-314. mrkleotidok; and corresponding to ORFd and ORF 13 described in U.S. Patent Application Serial No. 09 / 161,092, issued September 25, 1998, respectively, and WO-A-9918214. Other PCV-2 sequences are also disclosed in WO-A-9918214, designated ImplőÖS, lmp999, JmplüI 1-48282 and IrnplÖl. 1-48Í21; and A. L, Hamui et al., (1998, Virol 72: 5202-5267) (GeaBank AF27217) and Motozov et al., 1998, Microb 36, 2535-2541]. and OenBank SEQ ID NOs: 686834, AFD86835 and AFÖS6836, and make available equivalent ORF sequences.

Equivalent sequences are also provided herein. in the sense that they are capable of carrying out the novel gene sequence of the gene of interest under normal conditions. Among these equivalent sequences may be mentioned the gene fragments which have retained the entire sequence by immobilization, for example the epilope of interest.

The horizontal geography of type I and type 2 PCVs is about 75%. But within type 2, the homologue is 95% found. Thus, in the present invention, any P <RTI ID = 0.0> Y-2 </RTI> strain is equilibrated. One condition may be that the type 2 strain, for example the homologue to the entire ghetto, has a nucleotide level of 85% or greater, preferably 90% or higher, more preferably 95% or greater, preferably 97, 98 or 99% or greater with strains of the invention, such as linp 1819,

The boundaries of the ORFs of the iBwiöKhjetü strain are given in Table 3 below »:

Name Start over Thread ORF size (nncientids, nf) Protein Size Orphic 303 230 szsnsz 308 e.g. 35 aa ORF.2 1 ISO 331? ssensz 338 nt 45 aa ORF3 1363 1524 sense 362 nt 53 aa ORF4 398 1342 sense 94 5 nt. 314 sons ORF5 900 1079 for taking i 80 e.g. 59 aa ORF6 1254 1334 sense 81 ni 26 aa ORF7 3018 704 antisense 335 nt 104 aa ÖRF8 439 313 antisense 129 e.g. 42 sa ORF9 190 From andszensz 90 e.g. 29 sa ORPIÖ 912 723 astíszeasz ISO e.g. 59 aa ORFi 3: 645 565 antisense 81 e.g. 26 aa ORF12 1100 1035 antisense 66 e.g. 21 aa ORFI 3 334 13SI antisense 702 e.g. 213 aa

ORFs are defined with respect to the Implole Strain. This invention also encompasses the use of appropriate ORFs from any other PCV-2 strain and any other PCV-2 strain as described herein and in the publications cited therein. So, genomic nlkleötidskskendaböl is routinely done. can determine ORFs using standard software such as MaeVecoror®. Thus, alignment of gesotts with 1010 strain-derived genomes and comparison with strain-derived ORFs allows one skilled in the art to use other strains (e.g., strains described in WO-A-99/18214, specifically ImplOOS, mplOlI-48i21, mpl011-48282, lmp999, as well as the 1103 and 1121 strains) genome. Application of the software and alignment do not require unnecessary experimentation and thus directly access these AzORFs.

For example, with reference to Figures 6 and 7, the boundaries of the corresponding ORFs of strain 3103 and strain 1121 are given in Table 2 below:

Name Start over Thread Size of ÖRF Cmddeottdok, at) Protein Size (Fatty Nino Acids) Orphic 1524 3631 sense 308 e.g. 35 as ORF2 §33 970 sense 338 nt 45 as ORF3 3016 1177 sense 3 62 e.g. 53 as ORF4 51 995 sense 945 e.g. 314 as OK.FS 553 732 szesrsz 180 ni 59 ss ÖRP6 907 987 sense 81 e.g. 26 as ORF7 671 357 antisense 315 nt 1Ö4 as ORF8 92 1732 antisense 329 e.g. 4 2 ss ORF9 1613 1522 antisense 90 e.g. 29 ss ORF 10 565 386 antisense 380nt 59 as ORF11 298 218 astisasusz 81 e.g. 26 ss ORFI 2 753 688 antisense 66 skis 23 as ORFI 3 1735 1037 antisense 702 e.g. 213 as

X »

Equivalently, the present invention also applies to those nayleotide sequences in which neither the fusion protein, the sw tissue specificity (type 2 strain) of the gene in question, or the genes encoded by the gene in the pelipepdd are of course different because of the degeneration of the subject. They are.

For ÖRF4, the theology between PCV-1 and PCV-2 is about 86%, and for ÖRF13, about 66% for the homologue between PCV-I and FCV-2. Thus, sequences having 95% or greater of ÖBP4 are equally applicable to the present invention. have ORF4 from Impl06 and have sequences having 95% or greater homology to ÖRF13 from Impl0 (using the terminology in Table 1).

For the purposes of homology with other ORFs, sequences derived from a PCV strain having OR14 and / or ORF13 and defined as homologous to an appropriate ORF from a slurry as defined above are defined. For ORF7, sequences having preferably homology of 80% or greater, more preferably 85% or more, preferably 90% or 95% or more, of the Immunolabeling strain for CW 10 may be equally used in the present invention. sequences which preferably have 86% or more homology, more preferably 90% or more homologous, preferably 95% or more homologous to OSF10 (using the thermolysis given in Table 1),

Equivalent sequences having 95% or greater homology to ÖRF4 from ImplO1O strain and CW'13 to sequences having 95% or more hotness to QRP13 from ImplOlo strain can be used in the present invention.

ÖRF4 and ORF13 encode potentially 37.7 kI and 27.8 kI, respectively, of proteins with expected molecular weights, ÖRF'7 and ORF1 (corresponding to ORF3 and ÖRF4 as described by Mfoehan et al., 1998} potentially 11.9 kD and 6.5 kb, respectively, encoding proteins with the expected molecular weight The sequences of these ORFs are available in Genbank AF 055392. They can be incorporated into plasmids and can be used alone or in combination with the invention, for example with ORP4 and / or al-ORF13.

The other 1-3 and 5, 6, S-9 ... 11-12 listed in the table above. ÖRF (according to International Publication No. WO-A-99/18214 GOL, 1-3 and 5, £>., 8-9, 11-12)}, or the region (s) thereof encoding an antigen or epitope ¹ may be optionally related to the present invention, for example, alone or in combination or otherwise, with each other or with the ORF or region (s) 4 and / or 13 of the antigen (s) or epilope (fcs). Similarly, homologous sequences derived from a PCY strain having ORF13 and / or ORF4 as defined above or homologous to those described herein or by Meshan et al. The corresponding ORFs from the 10 strain described in (1998) have a homologue of, for example, 80% or more, e.g. 85% or more, preferably 99% or 95% or more. from l ORF7 away -ORFlö 'it may advantageously be used an equivalent sequence 86% or more, preferably 90% or more, preferably 95% or more homolog "♦' ·, f S> * <? ♦ «»; *

- 18 has O.RE! 0 from ImpiCSIö strain,

Nucleotide sequence sequencing can be determined using the "Akgn" program described by Myers and Miller (CABios 4: 11-17 (1988)), Alternatively or alternatively, the "homologue or" identity " terms for nucleoid or amino acid sequences can satisfy the quantitative measure of a .green homologue of two sequences. The percent homologue can be computed as: (N _ref - · where N & r is · my two sequences are the number of filamentous groups in order where N, " _{ is the number of all residues in one sequence. Therefore, the AOTCAGTC DKS sequence has 75% identity to the A ?TCAA'rC sequence = 8;

^::: 2).

Alternatively, or in addition, the terms "homologue" or "identity" refer to sequences. meaning that the number of positions of the same nucleotides or amino acids is divided by the number of nucleotides or nmlnossv in the two sequences if the kha sequence is aligned by the Wilbur and Lippmann algorithm [Wilbor and Liprnann, Proc. Acad, Sci., USA, 80, 722 (1983)], for example, with the following setting: window size of 20 srsflialic acid, 4 mskleo 'word iesgth {word length} and' gap penslty ': 4, computer analysis of sequence data and description, including. alignment can be performed conveniently using commercially available programs (Intelligenetics ™ So.be. intelligenetics Inc, CA). If the WS sequences are said to be similar, or to some degree, have sequence identity or homology with the DNA sequences, then the tin (T) in the ONS sequence is considered equal to your RNA sequence (U>).

The RNA sequences claimed by the invention are derived from DNA sequences. that thymidine (Tj in the DNA sequence is considered equal to urea (U) in the RNA sequence).

Furthermore, or alternatively modified in the antinoic acid sequence. similarity or identity or homology can be determined using a BlastP program [Alisokul et al., Nueterc Aldis Slit. 25, 3389-3402] available from NCBI. The following references describe algorithms capable of comparing the relative identity or homology of amino acids in two proteins, and in addition or alternatively, with reference to the above . can be used to determine percent homology or identity: Needleman and Wunsch, i. Moh Bioi, 48, 443-453 (1970); Smith, T.F., and Waterman, M.S. (Advauees in Applied Mathesales 2, 482-489-0981): Smith, T.F. and Waterman, M.S. and Sadler, R., "Static Characterization of Nucleic Acid Function Functions", 1983, Nuclear Acids Rxx, 22-5-5-220; Feag D, F. and Dolittle, R.F., "A Progressive Sequence for Prerequisite to Correct Phyiogenetic Editions,", 1. ofMol. Evol. 25: 351-360 (1987); Higgins, D.G. and Sharpe F.M., "Fascia and Sequencing .mnltiple Sequence Alignment on the Mierocompnter CASIOS 5, 151-153 (1989); 3'hompsors, I.D. "Higgins DG and Öfeson T.I.," Clusíer W: Improvement of the sensitization of o-f progressively maltylpie sequence alligations through sequence weigings, positional-gap penaities and vveight matrix chotce, Ntseleic Aeids Slot. 22: 4673-480 (1994); and Deveteux, X, Haebetüe P and Smilies O, "The eomprehensive set of sequence analysis program ibr the VAX", Nucl. Journal Research 12: 387-395 (1984),

The present invention also provides: the use of a PCV-2 immunogen, alone or in combination with an immunogen derived from another porcine pathogen, for the preparation of the compositions of the invention, for example by mixing the ingredients; and therefore a. The present invention relates to kits in which the ingredients of the invention are stored separately and, if appropriate, packaged together for mixing and / or administration, wherein the reagent kit optionally contains instructions for mixing and / or administration.

While the. The present invention relates to the administration of PCV-2-lymphogenetic or vaccine kits containing females to pigs, and the present invention relates to the administration of such formulations to sows or sows and / or males as described. emse), all of the pigs may be administered the compositions of the invention and / or subject to the methods of the invention. Accordingly, pig populations may be administered and / or subjected to the methods of the invention.

The thymmogenic or vacuole compositions of the invention may contain more than one immunogen from PCV-2 strain. For example, inantmogens from strains 1121 and 1103 can be combined (from one or both of these strains) with at least one other mnunogen from the strain of the invention, or any other combination can be created.

The methods of the invention allow those skilled in the art to evaluate the efficacy of vaccines against PCV-2. One method is using ELISA or seroneutralization. In another method, the vaccine is infected with virulent PCV-2 strains, such as one strain of the invention. In other words, the present invention allows for the screening of PCV-hn immunogens, including PCV-1 immunogens, which are capable of eliciting a tan or projective response against PCV-2, such PCV-hnmgngs then being useful in pigs for prevention or treatment, especially PCV-2. myocarditis and / or abortion and / or intrauterine infection and PMWS and / or other pathological sequelae associated with it.

In one aspect, the present invention relates to immunogenic or blinded formulations which contain PCV-immunoglobulin and are capable of eliciting an immunogen or projective response to PCV-2. The invention also relates to methods of immunization and vaccination using such an immunogen and to the use of such an immunogen .

The present invention will be further described by the following examples and examples, which are intended to be illustrative and are not intended to limit the scope of the invention.

In FIG. which is the S sequence of PCV-DN derived from the genome of imp, strain 1M112121.

Figure 2 depicts the strain 2 sequence, as described in Imp. DNA sequence from 101 MOS strain genomes.

Figure 3 is SEQ ID NO: 3, derived from the gesome of Imp, strain 999

DNA szekveseia.

Figure 4! SEQ ID NO: 4 is shown. Imp, D'NS sequence from genome of horse strain.

Figure 5 is SEQ ID NO: 5, which is a DNA sequence derived from the genome of ΡΚ15 strain.

Figure 6 shows SEQ ID NO: 6 isolated by A. lberahan (Canada), imp. The DNA sequence derived from the genome of strain 1103; k is g (G) or t (T), y is c (C) or t (T). These * φ * φ χ Φ φ χ »φ *» * * X φ φ, φ * φ * ♦ φ ♦ **

ΦΦΧ «ΦΦΦ X Φ φ Φ *

-2Q- "* · *" ** * * '*** ^{>, κ} sequence variations were observed in the viral pellet,

Figure 7 shows the sequence of SEQ ID NO: 7, isolated in Saskoon (Canada).

DNA sequence from strain 1121 genome.

Figures 1.1-1.5 in Example 12, for their roles,

Examples 2, 1 ~ 2 are the roles of reference 13,

EXAMPLES AND DPDDIMENTS

L refergfwsspD'dii

PCV-2 Associated MILK & RISIS, Abortion, and Intrauterine Infection

In a new pig farm with 450 sows, there were late-term abortions and larvae of stillborn or mummified piglets at the start of breeding. Pregnancy in some sows: We also observed that sows received an inactive vaccine derived from a 2 dose parvovlrus and precursor of the pathogenesis and containing the leptospiral immunogen.

In a postmortem examination of an animal from one litter, nine fetuses were found which appeared to be ablated at various stages of gestation. The hatchery was mummified, 2 macerated, 3 autolysed, and 2 freshly born. In a macroscopy pathology study, damage was observed in only one partially atolized fetus. In this ntagzaíbtm both cancers of the heart were dilated, the liver was enlarged and solidified, and hyaryothorax (chest fluid) and systeitis (abdominal water) were seen. Archbishopric tendon stroke, There was a striking generalized hepatic blood flow and hepatocellular (hepatocellular) loss. The spleen and kidney were also blood-thinning. No significant histological damage was detected in the other fetuses.

Immunoglobulin staining for PCV-2 as described previously was performed with rabbit raised polyclonal antisense monoclonal antibody raised against PCV-2, formulated in fixed, conventionally treated and embedded tissue sections (Bilis, 1998; 1999), The affected part of the cardiac muscle of the fetus with cardiomyopathy is intensively combed for PCV-2 antigen. The staining was the most intense in the area of necrosis, and the bed was mainly affected by the sniociS. We have experienced both Cttoplastnaphic and nuclear dyestuffs in several fetuses. liver was Intense staining. In some sections, staining appeared to be predominantly involving the sinusoidal endothelium and Rnnferte cells, whereas in other fetuses, such as mucocardial fetuses, nuclear and eleoplasmic staining also extended to hepatocytes. Positively stemming cells were scattered throughout the lungs and the lobe of the kidney. Polymerase chain reaction (PCR) for PCV-2 was performed as described previously (Bilis et al., 1999) using frozen tissue. The PCR product of the expected size was amplified to PCV-2 from fetal tissue. PCV-2 was isolated from myocardial fetus and pooled tissue stock from fetuses from other littermates revealed that x-tissue homogenates were inoculated into PCV-free ΡΚ-15 cells.

Fetal tissues in pigs associated with other viral pathogens associated with fetal injury and abortion, such as porcine parvovirus (PPV), porcine, reproductive and respiratory syndrome virus (PRRSV), and encephalomyorrhoea. PPVantigen not detected in fluorescent antibody test (FAT) in mummified or stillborn fetuses, in lung, liver and epithelial sections of fetuses, lymphoid fetuses ♦ «φφ« φ φφ φ φ »

- * «φ

ΦΦ φφφ ΦΦ luminal and spleen homogenates were also inoculated into PCV-free PK-1S cell cultures, mainly porcine-derived ova and spleen cells, and no Ciopical viruses were dosed after three pseudings. Tissues were negative for PPV by PCR and immunoprecipitated with PRRSV antigen.

Thus, fetal lesions and abortion are directly associated with PCV-2 viruses. These results also indicate vertical transmission of the virus.

In an earlier experiment, fetuses tested tested for isolation of PC V, suggesting that viruses belonging to this group could be transmitted vertically; however, PCV-1 antigen could not be associated with any tissue damage (Aiiaa et al., 1995). Other agents such as PPV (Bolt et al., 1997; Melor et al., 1991), PPV (Lager et al., L990), EMCV (Kim et al., 1989) and enterovine (1989) have been associated with fetal damage and abortion in pigs. The exclusion of Mólkor et al., 1991) shows that PCV-2 is capable of causing significant fetal pathology and subsequent abortion.

PCV-2 infection-associated atrophy; syndrome most frequently occurs in piglets from 5 to 12 weeks of age (Alian et al., 1998; ElUs et al., 1998). Experimental infection of newborn pigs in art shows that it is relatively long. there is a predromatic period between the onset of infection and the onset of clinical signs associated with PCV-2 (Allan et al., 1999; Bilis et al., 1999). Khuutahuk that the virus is transmitted vertically or around birth. Not only can intrauterine transmission of PCV-2 result in abortion, but it is also possible that synbletally infected piglets may be animals that subsequently develop PMW'S.

In addition, the results show that sows are vaccinated before breeding or calving, or before and / or during pregnancy, PCV-2-lmm.nnogem ·. (which may also contain a porcine immune pathogen, such as porcine parvovirus), to prevent lymphadenopathy and / or abortion and / or swine-associated circovirus-2-νεΙ associated uterine, uterine uterus. and other pathological consequences associated with PCV-2 by inducing immune reactivity or production of antibodies against PCV-2.

Of course, the compositions, methods and other aspects of the invention may be applied to animals other than pigs, such as sheep, bison, cattle, wild boars; for example, if PCV-2 infects such other findings.

2. rsfgreíet'apé & ftí gCV-2-ye [, im ^ ájtmtokstüilisrt, abpnuszjb ^ gn.beí§h ^^

It is assumed that the presence of PCV-2 in newborn piglets is by vertical transmission an important way of transmitting the virus. This mode of transmission is associated not only with reproductive damage, but also with the development of MSD at a later stage in life. The aim was to determine whether verticals of previously undetected PCV-2 (and PCV-1) are transmitted in pig farms where FMWS has been endemic for at least several years with the spread of PCV-2 infection.

38 samples from a total of 39 Canadian breeds were submitted to the WesternCollege of Veterinary Medicine (WCVM) Diagnostic Laboratory at the University of Saskatchewan (Canada, Saskatoon), including 38 samples from animals suffering from reproductive damage. . Samples were obtained from five farms where PMWS cases were diagnosed. A 38 min-22 ♦ β «Φ *» Φ ♦ · * X * * * * * · ♦ * Φ »* * Φ ♦ Φ 9 Φ ΦΦ * Φ ♦ Φ« * * «» 9 9 4 Φ Φ * « Φ * * of twenty-seven (? 1%) abortion partners; they report five (+ 3%) associated with at least one fetal fetus. Of the remaining cases of KI: 5 were from stillbirth or non-viable tusiad (13%); .2 from a stillborn piglet and one or more mummy-born fetuses (5% X 2 was from a stillborn pig only (5%); and one from a mummified piglet only. It has been shown by routine diagnostics of various pstogens in 4 cases (11 %) etiology sedimentation parvovcture was determined and in 2 cases etiology was determined as bacterial luminal lysis complete necropsies, tissue samples were taken and fixed with TOR (fixed at 24-72 h); Prior to this, we had not tested on PCV-2 in either case.

For the detection of PCV-1 and PCV-2, a PCR technique was used as previously described (Tischer et al., 1974). A. PCV-1 was not detected by PCR in any of the samples containing stem cells associated with reproductive damage from the four-year period, and PCV-2 was detected by PCR in two different samples from multiple colonies: standing breeding units, on two separate occasions, in the spring of the last year of the four-year period. The first of these samples came from piglets with visible signs of myocarditis, cardiac hypertrophy and chronic passive blood flow.

PCV-2 in tissues: Immunohistochemical identification was performed as described previously (Tischer et al., 1974). Irarnunpheistokenin staining with IHC was positive for FCV-2 in all six piglets tested on stornoma specimens, was determined by PCR (see table below).

Tabulated: Detection of PCV-2 in my form using fixed myocardial serous heart disease, PCR, 1HC and virus isolation from cell culture.

PCV-2 positive tissues PCR 1HC VfrusMsoIáiás fixed 5 / her He / she SO Frozen 4/4 SO 2/4

The second sample came from a group of four piglets of the same colony, in which 2 piglets are stillborn and the other two died shortly after birth. All four pigs showed obvious signs of severe, diffuse myocarditis, sweeping hypertension and chronic passive blood flow in the swine, fresh frozen heart and lung / spleen pooled tissues were analyzed for PC V-2. was present in 2 hearts of 4 pigs and in 4 cases of combined pigs and spleen in 4 cases. . PCV-2 was isolated from the affected hearts and / or from the combined lung and spleen tissue in 2 out of 4 cases that were positive for FC V-2 by PCR based on serology and / or PCR with reproductive abnormalities, other burns, such as porcine, reproductive and respiratory syndrome virus, and porcine parvoviruses, were apparently present and transmitted in farm animals. However, not about these agents. it has also been shown that ax affected pigs; m have been associated with severe cardiac (or other) lesions; but they can play a role in the development of PMWS,

Not defective by PCR or HC in any representative sample associated with PCV-2 reproductive disorders which; in the first three years of the four-year period (we detected PCV-2 in reproductive disorders cases in samples of the last four years).

DNA damage is formalin: to rule out subsequent damage due to fixation (a possible

Five

(Harmful Factor XX, which Restricts the Detectivity of PCV-2 by PCR), was performed on tissues taken from four isolated piglets suffering from PMWS. PCV-2 DNA is amplified in all four lymphoid tissues tested, including lung, liver, kidney, and bronchial lymphoid tissue. Furthermore, the sensitivity of PCV-2-PCs is independent of the duration of fixation of individual tissues in the loral line

These results confirm and extend the previously reported observation (West et al., 1999) that PCV-2 can be transported vertically and in large parts of the affected porcine infectious piglets. Vertical transmission of PCV-2 virus and resulting fetal damage, such as myocarditis, is another manifestation of PCV-2 in the form of a disease. In addition, the fact that PCV-2 was not detected in areas associated with PCV-2 infection in cases that were associated with reproductive disorders prior to the last year of the four-year period may indicate that vertical transmission is not the primary mecianism that initiates viral infection. responsible for its spread. The spread of PCY-2 infection in pigs can be reversed by both sexual and vertical transmission.

d, ze / ewícrápté & íb

The 1103 viral was isolated in Albertine and the lOSi virus was isolated from abortion cases in Saskatoon, Canada according to the procedure described by I. Ellis et al. I. Vet. 39: 44-51 (1998).

The virus was cultured on PK / 15 cell cultures which were known to have porcine porcine ova (PCV), peshvtres, porcine adenoviruses and porcine parvoviruses [Alisa G. et al. “Pythogenesis of perelne circovirus experimmental of perfection of coiostrutndeprived pigiets and examination of pig fosta! her material * ', Vet. M'ierobtoi. 44.49-64 (1995)),

Monolayer PK / I5 cell pellets were detached from confluent cultures by trypsin treatment (trypsin-vertebrate mixture) and added in MEM-SA medium (15% fetal medium free of Pest virus-contaminated). about 4,000 cells to the final concentrator. Then, 1 ml aliquots of this cell pellet suspension were mixed with 2 ml aliquots of the inoculum described above and 6-6 ml aliquots of the final mixture were divided into two 25 EnV Falcon flasks. These cultures do 3? ' ^s C-bn was incubated for 18 hours under an atmosphere containing 19% arane dioxide.

After incubation, the gingiva of semi-continental monolayer cultures was treated with 300 mM D-glucose amine (Celli G48 l.S.S, Sygma-Aldribeb Compaay Limited, Poole, UK) [Tischr, 1, et al., Arch. Virol., 96, 3957 (1987), followed by incubation for an additional 48-72 hours at 37 ° C. After the final incubation, one of two Faicon flasks corresponding to each vaccine was subjected to 3 consecutive freezing thaw cycles. . The remaining ΡΚ-15 cells in the other Falcon flasks were treated with trypsin solution, rinsed with 20 ml of MEM-G medium and then inoculated with 75 µl Faikos flasks at 4,000. with the addition of 5 ml of appropriate lysate from fstgyssucci / thawing cyclodex.

4. rtyfezeneAyráófe

Technique for detecting PVV by aliquoting immuno-fluorescein

Initial screening of all aeetonoal fixed cell pellet preparations was performed by indirect Immunofluorescence (HF), pooled 1/100 dilution serum from adult pigs with aSsal * * + ♦ ♦ * Ο * **

XX> «* * * * * * * *» V Λ X · Φ 9 Η * «'ψ <. Λ * »« _«♦ Λ- ♦ ♦ Μ ~ 74 ** ** ♦ ^{φφχ χ} * ♦ ^'η *' wazAsával, this serum pool was from 25 sows from Northern Ireland, which were known that a wide variety of offensive,« a specific antibody to a virus of origin, such as ECV, porcine parvovfess, porcine adesovirus, and PRRS vfrus. HE techniques were performed by crossing the serum (diluted in PBS) with cell cultures for one hour at 37 ° C, then washing twice with PBS. The cultures were then conjugated with ESL-conjugated ESL, Your pig pigs diluted in I / Si ratio, immunoglobulin-elfenauyaggsl body for one hour, then washed with FBS, and samples were prepared in glycerol buffer for microscopic observation under UV light,

Production of PCV-atigenes in m u & w culture

Uninfected EC / 1S cells are cultured and the virus propagated according to the procedure described in Example 1. After 4 days of incubation with .TTX, the infected cells were harvested after trypsin treatment and counted. At next passage, -400,000 cells / ml were inoculated.

Various PCV-2 filaments of the invention, such as strain 11β3 and 1121, are cultured accordingly.

she, rc / her «cmpáteb

Criterion A is performed on a plate containing 9 5 culture sites. First, 100 [mu] l of PK / 1S cell suspension (150,000 cells / ml) was added per culture well. Then we dilute the virus culture and from it. Weigh 100 pl into a. tenyésztőbelyekre. The work-up is carried out in the presence of carbon dioxide at 37 * €. After 24 hours, glucosamine was treated for 1 h at 37 ° C (for conditions see Example 3). The culture medium is then removed and fresh media added to the wells. Then IskuMtak for 72 hours at 3 ° C. The focal points are displayed with an att-ECV-2 monoclonal antibody and FTC-ve-labeled murine conjugate.

This procedure can be used to prepare inactive and live attenuated FCV-2.

7, pefereneiapélilii

At the end of the virus harvest, infected cells were killed by ultrasound and ultrasound (Brnuson Somtler). or by lysis using a colloidal monkey (IL-1'urmx, 1KA) of the rotorstear type. The slurry was then centrifuged at 3700 g for 3 minutes. The virus suspenders were motivated by,% nickname for 1 h, 37 ^at C, or 0.5% beta-propanol for 24 h at 21TC. If the virus titer is inadequate before inactivation, will the virus matrix be screened by ultrafiltration, which retains a blank at 306 kDa? (Millipore .PTMOÖÖ). The inactivated virus suspension is stored at 5 ° C.

& rg / empty-tip / di

The vaccine is prepared as an emulsion for its mineral oils

The vaccine is prepared as follows;

- imtku pig porcine circulating eirovirus: 2.50 ml

- Mcsntaoldedú ISA 70 (SEBElCj; 75Ö ml «» # «χ * Φ« 4 Φ * Χ *

Φ Φ φφφ «φ -X Φ ♦ * ·« · ΦΦ ΦΦ XX φ Φ · - »*

The aqueous and uterine phases are sterilized by filtration. the emulsion is prepared by mixing and homogenizing the ingredients with the aid of a Si-em-brMaaem.

One dose of vaccine contains about ⁵ % TCID5. The volume of the vaccine administered by irradiation is 0.5 ml. The volume of vaccine administered mtmmusculically is 2 ml.

This vaccine is used in the vaccination program for systemic: atrophy syndrome in combination with Pm-o ¥ ax® vaccine,

9

Vaccine precooling in the form of a soluble eiaf base swirl emulsion

The vaccine is prepared as follows:

suspension of inactivated swine from pigs: 206 tnl

- Dehytnuls HRE 7 (Henkel): 6 ml

-Radía 7204 (Oleophina); 740 bowls

The aqueous and oily phases are sterilized by filtration. The emulsions are prepared by mixing and homogenizing the ingredients with a Sixtonston Bubble Emulsifier.

One vaccine dose: contains approximately ⁵ TCl.DSO2. The volume of vaccine administered by intramuscular injection is 2 ml.

This vaccine is used in the vaccination program for multiple sclerosis syndrome in combination with Parv <sva>:? ® vaccine.

J & baker & t

Inoculation of piglets with DNA (plasmid) vector

Groups of 3 or 4 piglets, delivered by cesarean section, are placed in isolators on the day. The piglets are inoculated on day 2 with a plasmid containing (A) OR.F-1.3 or (B) said plasmid and another. Pigs in the control group with physiological sodium chloride oclate. Each plasmid was diluted in sterile saline (0.9% NstCl) to a final concentration of 256 pg / µl. Intravenous injection. 2 ml in two places, 1 -1 ml each (one spot on each side of the neck). The second vaccine or injection from the market is administered on .14, day. The piglets broke their DNA blinding well and the blinds had no noticeable side effects. The piglets are infected on day 21 with 1 ml of PCV-2 virus suspension oronasal in the nostril. After infection: piglets are weighed weekly. Rectal temperature was measured at 17, 21, 22, 24, 27, 29, 31, 34, 37, 41, 44 days. All piglets on day 44 are excreted with feces to determine PCV-2 activity. Detection and quantification of A. virus is performed by quantitative PCR. On day 45, necropsy is performed and tissue samples are taken from the viral isolation guild.

^ &AkALItÉífipiónte;

There was no significant difference in mean body weight and body temperature between groups.

Necropic lesions:

At the end of the experiment, the visible lesions in the pigs were bronchial lymph & denopathy only. Damage was evaluated according to the following criteria (by dot score):

™ no visible oyirokmirlgy enlargement χ * ♦ - «

ΦΦ φ 9 Λ * *

Φ φ Φ Φ *

χ. χ φ «Φ» ΦΧ «

ΦΦ X X * * Φ * * **

Λ Λ 9 «·« ~ 26 ·

1. ~ mild enlargement of the lymphatic glands · restricted to the bronchial lymph glands ~ moderate enlargement of the lymph glands limited to the bronchial lymph glands

- severe lymphatic glandular obstruction. which is common to bronchial, submnibibular, prescapsular, and groin thyroid glands, shuttle: abbreviation for standard deviation

Groups Lymphoedefinger p · average ski N (THE) 1.2 1.3 4 (8; 2.0 1.7 .3 controls 3.0 0.0 Ύ

N · = number of piglets in each group

Decreases in the hematopoietic gland damage were observed in 3, 3 (A) to 1 immunized piglets, and 3 to 1 (B) immunized piglets. This difference was not significant (p> 0.5) due to the high value of the standard deviation ·.

Quantitative re-assay of the virus should be performed on tissue homogenates prepared from reserve and myenteric lymph glands.

The data shown corresponds to the logjy of the viral filters in the tissue homogenate,

PCV-2-liter

Groups Bnmcbíál középért. also ny, gland std, Mezentédkus ny.msrigy fcözepértstd. SID. N (THE) 0.9 Ö 0.9 0.8 4 (B) 0.7 0.6 0.2 0.2 3 control 2.0 1.1 1.8 U . <

The bronchial lymphatic vessels appear to contain the most infectious virus. A decrease in observable & vb rusterity in the reservation and seminal blood vessels of pigs immunized with a (A> or (S) mixture).

Vjfus ^ excretion;

The prevalence of FCV-2, the PCR amplicon of CRP-1.3 from PCV-2, was determined in dipped stools. The assay procedures were performed on 2 mL samples, in duplicate. A non-vaccinated control group was negative for ECV-2 at the time of infection but positive after infection, confirming the validity of the PIR assay.

Values are _{log! S} ~ knife expressed iron (PCV-2 DNA smlékölák example 2 sample).

-27 - ♦ Φ neither * «Φ ΦΦΦ Number of FCV-2 DNA molecules diluted;, - spy: expressed Group Kőzépérték std N (THE) 3.3 0.3 4 (THE) 2.9 0.7 Ύ controls 3.6 0.0 4

The differences between the groups are not significant (p> δ, O5), //, ze / k «®vmpd?

Vaccines for piglets with live vector from canarylmlo virus and results

Groups of 3 or 4 piglets delivered by caesarean section are placed in isolators on day 0. Piglets are: inoculated on day 2 with canarypox virus containing (C) -eliu, ORF-13, or canarypox virus (Dkjeel, containing ORF-13 and ORM), ml P8S, IstramKScutaneously to the sites on the neck, Second: Injection of vaccine or piaceb on day 14, The piglets broke well with the k, and had no appreciable side effects of the vaccinia. piglets are infected on day 21 with a dose of M ml of PCV-2 virase suspension per ml of chronazal nostril.

NSfeSÜSSaej dmén ^ i ^:

PMWS · is usually characterized by lymphadenopathy, rarely hepatitis or nelfltis, so that visible lesions in the lymphatic glands are evaluated (scored) by the following criteria: 0 - no visible enlargement of the thyroid gland; 1 - mild lymphatic gland enlargement limited to the reservation larynx; 2 = moderate lymphatic gland enlargement limited to bfoncbial thyroid glands; 3-severe lymph node enlargement, which extended to bronchial, snibmandibular (sub-jaw), pituitary, and groin glands.

Groups Fonts

IC) 0.5

0.0

0.0

1.0 mean S, 3S standard deviation 0.48 (D) 0.0

0.5

0.5

1.0 mean 0.5 standard deviation 0.41

Comroiio.k 2.0

2.5

2.5

2.5 average 2.38 standard deviation 0.25 ·· * '»♦ * · * · * φ Φ * Φ φ Φ * -κ φ φ χ ♦ Φ <· 9 ΦΦΦ φΦΦ ΦΦ ί» ί * ♦♦ * * Φ ΦΦ

Occasional lymphatic macrovascular manifestation of FCF-2. Stigma and buccal depression of lymph node damage was observed compared to the control group after it was injected with <C> and (D) (p <0.5).

/ APD / dn

The following sections are cited in U.S. Provisional Patent Application Serial No. 9 / 138,352.

In the examples, alksl; naziotic FCV-2 sequences were derived from sequences described by Meeham et al., (Nucleotides ORF1, 398-1342; ORF2, 1381-314; and corresponding to U.S. Pat. No. VS 09 / 161,992). ORF4s and OKF13, as described in U.S. Patent Application Serial No. 25, September 25, 1998, and AGL4 and COL13, described in WO-A-99I82M.

In the expression plasmid, a. As used herein, any DNA transcription unit in the form of a pofinucleotide sequence comprising the elements necessary for expression of the FCV sequence to be expressed and the transporter is preferred. The circular plasmid form is preferred, superhellally or otherwise, as claimed by the present invention.

More particularly, the present invention relates to p3P109 (which contains the ORF2 gene derived from PCV-2).

Figure 1.1), pJP111 (containing the ORF1 gene from FCV-2, Figure 1.2). p5F12O- (containing the OVF2 gene from PCV-1, Figure 1.3) and pJP 12.1 (containing the ORF gene from PCV-1, Figure 1.4).

Each plasmid retains the promoter in order to control the expression of the inserted gene in the host cells. This is generally a strong eukaryotic promoter, and in particular, an early portal CMV-IE-derived from Eger and Virovirus, which is human or yeast-derived, or optionally derived from other species such as rat or guinea pig, more preferably, derived from or derived from the promoter virus. Other than CMV-IE, promoters from other viruses may be mentioned. An early or late promoter from the SV400 virus or a UTR prototype derived from Rous Sarcomé virus. A promoter derived from the virus from which the gene is derived, such as the gene-specific promoter, is also deleted. As a cellular primer, we can mention a protozoan from the ozoskeletal gene, such as a desmin promoter, or alternatively, an acti promoter. If several, several genes are present in the same piartuidbau, they may be in the same transcription unit or in two different units.

The plasmids may contain other transcriptional regulatory elements, such as β-glebogen genes derived from iniro, preferably from saliva. corresponding to the 11-fold iniron stabilizing sequences (Vaoy Ooyen et al., 1979, Science 206, 337-344), a protein encoded by the plasmid plasmid mammalian gene gene (ICA; Monigotnery et al., Cell. Mol. 43, 285-292 (1997)] and the Pituitary Gene Signal (polyA), in particular from the gene for tsarahmic growth hormone (bGH) (> U.S. Patent No. 122,458) or the β-globm gene of its rabbit gland.

Detailed Description of the Invention The present invention will now be described in more detail with reference to preferred embodiments of the invention, which are not intended to limit the scope of the appended claims.

- 2.9 «44X4 * *., .. * * *«

4 «» 4 4 «44» 4 4

V «V Λ * * 4 * 44«

X «4 * 4444 4 * 4 4

44 «» * 44 «4 4 4 4X0 X»

Fig. Irt: piPlOS-plasmid

Figure 1.2; plasmid pJPI 11

Figure 1.3: Plasmid pJP120 ~

Figure 1.4: plasmid p121, for example

Figure 1.5: Plasmid pJPÖSS

Saekvencialista:

SEQ ID NO: 27: JP779. csligonucleotide

SEQ ID NO: 28: JP780. number oligonucleotide

SEQ ID NO: 29: 3P781. No. oligonkleodd

SEQ ID NO 30: JP7S2, eligon nucleobd

SEQ ID NO: 31: JP783. oligonucleotide .32. SEQ ID NO .: JP784. number oligonucleotide

SEQ ID NO: 33: JP785. oligonucleotide

SEQ ID NO: 34; JP7S6, number oligonucleotide

Preparation of oJPtgfr-nlazsgKI

Plasmid pGExM72-Implole Stoon-EeoRJ # 14 containing the genome of the PCV-2 viral in the form of EeoR1-Ragmen® (B, Msehan et al., J. Gsn. Virol. 79, 2171-2179). 1998)] was digested with EcoRI to isolate 1768 base pairs (bp) of EcoRl-RI fragment after agarose gel electrolysis.

PGV-2 virus from 1010-Stoon-Ttoeebe [B. Meehan et al., 1 night, Virol. 79: 2171-2179 (1998); GenBank Sequence Registry No. APÖ55392] was amplified by the 0RF2 gene using the polymerase chain reaction (PCR) technique, the template strand is the self-ligating EcoRldSeoRJ fragment, and

JP779 (SEQ ID NO: 27) (35 members):

- -GATGATCATGTCGACATGACGTATCCAAGGAGGCG - 3 'and 3P780 (SEQ ID NO: 28) (36 members);

5 '~ TAGTACTACAGATCTTTAGGGTTTAAGTGGGGGGTC ~ 3 ^f

730 bp for the production of a PCR plasmid. This fragment was digested with SallZRg11I to isolate the 715 bp SalEBglII restriction enzyme after agarose gel electrophoresis. This fmgxnense was then plasmid pVR1012. [Article 1. et al., Human Oeae Therapy 7, 1205-1217 (199))], previously digested with SalPBgin, yielded plasmid pJP109 (5567 bp) (Figure 1.1).

AJidUMí ™

The polymerase chain reaction was performed with plasmid pGem72-1mpl819> -Stoon (see Example 12.1) [13, Meehan et al., Gon. Virol. 79,2171-2179 (1998)] and the following oligohydroxide:

JP781 (SEQ ID NO: 29) (35 members):

5 · '• -CATGA7CATGTCGACA7GGCCAGGAAGAAGAA7GG-3 ^Í «Γ Φ« «« <««

-3Ö «« «χ * Φ ίχ * Φ X« Φ * ♦ 9 χ X * «♦ * ** ♦ φ * X» ♦ «« »* *« «« X XX · «« XX

ΙΡ782 (30, SEQ ID NO: 36):

5 '~ TACTAC'TACAGA.TCTTCAGTAATTTA7TT'CAW'GG ~ 3' & to generate a 970 bp E R fragment containing the GRV1 gene of ECV ~ 2. This fragment (digested with SalI / BglII) was digested to isolate the 955 bp SalEBgE1 restriction phthalase after agarose gel electrophoresis. This fragment was then ligated with pYR1101 plasmid, Digested with SalI / BglII-enzymes, plasmid pI111 (5810 bp) was obtained (Figure 1.2).

The rolimethez chain reaction was performed on pPCVi plasmid-1B. Meehan et al., J. Gene. Virol. 78, 221-227 (1997), and with the following oligosleotides:

JP783 (SEQ ID NO: 31) (35 members):

5 ^{f -CATCA3:} CATG7CGAGATGACGTGGCCAAGGAGGCG - 3 '

JP784 (SEQ ID NO: 32) (40 members):

S '- TACTACTACAGATCTTTATTTA7TTAGAGGGTCTTTTAGG - 3' for the purpose of producing a 73 Rbp PCR rfagmcns (PK-15 ~, GenB &amp; nk) SEQ ID NO: 11496 containing the BCR-1 viral ORR2 gene. This fragment was digested with SalYBglII to isolate the 715 bp SalI / BglII-11 restriction enzyme on agarose gel algal base. This feagrain was then plasmid pVR1012! ligations (Example 12.1) previously digested with SalI / BglII enzymes to give plasmid p.Pi210 ~ (5565 bp) (Figure 1.3),

22.4 «'/ k'míc / upd / dff

Synthesis of pJE1S1-olazinide (FCV-1-GRF1

Plasmid pPCV1, which is the genome of FGV1 virus. contained in the form of Psii-fragment {&. Meehan et al., .1. Gon. Virol. 78, 22.1-227 (1997)], was digested with EstI to isolate 1759 married couple (bp) PstlAVtl-Sagmenst after agar gel elecophoresis. This fmgmenst was subjected to self-indulgence.

PK-ISS Stock Exchange of ECV-1 (B. Meehan et al., 1997, Gene I, Virol. 78, 221-22?); GeuBat? SEQ ID NO: 1449186], gene was spliced by the polymerase chain reaction technique (PCR), using the PgII / FstI fragment as self-ligated to digest the following oligonucleoids:

JP7S5 (33, SEQ ID NO: 35):

5 ^f -CATCATCATGTCGAGAYGCCAaGGAAGAAAAGCGG-3 ^f and JP7 & 6 (SEQ ID NO: 34) (36 members):

5 '~? ACTACTACAGA ^! rCTTCAGTAA2 ^!: rTATTTTATATGG-3 ^f to generate a 965 bp ECR fragment containing the POM «virus (ΕΚ-15) strain This was digested with railmeasil Sail / BglII to obtain nectar gel This SalI / BglII restriction fragment was isolated (pVK.iO2.2 plasmid (Example 02.1)) to give plasmid pI21I (5804 bp) (Figure 1.4).

φφφφ

«Φ 9 ΦΧ» ΦΦ φ φ * Φ Φ φ X Φ Φφ φ 9 Φ »Φ Φ Φ Φ 9 φφ *» *

ΦΦΦ

ΦΦ

PREPARATION OF OTPŐSP-NLAZINIDE (PORSE GM-CSF FROM PIGS)

Pigs were bled from the jugular vein into an EDTA4 tympanic tube. Mortosmkfesrfe cells were isolated by Fleoll-grsdhmses by cetrifugation and then cultured in v / rro way with RPM1504 medium (OIBOOBRL) and stimulated by addition of coagulated n-A (Sigma) with the final addition of a supernatant. After 72 hours of stimulation, the lymphoblasts were sacrificed and total RNA from these cells was extracted using a Miero-Seale Total RNA Separator kit (Clontech) according to the manufacturer's instructions in Serbian. Revem transcription reaction was performed using the 1 H-Sü & nd cDNA Syx-thesis Kit (Perkin-Eimer), followed by polymerase chain reactions using porcine thymoblast-derived RNA-eo using the following oligonucleotides:

RÖ972 (33 members):

5 'TATGCGGCeGCCACGA2 ^{<GTGGCTGCAGAACCTG3} RÖ973 and ^t (34 membered):

5 'TATGGGGCCGCTACG? A7CAGTTGTGGGC7 ^: GGTT3 ^f to' generate PCR fetgms of approximately 450 base pairs (bp). This was digested with the enzyme feagmensil Noil to isolate it by 450 bp NothTlotl feagmensil agar vapor gel electrophoresis. This fragment was then ligated with the pVR110I peak (Example 12i), which was preferably digested and dephosphorylated with Notlenzyme, to give the plasmid p.TP058 (54.5 bp) (Figure 1.5). The cloned strain sequence of the pGMCSE-gentle pJFTP plasmid was verified and found to be identical to the sequence available in the GenOankaddatabase (accession number B21-74).

Officer drank;

wheezing pigs va

Escherfohi # · oo. / K12 strains (ΔDH10B or SCS1 strains) were transfected in Example 12.1.

with the plasmids pJF109, p, lp111, pJP058, pJP120 and p11F121 described above, the resulting five plasmid-transformed clans were then cultured separately at 37Χ-οη, Usia-Broöt (Lö). In culture medium, the cultures of bacillus were stopped at the end of the exponential phase and the plasmids were extracted according to the technique of alkaline lysis. The extracted plasmids were then confirmed in a cesium chloride gradient according to the technique described by Sambrook et al., Molecular Biology: Laboratory Marasd, 2nd Edition, 1989, Cold Sprisg Harbor Laboratory, Cold Sprlng Harbor, NY. The last extract of Ethyl Chromide and Absolute Ethanol in its presence after the blow, cleanser! plasmids were semi-suspended in TE buffer (1mM Tris / EDTA, pH 8.0) to generate strain Idates containing 2 mg / ml plasmid. These were stored in stock solutions at -250C before use.

FCV-2-yírnshóí.szármgzó <) BF; l ésORFy2, ^ gr ^ ^ gM sglójtek> vgá§a

In order to regulate the expression of PCV-2-ORE2 and PCV-2-ORP1 gene products cloned into plasmids pIP109 and pJR11, these plasmid ligands were transformed into CHO-KI cells (Chinese hamster ovary, CC, (lead) were transfected using the Lipolectamine Plus ^ Transfection Kit (Gicco-BRL Cat. No. 1-9-04-13) according to the manufacturer's instructions! köveivé.

Transfection Mán tomszfskfált 48 hours the cells were washed and ice-acetone 95% solution were fixed with 3 * Χ ΦΦ * »* φ φ ^Λ **.« * Φ. *

Φ- ♦ »* φ * χ * ♦♦♦ φ Φ ¢. »ΦΦΦ * Φ χ Φ * • Χ ·· γ ΦΦΧ # ΦΦΧ ΦΦ * * ΦΦ β $ Χ X * minutes at room temperature. .PCV-l-OFL-fehéíjto? <fl99 1D3GA and E21007SGD) and ÖRF2 proteins (Pl904C7CP, F190 281BC and P19003A8BC) were used as the first antibody specific for the antibody. Cy3-labeled Aryl-mouse IgG conjugate isobased to display specific labeling. PCV-2 specific fluorescence with 3 PCV-2 ~ ORf2 monoclonal cells in cells that can be sputtered with plasmid pJP109 but not those in pTFill plasmid. transfected. In contrast,. PCV-2-specific Euorescence was observed with 2 PCV-2-ΔRH-nymalysis in cells that were plasmid pJPII? but not in those transcribed with the p3P10-9 pktxmid. No direct response was detected with the PCV ~ 2 Laundromat! pVR1.22 plasmid in transfected CHO cells alone or in non-transfected COO cells.

The same expression result was obtained with PCV-2 virus specific polyclonal serum. In this case, Suesorescein-labeled anti-porcine IgG conjugate was used to detect specific fluorescence. /3.9 peá / a

12,8.1 Day old piglets

We put the process DÖ into the isolation unit. On the day of her caesarean section she gave birth to groups of piglets. These piglets were sacrificed at 2 days of age with various plasmid solutions as vaccines. The vaccine solutions were prepared by dilution of the forage solution in sterile physiological saline (9% NaCl).

The piglets were vaccinated with:

p.PP109 alone or with a mixture of plasmids p / P109 and pJP111, or with a plasmid plasmid pJP109 and piP101 or with pJP109-pJP111 and p105-p105.

The vaccine solutions contained 5 µg of plasmid. Volume; The vaccine-containing solutions were inoculated by imramuscular injection in a total volume of 2 ml. In practice, based on the age of the piglets (1-2 days) at the time of vaccination, 1 ml was injected into the neck on each side ('2 χ 1 ml).

Two vaccine injections were given with a two week time difference, i.e. procedure D2 and D14. day.

Procedure D21. was infected by oronasal administration of a vims suspension of virulent FCV-2 strain. The piglets were then fed for 3 weeks post-weaning systemic atrophy! specific clinical features of the syndrome in piglets. The analyzed parameters were as follows:

Rectal Temperature: Measured daily for the first 14 days, followed by two measurements 3, weekly after infection.

Weight: Piglets were weighed immediately after infection, then weekly for 3 weeks following infection.

Receiving blood samples for the presence of vireme and antibodies; blood samples were taken for D2 ,, D! 4 "D2L,

D28, D35 and D42. on the sun.

Autopsy: D42. On day 1, the surviving pigs were humanely killed and autopsied ana.73 * «« ««

Φ «Λ * 0« Φ X * '* - ♦. φφ <r «·, · * Φ ΦΦ ψί φ χ '* * Φ Φ φ ♦ Φ * *« * * «Φ

Φ Φ * Φ »β *« *

X Φ X X ΦΦ ΦΦ keresése keresése ΦΦ keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése keresése céljából keresése céljából keresése keresése keresése keresése keresése keresése keresése keresése céljából céljából keresése céljából céljából keresése keresése

12.8.2 S ~? 7 weeks old piglets

PCY-2 ~ virus-specific 5-7 week old piglets no longer bearing maternal antibodies:

with plasmid pJP109 alone or with a mixture of plasmids pIP109 and pJP111I, or with plasmids pJP109 and p1010S8, or with a mixture of ρ JP109-ρ JP111 and p.10F5-5

The doses of the blind were about the same as the doses described in Example 12.8.1: - (500 µg / kg). Of the solutions acting as vaccine, 2 rrd were injected intramuscularly (2 ml single administration to the neck muscles).

Two vaccine injections were given at 21 days with a gastric difference (D0 and > 21 days). After my last vaccine, 14 days (D35) were infected by intramuscular injection of a viral suspension of viral P € V ~ 2 ~,

The piglets were then observed for 8 weeks for post-weaning systemic atrophy! specific clinical features of scedrera in piglets. Clinical follow-up of piglets on infection was identical to Example 12.8.1. with the exception of art that the total duration of the observation is 8 weeks veit.

/ 2.9 reference / new

Swine Blindfold with IlMRIE-DOFE with RNA

Instead of the bare plasmid DNA solution described in Example 12.8, a plasmid DNA solution formulated in DMRIE-DOPE can also be subabrased. 1 mg'ml's DNA solution was prepared in 0.9% NaCl beu (described which comprises a ^V W lobha ptenídoí in Example 12.6). 0.75 µM DMRIE-LWE is prepared by adding DMRJ & DGPE in a suitable volume of sterile distilled water,

The plazndd DNA is formed by dilution of the amphiphilic IIppid complex by diluting the δ7S m'M DMR1EDÖRE solution in the same volume with the 1 mg / ml DNA solution in 0.9% NaCl, The DNA solution is gradually added to assist the syringe equipped with a 2µg needle along the wall of the container containing the cationic lipid solution, so as to eliminate foam. Gently stir as soon as the two solutions are mixed. Finally, a composition containing 0.375 mM DMRIB-DOFE and 500 pg / ml DNA solution was obtained.

It is desirable that all solutions be at room temperature for each of the operating steps described above. The DNA / DMR1E-DÖFE complex was formed at room temperature 30 minutes before the pigs were inoculated.

The pigs were vaccinated according to the conditions described in Examples 12.8.1 and 12.8.2.

The following sections are to be found in his / her No. 38,352. It is cited from U.S. Patent Application Laid-Open.

ÖRF1 (Meefaaa et al., 1998; corresponds to that described in French Patent Application No. 98 Ő37Ő7).

COL4) at 398-1342. containing genes (GettBank accession number: AFÖ55392), and potentially

Encodes its 37.7 kD predicted molar mass pad. ORE2 (Medium et al., 1998; corresponds to 98,0377).

COLI 3 described in French Patent Application Nos. 1381-1768, nucleotides 1-314.

f · 00

- 34 <0 * * «*» «*« ι * 0 X * ί »** * 0« «« «X linked to nucleotides (GenBank accession number: AF055392) ,. and 27.8 kD protein with a predicted low mass

For a better understanding of the present invention, reference is made to the following figures, in which:

Figure 2.1 (SEQ ID NO: 5) shows the mkclolylation sequence of a 3.7 kbp fragment of ALVAC DNA containing the open reading phase of G6.

Figure 2.2 is a view of the plasmid pJP102-donot plasmid.

Figure 2.3 (SEQ ID NO: 8) shows the nucleotide sequence of a 2.5 kbp fragment from the KIPI2-doubling plasmid (position 53) to the SacI-5 restriction site (position 3166).

Figure 2.4 shows a map of piPió-dunorplazHyd.

Figure 2.5 shows a map of the pJPlö? -Döwpteaid,

Figure 2.6 (SEQ ID NO: 11) shows the nucleotide sequence of a 3.6 kbp cobase fragment derived from p.iP107-donorplaznrld from the restriction site RpnI site (position 653) to the SacI restriction site (position 4255).

The present invention relates to recombinant smallpox cells that contain DNA sequences derived from PCV2 in the non-essential region of our equine viral gland. Recombinant hymenoviruses are capable of expressing a foreign PCV2 gene gene-dependent. In particular, the ÖRF2 and ÖRF1 genes expressing PCV2 proteins were isolated and inserted into ÁLYAC recombinants (canaryoma vector). Molecular biological techniques described by Sarabrook et al. (1989) were used.

Cell lines and virus strains. PCV2 ~ strains of ..Imp.lO10-Stoori 'have been previously described (Meefeaa et al., 199S). Isolated from Fesenteric rabbit glandular tissue from sick pigs from Canada The cloning of the P € Y2 genome was described by Meefean et al. (1998). The EcoR1 fragment double plasmid pGesn? Z4mp10618-SiOGB-EcoRI No. 14 contains the PCV2 genome, lysed in the EcoRI clone of plasmid pGem-7Z (Promega, Maison, WI). The complete nucleotide sequence of the strain <RTI ID = 0.0> p1106-stol-St <i> n-PCV2 </RTI> was determined by Meenan et al. GenBaoh Registry).

The parental canary virus (Rentshier strain) vaccine strain used in canaries. The vaccine strain was recovered from wild-type isolates and was attenuated by more than 2QÖ successive passages on fibroblasts from chicken embryos. One sample inoculation was subjected to four successive plaque dilutions on agar from which a plaque clone could be amplified by further passage, and then the viral stock was used as a parent virus in recombinant assays. Plaque-purified canary grass-zolatenol was designated ALV.AC. ALVAC was deported on November 14, 1996, under the Treaty of Budapest, at the Ámericaa Type Sugar Colleedon, VR-2547. Under the ATGC registry number.

The preparation of canary poisoning recombinants consists of various steps: (1) construction of a plasmid containing a transfection locus ("srtns") and a multiple cloning site (M € S>) between the two flanking arms (see, e.g. (2) preparation of dnaorpio plasmids containing a microsomal plasmid containing a foreign gene expression cassette inserted into its MCS (see, for example, Examples 13.2-13.5); (3) cellular recombination of oocytes in donor culture and the parental hymenovirus genome, allowing insertion of the foreign gene expression cassette into a &quot; smallpox virus genotype locus &quot; and the recombinant virus plaque purity (see, e.g.

* * »* * · ♦ Example 13.6), /5.3 Refresh & Up

Figure 2.1 shows the sequence of the 3.7 kb segment of canary genomic DNA (SEQ ID NO: 16). Analysis of the sequence revealed an ORF that started at position 377 and terminated at position 2254, coding for COL. . The following describes the preparation of a C6 Formation Piamide in which the C0-ORP is deleted and replaced by a multiple cloning site (MGS) flanked by transcription and translation signals. 388 fp PCR & agmes amplified over-genomic chamber DNA sequences C6 A1 (SEQ ID NO: 21) and C0BI (SEQ ID NO: 22) were amplified into 1155 bp PCR fragments. , C6C1 (SEQ ID NO: 23) and COD1 (SEQ ID NO: 24) using primer oligonucleotides. A. The 380 bp and 1155 bp PCR fragments were fused to each other as therapies and the .1613 bp PCR fragment was amplified using C6A1 (SEQ ID NO: 21) and SEQ ID NO: 24. . This fragment was digested with Sacl / Kpn.l and digested with Sacb'Kpn1 and ligated into the pBhtescript SK + vector (Stratagene, La Jolla, CA, USA). The resulting pCSL plasmid was verified by DNA sequencing. structure; 370 bp DNA kanárihlmiő CO from (Co ,, left arm "), upstream of the early signal from tertninációs tehénlúmlö-vírusbóí, translation stop hazy six reading frames and the Smal ~ _s Psí.1-, Xttol- and EcoRI hasítöhelyekkel MOS, an early termination signal from a streaming hormone virus, translational stop codons in six reading phases, and a 1,156 bp 3'-end canal inhibition sequence ("C6 right arm").

Plasma p3Pö99 containing a cowhide-derived Snow Pramoter cassette linked to a foreign gene at the SmaI / EcoRI site of pC6L heat pphenazotk, Tayior et al., 1988c; Guo et al., 1989; and Perkns et al., 1989].

The unique EcoRV cleavage sites of pJP099-p133dir have: and contained a unique Nrul cleavage site at the S 'end of the Snow promoter, and unique SaH cleavage sites contain the STOP codon of the foreign gene and the left arm of C0. Approx. Thus, the 4.5 kb EeoRV / Ssil or NroESali fragment contained the plasmid sequence (pBhtescript SK. +; Syragene, La Jolla, CA, USA), 2 Co and the 5 'end of the Heat promoter. To EeoRV or Nrul abdomen.

C6A1 (SEQ ID NO: 21) judgment oligonucleotide:

ATCATCGAGCTCGGGGŐiCGCCTATCAAAAGTCTCAATGAGTT

CóBl (SEQ ID NO: 22) oligonucleotide sequence:

GAATTCCTCGAGCTGCAGCCCGGGTTTTCACAGCTAATTAGTCATTTTTTC

GTAAGTAAGTATCTTTACCTAA

C6C1 (SEQ ID NO: 23) phage promoter oligomicleotide:

GCCGGGCTGCAGCTCGAGGAATTCTTTTTAJTGATTAACrAGirCAAATGAG

TATATATAATTGAAAAAGTAA

- 36 * φ φφ φ _κ * * ϊ φ »« «

Φφ Φ X * «* * Φ ΦΦΦ φφ φ *

0501 (SEQ ID NO: 24) Chain Commutator Oligonucleotide: GATGATGGTACCTTCATAAATACAASTTTGATTAAACTTAAGTPG

Production of ALVAC-danornlaznissis for P € ¥ 2-ORF2

Plasmid "pGEM7Z-lpi-10-Stoon-100 oRIII No, 14," containing the PCY2-gsnome in the form of EeoPJ-fragment in pGera-72 plasmid, was digested with EeoR1 and 1768 base pairs (fep) was isolated.

PCV2-ORF2 for insertion into a suitable ALVAC insertion vector, 3P768 <25. SEQ ID NO: 26) and JP7? 3 (SEQ ID NO: 26) were used to amplify PCV2-ORF2 from 1768 fep of the ligated EcoRI fragment (see above) to yield J134. The 5P7O10 primer oligonucleotide (SEQ ID NO: 25) contains the 3 'end of the Heat promoter from the EcoRV base site and the 5' end of the PCV2-ORF2, SEQ ID NO: 26. The 3 'end of PCY2-ORE2, followed by the SalI site, was a PCR product of J134, which was then digested with EcoRVSalII and cloned into approximately 75 (1bp) Sapiens from pJP099 ~ plaqueid, approximately 4.5 kb EcoKV / SalI. The resulting plasmid was confirmed by sequence annealing and pIP102 tagging (see map of p3'P106 in Figure 2.2 and its sequence as SEQ ID NO: 8 in Figure 2.3). has the same sequence as the one found in GenBank under accession number AFÖS5392.PJ1063Anorporpase (cleaved with N'otl) used in a space in vitro recombination (IRR) assay to produce ALCPAC recombinant vCPi4 (see Example 13.6),

JP76Ö (SEQ ID NO: 25):

CAT-CAT-CAT-GAT'-ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-ACG-TAT-CCAAGG "· AiGG —CG

1P773 (SEQ ID NO: 2):

TAC ~? AC "TAC ~ GTC-GAC-TTA-.GG.Ö ~ TTT - AAG-'TGG" GGG-GTC /3.3 Referee & Others

PCV2-ORF1 was amplified by PCR using the primer, .P774 (SEQ ID NO: 9) and 3P775 (SEQ ID NO: 11), using the oligonucleotide plasmid pfIEM723mpiIoI-14o-Beo-Beo. Thus, PCR .1131I was obtained. The primer oligonucleotide &lt; RTI ID = 0.0 &gt; &lt; / RTI &gt; 74 (SEQ ID NO: 9) contains the 3 'end of the Snow promoter from the bursting surface and the 5' end of PCV2-0RFI. The 3P775 lumbar spindle oligo-bicyclotide (SEQ ID NO: 10) contains the d 'end of PCY2-ORFI followed by the SsH cleavage site, PCP. its product was .11311 (approximately 1 kb), which was cloned at p2R2. I-phmidmid (InYirogen, Carlsbad, CA), The resulting plasmid was confirmed by sequence analysis and designated pJP106. The. ORF1 has the same sequence as A.F855392 in GenBank. registration number. The Nnrl / SalI fragment of about 97S bp was isolated from pJPb94 and the about 4.5 kb NrnPSa1l fragment from p099phztnid (see Example 13.1 above) was cloned, and the resulting plasmid was cleaved with marked * »*

-37 (see Figures .2.4 :). The pJP106 donor donor plasmid can be used in a recombination assay (as described in Example I3) to produce an ALVAC recombinant capable of expressing RCV2-ORF-I.

The 838 bp RamHI / Sail from plasmid p102 (see Example 13.2) was converted to a blunt chisel by cloning into a BNS polymerase cleaver and pJPl0eEeRiI batcher, which was a Clenow flask. Clones were checked by restriction analysis for insert orientation and head-to-head orientations were selected. The structure of the plasmid was confirmed by sequence analysis and designated pJIG? (See map of pIPI? In Figure 2.5, and SEQ ID NO: II in SEQ ID NO: 2), A p.lp107-donofpla; (linearized) was used in the recombinant 5 (ICR) assay for fVV; to generate an ALVAC recombinant labeled with vCPII (see Example 1: 3.0),

JP774 (SEQ ID NO: 9);

'CZ ^ T-CAT CAT TCG CGA TAT CGG-ACT-TTC-TT'A'TAT-CGT AAT GCCCAG-CAA GAA GAA TGG

7P775 (SEQ ID NO: 10);

TAC-TAC-TAC GTC GAC TGA-GTA-TAT-ATT-TTC-ATA-TGG

33.7 ze / breneröpe / ds

Preparation of ALAVAOROptazmld PCV1-ORF2-rc

Plasmid pPCVI, which contained the PCVI gene in the form of an Rss gene, was obtained from pGem-7Zplasmids [B. Mádba et al.,, 1, Gene, Virol. 78, 221-227 (1997)}, used as therapies to amplify FCVI-0RF2,

RCV2-ORF2 for insertion of an appropriate AI VC into the insertion vector; The plasmid oligonucleotides jP787 (12, SEQ ID NO: 12) and JP7S8 (SEQ ID NO: 13) were used to amplify PCV1ORP2 from pPCV1-pfezd (see above), so for PCR 71315m. The 7P? 8? Chain-initiating oligonucleotide (SEQ ID NO: 12) contains the 3 'end of the Heat promoter from EeoRVhanituclole and 0RJF2-1, followed by the Sail bay site. The PCR. 713154 was then digested with EcoRV / SalI and cloned as a 750 bp fragment of the disease gene into EcoRI / Sail-Ragnrens plasmid plasmid plasmid pJ0991 (see Example 13.1 above). The resulting plasmid was confirmed by sequence analysis and designated pJPI 13. 0S.P2 has the same sequence as Gen49 in U49I86. sequence number available under registration number. The plasmid pJID (immunized with NotiI) was used in the vbro recombination (IRR) assay to generate the vCP1-2I ALVAC recombinant (see Example 13.7).

Transient oligonucleotide sequence:

JP78? (SEQ ID NO: 12);

CAT-CAT-CAT-GAT - ATC-CGT ~ TAA ~ GTT-TGT-ATG-GTA-ATC-AGG-TGG-C C AAGG-AGG-CG

JP788 (SEQ ID NO: 13):

TAG-TAC-TAC-GTC-GAC-TTA-TTT-ATT-TAG-AGG-GTC-TTT-TAG-G

-38φ * ** X V φ φ φ φ φφ φ «φφφ« φ * Φ * »ίν« ♦ »X: *» 9 9

Φ X φφφ φφ

I4. 5 rej & exefep & fa

The pPCV1 plasmid (see Example 13.4 above), which contained the pGem-2Z plasmid in the form of the PstI fragment of the PCVI genotype, was digested with the EstI enzyme and isolated as a 1759 bp fragment,

JP7S9 (SEQ ID NO: 14) and jP790 (SEQ ID NO: 15) oligonucleotide primers were used to amplify PCVi-ORPI from the ligated PstI fragment of 1759 bp (see more), so that PCR M 316 was obtained. The soluble jP789 protein oligonucleotide (SEQ ID NO: 14) contains the 3 'end of the Snow promoter from Nrol basil and the 5' end of PCV1-ORF1 followed by the S &lt; 11 &gt; The 3P790 lineage oligonucleotide (SEQ ID NO: 15) contains the 3 'end of PCV1 Q&F followed by the SaH site, The 11316 FCR strains (approximately 1 Kb) were then cloned into pCR2, J (Invitrogen, Carlsbad, CA), The resulting plasmid was confirmed by sequence analysis and designated p3Pl4. The ORF1 has the same sequence as Ü49186 in GeoSunk-bao. No 97 / bp Nroi / Sail kagmeos was isolated from pJPUA and cloned into the N'ruI / SalIlragmetts of p, iF099 ~ of about 4.5 kb (see Example 13.1 above). the resulting plasmid was confirmed by restriction analysis and designated pJPl15. Plasmid plPl15 can be used in the recombination assay to generate a user FCV1-ORF1 capable of expressing a PACC refcombioant (see Example 13.7),

The approximately 838 bp Bam HI / Sal I derived from plasmid pJP113 (see Example 2.4) was blunt-ended and cloned into the BeoRI cleavage site of pJPUS, which was blunt-ended with the Klertow fragment. The clones were checked by restriction analysis for the ammunition orientation, and the head-to-head orientation was selected. The plasmid structure was confirmed by sequence analysis and designated pJF 117. The ρ, ΙΡΙ IT donor plasmid (ll not normalized with Nol) oh? was used in the vW recombination (fVR) assay to generate the ALCPAC recombinant vCP 1622 (see Example 13.7).

5P789 (SEQ ID NO: 14):

CAT-CAT-CA ^, -TCG-GGA "TAT-CCG - TTA-AGT-TTG - TAT-GGT-AA5 ^: -GGC" AAG ~

GAA-GAA AAG CGG

J.P790 (SEQ ID NO: 3.5):

TAG-member "GTC TAe- ~ ~ ~ GAC TGA - GGA ~ T? - T-TTT-ATA-TGG

2 <ó re / ereuempcMí

VAC-FCV2, recombinant docking station

Plasmid pJPlOG (see Example 13.2 and Figure 2.2) and pJP107 plasma plasmids (see Example 13.3 and Figure 2.5) were linearized with NotI and traumatized with ALVAC-infused printer CEF cells as described previously (Panieall and Paoleuli). , 1982; Picéim et al., 1987) using a calcium phosphate kick method. Positive plaques based on hybridization to PCV2-specific rediotype labeled probes were selected and subjected to four consecutive plaque purification cycles until a clear population was achieved. Then, one representative plaque from each IVR was amplified and Recombiners of ÁLVAC are designated as vCFlo 14 and vCP5, The recombination event of vCP1614 virus between VLC and p3'P; Ö2 donor plasmidsX ♦ * «Φ« Χ «♦ * ♦» Λ * X φ * * » ♦ »« ΦΦ 9 '' eredménye eredménye *** * · '*** * ** * »*» *, and contains the PCY2-QRF2 in the ALVAC-Có slider index. It is the result of recombination events between the vCF1Δ-vfeus ALVAC and s pJP107 donor plasmids and contains &amp; PCV2-ΔRF24 and ΔRF1 mapped to the ALVAC-Δ6 locus in head-to-head orientation.

Similarly, recombinant ALVAC capable of expressing only PCV2-ORF1 can be produced using the PI105-dono: plasmid, prepared as described in Example 13.3.

tmmnnfluoresz.eenclg. To determine whether PCV2-fibrils were expressed in ALVAC-recombinant-infected Spleen cells, nn-mmumorescence (IF) analysis was performed, Infected Spleen cells were washed with PBS 24 hours after infection (approximately 19 moles) and Do you fix the 9554 ice cold aeeton? minutes at room temperature. Five monoclonal (derived from hybrid time supernatant) specific for PCV'2-ORFi (PCV2 199 1D3GA & PCV2 216 7Ö5GD) or 0RF2 (PCV2 190 4C7CF, FCV2 199 28i.BC <& PCV2. 190 3A.8BC) -propsrate (Mab-preparahms) was applied in the first eUemmyagke. These specific monoclonal antibodies were obtained from Merial-Lyon. Monoclonal antibodies may also be obtained by reference to the publications cited herein, e.g. 09 / 082,358; and 1) 9/1, 992. The US reaction was performed as described by Tayiorés et al. (1990).

PCV2-specific intrinsic fluorescence could be detected in cells infected with the mycobacterial ORF2-specific antibody, vCP1614, and v? Pt? These results imply that, as expected, vCP10H expresses only OIU'2 and vCP105 ORF1 and ORF2-1. No fluorescence was detected in Vero-soils infected with grape ALVAC, nor in oem-infected Spleen cells, / 3.7 r <? Ymol.'mpé / to

Y / AC Vlrgk ^ ^ ^ uto kelöQRása

Plasmids p, lEÜ3 (see Example 13.4) and pJP117 (see Example 13.5) were hybridized with NotI and transfected into primary CFF cells infected with ALVAC as previously described (Faoleali and Paoletti, 19S2 et al.); , 198?) By a precipitation method using calcium phosphate. Positive plaques were selected based on hybridization to PCV 1-specific radiolabeled probes and subjected to four consecutive rounds of plaque purification until a clear population was achieved. We then amplify one of each of the 1YRs at a representative peak, and; the resulting ALVAC recombinant beacons were designated as vCPl1l and vCPll22. The result of recombination events between v? P 1621 virus ALVAC and the pJP1 IS donor plasmids, and contains PCV1? RF2 insertion into the ALVAC-Codocus; ? -0RF2 and ORFI are included in the ALVAC-SHOE-tea. inserted in head-to-head orientation.

Similarly, only recombinant ALVAC capable of expressing PCV1-ORF1 can be produced using immunoprecipitation of the Pi110 donor donor peptide prepared as described in Example 13.5. For the purpose of determining whether PCV 1 proteins are expressed

Immatatyl fluorescence (IP) analysis was performed on Spleen cells infected with recombinant ALVAC. Fertőzőit

Bladder cells were washed with PBS 24 hours after infection (about 10 m.o.L.) and fixed with 95% ice-cold aetone for 3 minutes at room temperature. Specific polyclonal serum from porcine PCV1 [Al ·

-40 ro '* 66 lan, G. et al. (1999) Vet, Microhioi 66, 115-123, was used as the first antibody and was performed as described by Taylot Anc.

PCV1-specific immunoreactive vCP162I; and vCP 1622 infected cells. They are. results show that it is expected to express -vCF1 $ 21 and vCP 1622 PGV1-specific products. No flouressenea was detected in PC V2 -specific porcine-infected cells infected with polyclonal serum vCP1621 and cells infected with vCP10222. No fluorescein was detected in Vero cells infected with grape ALVAC or in non-infectious hematopoietic cells.

73.6 re / émíriupé / da

For the production of vaccines, recombinant canarykill virus vCP1614 and vCPlII 5 (Example 13.6) can be mixed with carmer solutions. Similarly, vCPlőzi- and vCP1622-iehl recombinant kanárifeimiovírusokat (Example 13.7) can be mixed with solutions of carbomer, total, used according to the invention, component üarbopoi vakuináeiójára pigs carbomer 974P ^TO plants by a. BF Goodrich factory (the molecular # 3,000..000) First, a Carbopol 974P 1.5% · ^IM stock solution of 1 g / l ", of distilled water containing áiríum-klorkiol. The stock solution was then used to prepare 4 µg / ml C3rbopol ™ 974P solutions in physiological water. The stock solutions were mixed with the desired volume of physiological water in one step or a few successive steps, each step was adjusted to pH 1N (or more concentrated) with sodium hydroxide solution to give a final pH value of 7.3-7.4. . This final Carb »pol ™ 974P solution is ready to use for reconstitution of lyophilisate, recombinant virus or dilution of concentrated recombinant viros. For example, to make a final vrus suspension containing a dose of lo * p.fu / 2 ml, 0.1 ml of 100 ^? PIU / ml stock solution was diluted 1.9 ml, as described above, 4 mg / ml ^{Carbopo.l! M} 974P oldartal ready for use. Similarly, a ready-to-use solution of Oarh © ^{pol t3M} 974P 2 mg / ml can be prepared.

33.9 referral help

13,9,1 1 puppy piglets iffimtsöfafess

We placed groups of piglets born to Caesarean section on the day of the procedure Dö in their isolator. The piglets were inoculated with various vaccine solutions by intramuscular injection at 2 days of age. The vaccine was prepared by diluting recombinant viral kernels with artificial supernatant suspensions in sterile physiological sodium chloride solutions (0.954 NaCl). Suitable ranges for virns spies are empirically determined but are generally in the range of &gt; 10 &lt; 10 ^&gt; pfu and preferably contain about 1δ ^ϊ0 pi per dose. Vaccine solutions can also be prepared by the recombinant VIMS suspension mixed Carb »^ ool ^and 974P, with a 13.8 példásait described by.

The piglets were vaccinated;

with vCP 1614 recombinant virus (Example 13.2) with vCP 161.5 recombinant virus (Example 13.3)

Carotope mixed with vCF1614 recombinant virus (4 mg / ml solution)

Curbopohal mixes v Pló with 15 recombinant viruses (4 mg / ml solution),

The virus suspensions are 10 * plaque-per-unit units (piu) per dose. Each virus suspension was inoculated in a volumetric manner at a volume of less than 1 ml. The intracranial injection of 41 -

We gave it to the muscles.

Two dairy primers containing vlros suspension were administered on days 2 and 14 of the ghost. Infection was carried out on day 21 by oronasal administration of a supernatant suspension from a virulent PCV-2 strain. After infection, the piglets were observed for 3 weeks post-weaning, with ragitis systemic atrophy! my syndrome speciSktrs clinical features. We evaluated the following:

Rectal temperature: aaposta was measured for two weeks after infection and two measurements were made at week 3 post-infection.

Weight: The piglets were culled immediately before infection and then weekly for the first 3 weeks following the infection.

Blood Sampling for Virus and Antibodies: Blood shunts were taken on days 2-14, 21, 28, 35 and 42 of Experiment 2 to monitor vireme level and anti-βCV-2 specific antibody twins.

Necropsies: At day 42, the surviving pigs were humanely killed and necropsied for PWMS-specific macroscopic lesions. Tissue samples were prepared from the liver, hydrocytes, spleen, kidneys and thymus to search for specific pheistologic lesions in these tissues.

13,9,2 5-7-font Piglets Immunization

PCV-2 virus-specific S-7-week-old piglets no longer having maternal antibodies were injected intramuscularly with various vaccine solutions. (0.9% NaCl). Vaccine solutions may also be prepared by mixing the recombinant vlms suspension with Carbopol ^M 974P as described in Example 13.8.

The piglets were vaccinated:

from vCF with 4 recombinant viruses (Example 13.2) with vCP1 from S recombinant virus (Example 13.3)

Carbopoll & l mixed with 14 recombinant viruses (4 mg / ml solution)

VCP broth mixed with C & rbopol with recombinant virus (4 mg / ml solution).

The suspension vtrus history ^S piakkfermálő units (pfu) per dose contained .The. some virus suspensions were inoculated intramuscularly in a volume of less than 2 ad. Intramuscular injection was given into the neck muscles.

Two injections of virus suspension were given on days 0 and 21 of the experiment. Infection was carried out on day 35 by oronasal administration of virus suspension from a culture of virulent PCV-2 Forge. After infection, the piglets were observed for 8 weeks post-weaning, no-sulfosis systemic atrophy! clinical syndrome specific to the syndrome. Clinical follow-up was the same as described in Example & 13.9.1 except that the total follow-up was 8 weeks instead of 3 weeks.

Necropsies were performed during the experiment on piglets that died from infection and at the end of the experiment (day 97) on surviving piglets. The tissue samples were the same as in Example 13.9.1.

φ

-42List of References

Claims (27)

«« Γ * 1. Clark, Ε. G, Proc. Amer. Asssc. Swine Pract. 499-501 (1997). 2. Edbatter, C., R. Weiaberg, X. Taylor, A. Rey-Senelonge, X. F. Beaquek, P. Destnetre and E, Paolctti, Virology 179,901-904 (1990), 3. Ellis, A,!.,. .Hassard, E. Clark, X Haráíng, <X Adás, P. Wlllsoo, X Strakappe, K. Martja, F. MeNeiily, B. Medián, D. Tedd, D. Hsines, Cm .. Vet 3. 3 $, 44-51 (1998). 4. Goebe.1, S. X. G. P. Johnson, Μ. E. Fejte, S. W. Davis, X P. Winsfow, E .. Paoletti, Vtrologv 179,247-266, 517-563 (1990). 5. Guo, P., S. Goebei, S. Davis, Μ. E. Perk, B. Laoguet, P. Desmet & e, G. Allén, and E. Paoletii, X Virol. 03, 4189-4198 (1989). 6. Hamei, A, t, ₅ L, L. Lm and G. P, S. Nayar, 3. Virol. 72: 5202-5267 (1998), 7. Hardiag X C., Proc. Aa. Assoc. Swíae Prad 28, 503 (1997). 8. Mankem, A., X M & nksrtz, K. Wolf, H.-X Buhk, Gén. Virol. 79, 381-384 (1998a). 9. Mankertz, 3, 1L-A Buhk, G. Slaess, A. Masikeitz, Viral Gene 16,267-276 (1998b). 10. Mattbews, R, E, F., Jervervirology 17, 42-94 (1982). 11. Meefern, Β. Μ., X L, Cteeíaa, M. S. McNuÜy, D. Todd, X δα. Virol., 78, 221-222 (1997). 12. Meohsn, 8. M., E. MeNeilly, D. Todd, S. Kennedy, V. A. Jewtarst, X. A .. Bill, L. E. Hassard, E, G. Clark, D. M. Hafees, G. M. Alim, 3. δα Virol. 79,2171-2179 (1998). 13. Nayar, G. P. A. Hantéi and L. Lirs. Cas. Vet. X, 38, 385-380 (1997), 14. Pmieali, D. and E. Paoletd, Proc. Nstl, Acad. Set USA 79, 4927-4931 (1982). 15. Paolettí, E. <8. R. Llpiaskalcs, C. SamsoneiT, S. Meroer. and £>. PanicaB, Proc. Mail. Acad. Set Ü.S.A. 81, 193-19? (1984). 16. Husband, Μ. E., K. Limbach, aad £, Faotetti, .3. Virol. 1989, 03, 3829-3836. 17. Pieclrd. A., M..E. Perkus, and E, Paoletti, Young Methods, in Eitzymology, Vol, 153rd eds. Wa, R, _f and Grossmaq, L., (Ac & demíe Press) p. 545-563 (1987). 18. Sambrook, A, E. F. Frozzeb, aod T. Maníatís, M. Moiecular C-ioning: A Laboratory, 'ed., Ed. 2nd edidos, (Cold Spring Harbor Press, NY) (1989). 19. Tartaglta, 1, 3 .. Winsfow, -S, GoebeLG. P. jebtíson, A Taylor, and E, Paoleíd, X Ga VíroL ?, 1990, I517-1524. 20. Tartaglia, 3rd _,; Perkas ME, Tayte J, Noitoa EK, Aadoanet JC, Cox WI, Davis SW, van dér Hoeven), Meigaier 8, Riviera M, and E. Paoletti, Virology 188,2.17-232 (1992). 21 .. Taylor, X, R., Weirtherg, 8. Lasguet, Ph. Desuiettre and E. P & oletti, Vaccine 6,497-503 (1988a), 22. Taylor, X and E. Paoletii, Vaccfee 6,466-408 (1988). 23, Taylor »X, R. Weinberg, Y. Kawaoka, R Webster and E. Paoleöt. Yacefee 6,504-5S (1988c). 24, Taylor, A, C. Edbaner, A. Rey-SefielQftge, 3. E. B © u <pet »E, Norton, S. Goebel, P. Desmettee and E, Paoletii, 3. Virol, 64, 1441-1450 (1990). 25. Taylor, X, C. Trimarohí, R. Weinberg, 8. Pangóét, F. Guíltoia, P. Desmettre and E. Pttolerti, Vaccine 9,190-193 (1991). 26. Tayler .1, Wenihorg R, Tarlttglsa X Riehards ·! C, Álkbstib G, Briedis D, Áppel M, Norton B, Have Your Say! E., Virology 187.32s -328 (1992), ' 27, Todd, D., F. D. Níagro, B., W. Rltebse, W. Cukron, G. M. State P. & Lakert, K. S. Latíroer, W. L. StefFeas, M. S. McNniiy, Areh. Virol. 117: 129-135 (1991). * φ φ Jt φ From this detailed description of the preferred embodiments of the invention, it is to be understood that the invention as defined by the appended claims is not limited to the specific details described in the foregoing description, since many obvious variations thereof may exist without departing from the scope of the invention. - 44 «Ο *« *** χ »ψ * ** ** χ ** * Λ» references; 1 - Alias! GM, MeNeiíly F, C & ssady Jp. et al., 1995, Ifoihogesssis of edge ckeovlms; experiraestei mteetrons of coiesínan deprived plgiets aad exsmisaiion of psg foeial matter. Vet Mbrobiol 44; 49-641, 2. AHan CM, MoHbilly F, Kennedy S, et al; · I99S, Isolatlos ef porcine circoverse-like vsuses ϊΌϊΊΏ pi g5í í s wifh a wasting dysease in the United States o £ America and Europe, J Vet Diag. lo: 3-10, 3. Allan GM; Kennedy S, Mcbeeeily F, et al., 1999, Bxperlmsnta; reproeactiss! of vrasdog disease and deash by oisisfeciion of pigs vBih porcine disease and perelne paryovirus, J CompFatb 121: 1-11 (July 1999), 4. Bolt DM, Hasri H, Maller E, and Waídvogel AS: 1997, Honsnppuraiive myocardial m pigiets assoeiaíed wtth porcine parvo-váus infecdon. J Consp Path 117: 107-1 IS. 5 ', Ellls, JA, Hassard L, Clark EG, et al., 1998, Isolation of the circulatory system of the pigmentary lymphatic systemic syndrome. Can Vet J 39: 44-51 6. Ellís JA, Krakewka S, Lairroere M, et al., 1999, Reproducing the top of posriveatsing the synaptic wasting syndrome of gnotobiotic pigment, 1 Vet Díag Gum 1I: 3-14. 7. Kim BS, <lo BS and Bergetad ME: 19119, Serologist, virologist, and histopathologist of encephalopathic virus infection infection with adenoidal pigs-3 Vet Diag Invest 1: Ϊ-Ϊ04. 8. Lager KM and Lislbuf PG: 1996, Gross and Tricicroscopic Implants for Porcine Fetal Misfaction with Porcine Reproductive and Respiratory Sickness. J Vet. Diag Invest 8; 275-282, 9. Meebaa BM, MoNeiily F, Todd D, et al., 199S, Charscterization of increased circovirus DNA's 3sociated wastes syncope. J Gen Viroi 79: 2171 -2179. Shoot. Mengeltng WL 1992, Porctne parvovirns. tendon: Dísesses oíswine. ed. Lesnan AD, 7íh ed-, pp, 299-31 1. lowa. State University Press, Atrses, 1A, 1. Molitor TW, Orveerakul K, Zhang ZZ, et al. 1991, Polymerase ehain ractivation (ÉRC) sanitisation for detection of perilne parvovsras. 1 Viroi Meth 32: 201-211 12. PesrsaertMand DeMemichyW: 1973, Aporome enterovirns caosing fetal death adm. Experbnental infeetíon of pregnant femaie pigs. Zenirislbi Vetermaermed Beih 11: 2Ö25. 13. Tiscber 1, Rsscb R and Toehíennaon G; 1974, Characterization! of papovavims-and picomavíms-líke paríiclesin peonaneni piglet ktdney coll Itnes. Zentralbl-Bakertioi-worm-A 226: 353-167. 14. WestKH, Rystí'ont, JM, Wöjoa-Owícz C, et al .: 1999. Myocarditis and aborillon associated with intrinsic infections of porcine chorovirus-2. j Vet Diag invest L 4 4 ♦ 4 ♦ 4 « 4 ' -45 Patent claims * 4 4 4 «* 4 XX A first DNA plasmid DNA comprising a first stdkleoode sequence that is at least 95% identical to the ÖRFld of strain PCV-2 for use in reducing porcine bronchial and intestinal viral load. A temwogenic composition for use in reducing porcine bronchial and enteric pleural effusion, wherein said composition comprises a. following: (a) a first DNA plasmid vector comprising a first nnleotide sequence having at least 95% identity to the ORPtfoav and bi of the Inml100 johi.PCV-2 strain. or a pharmaceutically acceptable carrier and / or vector and / or excipient and / or adjuvant, 3. Application of the following: (a) a first DNA plaque DNA vector comprising a first nucleotide sequence having at least 95% identity to the GPR13 strain PCV-2 of Impl6; and b) a pharmaceutically acceptable or pharmaceutically acceptable carrier and / or vector and / or excipient and / or adjuvant for use in the preparation of an immunogenic composition for use in reducing porcine bronchial and pleural effusion in porcine bronchi. A first DNA plasmid vector comprising a first imcleoid sequence which is at least 95% identical. Impl main marked PCV-2 strain of ortho-and a second DNA plazmidvekíor comprising a second nukleotiá szekvenclát ~ _s containing at least 95% identical to marked ímplölö PCV-2 strain ORP4-pig bronchial and perennials béíboiyhaiban PCV -2 water skiing load: for rainproof use, 5. A chimeric composition for use in reducing porcine bronchial and intestinal lymphoid virus PCV-2 viral secretion, wherein the composition comprises: (a) a first DNA plasmid vector comprising a kidney of a first nucleotide sequence that is at least 95% identical to the ÖRFlo of strain PCV-2; b) a second El'NS plasmid comprising: a second n-nucleotide sequence that is at least 95% identical to OE; F4 of the ImplO110 strain PCV-2, and (c) a pharmaceutical or veterinary carrier and / or vector and / or excipient and / or anew, She. Application of the following: (a) a first DNA plasmid vector containing a first nrkylotld sequence that is at least 95% identical to the ÖRF13 of strain PCV-2; b) thus, a second DNA plasmid vector comprising a second mtkleotide sequence that is at least 95% identical to the ÖRF4 of the strain PCV-2, and c) medical! g or veterinary phage is an acceptable carrier and / or vector and / or excipient and / or adirant. -46 »* * * 4 4 «· ♦ ** ♦« »** * Λ» »4 *** for the preparation of an imnr> mogeu formulation for use in reducing porcine bronchial and pancreatic pigs PCV-2. The first plasmid for use according to claim 1; an immunogenic composition for use according to claim 2; use of the first plasmid according to claim 3; the. first and second plasmids for use according to claim 4; the immunogenic composition for use according to claim 5; or the use of the first and second plasmids as described in § 2. according to claim 1; wherein the first nucleotide sequence is identical to the ORFi3 sequence of the Impl010 strain. The first and second plasmids for use according to claim 4 or 7; the immunogenic composition for use according to claim 5 or 7; or using your first and second plasmas oh. or claim 7; wherein the second auldeodd sequence is the same as the Opldr ÖRF4 of Implol. The agent is DANUBIA Patent and Law Office Ltd. Árpád Patent Attorney