HRP940440A2 - Hybride proteins - Google Patents

Description

The invention relates to plasminogen activators, DNA encoding such hybrid plasminogen activators, hybrid vectors containing such DNA, hosts transformed with such hybrid vectors, methods for preparing such hybrid plasminogen activators DNA, hybrid vectors and hosts, and to pharmaceutical compositions , which contain such hybrid plasminogen activators.

Blood clots are a major cause of illness and death in humans in the developed world. Blood clots are an integral part of fibrin, which is formed from its soluble precursor fibrogen by the action of the enzyme thrombin. A variety of enzymes and other substances ensure that clots normally only form if and when they are needed to prevent blood loss.

Mammalian plasma contains an enzyme system, the fibrinolytic system, which can dissolve blood clots. One component of the fibrinolytic system is a group of enzymes, called plasminogens, which convert plasminogen (the inactive proenzyme form of plasmin) into the proteolytic enzyme plasmin. Plasmin then breaks down the fibrin cross-linking of clots so that soluble products are formed. In cases where the thrombolytic capacity is insufficient to remove intravascular thrombi, eg in patients suffering from thromboembolic or postoperative complications, the use of external thrombolytic agents may be necessary.

Two types of plasminogen activators (hereinafter referred to as "PA") can be isolated from human body fluids or cells: urokinase or urokinase-type plasminogen activator (hereinafter referred to as "u-PA"), a serine protease, found e.g. in human urine and kidney cells, and tissue-type plasminogen activator (hereinafter referred to as "t-PA"), which is produced by endothelial cells and is found in many endocrine tissues.

Both t-Pa and n-PA exist in two molecular forms: the single-chain form (usually designated as "sc-t-PA" and "sc-u-PA" and the two-chain (tc) form, respectively). The single chain or form of the proenzyme is transformed into the form of two chains by the action of proteolytic enzymes at precisely determined positions in the polypeptide chain. The resulting two chains of the processed PA protein remain attached to each other via the S-S bridge. The carboxy terminus or B-chain mediates the enzymatic activity of Pa, while the amino terminus of the A-chain contains regulatory units, such as fibrin binding sites. Specific binding of inactive sc-PA to blood clot constituents, such as fibrin, followed by conversion to active tc-PA with a catalytic amount of proteolytic enzymes present at that site, ultimately results in a site-specific, effective drug. t-Pa and u-PA, which are encoded by two different genes, can be distinguished immunologically and enzymatically and have a different response profile to inhibitors, stirnulators and activators. Thus, only t-PA was strongly inhibited with the protease inhibitor from Erythrina latissima (DE-3). The activity of t-PA is strongly stimulated by fibrin and fibrin fragments, while the activity of u-PA is insensitive to stimulation with fibrin and its fragments. A final property to distinguish the two PA enzymes is that tc-t-PA has a high affinity for fibrin and fibrin fragments, while tc-u-PA has no significant fibrin affinity.

Considering the insufficient serum persistence of injected t-PA, the low affinity of tc-t-PA for fibrin, and which means that the fibrin affinity of sc-to-PA is indirect, i.e. it requires additional blood. factor (cf. D.J. Binnema et al., 8th Int. Congress of Fibrinolysis, Vienna, 1986), there is a constant need for improved plasminogen activators with high affinity for fibrin, better response to stimulators, less inactivation with inhibitors and longer available half-life in blood flow.

Therefore, the subject of the proposed invention is the creation of new hybrid plasminogen activators, which will retain the beneficial properties of t-PA, while losing the undesirable properties of the original enzymes.

We surprisingly found that in the treatment of thrombosis and other conditions where it is desirable to cause fibrinolysis through plasmogenic activation, single-chain hybrid PA proteins show better biological properties compared to single-chain t-PA and u-PA. More specifically, compared to native PA, smaller amounts of novel PA molecules are required for the lysis of blood clots in vivo in accordance with the proposed invention. Hybrid single-chain PA molecules according to the invention can be produced in large quantities by recombinant DNA technology, and after infection, they will turn into a double-chain form in the patient under the influence of fibrin at the site of blood clot lysis. Double-chain hybrid PA molecules have been described in the literature (European Patent Application No. 155,387; K.C. Robbins, 8th International Congress of Fibrinolysis, Vienna, 1986), however the more favorable single-chain forms of hybrid PA molecules cannot be produced at the protein level, as stated in the cited literature, but they can be produced in larger quantities and on an industrial scale by recombinant DNA technology.

A further subject of the proposed invention is therefore the creation of means and methods for the production of said single-chain u-PA/t-PA hybrid proteins. Such means include DNAs encoding said u-PA/t-PA hybrid proteins, hybrid vectors containing said DNAs, and hosts transformed with said hybrid vectors. Also provided are methods for obtaining said single-chain u-PA/t-PA hybrid proteins, said DNA, said hybrid vectors and said hosts.

The proposed invention also provides a better process for obtaining double-stranded hybrid PA molecules, as single-stranded recombinant DNA products can be cleaved in vitro with suitable proteolytic enzymes, such as plasmin.

Detailed description of the invention

The invention relates in particular to a single-chain hybrid PA, which has a series of amino acids composed of at least two subunits, which corresponds to human t-PA and human u-PA in terms of amino acid identity and number of subunits. Similar to other serine proteases, involved in fibrinolytic and blood coagulation systems, u-PA and t-PA have large, non-catalytic segments, assembled in chain A, which is attached to the catalytic region (chain B). The non-catalytic A-chain can first be divided into discrete domains: a "finger" domain, a "growth factor" domain and two "kringle" structures, while the A-chain of u-PA is composed of a "growth factor" domain and one "kringle" structure / for reference see L. Patthy, Cell 41, 657-663 (1985)/. The catalytic site of B-chains is composed of His, Asp and Ser residues at positions 322, 371 and 478 (t-PA) and 204, 255 and 356 (u-PA) and is essential for fibriolytic activity.

A protein domain is a structural and/or functional unit in the overall structure of the entire protein. For example in t-PA chain A there are four domains ("finger", growth factor and two domains "kringle") arranged in a sequence. Domain boundaries are best defined by the positions of exon-intron junctions in the corresponding DNA sequence (L. Patthy, above). However, for practical reasons, the minimum size of each domain was defined in the sequence of amino acids between the first and last cysteine residues within each domain, which are probably involved in the formation of the S-S bridge. Amino acids before and after these domains, adjacent to cysteine residues, are defined as connecting strings (J.). The positions of the exonitron bonds (see above) are in these regions.

Thus, a single-chain t-PA of the following formula can be represented: T - F - Jl - G - J2 - Kl - J3 - K2 - J4 - TPAB, where T represents the N-terminal part comprising amino acids 1 to 5, F is the domain " finger", comprising acids 6 to 43, G is the growth factor domain, comprising amino acids 51 to 84, K1 is the "kringle" 1 structure comprising amino acids 92 to 173, K2 is the "kringle" 2 structure, comprising amino acids 180 to 261, TPAB is the catalytic serine protease region, encompassing amino acids 307 to 527 and J1 (amino acids 44 to 50), J2 (amino acids 85 to 91), J3 (amino acids 174 to 179), and J4 (amino acids 262 to 306) are linker sequences that connect the domain segments.

A single-chain U-PA can be represented by the following formula:

T' - U - J5 - K - J6 - UPAB

where T' represents the N-terminus comprising amino acids 1 to 12, U is the growth factor domain comprising amino acids 13 to 42, K is the "pretzel" structure comprising amino acids 50 to 131, UPAB is the catalytic serine protease domain, comprising amino acids 189 to 411, and J5 (amino acids 43 to 49) and J6 (amino acids 132 to 188) are linker sequences connecting the domain segments.

Each of the binding sequences J4 and J6 contains an activation site (site of chemical conversion) and another N-terminal cysteine residue, which is involved in the S-S bridge in the catalytic (B-chain) region.

We surprisingly found that single-chain hybrid PAs, which contain the serine protease catalytic domain of one of the PAs (TPAB or UPAB), attached to a series of amino acids, which contain all or discrete domains of the A-chains of other PAs, or discrete domains of both PAs, show useful pharmacological properties.

The invention therefore relates to a single-chain hybrid PA comprising an amino acid sequence that contains all or discrete domains of the A-chain of human u-PA or discrete domains of the A-chain of human u-PA and human t-PA, linked sequentially to the catalytic region of human t -PA (TPAB) and to a single-chain hybrid PA, comprising an amino acid sequence, which contains all or discrete domains of human t-PA or discrete domains of the A-chain of human t-PA and u-PA, linked consecutively to the catalytic region of human u- Well (UPAB). In an advantageous embodiment, the hybrid PAs according to the invention contain the catalytic region of human u-PA (UPAB).

The invention particularly relates to single-chain PAs, which contain an amino acid sequence, selected from the group consisting of a series of amino acids, which contains all domains of the A-chain of human t-PA, a series of amino acids. comprising discrete domains of the A-chain of human t-PA, such as "finger" or "kringle" domains, particularly the "kringle 2" domain of human t-PA, and an amino acid sequence comprising two, three or four domains of the A-chain of human t-PA t-PA and/or human u-PA, especially two or three domains of human t-PA, or two or three domains of human u-PA and human t-PA, such as "finger", growth factor and "kringle" domains 2" of human t-PA, the "finger" and "kringle 2" domains of human t-PA or the growth factor domain u-PA and "kringle 2" t-PA, whose amino acid sequence is linked consecutively to the catalytic region of human u-PA and to single-chain PA, which includes the amino acid sequence containing the growth factor u-PA and "kringle" t-PA, whose amino acid sequence is linked consecutively to the catalytic region of human t-PA.

Preference is given to said amino acid sequences of hybrid PA with the N-terminal sequence of t-PA (T, amino acids 1 to S) or u-PA (T', amino acids 1 to 12) or starting with any linker sequence that is naturally N-terminally linked to the first domain of the hybrid PA, or with a fragment of such a linker sequence, which fragment preferably has at least five amino acid residues.

In the hybrid PA according to the invention, the domains are connected on the A-chain via native binding strings (eg J1, J2, J3 and J5), fused binding strings, or hybrid binding strings or their fragments.

The A-chain domains of the hybrid PAs of the invention are linked to the B-chain of the serine protease region (TPAB or UPAB) with a linker selected from the group consisting of the linker I, which connects the A-chain to the B-chain in human t- PA, the linker sequence J6, which connects the A-chain to the B-chain in human u-PA and a hybrid sequence composed of subunits of said linker sequences, wherein said linker sequence includes an activation site that can cleave plasmin and an additional N-terminal cysteine residue, which may participate in the sulfur-sulfur bridge to the catalytic region of the B-chain, where the linker sequence preferably has at least forty and even up to 60 amino acid residues.

The greatest advantage is connecting the domain at the position defined by the exon-intron connections to the corresponding DNA. The connection of the A-chain with the B-chain is primarily advantageous at the activation site.

Thus, the first domain is linked to the second domain with a linker sequence, which naturally appears in the C-terminal part of the first domain, with a linker sequence, which naturally appears in the N-terminal part of the first domain, with a linker sequence, which naturally appears at the N - the end part of the second domain, with a fused binding sequence, which is composed of the mentioned binding sequences or their fragments.

The invention particularly relates to a single-chain hybrid plasminogen activator, selected from the group consisting of such a hybrid plasminogen activator comprising the A-chain of u-PA, or an A-chain composed in a characteristic manner of the growth factor domain of u-PA and "kringle 2". t-PA, bound consecutively to the catalytic region (B-chain) of t-PA, and to the hybrid plasminogen activator, which includes the A-chain of t-PA, the A-chain composed in a characteristic way from the "finger" domain of t-PA, A -chain composed in a characteristic way from the growth factor domain u-PA and "kringle 2" t-PA, A-chain, composed in a characteristic way from the domain "finger" t-PA and "kringle 2" or A-chain, composed at a characteristic way from the "finger" domain of t-PA, the growth factor and "kringle 2" of the mentioned A-chain, which is connected consecutively to the catalytic region (B-chain) in-PA, whereby the A-chain is connected to the B-chain via a linker containing an activation site and a cysteine residue capable of forming an S-S bond to the B-chain.

In particular, the invention also relates to a single-chain hybrid plasminogen activator, which includes an A-chain composed in a characteristic manner of the "kringle 2" domain of t-PA, linked to the catalytic region (B-chain) of u-PA at the activation site.

Of particular advantage is a single-chain hybrid plasminogen activator selected from the group consisting of such a hybrid plasminogen activator comprising an A-chain composed in a characteristic manner of a growth factor domain of u-PA and a "kringle 2" domain of t-PA, linked in sequence to the catalytic region (B-chain) of t-PA and to the hybrid plasminogen activator, which includes the A-chain, composed in a characteristic way of the "kringle 2" domain of t-PA or the "finger" and "kringle 2" domains of t-PA, bound consecutively to the catalytic region (B-chain) of u-PA, whereby the connection between the domain(s) of the A-chain and the B-chain is at the activation site.

Hybrid PAs in terms of the invention, which are preferred, are:

UPAATPAB(BC) = [uPA(1-158)-tPA(276-527)],

UPAATPAB(BR) = [uPA(1-131)-tPA(263-527)],

UPAATPAB(BC) = [tPA(1-275)-uPA(159-411)],

UPAATPAB(BR) = [tPA(1-262)-uPA(132-411)],

UK2UPAB(BR) = [uPA(1-44)-tPA(176-261)-uPA(134-411)],

FUPAB(BC) = [uPA(1-49)-tPA(262-275)-uPA(159-411)],

FUPAB(BR) = [tPA(1-49)-uPA(134-411)],

FK2UPAB(BC) = [tPA(1-49)-tPA(176-275)-uPA(159-411)],

FK2UPAB(BR) = [tPA(1-49)-tPA(176-262)-uPA(132-411)],

UK2TPA(BC) = [tPA(1-44)-tPA(176-527)],

K2UPAB(BC) = [tPA(1-3)-tPA(176-275)-uPA(159-411)],

FGK2UPAB(BC) = [tPA(1-86)-tPA(176-275)-uPA(159-411)], and

FGK2UPAB(BR) = [tPA(1-86)-tPA(176-262)-uPA(132-411)],

where UPAA is the A-chain of u-PA, TPAA is the A-chain of t-PA, UPAB is the B-chain of u-PA, TPAB is the B-chain of t-PA, U refers to the growth factor domain of u-PA , K2 refers to the "kringle 2" domain of t-PA, F refers to the "finger" domain of t-PA, G refers to the growth factor domain of t-PA, (BC) indicates that the link between the A-chain domain and of the B-chain at the activation site, and (BR) indicates that the domain(s) of the A-chain are (are) linked to the B-chain via a linker sequence, naturally attached to the B-chain, which includes the activation site, and further, the N- the last, cysteine residue, which is involved in the S-S bridge to the B-strand. The numbers refer to the sequences of amino acids taken from u-PA and t-PA. For example UK2UPAB(BR) - /uPA(1-44)-tPA(176-261)-uPA(134-411/) stands for single-chain hybrid plasminogen activator, consisting of amino acids 1-44 (growth factor domain; U), in -PA and amino acid 176261 ("kringle 2" domain, K2) of t-PA, linked in a linear fashion to amino acids 134-411 (B-chain, UPAB) of u-PA.

Of particular advantage are the hybrid plasminogen activators TPAAUPAB(BC), FUPAB(BC), FGK2UPAB(BC) and especially UK2TPAB(BC), FK2UPAB(BC) and K2UPAB(BC).

The invention further relates to mutants of hybrid PAs, in the sense of the invention, in which at least one, and preferably all, N-glycosylation sites are modified so that glycosylation cannot take place at that site(s). . It is well known that the first condition for N-linked glycosylation, in mammalian cells, is the presence of the tri-peptide sequence -Asn-L-Ser-(or Thr)-, where Asn is the acceptor and L can be any genetically encoded amino an acid, other than proline or aspartic acid, that prevents glycolysis. In the t-PA molecule, these three sites for N-glycosidic linkage (the numbers refer to the position of Asn in the amino acid sequence of t-PA, compare Figure 1, attached drawings): -Asn117-Ser-Ser- (present in "kringle 1" ), Asn184-Gly-Ser (present in "kringle" 2) and Asn448-Arg-Thr (present in t-PA B-chain). The only N-linked glycosylation site of u-PA is in the B-chain (Asn302-Ser-Thr, compare Figure 3). Clearly, hybrid PAs comprising t-PA "kringle" 1, t-PA "kringle" 2, B-chain t-PA and/or B-chain u-PA also include individual N-linked glycosylation sites.

Therefore, to prevent glycosylation at individual (one or more) glycosylation sites, sequences in the tripeptides, known as N-glycosylation signals, must be altered. Substitution of Asn and/or Ser (or Thr) residues in the above tripeptide sequences to any other amino acid would prevent the formation of glycosidic bonds at these sites. For convenience, modification of N-glycosylation sites was not performed at the protein level. Instead, it is useful to modify the gene encoding the hybrid PA in such a way that after the expression of said modified gene in the host, a hybrid PA mutant is produced, in which one or more N-glycosylation sites have been changed in such a way that it cannot take place at these sites glycosylation. It is advantageous to modify all Nglycosylation sites occurring in the hybrid PAs of the invention.

First of all, asparagine is replaced with valine, leucine, isoleucine, alanine or especially glutamine, and serine or threonine with valine, methionine or especially alanine.

First of all, preference is given to modified hybrids

AND:

FUPAB(G1n302)(BC) = [tPA(1-49)-tPA(262-275)-uPA(159-301, Gln, 303-411)],

FK2(A1a186)UPAB(G1n302)(BC) = [tPA(1-49)-tPA(176-185, Ala, 187-275)- uPA(159-301, Gln, 303-411)],

UK2(Ala186)TPAB(Ala450)(BC) = [uPA(1-44)-tPA(176-185, Ala, 187-449, Ala, 451-527)],

K2(Ala186)UPAB(G1n302)(BC) = [tPA(1-3)-tPA(176-185, Ala, 187-275)-uPA(159-301, Gln, 303-411)],

FGK2(Ala186)UPAB(Gln302)(BC) = [tPA(1-86)-tPA(176-185, Ala, 187-275)-uPA(I59-301, Gln, 303-411)],

and so on

FK2UPAB(Gln302)(BC) = [tPA(1-49)-tPA(176-275)-uPA(159-301, Gln, 303-411)],

K2UPAB(G1n302)(BC) = [tPA(1-3)-tPA(176-275)-uPA(159-301, Gln, 303-411)],

UK2TPAB(Ala450)(BC) = [uPA(1-44)-tPA(176-449, Ala, 451-527)], and

FGK2UPAB(Gln302)(BC) = [tPA(1-86)-tPA(176-275)-uPA(159-301, Gln, 303-411)].

Hybrid PA and its mutants in the sense of the invention can be prepared by recombinant DNA technique, which includes, for example, the cultivation of a transformed host, which shows the hybrid PA protein or its mutant, under conditions that allow their expression and isolation of the hybrid PA protein, i.e. mutants of the hybrid PA protein. More specifically, the desired compounds are produced:

a) by obtaining DNA encoding the hybrid PA protein and its mutant, or by chemical synthesis of such DNA,

b) inclusion of DNA in a suitable expression vector,

c) transfer of the resulting hybrid vector to the receiving host,

d) selection of the transformed host from non-transformed hosts, e.g. by cultivation under conditions under which only the transformed host survives,

e) growing the transformed host under conditions that enable the expression of the hybrid PA protein i

f) isolation of hybrid PA protein or its mutant.

The steps involved in the preparation of hybrid PA proteins by the recombinant technique will be described in detail below.

DNA encoding hybrid PA proteins

The invention relates to DNA that has a sequence that encodes a hybrid PA, which is composed of at least two subunits that correspond in identity and number of amino acids to the subunits of human u-PA and human t-PA, or that encodes its mutant. The invention particularly relates to DNA having a sequence encoding each of the hybrid PA proteins and mutants thereof already mentioned as having an advantage.

DNA has the advantage in terms of the invention of the attached sequence at its ends. In particular, these flanking sequences include suitable restriction sites that allow the DNA to be integrated into suitable vectors.

Furthermore, the DNA of the invention includes a signal sequence for u-PA or t-PA, attached to the first codon of the sequence, which encodes the mature hybrid PA. If they are expressed in yeast cells, the DNA according to the invention may contain an alternative yeast signal sequence as a signal sequence naturally associated with the yeast promoter used, in particular a PHO5 or invertase signal sequence.

It is advantageous that the nucleotide sequences in the DNA subunits are identical to the nucleotide sequences in cDNA u-PA, i.e. cDNA t-PA. However, due to the degeneration of the genetic code, the nucleotide sequences can differ if the resulting amino acid sequence remains unchanged. In the DNA encoding the hybrid PA mutant, at least one codon encoding an amino acid essential for N-glycosylation in the hybrid PA protein is replaced by another codon encoding another amino acid that prevents recognition of the N-glycosylation site.

The nucleotide sequences for u-PA cDNA and t-PA cDNA are known (cf. W.E. Holmes et al., Biotechnology 3, 923-929 (1985); D. Pennica et al., Nature 301, 214-221 (1983)/ Furthermore, all nucleotide sequences in the genome for the u-PA and t-PA genes, including the mixture of introns and exons, were determined (cf. A. Ricco et al., Nucl. Acids Res. 13, 2759-2771 (1985) ; S. J. Friezner-Degen et al., J. Biol. Chem. 261, 6972-6985 (1986) /.

Knowing the sequence of cDNA and genomic DNA for u-PA and t-PA, we can create DNA according to the invention by methods known in the art. Methods for making these DNAs include chemical synthesis of DNA or preparation of fragments, which encode polynucleotide subunits for u-PA and t-PA cDNA and their reconnection into a predetermined sequence of choice, which includes one or more, as two or three steps of mutation.

DNAs encoding hybrid PA mutants, in terms of the invention, can be made by methods known in the art. Methods for making these DNAs include cutting out a segment of DNA, containing a codon for an undesired amino acid residue, from the parental hybrid PA gene and replacing it with a DNA sequence in which said codon has been replaced with a deoxyribonucleotide triplet, which codes for the desired amino acid residue or management of deoxyribo-nucleotide substitution by site-directed mutagenesis.

Chemical synthesis of DNA is well known in the art and uses conventional techniques. Suitable techniques were collected by S.A. Narang /Tetrahedron 39, 3 (1983)/. Special methods, described in European patent application no. 146,785 may be used and are incorporated by reference.

Another approach to DNA synthesis according to the invention consists in excision of suitable restriction fragments, which encode the polynucleotide sequences for u-PA and t-PA, from u-PA cDNA and t-PA c-DNA (or genomic u-PA DNA or t- PA DNA) and the use of these fragments for the preparation of the structural gene for the entire hybrid PA. In both strategies, care must be taken to fuse fragments at the sites between domains, in order to preserve the latter intact. The first strategy uses suitable restriction sites. If a suitable restriction site is available at the predetermined binding site(s) in both u-PA and t-PA DNA, the DNA is digested with the appropriate restriction endonuclease and the fragments are ligated with blunt or open ends (no opposite bases) (depending on the chosen restriction endonuclease). Another possibility is to introduce useful restriction sites, for example, by site-directed mutagenesis /cf. M. J. Zoller et al., Methods Enzymol 100, 468 (1983)/, and care is taken that the mutated DNA does not result in an altered amino acid sequence. Of particular advantage are natural or artificially introduced restriction sites that separate DNA encoding A- or B-chains or DNA encoding discrete domains containing A-chains: In this way, hybrid DNAs encoding hybrid PAs can be produced , which have the desired connection between the A-chain domain and the catalytic serine protease message.

The second strategy starts from the hypothesis that domain boundaries are best defined with the position of exon-intron connection in DNA genomes /cf. L. Patthy, Cell 41, 657-663 (1985)/, i.e. of the position of the cDNA, where the introns were joined. Since these positions rarely coincide with restriction sites, a scheme is accepted that can be followed for each new construction; in the first step, restriction fragments are prepared that encode a specific domain (e), and also contain additional DNA sequences, except for the expected fusion point (up to more than 100 base pairs), they are connected and subcloned into bacteriophage m13. In a second step, excessive sequences are disrupted by mutagenesis in vitro (Zoller et al., supra). This procedure allows in-frame fusion at each predetermined nucleotide position and is therefore advantageous.

For the preparation of hybrid PA mutants, a part of the mature hybrid DNA can be excised using restriction enzymes. The first condition of this method is the possibility to change suitable restriction sites near codons. A small restriction fragment, containing a codon for an unwanted amino acid, is removed by cleavage with an endonuclease. A suitable sequence of double-stranded DNA is prepared, for example by chemical synthesis, in which triplets encoding the desired amino acid are used. The DNA fragment is ligated in the appropriate orientation to the rest of the large fragment, to obtain the double-stranded DNA sequence, which encodes the hybrid mutant. For convenience and for ease of working with the hybrid gene, it is convenient that it resides in a larger DNA segment, which is accomplished with suitable linkers, which allow inclusion and cloning of the segment in a cloning vector.

In a preferred embodiment of the proposed invention, DNA encoding the hybrid PA mutant is prepared by site-directed mutagenesis. That method is mutagenesis in vitro, which can change a certain place within the region of cloned DNA / compare the following articles: M.J. Zoller, M. Smith, Methods Enzymol. 100, 468 (1983); D. Botstein, D. Shortle, Science 229, 1193 (1985)/. Mutagenesis can be carried out either on the entire gene of the hybrid PA or on its functional part, which contains the codon for the unwanted amino acid (e). After mutagenesis, the mutated functional part is connected to another part of the hybrid PA, to obtain a mutant of the hybrid PA.

The method of mutating the hybrid PA gene or its functional part is characterized by the fact that the single-stranded gene or single-stranded DNA containing the PA gene or its part is hybridized with an oligohexoxyribo-nucleotide example, which is complementary to the region of the hybrid gene, which will be mutated, except for poorly matched (pairings), which direct mutation; hybridized oligodeoxyribonucleotide is used as an example to start the synthesis of a complementary DNA strand, the resulting (partially) double-stranded DNA is transformed into a host type of microorganism, and it is cultivated, and transformants containing DNA with a modified (mutated) gene for hybrid PA are selected.

Hybrid vectors containing hybrid PA DNA

The invention relates to hybrid vectors, which contain DNA encoding a hybrid PA, which is composed of at least two subunits, which in terms of identity and number of amino acids correspond to the subunits of human u-PA and human t-PA, or encode its mutant, and to methods for their preparation.

The vector is chosen depending on the host cells planned for transformation. In principle, all vectors that replicate and express the desired polypeptide gene of the invention in a selected host are suitable. Examples of suitable hosts are eukaryotes, which are without or with few restriction enzymes or modified enzymes such as yeasts, e.g. Saccharomyces cerevisiae, e.g. S. cervisiae GRF18 and furthermore mammalian cells, especially the mentioned human or animal cell lines, e.g. myeloma cells, human embryonic lung fibroblasts L-132, COS cells, LTK cells, human cancer-like Bowes melanoma cells, HeLa cells, African green monkey COS-7 kidney cells transformed with SV-40 virus or Chinese hamster ovary (CHO) cells and variants thereof. As host microorganisms, upper mammalian cells and species of Saccharomyces cerevisiae, eg S. cerevisiae GRF18, are preferred.

a. Vectors for use in yeast

The vectors, which are suitable for cloning and expression in yeast, contain a yeast double bud and a yeast selectable genetic marker. Hybrid vectors, which contain a yeast replication origin, eg, a chromosomal segment (locus) that replicates independently, remain within the chromosomes in the yeast cell after transformation and replicate independently. Hybrid vectors containing sequences homologous to the 2µ plasmid DNA of yeast can also be used. Such hybrid vectors will integrate by recombination into 2µ plasmids, which already exist in the cell, or have duplicated independently. 2µ sequences are particularly suitable for plasmids, which have a high frequency of transformation and allow high copy numbers.

Suitable genetic markers for yeast are particularly those that confer antibiotic resistance to the host, or in the case of auxotrophic mutant yeasts, genes that repair damage to the host. The corresponding genes provide, for example, resistance to the antibiotic G418 or ensure the possibility of photosynthesis in auxotrophic yeast mutants, for example the URA3, LEV2, HIS3 or TRP1 gene. Furthermore, yeast hybrid vectors preferably contain a double primer and a gene marker for a bacterial host, particularly E. coli, so that the construction and cloning of hybrid vectors and their intermediates can take place in the bacterial host.

Expression control sequences suitable for expression in yeast are, for example, those between well-expressed yeast genes. Thus, promoters of the TRPI gene, ADHI or ADHII gene, acid phosphatase genes (PHO3 or PHO5), the isocytochrome gene or the promoter for glycolysis genes can be used, such as the promoter of the enolase gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 3-phosphoglycerate kinases (PGK), hexokinase, pyruvate decarboxylase, phosphorfructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase, invertase and glucokinase. Preferred vectors of the present invention contain transcriptionally controlled promoters, eg, the promoters of the PHO5 and ADHII genes, which can be turned on or off when growth conditions are changed. For example The PHO5 promoter can be stopped or released exclusively by increasing or decreasing the concentration of inorganic phosphate in the medium. First of all, hybrid yeast vectors, in the sense of the proposed invention, also comprise 3 flanking sequences of yeast genes, which contain a suitable signal for termination of transcription and polyadenylation. Suitable 3 flanking sequences are, for example, those which are naturally bound in the gene to the promoter used, such as the 3 flanking sequence in the yeast PHO5 gene.

b.Vectors for use in mammalian cells

Vectors for replication and expression in mammalian cells often have DNA from a viral source, eg from simian virus 40 (SV40), Rous sarcoma virus (RSV), adenovirus 2, bovine papillomavirus (BPV), mutant papovavirus (BK BKV) or murine or human cytomegalovirus (MCMV or HCMV).

Expression control arrays suitable for use in mammalian cells include, but are not limited to, the SV40 early and late promoters, the adenovirus major late promoter, the rodent metallothionein gene promoter, and the enhancer region of the mouse or human cytomegalovirus major sudden-early gene, the human immunoglobulin enhancer promoter region, the human α-globin promoter, optionally in combination with the SV40 enhancer promoter, and promoters derived from heat-shocked genes.

Suitable marker genes for mammalian cells are, for example, the neo and ble genes of transposon Tn5, which confer resistance to the antibiotic G418, i.e. the antibiotic bleomycin, the E.coli gene, resistance to hygromycin B, the gene for dihydrofolate reductase (dhfr) from mammalian cells or E .coli, which changes the phenotype of DHFR- cells to DHFR+ cells and/or. confers resistance against methotrexate and the thymidine kinase gene of Herpes simplex virus, which makes TK- cells phenotypic TK+.

In particular, the hybrid vectors contain a 3' non-digestible portion of the mammalian gene, which contains signals for similar termination of transcription and polyadenylation, such as the 3' flanking portion of the β-globin gene. More conveniently, the regions flanking the polypeptide coding region include one or more native introns, which have suitable binding signals at their ends. These additions are considered necessary, because cDNA and prokaryotic DNA, like the above selection genes, often do not have such processing and transcription signals.

For propagation in E. coli, vectors preferably have a transcription start and an antibiotic-resistant gene. A mammalian replication origin can be produced either by including a eukaryotic primer in the construction of a vector, one that comes from SV40 or another viral source, or we can produce it with the host cell's chromosome after integration of the vector into the host cell's chromosome.

In particular, the hybrid vectors we use in mammalian cells comprise the hybrid PA cDNA or hybrid PA mutant partially flanked, on the upstream side, by the cytomegalovirus rodent sudden-early gene promoter and, on the downstream side, by the 3'-end of the rabbit β-globin gene, which includes the second intron with its appropriate binding signals and polyadenylation sequence. Furthermore, they contain the sequences encoding the neomycin resistance gene from transposon Tn5, or in the given case from Tn9, or sequences encoding hygromycin phosphotransferase, closely flanked, upstream of the sequence, by the early promoter from the SV40 virus, which also includes the SC40 start replication, and the native promoter of the Tn5 neo gene, and, on the downstream side, the segmental SV40 early gene, which includes small t-antigen binding and polyadenylation signals. The entire construct is cloned into a fragment of the plasmid E.coli pBR322, which includes the plasmid origin of replication, the ampicillin resistance gene, but lacks these toxic sequences, which inhibit SV40-mode DNA replication in mammalian cells. Optionally, we include the gene encoding dihydrofolate reductase (DHFR) in the vector; the modular DHFR gene described in R.F. Kaufman et al., /Mol. Cell. He was. 2, 1304-1319 (1982)/. This modular DHFR gene consists of sequences from an even larger adenovirus type 2 late promoter, an immunoglobulin gene fragment, a cDNA encoding part of the rodent DHFR, and an SV40 initial polyadenylation site.

New hybrid vectors, preferred for use in mammalian cells, represent advances in the art. They are superior to previously known vectors in that they contain a strong expression signal for the cloned cDNA, located in the mouse sudden-early promoter and in β-globin binding/polyadenylation arrays in an environment that allows high-level expression in an extremely wide variety of cellular vertebrate species More specifically, the vectors can be used (a) to express the cDNA transiently in normal i.e. SV40-untransformed tissue culture cell lines, but (b), even better, with higher copy numbers in SV40-antigen-expressing primate cells , to allow the vector to replicate via its SV40 origin, but also (c) to express such cloned cDNA stably in normal tissue culture cell lines, where the vector can be integrated into the host cell's chromosome and (d) even better, because of the higher copy number , if we introduce the SV40T-antigen, which is produced by primate cell lines, where the vector can replicate episomally.

The enhancer-promoter part of MCMV includes, for example, DNA starting at nucleotides -835 to -443 and ending at nucleotide +50 (number from the mRNA start) on the 5' part of the MCMV larger sudden early gene. In particular, the enhancing promoter portion of MCMV comprises nucleotides -542 to +50.

3', the adjacent part of the rabbit β-globin gene consists of the second half of the rabbit β-globin gene /P. Dierks et al., Proc. Natl. Acad. Sci. USA 78, 1411-1415 (1981); A. van Ooyen et al., Sciens 206, 337-344 (1979) /, starts in the second exon, preferably at the BamHI site, thus includes the second intron with binding signals to its flanking sequences, and concludes with polyadenylation signals, primarily at the BglII site, located 1.2 kb upstream of the BamHI site.

The SV40 origin of replication is found, for example, in the HindIII-SphI fragment of viral DNA /nucleotides 5171 to 128, start = position 1; Tooze J. (ed.) DNA Tumor Viruses, Part. 2, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y. 1982/. A preferred embodiment is any HindIII-HpaII fragment (nucleotides 5171 to 346), which, in addition to the initiation of replication, also contain a viral promoter, used to accelerate transcription of the selection gene of the vector.

The neomycin gene is cloned behind a promoter that is active in tissue culture cells, preferably the SV40 early promoter, eg set on the HpaII-HindIII fragment, mentioned above. The coding sequences of the neomycin gene are found, for example, on the Bg1II-SmaI fragment from the transposon Tn5 /E. Beck et al., Gene 19, 327-336 (1982); P. Southern et al., J. Mol. Appl. Genet. 1, 327-341 (1982); F. Colbere-Garapin et al., J. Mol. He was. 150, 1-14 (1981/. It is advantageous to equip the neomycin gene with another promoter, which also allows transcription in E.coli. For example, the native Tn5 promoter of the neomycin gene, which is primarily located on the HindIII-BglII fragment, can be positioned behind of a eukaryotic promoter in front of the neo coding sequence (Southern et al., above), or further upstream, in front of a eukaryotic promoter (Colbere-Garapin et al., above).To be expressed in tissue culture cells, the bacterial neo gene must be followed by a polyadenylation signal , preferably part of the SV40t antigen gene, which also contains binding signals. The sequence encoding neomycin phosphotransferase, especially the BflII-SmaI part of the Tn5 fragment mentioned above, can also be replaced with the sequence encoding hydromycin B phosphotransferase, preferably in the form of a BarnHI fragment of plasmid pLG89 /L Gritz et al., Gene 25, 179-188 (18983)/, which is even better included in pSVd /Luedin et al., EMBO-J. 6, 109-114 (1987), a derivative from pSV2811 neo, in which BglII links were introduced r at the SmaI site in the vector.

Another preferred selection gene includes the coding sequence for the enzyme dihydrofolate reductase, as in pSV2dhfr ATCC 37145), which allows not only the selection of transformed cell types, but also the amplification of the plasmid-associated DNA sequence, often with a proportional increase in protein production in terms of inventions, coded in plazrnid.

The fragment emerging from the pBR322 E.coli plasmid includes the pBR322 origin of replication and the ampicillin resistance gene. The fragment is preferably taken from a pBR322 derivative, such as pSVOd /P. Mellon et al., Cell 27, 279-288 (1981)/, in which the team was removed. toxic sequence, which would inhibit SV40T antigen-driven vector cleavage.

In an advantageous embodiment, the proposed invention relates to hybrid vectors, which can be duplicated and phenotypic selections in a eukaryotic host species comprising a promoter and DNA, which encode hybrid PA or mutants of hybrid PA; said DNA is located, together with signals for transcription and termination, as well as A signals for the start and end of translation in said hybrid vector under the control of said promoter; like those in the transformed host, it is expressed in protein production.

Hybrid vectors according to the invention are prepared by methods known in the art, for example by connecting DNA segments containing the promoter, coding region, hybrid PA or hybrid PA mutants, 3' flanking sequence and vector DNA.

Different procedures can be used to connect DNA segments in vitro. Blunt ends (completely complementary DNA duplex), formed by certain restriction endonucleases, can be directly connected to T4 DNA ligase. It is more common to connect DNA segments via their single-stranded cohesive ends and covalently close them with DNA ligase, for example T4DNA ligase. Such single-stranded "cohesive ends" can form when DNA is cleaved with another type of endonuclease, which produces open ends (the two strands of a DNA duplex are cleaved at different points a few nucleotides apart). Single strands can also be formed by adding nucleotides to blunt or open ends using terminal transferases ("homopolymeric tails") or by simple digestion of a single strand on a blunt-ended DNA segment with a suitable exonuclease, such as λ-exonuclease. The following approach to creating open ends consists of joining DNA segments, with blunt ends, to chemically synthetically linked DNA, which contains a recognition site for an open-ended endonuclease, and digesting the resulting DNA with the appropriate endonuclease. The components of the hybrid vectors in the sense of the invention are connected together in a previously determined sequence, so that a proper action is obtained.

Hosts transformed with hybrid vectors containing DNA for hybrid PA

A further aspect of the proposed invention includes eukaryotic host organisms, transformed with hybrid vectors, which comprise DNA, which encodes a hybrid PA, which is composed of at least two subunits, which correspond in identity and number of amino acids to the subunits of human uPA and human t-PA, or which encode its mutant and mutants of said host, and procedures for their preparation.

Examples of suitable eukaryotic hosts are those listed above, particularly yeast species and mammalian cells. Mutants of transformed host organisms include especially mutants that have few proteases that degrade PA hybrids or hybrid PA mutants, and give a higher yield of hybrid PA or hybrid PA mutants.

The process of preparing transformed eukaryotic hosts comprises transforming or transfecting a eukaryotic host with an expression vector, comprising the DNA of the invention, regulated with an expression control sequence.

Transformation of eukaryotic host cells was carried out by methods known in the art. For example transformation of yeast with hybrid vectors can be carried out by the method described by Hinnen et al. /Proc. Natl. Acad. Sci. USA 75, 1919 (1978)/. This method can be divided into three stages:

1) Removal of the yeast cell membrane or its parts.

2) Treatment of "naked" yeasts (spheroplasts) with transforming DNA in the presence of PEG (polyethylene glycol) and Ca2+ ions.

3) Regeneration of cell membrane and selection of transformed cells in a solid layer of agar.

Preferred methods:

ad (1): The cell membrane of yeasts is removed enzymatically using various preparations of glycosidases, such as snail gut juices (e.g. Glusulase® or Helicase®) or enzyme mixtures obtained from microorganisms (e.g. Zymolyase®) in osmotically stabilized solutions (e.g. 1 sorbitol).

ad (2): Yeast spheroplasts aggregate in the presence of PEG, leading to local fusions of cytoplasmic membranes. The creation of conditions "suitable for fusion" is decisive and during the transformation process many transformed yeast cells become diploid or even triploid. Procedures that allow selection of fused spheroplasts can be used to enrich transformants, eg, transformed cells can be separated from pre-selected fusion products with difficulty.

ad (3): Since yeasts without a cell membrane do not divide, the cell wall must be renewed. This recovery is carried out conveniently by embedding spheroplasts in agar. For example molten agar (approx. 50ºC) is mixed with spheroplasts. When the melt is cooled to the yeast growth temperature (approximately 30ºC), a solid layer is obtained. This agar layer prevents the rapid diffusion and loss of essential macromolecules from the spheroplast and therefore promotes the renewal of the cell membrane. However, the restoration of the cell membrane is also achieved (albeit with lower efficiency) by planting spheroplasts on the surface of previously formed agar layers.

First of all, regeneration agar is prepared in a way that allows simultaneous renewal and selection of transformed cells. Since yeast genes, which encode amino acid enzymes of acid biosynthetic pathways, are mainly used as selectable markers (supra), regeneration is preferably carried out in minimal yeast agar medium. If very high regeneration effects are required, the following two-stage procedure is useful:

(1) cell membrane regeneration in a rich complex medium i

(2) selection of transformed cells by replicating the cell layer in selective agar media.

The introduction of hybrid vectors into mammalian cells is carried out by transformation in the presence of auxiliary compounds, eg diethylaminoethyldextran, dimethyl sulfoxide, glycerol, polyethylene glycol, etc., or some co-precipitator vector DNA, and calcium phosphate. Other suitable methods include direct microinjection of the vector DNA into the cell nucleus and electro-induction, eg by introducing the DNA with short electrical pulses, which increase the permeability of the cell membranes. Subsequent selection of transformed cells can be performed using a selection marker, which is either covalently integrated into the expression vector or added as a separate unit. Selectable markers include genes that confer resistance to antibiotics, or genes that repair genetic damage to the host cell (supra). Primarily, the selection system uses cells lacking dihydrofolate reductase (DHRF-), eg CHO cells, which absolutely require thymidine, glycine and purines for growth, unless an exogenous DHFR gene is added. With the introduction of the vector, which contains the hybrid PA gene, and additionally the DHFR gene, into the appropriate DHFR cells, eg CHO cells, the transformed cells are separated by increasing the concentration of the antifolate drug methotrexate in the medium.

Of particular advantage is the selection method by which suitable mammalian cells, eg CHO cells, are treated with co-precipitates of vector DNA, which contains the hybrid PA gene, and the gene encoding antibiotic resistance, eg resistance to G-418 and calcium phosphate. Transformed cells are isolated by culturing in the presence of appropriate antibiotics, eg G-418 and/or covering the expression of hybrid PA.

The transformed host organisms of the invention can be improved. in the production of hybrid PAs or mutants of hybrid PAs by applied methods of mutation and selection, known in the art. The mutation can be carried out, for example, by UV-irradiation or with suitable chemical substances. The production of protease-deficient mutants, especially yeast mutants, is particularly advantageous in order to avoid proteolytic degradation of the produced hybrid PA, i.e. mutant hybrid PA.

Cultivation of transformed host cells

The invention further relates to a method of obtaining single-chain hybrid PAs, which have an amino acid sequence composed of at least two subunits, which in terms of identity and number of amino acids correspond to the subunits of human t-PA and human u-PA or their mutants, which includes growing a transformed eukaryotic host under under suitable feeding conditions, which contains DNA sequences encoding said hybrid FA or hybrid PA mutant, and to isolate said hybrid PA or its mutant. Transformed host cells are cultivated by methods known in the field, in a liquid medium, which contains sources of carbon and nitrogen, which can be assimilated, and inorganic salts.

Different carbon sources can be used for the cultivation of transformed yeasts according to the invention. Examples of preferred carbon sources are assimilable carbohydrates such as glucose, maltose, mannitol or lactose or acetate, which can be used either alone or in suitable mixtures. Examples of suitable nitrogen sources are amino acids such as kesamino acids, peptides and proteins, and their breakdown products, such as tryptone, peptone or meat extracts, yeast extracts, malt extracts and also ammonium salts, e.g. ammonium chloride, sulphate or nitrate , which can be used as such or in suitable mixtures. Inorganic salts that can also be used are, for example, sulfates, chlorides, phosphates and carbonates of sodium, potassium, magnesium and calcium. The medium further contains, for example, substances that promote growth, such as a series of elements, for example, iron, zinc, manganese, etc., and above all, substances that create selection pressure and prevent the growth of cells that have lost plasmid expression. Thus, for example, if a type of yeast that is auxotrophic in e.g. an essential amino acid is used as the host microorganism, the plasmid primarily contains a gene encoding an enzyme, which fills the host's deficiency. Yeast species are grown in a minimal medium not supplemented with the mentioned amino acids.

Cultivation is carried out by methods known in the art. Cultivation conditions, such as temperature, pH value of the medium and fermentation time, were selected to obtain the maximum titer of the PA protein of the invention. Such yeasts are preferably grown under aerobic conditions with a submersible culture, with shaking or stirring, at a temperature of approximately 20 to 40°C, preferably approx. 30°C and pH values of 5 to 8, preferably pH 7, for approximately 4 to 30 hours, preferably until the maximum yield of the protein of the invention is reached.

Mammalian cells are grown under tissue culture conditions in commercially available media, optionally supplemented with growth promoters and/or mammalian sera. Cells grow either attached to a solid substrate such as micro-carriers or porous glass fibers, or free-swimming in suitable culture dishes. The culture medium is chosen in such a way that selection pressure is obtained and only those cells that still possess the hybrid DNA vector, which includes the genetic marker, survive. For example, if the vector includes a suitable gene for antibiotic resistance, an antibiotic is added to the medium. When a satisfactory value of cell density is reached, the culture is stopped and the protein is isolated. If we use mammalian cells, the hybrid PA or hybrid PA mutant is usually secreted into the medium. The medium, which contains the product, is separated from the cells, which, supplied with fresh medium, are used for continuous production. If we use yeast, the protein can also accumulate inside the cells, especially in the periplasmic space. In this case, the first stage of obtaining PA protein consists of releasing the protein from inside the cells. In most procedures, the cell membrane is first removed by enzymatic degradation of the cell membrane with glucosidases (supra). Alternatively, the cell membrane can be removed by treatment with chemical agents, eg, thiol reagents or EDTA, which cause damage to the cell membrane, and this allows the release of the produced hybrid PA or its mutant. The resulting mixture is enriched with PA hybrids or with its mutants in the usual way, such as removal of most of the non-protein material by treatment with polyethyleneamine, protein precipitation with ammonium sulfate, gel electrophoresis, dialysis, chromatography, e.g. ion exchange chromatography, chromatography based on separation by size, HPLC or reversed-phase HPLC, molecular sorting on a suitable Sephadex column or the like. The final cleaning of the previously cleaned product is achieved, for example, by affinity chromatography, e.g. by antibody-based affinity chromatography, especially by monoclonal antibody-based affinity chromatography, which uses monoclonal anti-t-FA or anti-u-PA antibodies attached to an insoluble matrix. by methods known in the art, or in the case of hybrid PAs containing the catalytic B-chain of t-PA, DE-3 affinity chromatography (DE-3 is a protease inhibitor, isolated from Erythrina latissima) and the like. The subject of the invention are also hybrid cell lines, which produce monoclonal antibodies, directed to specific domains of t-PA or u-PA, and said monoclonal antibodies.

In the appropriate preparation of single-chain hybrid PA or mutant hybrid PA, which is mostly free of the double-chain form, it is useful to include a protease inhibitor, such as aprotinin Trasylol® or basic trypsin inhibitor from the pancreas, during the purification process, in order to inhibit the protease sequences that may be present in the culture medium and 'which can cause (partial) conversion of the single-chain form into the double-chain form. The final purification is then achieved by column chromatography, which contains a selective affinity reagent.

5. Pharmaceutical preparations

The new single-chain PA proteins and their mutants, obtained in accordance with the proposed invention, show valuable pharmacological properties. They can be used analogously to known plasminogen activators in humans for the prevention or treatment of thrombosis and other conditions, where it is desirable to create local fibrinolytic or proteolytic activity through the mechanism of plasminogen activation, such as arteriosclerosis, myocardial or cerebral infarction, venous thrombosis, thromboembolism, postoperative thrombosis , thrombophlebitis and diabetic vasculopathy.

We surprisingly found that new hybrid PA proteins and their mutants in terms of the proposed invention combine the useful properties of native t-PA and u-PA. Thus, new hybrid PA proteins and their mutants are fibrinolytically active. The unique fibrin-directed properties, eg the ability to activate plasminogen, especially in the presence of fibrin, are preserved. Furthermore, the new proteins have a longer in vivo stability compared to authentic t-PA.

The invention also relates to pharmaceutical compositions comprising a therapeutically effective amount of the active ingredient (hybrid PA or its mutant), together with organic or inorganic solid or liquid pharmaceutically acceptable carriers, which are suitable for parenteral, i.e. intramuscular, subcutaneous or intraperitoneal administration and which they do not adversely affect other active ingredients.

Infusion solutions are suitable, preferably aqueous solutions or suspensions that can be prepared before use, for example, from lyophilized preparations containing the active ingredient alone or together with a carrier, such as mannitol, lactose, glucose, albumin, etc. Pharmaceutical compositions are sterilized and, if is preferably supplemented, for example, with preservatives, stabilizers, emulsifiers, agents for increasing solubility, buffers and/or salts for regulating osmotic pressure. Sterilization can be achieved by sterile filtration through small pore filters (diameter 0.45 µm or smaller), after which the composition can be lyophilized, if desired. Antibiotics may also be added to help maintain sterility.

Pharmaceutical compositions in terms of the proposed invention are dispensed in the form of dosage units, for example in ampoules which. contain 1 to 2000 mg of a pharmaceutically acceptable carrier per unit dose and approximately 1 to 200 mg, preferably 5 to 100 mg of active substance per dosage unit.

Depending on the type of disease and age, and the condition of the patient, the daily dose, if given when treating a patient weighing approximately 70 kg, ranges from 3 to 100 mg, preferably 5 to 50 mg in 24 hours. In the case of myocardial infarction, a daily dose of about 30 to 80 mg is administered between 60 and 120 minutes, preferably in three aliquots within about 90 minutes. The entire amount of hybrid PA or mutant hybrid PA can also be given i. as a single injection.

The invention also provides methods for the production of a pharmaceutical composition characterized by the fact that the biologically active protein of the proposed invention is added to a pharmaceutically acceptable carrier.

The use of new proteins for prophylactic and therapeutic treatment of the human body is also an object of the proposed invention.

The invention also relates in particular to DNA, hybrid vectors, transformed host species, hybrid PA proteins, mutants of hybrid PA proteins, hybrid cell lines, monoclonal antibodies and to methods for their preparation, as described in the examples.

Brief description of the drawing

In the following experimental part, various embodiments of the proposed invention are described in connection with the attached drawings, in which:

Figure 1 and Figure 3 show the nucleotide sequences and derived amino acid sequences of human t-PA cDNA and human u-PA cDNA, respectively. The first amino acids of mature proteins are underlined.

Figure 2 and Figure 4 are restriction endonuclease maps of human t-PA cDNA and u-PA cDNA, respectively.

Figure 5 schematically shows the technique used to construct the plasmid pEcoO.47ΔScaI.

Figure 6 schematically shows the construction of ph.tPAΔScaI plasmid, which contains mutated t-PA cDNA.

Figure 7 schematically shows the construction of plasmid pUNC.tc, which contains a cDNA insert, comprising the A-chain of the u-PA domain and the B-chain of t-PA.

Figure 8 schematically shows the construction of the plasmid ptNC-UC, which contains a cDNA insert encompassing the A-chain of the t-PA domain and the B-chain of u-PA.

Figure 9 schematically shows the construction of plasmid pD02. Figure 10 schematically shows the construction of the plasmid

Figure 10 containing t-PA cDNA, combined with a β-globin fragment.

Figure 11 schematically shows the construction of plasmid pCGA26, which contains t-PA cDNA under the control of the MCMV IE promoter and a β-globin fragment.

Figure 12 schematically shows the construction of the t-PA expression plasmid pCGA28 and the general expression plasmid pCGA44; both plasmids include a neomycin resistance gene.

Figure 13 schematically shows the construction of the t-PA expression plasmid pCGA42 and the general expression plasmid pCGA44d; both plasmids include a hygromycin resistance gene.

Figure 14 schematically shows the construction of the t-PA expression plasmid pCGA2B, which includes the neomycin resistance gene and the DHFR gene.

Figure 15 schematically shows the construction of the expression plasmid pBR1a, which includes the mutated t-PA cDNA inclusion plasmid ph.tPAΔScaI.

Figure 16 schematically shows the construction of the expression plasmid pBR2a, which contains a hybrid PA cDNA insert, comprising the A-chain of the u-PA domain and the B-chain of t-PA.

Figure 17 schematically shows the construction of the expression plasmid pBR3a.

Figure 18 schematically shows the construction of the expression plasmid pBR4a, which contains a hybrid PA cDNA insert, comprising the domains of the t-PA A-chain and the B-chain of u-PA.

Picture. 19 schematically shows the construction of the yeast expression vector pJDB207/PH05-I-TPA, which contains the PH05 promoter, the invertase signal sequence and the t-PA cDNA.

Figure 20 schematically shows the construction of plasmid pCS16.

Figure 21 schematically shows the construction of plasmid pCS16/UPA, which includes the u-PA cDNA.

Figure 22 schematically shows the construction of plasmid pJDB207/PH05-I-UPA.

Figures 23-26 schematically show the procedures used to convert the primary hybrid PA constructs, which include the A-chain domains and the B-chain catalytic region of u-PA or t-PA into the final construct in which the binding domain is in the activation site and/or in the native exon-intron junctions.

Figure 23 shows the construction of a gene encoding a hybrid PA comprising the domains of the A-chain of t-PA and the B-chain of u-PA.

Figure 24 shows the construction of a gene encoding a hybrid PA, comprising the domains of the A-chain of u-PA and the B-chain of t-PA.

Figure 25 shows the construction of the gene encoding the hybrid PA, which comprises the growth factor u-PA, the "kringle 2" domain of t-PA 7. The B-chain of t-PA.

Figure 26 shows the construction of a gene encoding a hybrid PA, comprising growth factor u-PA, the "kringle 2" domain of t-PA and the B-chain of u-PA.

Figure 27 shows the assembly of hybrid PAs and mutant hybrid PAs, according to the examples in the experimental part.

The symbols used in the attached images have the following meanings:

AMP; AMPR gene resistant to ampicillin (β-lactamase)

TET, TetR tetracycline resistance gene

NEO TN5 neomycin phosphotransferase

TN5PR bacterial transposon promoter TN5

HPH hygromycin phosphotransferase

pBRori initiation of replication of plasmid pBR322

pOIS toxic sequence, pBR322 sequence, which inhibits SV40 replication

SV40ori origin of SV40 replication, which coincides with the early and late promoters

5V40enh, SV40E 72 bp amplifying part of the SV40 early promoter

HCMVE enhancer of the human cytomegalovirus (HCMV) larger, native early gene

MCMVP promoter/mRNA start site of the murine cytomegalovirus (MCMC) major sudden early gene

RSV Rous sarcoma virus LTR (promoter)

CAP position 5. m7Gp "cap" of eukaryotic mRNA

polyA polyadenylation site of mRNA

SPLD binding donor site, 5th end of intron

SPLA binding acceptor site, 3rd end of intron

BAP bacterial alkaline phosphatase

CIP calf intestinal phosphatase

(RamH1/Bg12) Sau3a site resulting from binding of BamHI and BglII sites

ScaI(del) mutated ScaI site

x < y site of x restriction enzyme, which is clockwise to y

p promoter

inv.SS invertase signal sequence

t copy terminator

L DNA linker

DHFR dihydrofolate reductase

mtPA t-PA Bowes melanoma

Experimental part

Example 1

Introduction of a ScaI site at the junction between the "kringle" structures and the enzyme domain in the human t-PA cDNA

The principle applied to the construction of chimeric and hybrid molecules, which contain domains of both t-PA and u-PA, consists of preparing the desired restriction fragments that come out of individual clones, reassembling them in solution, and then cloning the output constructs. After cloning, we check the structure of chimeric molecules by restriction mapping and DNA sequence analysis.

To obtain hybrid molecules of both t-PA and u-PA cDNA, we cleave "kringles" and enzyme domains at the bonds between individual structures. We achieve this with u-PA by performing a partial digestion with the restriction endonuclease MstI, which separates the non-catalytic domain from the enzymatic domain and attached sequences at the 3' end. No suitable usable site is present in t-PA, and so we introduce one, as described below:

A) construction of plasmid pEcoO.47ΔScaI (see Figure 5)

In this construction, the only ScaI site (AGTACT) at nucleotide position 940-945 of t-PA cDNA is degraded (AGTACT → AGTATT) and we introduce another ScaI site at nucleotide positions 963-968 (ACCACC → AGTACT) at the 3' end of "kringle 2" ( compare figures 1 and 2). The coding of none of the amino acids was affected by these changes.

All restriction digestions are carried out in accordance with the manufacturer's instructions (New England Biolabs, Bethesda Research Labs) and the resulting digestions are analyzed by electrophoresis on a 3.5% polyacrylamide gel. Stain the gel with homidium bromide (1.0 µg/ml) and illuminate with ultraviolet light. Cut out the appropriate band and electroelute in 0.5 x TBE (1 x TBE = 90 mM Tris-borate, pH 8.3; 2.5 mM EDTA). The flextroeluted material is applied to an Elutip-d column (Schleicher and Schuell), the bound DNA is eluted in high salt and precipitated with the addition of ethanol. The precipitate is washed with ethanol, dried and dissolved in water.

Plasmid pW349F (European Patent Application No. 143,081), containing human t-PA cDNA (synthesized from mRNA, isolated from HeLaS3 cells and cloned into the PstI site of plasmid pBR322) was digested with EcoRI and a fragment of 470 base pairs (bp) was isolated. (compare figure 2). By digesting the 470 bp EcoRI fragment with ScaI, with respect to HaeIII, 150 bp EcoRI, ScaI and 290 bp EcoRI, HaeIII fragments are obtained. The two strands of the 470 bp EcoRI fragment are separated by denaturing the DNA in DMSO buffer (30% DMSO, 1 mM EDTA, 0.5% xylene cyanol, 0.05% bromophenol blue) and electrophoresed on a 5% polyacrylamide gel in 0.5x TBE at 8 volts per centimeter /Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, 1982/. Separated fibers are obtained by electroelution followed by precipitation with ethanol. A 31-mer deoxyoligonucleotide (which includes the 5 desired nucleotide changes, compare Figure 5) is synthesized using the phosphotriester method. Fifty pmol of 31-mer are labeled with 32P at the 5' end in 20 µl of the reaction, which contains 1 x kinase buffer (10 x kinase buffer = 0.5 M TriS-HCl, pH 7.5; 0.1 M MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA), 30 µCi/α32P/ATP (Amersham, ~ 3000 Ci/mmol) and 10 units of T, polynucleotide kinase (Hethesda Research Labs.). The reaction is incubated for 30 minutes at 37°C, followed by the addition of 1 µl of 10 mM ATP, 10 units of T4 kinase and a further 30 minutes of incubation at 37°C. The reaction is terminated by heating for 10 minutes at 68°C. A characteristic 31-mer, the sequence of which is that of the non-transcribed strand, is verified by dot blot analysis /performed according to Zoller and Smith, Nucl. Acids Res., 10, 6487-6500 (1982); except that the pre-hybridization, and the hybridization, were carried out at 50°C, and the wash at 60°C/ to determine which of the two fibers hybridizes with it, i.e., which represents the transcribed fiber. The four DNAs are mixed together in a 20 µl renatured reaction consisting of 0.3 pmol of transcribed strand, 2 pmol each of 150 bp EcoRI and 290 bp, EcoRI, HaeIII fragment, 25 pmol phosphorylated 31-mer, and 1 x renat. buffer (5 x renat. buffer = 0.5 m NaCl, 32.5 mM Tris-HCl, pH 7.5; 40 mM MgCl2 and 5 mM β-mercaptoethanol). The mixture is incubated for 3 minutes at 100°C, 30 minutes at 30°C, 30 minutes at 4°C and then 10 minutes on ice, then 400 units of T4 DNA ligase (New England Biolabs) are added and the reaction is incubated overnight at 12 .5°C, the 470 bp renatured fragment was run from a 3.5% polyacrylamide gel, as described above, and ligated to pBR322 DNA digested with EcoRI and dephosphorylated (New England Biolabs) in 50 ml Tris-HCl pH 7.5; 10 mM MgCl2. 10 mM DTT, 1 mM ATP, 1 mM spermidine, 0.1 mg/ml bovine serum albumin and overnight incubation at 12°C. The ligation mixture is used to transform the appropriate E.coli strain HB101 (Maniatis et al., supra). Colonies resistant to ampicillin are separated on L-agar containing 50 µg/ml ampicillin, and colonies containing a 470 bp fragment are identified by hybridization of the colony with the 31-mer used as test /D. Woods, Focus 6, 1-3, (1984)/. Plasmid DNA is isolated from individual hybridization colonies on a small scale /Holmes et al., Analyt. Biochem. 114, 193-197 (1981)/, and the creation of a new ScaI site was confirmed with combined EcoRI and ScaI digestion. To obtain purity, plasmid DNA from positive colonies in the second round of E.coli HB101 transformation is used. Plasmid preparation is largely done from the second generation of one such positive colony /Katz et al., J. Bacteriol. 144, 577-591 (1973); Biochemistry 16, 1677-1683 (1977)/, and the cancellation of the original ScaI site and the creation of a new ScaI site is confirmed by DNA sequence analysis using the Maxam and Gilbert method /Methods Enzym. 65, 499-560 (1980)/. We call this plasmid pEco0.47ΔScaI.

B) Reconstruction of human t-PA with a mutated ScaI site

(see picture 6)

In this construct, the 470 bp EcoRI fragment, present in two types of human t-PA, is replaced with the 470 bp EcoRI fragment, which contains a mutated ScaI site. Plasmid aW349F, containing human t-PA cDNA (see above) was digested with ClaI and the resulting sticky ends were blunted by the addition of 50 µm each of dCTP, dGTP and 10 units of DNA polymerase I, Klenow fragment (Boehringer, Mannheim). The reaction is incubated for 30 minutes at at room temperature, followed by extraction with phenol and ether and precipitation with ethanol. The pellet was dissolved in water, digested with EcoRI and ScaI and 1.5 kb EcoRI, ScaI and 4.3 kb ClaI (blunt-ended). The EcoRI fragment is isolated. The two fragments were mixed with the 470 bp fragment obtained from the plasmid pEco0.47ΔScaI after digestion with ECoRI and ligated as described above, overnight at 12°C. Appropriate E.coli HB101 cells were transformed with ligation mixture and tetracycline-resistant colonies were separated on L-agar containing 12.5 µg/ml tetracycline. Colonies containing the mutated 470 bp fragment are identified by colony hybridization using the previously described 31-mer as a probe. DNA is prepared from manlysates of individual positively hybridized colonies and the construct is confirmed accurately by performing appropriate restriction digests. One such plasmid with the desired changes is called ph.tPAΔScaI.

Example 2

Construction of u-PA/t-PA hybrid molecule; plasmid pUNC.tc (see Figure 7)

This construct is a hybrid between the non-catalytic region of u-PA (containing the 5' non-coding region, signal, growth factor, and "kringle" sequence) and the catalytic or enzymatic domain of human t-PA.

Urokinase cDNA was prepared from mRNA obtained from human Hep3 cells /cf. T. Maniatis et al., Molecular Cloning (1982), p. 188-246/. A 1.3 kb SmaI-BarnHI fragment and a 1 kb BamHI-EcoRI fragment of the PA cDNA were cloned into the SmaI, EcoRI sites of pUN121/B. Nilsson et al., Nucl. Acids Res. 11, 8019-8030 (1983)/, to obtain plasmid pcUK176. A drawing of the restriction endonuclease inclusion of human u-PA cDNA is shown in Figure 4. The nucleotide sequence and deduced amino acid sequence of the u-PA inclusion is shown in Figure 3.

Plasmid pcUK176 was digested with XmaI (compare Figure 4; XmaI is an isoschizomer of SmaI) and MstI and a 521 bp fragment was isolated. The restriction enzyme MstI recognizes the DNA sequence TGC T GCA (arrows indicate cleavage sites) and after digestion the end becomes blunt; this enzyme then binds the u-PA cDNA at nucleotides 520-525, i.e. right at the last cysteine residue (amino acid 131) that includes "kringle" /Holmes et al., Biotechnology 3, 923-929 (1985) /, and so the coding sequences for the non-catalytic and catalytic regions are clearly separated.

Plasmid ph.tPAΔScaI is digested with ScaI and HindIII (HindIII is present in the vector) and a 1.8 kb fragment is obtained. The restriction enzyme ScaI recognizes the DNA sequence ATG T ACT (arrows indicate cleavage site) and also produces a blunt end after digestion. ScaI will cut ph.tPAΔScaI DNA after the serine residue 262 /1 amino acids after the last cysteine of "kringle 2"; Pennica et al., Nature 301, 214-221 (1983)/, therefore separates the non-catalytic and catalytic domains.

The two fragments are mixed and ligated to XmaI, HindIII grafted pUC18 vector DNA. After transformation of E.coli HB101, colonies that have a proper inclusion are identified by colony hybridization using the 2.0 kb BgIII fragment of human t-PA (compare Figure 2) as a probe, which is characterized by the method of random prestaining, /Feinberg et al., Analyt . Biochem. 132, 6-13 (1983)/. We confirm the DNA sequence of the link between the u-PA and t-PA fragments by analyzing the DNA sequence. We designate the correct clone as pUNC.tc.

Example 3

Construction of t-PA/u-PA hybrid molecule:

plasmid pUNC.UC (see Figure 8)

This construct is the exact opposite of pUNC.tc in that the non-catalytic region of ph.tPAΔScaI (containing the 5' non-coding region, water, "finger", growth factor, "kringle 1" and "kringle 2" domains) is fused to the catalytic domain of the human u -AND. Plasmid ph.tPAΔScaI was digested with SacI and ScaI (compare Figure 8) and an approximately 1.0 kb fragment was isolated. Plasmid pcUK176 is first digested with BamHI and then partially digested with MstI to yield a fragment of approximately 800 bp. It follows that the BamHI digest is cut with EcoRI and an approximately 1.0 kb fragment is isolated. These three fragments are mixed with pUC19 vector digested with SacI, EcoRI and ligated. E.coli HB101 is transformed with ligation mixture, and colonies that have the correct inclusion are identified by colony hybridization using the same 20 kb BgIII probe as described above. We confirm the DNA sequence of the t-PA and u-PA DNA by DNA sequence analysis. We call one proper clone pt.NC.UC.

Example 4

Construction of an expression vector for use in mammalian cells

A) Conversion of the HgiAI site in the t-PA cDNA to the HindIII site

This is achieved in five stages (Figure 9).

Plasmid pW349F (European Patent Application No. 143,081) in part. cleave with the restriction enzyme HgiAI by incubating 20 µg/ml DNA for 1 hour at 37°C with 12 U/ml enzyme in the buffer recommended by the manufacturer (Bethesda Research Laboratories), except supplemented with 10 µg/ml homidium bromide, to prevent second cutting plasmid. Plasmid DNA in linear forms is then placed on a 0.8% agarose gel in TBE buffer (TBE: 89 mM Tris-borate, pH 8.9, containing 1 mM EDTA), eluted by electrophoresis in the same buffer, twice is extracted with phenol, twice with chloroform and finally precipitated with alcohol at -20°C after addition of 0.1 vol. 3 M sodium acetate, pH 5.2. The precipitated DNA was dissolved at 0.2 mg/ml in TE (TE: 10 ml Tris-HCl pH 7.2 with 0.1 mM EDTA).

63 µl of DNA in linear forms is then incubated for 30 minutes at 37°C with 15 U T4 DNA polymerase in ligase buffer /33 mM Tris-acetate (pH 7.9), 66 mM potassium acetate, 10 mM magnesium acetate, 0.5 mM dithiothreitol and 0.1 mg/ml bovine serum albumin/; followed by 10 minutes of heating at 60°C to inactivate the enzyme. The aim of this incubation is to use the exonucleolytic activity of T4 polymerase to remove the remaining four nucleotides after digestion with HgiAI, to obtain DNA molecules with blunt ends.

Then, to connect the HindIII linkers (CAAGCTTG) to the blunt end of the DNA, we add 6 µl (300 ng) of kinase linkers to the above solution with 4 µl of 10 mM ATP and 3 µl of 4T DNA ligase (New England Biolabs, 400 U/µl), followed by 16-hour incubation at 16°C. Ligation was completed by heating the mixture for 10 min at 68°C, after which the DNA was digested with HindIII and BglII, i.e. 15 µl (135 U) HindIII was added to 1.5 µl 4M NaCl, 0.2 µl and 1M MgCl2 and 11 µl 1 mg/ml bovine serum albumin, incubated for 1 hour at 37°C, followed by the addition of 40 U of HglII, followed by another hour of incubation at 37°C. The resulting fragment with 177 base pairs is purified on a 6% polyacrylamide gel run in TBE, eluted in TNE (TNE: 10 mM Tris-HCl pH 8.8, containing 100 mM NaCl and 1 mM EDTA), absorbed on DEAE cellulose (Whatman DE52), eluted with 1M NaCl in TNE, diluted with 4 volumes of water, precipitated at -20°C after the addition of 2.5 volumes of ethanol and finally dissolved in 17 µl of TE (TE: 10 mM Tris-HCl pH 8 ,0, containing 1 mM EDTA).

Plasmid pRSVneo is a derivative of plasmid pSV2neo /P.J. Southern and Berg, J. Mol. Appl. Genet. 1, 327-341 (1982)/ in which the SV40-derived PvuII-Hind fragment was replaced with the PvuII-HindIII fragment, containing the Rous sarcoma virus LTR promoter, in the same way as pRSVcat i.z pSV2cat /C.M. Gorman et al., Proc. Natl. Acad. Sci. USA 79, 6777-6781 (1982)/. 5 µg of this plasmid is cut in a 50 µl volume with 24 U BgIII according to the manufacturer's instructions. After 1 hour of incubation at 37°C, 40 U of HindIII was added and incubation was continued for 1.5 hours, and then the 5.4 kb fragment was purified as described above.

17 µl of the purified 177 bp fragment is ligated for 18 hours at 16°C to 2 µl (20 ng) of the pSRVneo fragment using 0.25 µl (100 U) of T4 ligase in a total volume of 22 µl of ligase buffer, then the plasmid DNA is used for transformation E.coli according to D. Hanahan /J. Mole. Biol. 166, 557-580 (1983)/. From the ampicillin-resistant strains obtained, one containing a ptPAL-tagged plasmid with a 177 bp HindIII-BgIII fragment was selected, as evidenced by restriction analysis. 0.1 µg of this plasmid is digested in 16 µl with 16 U HgIII as recommended by the manufacturer for 1.5 hours at 37°C. Then 20 U of bovine intestinal alkaline phosphatase (Boehringer Mannheim) is added to this solution and the incubation is continued for another 30 minutes, after which the DNA is extracted twice with phenol, twice with chloroform and precipitated after the addition of 0.1 volume of 3.0 M sodium of acetate pH 5.2 and 0.6 volume of isopropanol, dissolved in TE, purified further by electrophoresis on agarose gel, as described above, extracted twice with phenol, twice with chloroform, precipitated at -20°C after addn. 2.5 vol ethanol and 0.1 vol 3M sodium acetate pH 5.2 and finally dissolved in 30 µl TE. The 2.1 kb tPA BglII fragment was then excised from 5 µg pW349F in a 25 µl reaction using 20 U BrlII for 2 hours at 37°C, purified on a 0.8% agarose gel, eluted by electrophoresis, as described above, extracted twice with phenol, twice with chloroform, precipitated at -20°C after addition of 2.5 volumes of ethanol and 0.1 vol of 3 M sodium acetate pH 5.2 and dissolved at a concentration of 8 ng/µl in TE. 1 µl of the t-PA fragment is then ligated in a 10 µl reaction to 7.5 ng of BgIII cut vector DNA using 100 U of T4 ligase (Biolabs) for 17 hours at 16°C and then transformed into E.coli. One of the output clones, designated pDO2, contains the t-PA BgIII fragment, incorporated in such a way that the plasmid contains a continuous open reading frame for human t-PA.

B) Combination of t-PA cDNA with beta-globin fragment

Plasmid pDO10 (Figure 10) is constructed by connecting three DNA fragments: (i) a 2.1 kb fragment, which starts with the HindIII site and ends with the BglII site, and contains the entire t-PA coding sequence isolated from an agarose gel, on which it is placed 10 µg of pDO2 DNA partially cut with BglII and completely cut with HindIII. (ii) pUB is a plasmid containing the rabbit beta-globin /A gene. Van Ooyen et al., Science 206, 337 (1979)/, subcloned as a BgIII partial digest into the BamHI site of plasmid pUC9 /J. Vieira and J. Messing, Gene 19, 259-268 (1982); ibid. 19, 269-276 (1982)/. A 1.2 kb BamHI-HindIII fragment containing the second intron and a polyadenylation site was cut from that plasmid and purified by electrophoresis on agarose gel. (iii) Vector pDO1 was inserted in a counter-clockwise direction, from the Hind III site (Figure 10) of the HindIII-AccI fragment of pBR322, which includes the origin of replication, a 0.3 kb fragment containing the human cytomegalovirus (HCMV) enhancer, ending in at the synthetic XbaI site and is followed by a second copy of that enhancer, attached to a homologous promoter, ending at the synthetic HindIII site. We cut this DNA vector with HindIII and purified the 6.3 kb linear plasmid by electrophoresis on agarose gel.

C) Insertion of tPA/globin combination into pSP62Pst33 (see Figure 11)

pSP62Pst33 (Figure 11) is a plasmid containing a 2.1 kb PstI fragment of cytomegalovirus (MCMV) DNA, which includes the viral immediate early (IE) promoter, inserted into the PstI site of plasmid pSP62 (Boehringer Mannheirn), as indicated in the figure. The HindIII fragment of pDl0 was inserted into the HindIII site of pSP62Pst33. Plasmid pCGA26 was chosen in which the t-PA coding sequence was inserted so that it could be transcribed in a "sense" orientation from the MCMV IE promoter.

D) Insertion of the MCMV/tPA/globin unit into pFASV2911neo (see Figure 12).

Plasmid pSV2911neo /F. Asselbergs et al., J. Mol. Biol. 189, 401-411 (1986)/ contains the neomycin (neo) phospho-transferase gene from the TN5 transposon and the SV40 expression cassette (Figure 12). Introduced into mammalian tissue culture cells, it confers resistance to neomycin and kanamycin. pSV2911neo DNA was prepared for cloning by cutting with BaMHI treatment with bovine intestinal alkaline phosphatase, two phenol extractions, two chloroform extractions, alcohol precipitation and finally dissolving in TE. Plasmid pCGA26 is cut with the restriction enzyme AccI, which cuts the GT/ACAC sequence at position 345 in the MCMV enhancer/promoter /K region. Doersch-Haessler et al., Proc. Natl. Acad. Sci. USA 82, 8325-8329 (1985)/ and the sequence GT/CGAC (cuttable also with SalII) behind the globin portion. Over the protruding residues from the two bases, which come out after cutting, it is filled with E.coli (large fragment) DNA polymerase I, now the blunt ends are connected to BamHI linkers (CGGATCCG) and they are cut with the BamHI enzyme. The 3.8 kb fragment carrying the MCMV/tPA/globin unit, now with BamHI ends, was purified over an agarose gel and then ligated to pSV2911neo DNA, obtained as described above, to obtain the expression plasmid pCGA28.

E) Expression vectors derived from pCGA28

pCGA42 is a derivative of pCGA28, in which the neo coding sequence (between the BgIII site and the SmaI site) has been replaced with the coding sequence of the hygromycin resistance gene. This is accomplished (see Figure 13) by cutting plasmid pSV2911neo at its single SmaI site, ligating the BglII linker (CAGATCTG) to the DNA, followed by cutting with BgIII. The resulting large DNA fragment, which consists of the vector minus the neo coding sequence, is purified on an agarose gel and connected to a smaller BamHI fragment from the plasmid pLG89 /L. Gritz et al., Gene 25, 179-188 (1983)/, equally purified on an agarose gel, and introduced into plasmids pCGA25c and pCGA25d, which contain the hygromycin phosphotransferase gene in a sense-to-nonsense orientation. If transfected into CHO DUKXB1 cells under standard conditions (see Example 16), pCGA25C yields 60 colonies/µg DNA resistant to 0.2 µg/ml hygromycin B, a concentration that kills CHO cells, which contain a plasmid that does not encode hygromycin resistance. eg pCGA28. In pCGA25c, the sequences coding for hygromycin-B resistance are located so that in E.coli they are transcribed from the Tn5 promoter (which transcribes the kanamycin-resistant gene in the Tn5 transposon). Thus, 2.5 ml of Luria broth (LB) culture, containing 40 mg/1 hygromycin-B, inoculated with 0.05 ml, grown overnight, i.e. saturated culture of E.coli DH1 bacteria (which grows under 50 mg/1 amicillin selection) achieves after 3 hours exposure to air at 37°C at least a tenfold higher density of bacteria than when the bacteria are tested with plasmids, which do not contain the hygromycin gene, which works in E.coli, such as pCGA25d, pCGA2B or pAT153 /A.J. Twigg et al., Nature 283, 216-218 (1980)/. The functionality of the hygromycin-B resistance gene in both animal tissue culture cells and E.coli greatly facilitates the use of the pCGA2Sc plasmid and its derivatives. Plasmid pCGA42 was then constructed by inserting the BamHI fragment from pCGA28, which contains the MCMV/t-PA/beta-globin cassette, into pCGA25c. It is used to deliver t-PA expressing the gene into cells that we cannot transform geneticin-resistant or that are already resistant to geneticin. Also, pCGA42 is capable of expressing its hygromycin gene in E.coli, which allows pCGA42, containing E.coli DH1, to grow to a density at least tenfold higher than, for example, E.coli containing pCGA2B, when assayed as above. described.

Plasmid pCGA2B contains two SacI sites, one at the start of the linker immediately after the MCMV promoter, and the other in the t-PA cDNA. The sequence between the SacI sites was deleted first by cutting with a restriction enzyme, purifying the fragment over an agarose gel and circularizing this linear DNA using T4 DNA ligase, which forms the plasmid pCGA44 (see Figure 12). Each cDNA, cloned in the correct orientation into the now single SacI site of pCGA44, efficiently replaces the t-PA coding sequence in pCGA28 and is efficiently expressed.

pCGA42d was derived from pCGA42 by destroying the 1.4 kb SacI fragment (see Figure 13). We can insert the cDNA into the now single ScaI site as t-PA cDNA and it is expressed at high levels in tissue culture cells.

Example 5

Insertion of cDNA, u-PA, t-PA and hybrid PA into the expression vector pCGA2B

A) Insertion of t-PA cDNA (see Figure 15)

In this construct we insert the t-PA cDNA fragment from the ph.tPAΔScaI plasmid, and this construct serves as a control for any change that might occur unnoticed during the restructuring of the ScaI site. A 1.4 kb SacI fragment was obtained from the plasmid after ph.tPAΔScaI digestion. The expression vector pCGA28 is also digested with ScaI and the 8.2 kb vector fragment is isolated and dephosphorylated in 100 µl reaction mixture containing 0.1 mM Tris pH 8, 0.0.1% SDS and 0.02 units of bacterial alkaline phosphatase. After incubation. The reaction mixture was extracted twice with phenol and ether for 30 minutes at 60°C and then precipitated with ethanol. The pellet was dissolved in water and an aliquot was used to ligate the 1.4 kb SacI fragment from ph.tPA ScaI. The ligation mixture is used to transform E.coli HB101, and the minimized DNA prepared from ampicillin-resistant colonies is digested with the appropriate restriction enzyme to determine if ScaI is incorporated in the desired orientation. Plasmid that has the desired orientation is called pBR1A. The plasmid with the ScaI fragment in the opposite orientation was named pBR1B.

B) Insertion of hybrid UPAATPAB cDNA (see Figure 16)

In this construction, we insert the hybrid UPAATPAB cDNA fragment from the plasmid pUNC.tc into the expression vector pCGA28. The pUNC.tc DNA is digested with SmaI (compare Figure 7), the 1.24 kb fragment is isolated and ligated to the SacI digested, dephosphorylated 8.2 kb pCGA2B vector DNA. E.coli HB101 cells are transformed with the ligation mixture and colonies containing the SacI inclusion in the desired orientation are identified by performing restriction digests on the minilized DNA. The plasmid with the pUNC.tc DNA inclusion in the desired orientation is labeled pBR2A, and the one with the opposite orientation is labeled pBR2B.

C) Insertion of u-PA cDNA see Figure 17

In this construction, we insert human u-PA DNA into the expression vector pCGA28 and together with pBRI, this plasmid serves as a parental plasmid control and confirms the usability of the pCGA28 type vector... Plasmid pcUK176 is digested with SmaI, AhaIII (compare Figure 4), 2.25 kb fragment is isolated and attached to the phosphorylated SacI linker. as described above. After SacI digestion, we obtain a 2.25 kb fragment and bind to the SacI digested dephosphorylated 8.2 kb pCGA2B DNA fragment. E.coli HB101 is transformed and colonies harboring the desired plasmid are identified by digesting the minified DNA with restriction enzymes.

The plasmid with human u-PA DNA in the correct orientation is designated pBR23A, and the one with the opposite orientation is designated pBR3B.

D) Insertion of hybrid TPAAUPAB cDNA (see Figure 18)

We insert the hybrid TPAAUPAB cDNA from the plasmid ptNC.UC into the expression vector pCGA28. 2.75 kb SmaI (present in vector), AhaIII fragment is isolated from ptNC.UC DNA, linked to phosphorylated ScaI linker, linker binds 2.75 kb fragment and linked to SacI digested, dephosphorylated vector DNA and desired colonies are identified as above described. Plasmid with ptNC.UC DNA inclusion in the correct orientation is called pBR4A.

Example 6

Construction of a yeast expression vector containing the pHO5 promoter, the invertase signal sequence and the t-PA coding region

A) Synthesis of oligodeoxyribonucleotides for the invertase signal sequence:

Four oligodeoxyribonucleotides: I-1, I-2, I-3, I-4 were synthesized with a DNA synthesizer (model 380B Applied Biosystems). After unblocking, the synthetic fragments are purified on a 12% polyacrylamide gel containing 8 M urea. Salt-free, pure oligodeoxyribonucleotides are obtained using Sep. Puck (Waters Associates). These fragments represent a double helix, which encodes an invertase signal sequence with frequently used yeast codons.

HindIII

EcoRI,.:MetLeuLeuGlnAlaPheLeuPheLeuLeu

I-1. 5'AATTCATGCTTTTGCAAGCTTTCCTTTTCCTTTT 3'

I-2 3'GTACCAAAACGTTCGAAAGGAAAAGGAAAACCGAC 5'

AlaGlyPheAlaAlaLysIleSerAla

I-3 5'GGCTGGTTTTGCAGCCAAAATATCTGCATCTTAGCGTC 3'

I-4 3' CAAAACGTCGGTTTTATAGACGTAGAATCGCAGAGCT 5'

Hga I

XhoI

B) Subcloning of the invertase signal sequence in plasmid p31

a) Preparation of vectors:

1.5 µg of p31R/SS-TPA 2 (European Patent Application No. 143,081) was digested with 10 U of EcoRI (Boehringer) in 50 µl of 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 100 mM NdCl, 6 mM NaCl. mercaptoethanol for 1 hour at 37°C. After the addition of 1 µl of 2.5 M NaCl, 10 U XhoI (Boehringer) was added and incubated for one hour at 37°C. 4.2 kb vector isolated on 0.8% preparative agarose gel. Transfer the gel slice to a Micro Collodor tube (Sartorius GrnbH), covered with 200 µl TE and electroelute (electrophoresis for 50 minutes at 90 mA). Collect the TE solution and precipitate in 2.5 volumes of absolute ethanol after adding 0.1 volumes of 10 x TNE. The DNA precipitate is washed with 80% ethanol and dried in a vacuum. DNA is resuspended in 6 µl TE (40 pmole/µl).

b) Renaturation (annealing) of oligodeoxyribonucleotides (I-1, I-2, I-3, I-4), kination and binding with the vector

A solution containing 10 pmol of each of the four deoxyribonucleotides in 10 µl of 0.5 M Tris-HCl pH 8 was incubated for 90 minutes at 95°C in a water bath. Cool the water bath slowly over 5 hours to 30°C. To this renaturation mixture we add 2 µl each of 0.1 M MgCl2, 0.1 M NaCl, 30 mM DTT, 4 mM ATP and 8 U (1 µl) polynucleotide kinase (Boehringer). Kination takes place for one hour at 37°C. Renatured, kinased oligodeoxy-ribonucleotides and 60 pmol of p31R/SS-TPAΔ2 cut vector (1.5 µl) were connected with 400 U (1 µl) of T4 DNA ligase (Biolabs) for 17 hours at 14°C. The reaction was stopped by incubation for 10 minutes at 65°C. We use 10 µl of this binding mixture to transform E.coli HB101 Ca++ cells /M. Dagert and S.D. Ehrlich, Gene 56, 23-28 (1979)/. We select 20 ampR colonies. DNA is prepared by a rapid isolation procedure (D.S. Holmes and M. Quigley, Anal. Biochem. 114, 193-197 (1981)/. DNA is digested with EcoRI and XhoI, radiolabeled at the EcoRI end and analyzed on a 6%-norm polyacrylamide-norm gel, which contains 8 M urea, using radiolabeled pBR322 HaeIII cut DNA as a marker. Bands of the correct size for DNA obtained from all 20 clones are seen. One clone grows in 100 ml of LB medium, containing 100 µg/ml ampicillin. Plasmid DNA is isolated and we designate as p31RIT-12.

C) Construction of pJDB207/PHO5-I-TPA (see Figure 19)

a) Preparation of vectors:

Three µg of pJDB207/PHO5-TPA18 (European Patent Application No. 143,081) were incubated for one hour at 37°C with 10 U of BamHI in 50 µl of 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 100 mM NaCl, 6 mM mercaptoethanol. . We examine the aliquot on a 1% agarose gel in TBE buffer to confirm complete digestion. The digestion is incubated for 10 minutes at 65°C. Then we add 0.5 µl 5 M NaCl, then 15 U XhoI (Boehringer). This is incubated for one hour at 37°C. The 6.8 kb vector was isolated on a 0.8% preparative agarose gel. DNA is extracted by electroelution and after precipitation is dissolved in TE.

b) XhoI digestion of p31/PHO5-TPA18:

30 ELg p31/PH05-TPA 18 (European Patent Application No. 143,081) incubated for one hour at 37°C with 60 U XhoI (15 U/µl) in 200 µl 10 mM Tris-HCl pH 8, 6 mM MgCl2, 150 mM NaCl, 6 mM mercaptoethanol, extracted with an equal volume of phenolchloroform and precipitated in ethanol.

c) Partial PstI digestion of the XHOII cut of p31/PHO5-TPA18

Resuspend the precipitated .aXhoI cut p31/PHO5-TPA18 DNA in 250 µl 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 50 mM NaCl, 6 mM mercaptoethanol, 2.5 mg homidium bromide, incubate for 35 minutes at 37°C. with 22.5 U.PstI and extracted with an equal volume of phenol and then with an equal volume of chloroform-isoamyl alcohol (50:1). The 1.6 kb fragment was isolated on a 1% preparative agarose gel. DNA is extracted by electroelution and precipitated (inset 1).

d) SalI-XhoI digestion of p31RIT-12:

Thirty µg of p31RIT-12 were incubated for one hour at 37°C with 60 U of SaII (Boehringer 12 U/µl) and 60 U of XhoI (15 U/µl) in 200 µl of 10 mM Tris-HCl pH 8, 6 mM MgCl2, 150 mM NaCl, 6 mM mercaptoethanol, extracted with an equal volume of phenol-chloroform and precipitated in ethanol. The 869 bp fragment was isolated on a 1.2% preparative agarose gel. DNA is extracted by electroelution, desalted with DE-52, and precipitated in ethanol.

e) Hgal digestion of Sa1I-XohI cut of p31RIT-12

Resuspend the SalI-XhoI cut of p31RIT-12 in 100 µl 6 mM Tris-HCl pH 7.5, 10 mM MgCl2, 50 mM NaCl, 1 mM dithiotrietol, 10 mg bovine serum albumin and incubate for one hour at 37°C with 6 U of HgaI. (Biolabs, 0.5 U/µl). The 600 bp fragment was isolated on a 1.2% agarose gel. DNA is extracted by electroelution and precipitated in ethanol.

f) Renaturation of binding oligonucleotides

90 pmoles of two oligodeoxyribonucleotides having the sequence

HgaI PstI

5' CTGCATCTTACCAAGTGATCTGCA 3'

3' AGAATGGTTCACTAG 5'

it is suspended in 10 µl of 0.5 mM Tris-HCl pH 8 in a siliconized Eppendorf tube. The solution is incubated for 5 minutes at 95°C and then slowly cooled to room temperature overnight.

g) Linker kinetics

Add 2 µl of 0.1 M KCl, 2 µl of 0.1 M MgCl2, 3 µl of 30 mM DTT, 1 µl of 200 mM ATP, 8 U of polynucleotide (8 U/µl) to the above solution. This is incubated for one hour at 37°C.

h) Binding of HgaI fragment from p31RIT-12 with kinased,

Transfer the kinased linker solution to a test tube containing the dry HgaI fragment and add 400 U of T4 DNA ligase. The solution is incubated for 90 minutes at room temperature (21 to 22°C). dilute to 100 µl with TE and extract with an equal volume of phenol/chloroform. The fragment is precipitated by adding 0.6 volumes of isopropanol and 0.1 volumes of 3 M sodium acetate to the solution at room temperature.

i) BamHI-PstI digestion of the above

The above dried DNA was digested with 10 U BamHI and 10 U PstI in 20 µl 10 mM Tris-HCl pH 7.5, 100 mM MgCl 2 , 6 mM mercaptoethanol for one hour at 37°C. After dilution to 100 µl, the solution is extracted with an equal volume of phenol/chloroform and the aqueous layer is precipitated in isopropanol (inset 2).

j) Connection of three fragments

100 fmol of pJDB207/PHO5-TPA18 BamHI-XhoI cut vector fragment, 200 fmol of each of the other two inserted fragments (1 and 2) are ligated in 10 µl of 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 µg gelatin with 400 U T4 DNA ligase for 16 hours at 15°C. The reaction was stopped by incubating for 10 minutes at 65°C. 5 µl of this binding mixture is used to transform E.coli HB101 CA++ cells. 10 ampR colonies are picked and DNA is prepared by the rapid isolation procedure. When analyzed with EcoRI, PstI and BamHI-HindIII, we see fragments of the correct size. One clone grows in 100 ml of LB medium, containing 100 µg/ml ampicillin. Plasmid DNA was isolated and named as pJDB 207/PHO5-I-TPA.

Example 7

Construction of plasmid pC516/UPA encompassing the coding region of u-PA

A) Construction of plasmid pCS16 (see Figure 20)

1.5 kb PstI-BamHI fragment of plasmid pUN121 /B. Nilsson et al., Nucl. Acids Res. 11, 8019-8030 (1983)/ which includes the cI gene of phage lambda and part of the tetracycline resistance gene was cloned into pUC18 /J. Norrander et al., Gene 26, 101-106 (1983)/, cut with PstI and BamHI. The resulting clone is digested with PstI. The ends that hang over 3' are removed in the reaction with T4 DNA polymerase and XhoI linkers are attached to the blunt ends. After digestion with XhoI, we change the molecule back into a circular shape by linking. An aliquot of the binding mixture was used to transform Ca++-treated E.coli HB101 cells. We analyze the DNA of individual, transformed colonies resistant to ampicillin. We select one of several clones and name it as pCS16.

B) Construction of plasmid pCS16/UPA (see Figure 21)

Urokinase cDNA, which is in plasmid pcUK176 (see example 2), is subcloned in plasmid pCS16. The subcloned cDNA extends from the SmaI site in region 5 of the undigested region (Fig. 4) to the PvuII site at nucleotide position 1439-1444 in the 3 undigested region (numbering according to Fig. 3).

15 µg of pcUK176 plasmid was digested with PvuII. The 379 bp PvuII fragment is isolated from other fragments on a 1.5% agarose gel in Tris-borate EDTA buffer pH 8.3. DNA is electroeluted, purified with DES2 (Whatman) ion exchange chromatography and precipitated with ethanol. 1.2 µg of single-stranded XhoI linkers (5'-CCTCGAGG-3') are phosphorylated at the 5' ends, heated for 10 minutes at 75°C, during cooling to room temperature they renature themselves and stored at -20°C. 0.9 µg of kinase, double-stranded XhoI linkers were ligated at 80-fold molar excess to the blunt ends of the 379 bp PvuII fragment of pcUK176 (see above) in 20 µl of 60 Tris-HCl pH 7.5, 10 mM MgCl2, 5 mM DTT, 3 , 5 mM ATP and 400 units of T4 DNA ligase (Biolabs) for 16 hours at 15°C. He heats the mixture for 10 minutes at 85°C. Excess binding molecules are removed by precipitation with 0.54 volumes of isopropanol in the presence of 10 mM EDTA and 300 mM sodium acetate pH 6.0 for 30 minutes at room temperature. The DNA was digested with XhoI and BamHI. The 121 bp BamHI-XhoI fragment was isolated on a 1.5% agarose gel in Tris-borate-EDTA buffer pH 8.3. 6 µg of pcUK176 plasmid was digested with SmaI and BamHI. We isolated a 1.3 kb SmaI-BamHI fragment encompassing most of the u-PA coding sequence. 6 µg of plasmid pCS16 was digested with SmaI and XhoI. We isolate a 2.7 kb vector fragment. DNA fragments are electroeluted from the gel and precipitated with ethanol. 0.2 pmol of the 1.3 kb SmaI-BamHI fragment, 0.2 pmol of the 121 bp BamHI-XhoI fragment (both fragments together comprise the entire u-PA coding sequence) and 0.1 pmol of the 2.7 kb vector fragment are combined in 10 µl 60 mM Tris-HCl pH 7.5, 10 mM MgCl2, 5 mM DTT, 3.5 mM ATP and 400 units of T4 DNA ligase at 15°C. Add one and 3 µl aliquots of the binding mixture to 100 µl of Ca++ treated E.coli HB101 cells. The transformation takes place as described /A. Hinnen et al., Proc. Natl. Acad. Sci. USA 75, 1929 (1978)/. 12 colonies resistant to ampicillin grow in LB medium containing 100 ml/1 ampicillin. DNA is isolated according to Holmes et al., Anal. Biochem. 114, 193 (1981) and analyzed after EcoRI, PvuII and XhoI restriction digestion. One clone with the expected restriction fragments is called pCS16/UPA.

Example 8

Construction of plasmid pJDB207/PHO5-I-UPA (Figure 22)

pJDB2O7/PHO5-I-UPA contains the PHO5 promoter, the invertase signal sequence, the mature urokinase coding sequence, and the PHO5 transcription terminator in sequence, cloned into the pJD8207 yeast expression vector.

20 µg of plasmid pCS16/UPA was digested to completion with 40 units of EcoRI. After phenol extraction and ethanol precipitation with DNA digested with EcoRI, cut further with TaqI at 65°C. The obtained fragments are separated on a preparative 1.2% agarose gel. The 462 bp TaqI-EcoRI fragment was isolated by electroelution from the gel and precipitated with ethanol.

Oligodeoxyribonucleotide linker of the formula

(I) 5'-CTGCAAGCAATGAACTTCATCAAGTTCCAT-3'

(II) 3'-TCGTTACTTGAAGTAGTTCAAGGTAGC-5'

bind to the TaqI site of the DNA fragment. The linker restores the 5' end of the mature u-PA coding sequence (nucleotides 130-154, Figure 3) and introduces an in-frame fusion with the invertase signal sequence. The 5'-CTGCA linker sequence fills in the corresponding 3 missing part of the invertase signal sequence, obtained by cleavage with HgaI.

300 pmoles of each of oligodeoxynucleotides I and II are phosphorylated and renatured. We bind 5.25 µg (600 pmol) of phosphorylated double-stranded DNA to 1.7 µg (5.6 pmol) of the 462 bp TaqI-EcoRI fragment (see above) in 175 µl of 60 mM TriS-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 5 mM DTT and 800 units of T4 DNA ligase for 16 hours at 15°C. T4 DNA ligase is inactivated for 10 minutes at 85°C. Excess linker was removed by precipitation in the presence of 10 mM EDTA, 300 mM sodium acetate pH 6.0, and 0.54 volumes of isopropanol. DNA is digested with PstI. The only 312 bp fragment containing a linker attached to the DNA sequence encoding u-PA up to nucleotide 436 (PstI site, see Figure 3) was isolated. The DNA fragment is purified by electroelution and precipitation with methanol.

Plasmid pCS16/UPA was digested with XhoI and PstI. The 1007 bp PstI-XhoI fragment was isolated and purified. This fragment contains most of the coding sequence for urokinase.

Plasmid p31RIT-12 (see Example 6B) was digested with SalI and XhoI. The 882 bp Sa1I-XhoI fragment was isolated from the gel by electroelution and ethanol precipitation. The fragment was further digested with BamHI and HgaI. A 591 bp BamHI-Ggai fragment containing the PHO5 promoter region and the invertase signal sequence was isolated.

Plasmid pJDB207/PHO5-TPA 18 (see European Patent Application No. 143,081) was digested with BamHI and XhoI. The 6.8 kb vector fragment was isolated on a preparative 0.6% agarose gel in Tris-acetate buffer, pH 8.2. DNA is electroeluted and precipitated with ethanol.

All DNA fragments are resuspended in water at a concentration of 0.1 pmol/µl. 0.2 pmole of 591 bp BamHI-HgaI fragment, 0.2 pmole of 312 bp HgaI-PstI fragment, 0.2 pmole of 1007 bp PstI-XhoI fragment and 0.1 pmole of 6.8 kb BamHI-XhoI vector fragment are bound for 15 hours at 15°C in 10 µl 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 5 mM DTT, 1 mM ATP and 400 units of T4 DNA ligase. One µl of the binding mixture is used to transform E.coli HB101 Ca++ cells. We pick up 12 ampR colonies and grow them in LB medium, which contains 100 mg/1 ampicillin. DNA is prepared by a rapid isolation procedure / D.S. Holmes et al., Anal. Biochem. 114, 193 (1981). On restriction digests of plasmid DNA with HindII and EcoRI, we see the expected restriction fragments. We select the plasmid DNA of a single clone and name it pJDB207/PHO5-I-UPA.

Example 9

t-PA/u-PA hybrid plasminogen activator with t-PA A-chain and u-PA B-chain domains (primary DNA construct)

Another approach to the construction within the framework of the fusion of DNA sequences that encode the A-chain of t-PA and the B-chain of u-PA in a previously determined position, consists of two steps: First, we connect the appropriate restriction fragments to the coding sequences. DNA is prepared in E.coli and subcloned in M13 to obtain single-stranded templates. In the second step, we remove excess nucleotide sequences by mutagenesis in vitro. The exact, framed bond between the t-PA A-chain and the u-PA B-chain is at the activation site. The mutated DNA is subcloned in a suitable expression vector for yeast and mammalian cell lines.

a) Isolation of the DNA fragment encoding the t-PA A-chain:

10 µg of plasmid pJDB207/PHO5-I-TPA (see example 6) was obtained with BamHI and PvuII. The 1.7 kb BamHI-PvuII fragment was separated on a 0.8% agarose gel in Tris-borate-EDTA buffer, pH 8.3. The DNA fragment contains the PHO5 promoter, the invertase signal sequence and the coding sequence of the mature t-PA up to the PvuII restriction site (compare Figure 1; nucleotide positions 1305-1310). DNA is electroeluted, precipitated with ethanol and resuspended in H2O at a concentration of 0.1 pmol/µl.

b) Isolation of DNA fragment encoding u-PA B-chain

Plasmid pCS16/UPA (see Example 7B) was digested with BaIII (compare Figures 3 and 4, nucleotide positions 573-578) and XhoI. The 868 bp BaII-XhoI fragment was isolated as above and resuspended in water at a concentration of 0.1 pmol/µl.

c) Connecting the fragments to the vector fragment

Plasmid pJDB207/PHO5-TPA 18 (European Patent Application No. 143,081) was digested with BamHI and XhoI. The 678 kb vector fragment was isolated on a preparative 0.8% agarose gel in Tris-acetatenorm buffer, pH 8.2. DNA is electroeluted and precipitated with ethanol and resuspended in water at a concentration of 0.1 pmol/µl.

0.2 pmole of 1.7 bp BamHI-HgaI fragment, 0.2 pmole of 868 bp BalII-XhoI fragment and 0.1 pmole of 6.7 kb BamHI-XhoI vector fragment are bound for 16 hours at 15°C in 10 µl of 60 mM Tris -HCl pH 7.5, 10 mM MgCl2, 5 mM DTT, 1 mM DTT, 3.5 mM ATP and 400 units of T4 DNA ligase (Biolabs). Add one and 3 µl aliquot mixtures to 100 µl of E.coli HB101 cells treated with Ca++. The transformation is carried out as usual.

Six transformed ampicillin-resistant colonies grow in LB medium containing 100 mg/l ampicillin. We prepare plasmid DNA using the method according to Holmes et al.,/Analyt. Biochem. 114, 193 (1981)/ and analyzed after restriction digests with BamHI and PstI. We select one clone with the expected restriction fragments and name it pJDB207/PHO5-TPAAUPAB.

Example 10

u-PA/t-PA hybrid plasminogen activator with u-PA A-chain and t-PA B-chain domains (primary DNA construct)

The primary hybrid DNA construct comprises the u-PA nucleotide sequences from the SmaI site to the EcoRI site (see Figure 4) linked to the t-PA nucleotide sequences from the ScaI site (positions 940-945) to the XhoI site, introduced at position 1800 via the XhoI linker. The output sequences of the hybrid DNA contain an excess of nucleotides, which we remove by mutagenesis in vitro. Exact, framed binding of u-PA A-chain and t-PA B-chain is located at the activation site.

a) Isolation of DNA fragment encoding u-PA A-chain:

7 ng of plasmid pCS16/UPA were digested with EcoRI. We convert the sticky ends of the obtained 3 fragments into blunt ends by an insertion reaction with 7.5 units of Klenow DNA polymerase (BRL) in the presence of 60 mM Tris-HCl pH 7.5, 10 mM MgCl2, 0.1 mM dATP and 0.1 mM dTTP 30 minutes at 25°C. Stop the reaction by adding EDTA to a final concentration of 12.5 mM. The DNA is further digested with KpnI. The 619 bp KpnI fragment with a blunt (EcoRI) end was isolated on a 1.5% agarose gel in Trisborate-EDTA buffer, pH 8.3, electroeluted and precipitated in ethanol.

b) Isolation of DNA fragment encoding t-PA B-chain:

6 µg of plasmid pJDB207/PHO5-TPA18 were digested with ScaI and XhoI. The 860 bp fragment was isolated on a 1.2% agarose gel in Tris-borate-EDTA buffer, pH 8.3, electroeluted and precipitated in ethanol.

c) Connection of DNA fragments to the pUC18 derived vector:

5 µg of plasmid pCS16/UPA (see Example 7) was digested with KpnI and XhoI. The resulting 2.7 kb fragment was isolated on a 0.8% agarose gel in Tris-borate-EDTA buffer, pH 8.3. DNA is electroeluted and precipitated in ethanol. All DNA fragments are resuspended in water at a concentration of 0.1 pmo1 a /µl.

0.2 pmole of 619 bp Kpn-blunt-ended u-PA fragments, 0.2 pmole of 860 bp Scal-XhoI t-PA fragment and 0.1 pmole of 2.7 kb KpnI-XhoI vector fragment are ligated as described above (example 9). Ca++ treated E.coli HB101 cells are transformed. 12 transformed ampicillin-resistant colonies grow in LB medium supplemented with ampicillin (100 mg/1). DNA is prepared according to Holmes (see above) and analyzed after restriction digestion with EcoRI and PstI. We denote the individual clone with the expected restriction fragments as pCS16/UPAA/TPAB.

Example 11

u-PA/t-PA hybrid plasminogen activator with another "kringle" and catalytic B-chain of t-PA (primary structure)

The hybrid plasminogen activator gene, which includes the DNA sequences of the "growth factor-like" (U)-domain of urokinase, the second "kringle" domain (K2) of t-PA and the catalytic B-chain of t-PA, is constructed in the following way: Two DNA restriction fragments that encode growth factor u-PA domain and t-PA K2 "kringles" with respect to the e-chain, we connect and insert into plasmid pCS16. We call the obtained clone pCS16/UK2TPAB. The fragment containing the sequences encoding u-PA and t-PA was subcloned into M13. In vitro mutagenesis is performed on single-stranded DNA to remove redundant DNA sequences at the junction between the u-PA and t-PA sequences.

5 µg of plasmid pSC16/UPA was digested with NcoI (nucleotide positions 326-331, see Figure 4). We fill the sticky ends of the restriction fragments by reacting with 5 units of Klenow DNA polymerase I (BRL) in the presence of 0.1 mM each of dATP, dTTP, dCTP, dGTP, 60 mM Tris-HCl pH 7, 5, 10 rnM MgCl2 in 50 µl for 30 minutes. at room temperature. Stop the reaction by adding EDTA to a final concentration of 12.5 mM. DNA is precipitated in ethanol and further digested with XhoI. The 3 kb fragment of XhoI with a blunt end /NcoI/ was isolated on a 0.8% agarose gel in Tris-borate-EDTA, pH 8.3, electroeluted and precipitated in ethanol. This fragment contains the pCS16 vector and the coding sequence for the growth factor u-PA domain. 10 µg of plasmid pJBD207/PHO5-TPA18 (European patent application number 143,081) was digested with BstXI / nucleotide positions 577-588/. A linear DPdA fragment with ends overhanging the 3' was incubated with 10 units of T4 DNA polymerase (BRL) in 100 µl of 33 mM Trisacetate pH 7.9, 66 mM potassium acetate, 10 mM magnesium acetate, 0.5 mM DTT and 0.1 mg/ml bovine serum albumin 2.5 min at 37°C. We continue the incubation for 35 minutes at 37°C in the presence of 0.1 mM each of dATP, dCTP. dTTP, dGTP in a total volume of 200 µl. The DNA is precipitated in ethanol and further digested with XhoI. The 1.2 kb blunt-ended /BStXI/-XhoI fragment is separated on a 0.8% agarose gel, electroeluted and precipitated in ethanol. This fragment has the coding sequence for K2 and the B-chain of t-PA.

0.2 pmole of the 1.2 kb t-PA fragment and 0.1 pmole of the 3 kb u-PA7 vector fragment (see above) were ligated as described. We use aliquot binding mixtures to transform primary E.coli HB101 cells. We select ampicillin-resistant colonies on LB agar plates containing 100 mg/1 ampicillin. DNA is prepared from individual transformants and analyzed after ScaI and SmaI restriction digestions. We select a clone containing 0.5 kb Scal and 1.55 SmaI binding fragments and name it pCS16/UK2TPAB.

Example 12

t-PA/u-PA hybrid plasmogenic activator with another "kringle" t-PA and catalytic B-chain of u-PA (primary structure)

The hybrid plasminogen activator gene, which includes the DNA sequences of the "growth factor-like" (U)-domain of urokinase, the second "kringle" domain (K2) of t-PA and the catalytic B-chain of u-PA, is constructed by a method analogous to that described in example 11 .

Construction of plasmid pCS16/UK2UPAB:

5 µg of plasmid pSC16/UPA was digested with BglII and NcoI (nucleotide positions 391-396 relative to 326-331, see Figure 4). Sticky ends of restriction fragments are filled in by reaction with Klenow DNA polymerase I (BRL) as described above. 4.2 kb of DNA with blunt ends was isolated on a 0.8% agarose gel in Tris-borate-EDTA, pH 8.2. DNA is electroeluted and precipitated in ethanol. This fragment contains u-PA G-domain and u-PA B-chain linked to the vector molecule.

10 µg of plasmid p31/PHO5-TPA18 (European Patent Application No. 143,081) was digested with AluI. The 447 bp AIuI fragment containing the entire t-PA domain was isolated on a 1.5% agarose gel in Tris-borate-EDTA buffer, pH 8.3. The DNA fragment is electroeluted and precipitated in ethanol.

0.2 pmol of the 447 kb fragment and 0.1 pmol of the 4.2 kb fragment. We use aliquot binding mixtures to transform primary E.coli HB101 cells. We select transformed cells on LB agar plates with 100 mg/1 ampicillin. DNA is prepared from ampicillin-resistant cells and analyzed after EcoRI and ScaI digestion. A single clone showing a 551 kb EcoRI fragment and a 403 bp ScaI fragment has the AIuI fragment inserted in the correct orientation. We call this clone pCS16/UK2UPAB.

Example 13

Cloning of primary hybrid DNA constructs in M13mp18

A) Cloning of pJDB207/PHO5-I-TPAAUPAB HamHI fragment in M13mp18

1.5 µg pJDB207 /PHO5-I-TPAAUPAB (cf. Example 9) obtained by rapid DNA preparation, digested with 9 U BamHI (Boehringer) in 20 µl 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 100 mM NaCl , 6 mM mercaptoethanol for one hour at 37°C. After the addition of 1 µl of RNase (Serva, 1 mg/ml), incubation for 15 minutes at 37°C and phenolization, a 2.5 kb inclusion was isolated on a 0.8% preparative agarose gel. DNA is extracted by electroelution and precipitated.

1 µg of 31mp18 (RF) was cut with BamHI, treated with calf intestinal alkaline phosphatase, and the 7.3 kb vector fragment was isolated on a 0.7% preparative agarose gel. DNA is electroeluted and precipitated.

100 pmol of M13mp18 BamHI cut vector and 200 pmol of BamHI TPAUPAB included in 10 µl of 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 µg gelatin with 400 in T4 DNA ligase 7 hours at 15°C. After incubation for 10 minutes at 65°C, we use 5 µl of this binding mixture for the transformation of E.coli JM101 primary cells according to the manual "M13 Cloning and Sequencing Handbook", published by Amersham. We collect 36 colorless plaques and prepare the single-stranded replicate form (RF) of DNA. In FR-DNA analysis, all clones showed inclusions of the correct size after digestion with BarnHI. Fragments of the correct size after digestion with EcoRI and PstI show that the DNA inclusions in all clones are in reverse orientation (single-stranded template DNA is the non-coding strand). We named one of these clones as mp18/BamHI/-TPAA/UPAB and used it for deletion mutagenesis.

B) Cloning of pCS16/UPAA/TPAB KpnI-HindIII fragment in M13mp18

1.5 µg pCS16/UPAA/TPAB (cf. Example 10) obtained by rapid DNA preparation, digested with 12 U KpnI in 20 µl 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 6 mM mercaptoethanol for one hour at 37° C. After addition of 1 µl of 1 M NaCl DNA is digested with 12 U HindIII for one hour at 37°C. We isolate a 1.5 kb fragment on a 0.8% preparative agarose gel. DNA is extracted by electroelution and precipitated.

0.5 µg of M13mp18 (RF) was digested with KpnI and HindIII. We isolate the 7.3 kb vector fragment on a 0.7% preparative agarose gel. DNA is electroeluted and precipitated.

100 pmoles of M13mp18 KpnI-HindIII cut vector and 200 pmoles of KpnI-HindIII inclusive are ligated in 10 µl of 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 µg gelatin with 400 in T4 DNA ligase for 7 hours at 15°C. The reaction was stopped by incubation for 10 minutes at 65°C. We use 5 µl of this binding mixture for the transformation of E.coli JM101 primary cells. We collect 10 colorless plaques and prepare a single-stranded replicate form (RF) of DNA. In the RF-DNA analysis, all clones show inclusions of the correct size and the correct size of fragments. We name one of these clones as mp18/KpnI-HindIII/-UPAA/TPAB and use it for................

C) Cloning of pCS16/UK2TPAB KpnI-HindIII fragment in M13mp18

1.5 µg of pCS16/UK2TPAB (cf. Example 11) obtained from the rapid DNA preparation was digested with 12 U of KpnI (Boehringer) in 20 µl of 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 6 mM mercaptoethanol for one hour at 37°C. After addition of 1 µl of 1 M NaCl DNA is digested with 12 U HindIII for one hour at 37°C. We isolate a 1.5 kb fragment on a 0.8% preparative agarose gel. DNA is extracted by electroelution and precipitated.

0.5 µg of M13mp18 (RF) was digested with KpnI and HindIII. We isolate the 7.3 kb vector fragment on a 0.7% preparative agarose gel. DNA is electroeluted and precipitated.

100 pmoles of M13mp18 KpnI-HindIII cut vector and 200 pmoles of KpnI-HindIII included are ligated in 10 µl of 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 gelatin with 400 in T4 DNA ligase for 7 hours at 15°C. The reaction was stopped by incubation for 10 minutes at 65°C. We use 5 µl of this binding mixture for the transformation of E.coli JM101 primary cells. We collect 10 colorless plaques and prepare a single-stranded replicative form (RF) of DNA. In the RF-DNA analysis, all clones show inclusions of the correct size and the correct size of fragments. We named one of these clones as mp18/KpnI-HindIII/UK2TPAB and used it for deletion mutagenesis.

D) Cloning of pCS16/UK2UPAB KpnI-HindIII fragment in M13mp18

1.5 µg pC516/UK2UPAB (cf. Example 12) obtained by rapid DNA preparation, digested with 12 U KpnI (Boehringer) in 20 µl 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 6 mM mercaptoethanol for one hour at 37 °C. After addition of 1 µl of 1 M NaCl DNA is digested with 12 U HindIII for one hour at 37°C. We isolated a 1.7 kb fragment on a 0.8% preparative agarose gel. DNA is extracted by electroelution and precipitated.

0.5 µg of M13mp18 (RF) was digested with KpnI and HindIII. We isolate the 7.3 kb vector fragment on a 0.7% preparative agarose gel. DNA is electroeluted and precipitated.

100 fmoles of M13mp18 KpnI-HindIII cut vector and 200 fmoles of KpnI-HindIII inclusive are ligated in 10 µl of 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 µg gelatin with 400 in T4 DNA ligase for 7 hours at 15°C. The reaction was stopped by incubation for 10 minutes at 65°C. We use 5 µl of this binding mixture for the transformation of E.coli JM101 primary cells. We collect 10 colorless plaques and prepare a single-stranded replicative form (RF) of DNA. When analyzing RF-DNA, all clones show inclusions of the correct size and the correct size of fragments. We named one of these clones as mp18/KpnI-HindIII/UK2UPAB and used it for deletion mutagenesis.

Example 14

Deletion mutagenesis of primary hybrid DNA constructs

A) General protocol of deletion mutagenesis

a) Phosphorylation of the mutant example:

For mutagenesis, we phosphorylate 200 pmol of mutagen sample in 20 µl of 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 5 mM DTT, 0.1 Spermidine, 0.1 mM EDTA containing 1 µl of 10 mM ATP and using 8 U T4 DNA polynucleotide kinase (Boehringer. 8 U/µl). After incubation for one hour at 37°C, the reaction is stopped by heating for 10 minutes at 65°C.

For hybridization overlay, 20 pmol of mutagenic sample is phosphorylated as above using 30 µCi γ32-P-ATP (3000 Ci/mmol): Amersham International; as the only source of ATP). Dilute the sample with 3.5 ml of 6 x SSC and use directly as a sample.

b) Renaturation of the mutagenic example and the general sequence example with a single-stranded template

0.2 pmol of single-stranded template was incubated with 20 pmol of phosphorylated mutagenic oligodeoxyribonucleotide primer (10 pmol/µl) and 10 pmol of general M13 sequence primer in 10 µl of 20 mM Tris-HCl pH 7.5, 10 mM MgCl2, 50 mM NaCl, 1 mM DTT for 5 minutes at 95°C. Let the solution slowly cool to room temperature over 30 minutes.

c) Prolonged binding reaction

To the above renaturation mixture, add 10 µl of enzymatic dNTP (dATP, dGTP, dTTP, dCTP) solution containing 1 µl of buffer (0.2 M Tris-HCl pH 7.5, 0.1 MgCl2, 0.1 M DTT), 4 µl 2.5 mM dNTP mix, 1 µl 10 mM ATP, 0.5 µl T4 DNA ligase (Biolabs. 400 U/µl), 0.67 µl Klenow DNA polymerase (BRL, 2.99 U/µl). The mixture is incubated for one hour at 15°C and then for 16 hours at 8 - 9°C. The reaction was stopped by incubation for 10 minutes at 65°C.

d) Transformation of the binding mixture

We dilute the binding mixture to 1:20 and 1:200 with TE: 1 µl and 5 µl of each of these diluted solutions are used to transform 0.2 ml of the non-repair strain E.coli BMH 71-18mutS /BMH71-I8 (δ( lac-proAB), thi, SupE, F'laCiq, ZδM15, proA+B+/ of primary cells. The construction of E.coli BMH71-18mutS (BMH71-18, mut S215::Tnio) was described by Kramer et al. /Cell 38, 879-887 (1984) / After transfection, the "trate" cells were harvested with the repair strain E.coli JM 101 in order to minimize the establishment of the phage mutator phenotype of the non-repair strains / P. Carter, H. Bedouelle and G. Winter, Nucl . Acids Res. 13, 4431-4443 (1985)/.

e) Phage coating

100 plaques emerging from the transfected DNA are transferred with a toothpick to YT plates and they grow as colonies of infected bacteria in 15 - 18 hours. Colony drying was adapted according to Grunstein and Hogness /Proc. Natl. Acad. Sci. USA 72, 3961-3965 (1985)/. Place a nitrocellulose filter (Millipore S.A., Cat. No. HAWP 090, pore size 0.45 µm) on the colony plate for 10 minutes at room temperature. Filters are denatured with 0.5 N NaOH, neutralized with 1 M Tris-HCl pH 7.5 and then treated with a high salt solution (0.5 M Tris-HCl pH 7.5 + 1.5 M NaCl). Bake the filters in a vacuum for 30 minutes at 80°C, prehybridize in 100 ml x 10 Denhardt's solution (D.T. Denhardt, Biochem. Biophys. Res. Commun. 23, 641-646), 6 x SSC and 0.2% SDS in a closed plastic bag for 15 minutes.

For hybridization overlay, prehybridized filters are washed in 50 ml of 6 x SSC for 1 minute and then hybridized in 3.5 ml of sample containing 32 P-labeled sample for 30 minutes. The hybridized filters are washed in 100 ml of 6 x SSC at room temperature for 2 minutes and then autoradiographed. Good discrimination between wild-type and mutated phage is obtained after a short wash (5 minutes) at 60°C in 100 ml of 0.1 x SSC + 0.1% SDS.

f) Confirmation of deletion mutation in positive clones obtained from hybridization

We transfer the phages from the positive columns with a toothpick into 1 ml of 2 x YT, heat for 20 minutes at 70°C to kill the bacteria and then inoculate 100 µl of this phage suspension into 1.5 ml of freshly growing E. coli JM101 culture (OD600 ~ 0.45) . We shake the cultures vigorously (300 rpm) for 4 hours at 37°C. Prepare the phage stock and replica DNA form from positive clones /J. Messing, Methods in Enzymology, 101, 21-78 (1983)/. DNA from mutants (after deletion mutagenesis) is analyzed with appropriate restriction enzymes and compared with restriction fragments of wild type (before deletion mutagenesis) DNA. After confirmation by restriction analysis, the DNA from one correct mutant is purified by plaque. Mutations are further confirmed after restriction analysis and by sequencing using the chain key /F method. Sanger, S. Niclen and A.R. Coulson, Proc. Natl. Acad. Sci. USA 74, 5463-5467 (1977)/.

B) Deletion mutagenesis at mp18/BamHI/TPAAUPAB (see Figure 23)

Deletion mutagenesis is performed as described in the general protocol. Positive clones obtained from hybridization are confirmed by restriction analysis. 333 bp is removed during deletion mutagenesis from the BamHI fragment. Restriction analysis with BamHI confirms the 2150 bp fragment. Further restriction analysis with EcoRI yielded 660, 416, 287, 230 bp fragments on the mutants instead of the 660, 472, 416 and 287 fragments seen on the wild type. Analysis with PstI shows two fragments of 611 and 414 bp for the mutants. The wild type DNA shows three fragments of 622, 611 and 414 bsp. One mutated clone that has the correct structure is named mp18/BamHI/MOTPAAUPAB.

We confirm the DNA sequence of the connection between the t-PA A-chain and the u-PA B-chain using the chain sequence key method, which has the example sequence of the sequence 5'CAGAGCCCCCCCGGTGC3'. This example is complementary to the u-PA coding strand (682-666).

C) Deletion mutagenesis at mp18/KpI-HindIII/UPAATPAB (see Figure 24)

Deletion mutagenesis is performed as described in the general protocol. Positive clones obtained from hybridization are confirmed by restriction analysis with PstI. In the mutants we observe a 467 bs band compared to the wild type which. gives a 544 bp fragment. One mutated clone that has the correct structure is named mpl1/KpnI-HindIII/MOUPAATPAB. We confirm the deletion using the chain sequence key method using the sequence 5'CAAAGATGGCAGCCTGC3'. This example is complementary to the coding strand of t-PA (1062-1046).

D) Deletion mutagenesis on mp18/KpnI-HindIII/UK2TPAB (see Figure 25)

Deletion mutagenesis is performed as described in the general protocol. Positive clones obtained from hybridization were confirmed by restriction analysis with KpnI-Hindl:Il, EcoRI and PstI. The fragments we get are

KpnI-HindIII EcoRI PstI

wild mutant wild mutant wild mutant

type type type

1475 bp 1284 bp 542 bp 351 bp 622 bp without 622

bp strips

For mutants, we determine the correct size of inserts and fragments. One of the mutant clones with the correct structure is referred to as mp18/KpnI-HindIII/MOUK2TPAB. We verify the release by the method of chain-terminator sequencing by applying a sequence comparison with the sequence (sequence)

5'CCCAGTGCCTGGGCACTGGGGTTCTGTGCTGTG3'

This example is complementary to the coding chain of t-PA (853-821).

E) Deletion mutagenesis at mp18/KpnI-HindIII/UK2UPAB (see Figure 26)

Two separate deletion mutations are involved in the construction of UK2UPAB:

We perform the first deletion mutagenesis as described in the general protocol. Positive clones obtained during hybridization were confirmed by restriction analysis with EcoRI. In the mutants we observe bands 549, 416, 431 bp, compared to the wild type which gives fragments 549, 452 and 416. One mutant clone with the correct structure is referred to as mp18/KpnI-HindIII/MOUK2UPAB-1. Deletion is verified by the method of chain-terminator sequencing, using sequence comparison with the sequence

5'CCCAGTGCCTGGGCACTGGGGTTCTGTGCTGTG3'

This example is complementary to the coding chain of t-PA (853-821).

In the second stage of deletion mutagenesis, we perform a deletion simultaneously with the introduction of a point mutation. Deletion mutation is performed as described in the general protocol. Positive clones obtained during hybridization were confirmed by restriction analysis with EcoRI. In the mutants, we observe bands of 416, 315, 259 bp, compared to the wild type which gives fragments of 549, 416 and 351 bp. We list one mutated clone with the correct structure as mp18/KpnI-HindIII/MOUK2UPAB. We confirm the deletion by the method of chain-terminator sequencing using sequence comparison with the sequence

5'CAGAGCCCCCCGGTGC3'.

This example is complementary to the code CHAIN U-PA (682-666).

Example 15

Cloning of hybrid t-PA/u-PA cDNA constructs into the yeast expression vector pJDB207

A) Cloning of the TPAAUPAB hybrid gene in pJDB207

RF-DNA is prepared for mp18/BamHI/MOTPAUPAB by rapid DNA isolation procedure /D.S. Holmes and M. Quingley, Anal. Biochem. 114, 192-197 (1981)/.

RF-DNA (1.5 (g) was digested with 9 U BamHI in 20 (l 10 mM Tris-HCl ph 7.5, 6 mM MgCl2, 100 mM NaCl, 6 mM mercaptoethanol for one hour at 37°C. After addition 1 l of RNase (1 mg/ml) and 10 minutes of incubation at 37°C, isolate a 2.1 kb insert on a 0.7% preparative agarose gel. The DNA insert is extracted by electroelution and precipitated in ethanol.

1.5 µg of pPDB207 /PHO5-I-TPAAUPAB were diluted with BamHI, treated with calf intestinal alkaline phosphatase, and the 6.7 kb vector was isolated. After electroelution, we precipitate vector DNA.

100 fmoles of pJDB207/PHO5-I-TPAAUPAB BamHI cleaved vector, 200 fmoles of TPAAUPAB insert are connected in 10 (l 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 (g gelatin with 400 U of T4 DNA ligase for 8 hours at 15° C. The reaction is stopped by incubation for 10 minutes at 65° C. 5 (l of this ligation mixture is used to transform E.coli HB101 Ca++ cells / M. Dagert and S.D. Ehrlich, Gene , 6, 23-28 (1979)/. 12 ampR colonies are picked and DNA prepared by a rapid isolation procedure. DNA analysis of 5 clones shows correct size of inserts as well as correct orientation. One clone is grown on 100 ml of LB medium containing 100 mg/ ml of ampicillin We isolate the plasmid DNA and designate it as pJDB207/PHO5-I-MOTPAAUPAB.

B) Cloning of MOUPAATPAB, MOUK2TPAB and MOUK2UPAB gene inserts into plasmid pCS16

RF-DNA is prepared for mp18/KpnI-HindIII/MOUPAATPAB, mp18/KpnI-HindIII/MOUK2TPAB, mp18/KpnI-HindIII/MOUK2UPAB by rapid DNA isolation procedure.

Three RF-DNAs (~1.5 (g)) were digested with 12 U of KpnI and 12 U of HindIII in 20 (l Tris-HCl pH 7.5, 6 mM MgCl2, 6 mM mercaptoethanol for 1 hour at 37°C. 1 (l 1 M. NaCl) is added and all DNA is further digested with 12 U HindIII. After the addition of 1 ml of RNase/1 mg/ml) and incubation for 10 minutes at 37°C, a 1.4 kb insert is isolated at 0.8% DNA inserts are extracted by electroelution and precipitated in ethanol.

Three (g) of pCS16/UPA were digested with KpnI and HindIII and a 2.7 vector fragment was isolated. After electroelution, the vector DNA was precipitated in ethanol.

100 fmol of pCS16 KpnI-HindIII cut vector, 200 fmol of KpnI-HindIII cut insert fragments are connected in 10 (l 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 (g gelatin with 400 U of T4 DNA ligase for 8 hours at 15° C. The reaction is stopped by incubation for 10 minutes at 65° C. 5 l of this binding mixture is used for the transformation of E.coli H8101 Ca2+ cells.

Six ampR colonies were collected from each of the three connections. DNA is prepared by the rapid isolation procedure. When analyzing DNA with KpnI-HindIII, insert bands of the correct size are observed. One clone between each of the three connections is grown in 100 ml LB medium containing 100 mg/ml ampicillin. Plasmid DNAs derived from mp18/KpnI-HindIII/MOUPAATPAB, mp18/KpnI-HindIII/MOUK2TPAB and mp18/KpnI-HindIII/MOUK2UPAB were isolated and designated as pCS16/MOUPAATPAB, pCS16/MOUK2TPAB and pCS16/MOUK2UPAB.

C) Cloning of MOUPAATPAA, MOUK2TPAB and MOUK2UPAB gene inserts into plasmid pJDB207

5 (g pJDB207/PHO5-I-UPA digested with 15 U ScaI and 15 U XhoI (Boehringer) in 50 (l 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 150 mM NaCl, 6 mM mercatethanol for 1 hour at 37°C. After the addition of 1 (l) RNase (1 mg/ml), we isolate a 6.7 kb vector fragment. After electroelution, we precipitate the vector DNA.

After 15 (g pCS16/MOUPAATPAB, pCS16/MOUK2TPAB and pCS16/MOUK2UPAB were incubated at 37°C for 1 hour in XhoI in 200 (l 10 mM Tris-HCl pH 8, 6 mM MgCl2, 150 mM NaCl, 6 mM mercaptoethanol, extracted with an equal volume of phenolchloroform, and precipitated in ethanol. Precipitated, cut with XhoI, pCS16/MOUPAATPAB, pCS16/MOUK2TPAB and pCS16/MOUK2UPAB DNA, resuspended, in 150 (l 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 150 mM NaCl, 6 mM mercaptoethanol, 1.5 homidium (ethidium) bromide, incubated for 40 minutes at 37°C with 12 U ScaI (partial digestion) and extracted with an equal volume of phenol, then with an equal volume of chloroform-isoamyl alcohol (50:1 ).1.2 kb fragments are isolated on 1% preparative agarose gel.DNA is extracted by electroelution and precipitated.

100 fmol pJDB207/PHO5-I-UPA ScaI-XhoI cut vector and 200 fmol Xho-ScaI cut pCS16/MOUPAATPAB, pCS16/MOUK2TPAB, i.e. pCS16/MOUK2UPAB l.2 kb inserts, connect in 10 (l 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 (g gelatin with 400 U T4 DNA ligase for 16 hours at 15°C. The reaction was stopped by incubation for 10 minutes at 65°C. 5 (l we use these binding mixtures for the transformation of E.coli H8101 Ca2+ cells.

Six ampR colonies are collected from each of these three connections. DNA is prepared by the rapid isolation procedure. Restriction lysis of DNA shows the correct size of the insert bands. One clone from each between the three connections is grown in 100 ml of LB medium, which contains 100 (g/ml of ampicillin. The DNA plasmids, derived from pCS16/MOUPAATPAB, pCS16/MOUK2TPAB, or pCS16/MOUK2UPAB, are designated as pJDB207/PHO5-I-MOUPAATPAB, pJDB207/PHO5-I-MOUK2TPAB and pJDB207/PHO5-I-MOUK2UPAB, respectively.

Example 16

Transformation of Saccharomyces cerevisiae GRF18 and preparation of yeast cell extracts

Plasmids pJDB207/PHO5-I-MOUK2UPAB, pJDB207/PHO5-IMOUPAATPAB, pJDB207/PHO5-I-MOUK2TPAB, and pJDB207/PHO5-I-MOUK2UPAB were introduced into Saccharomyces cerevisiae strain GRF18, using the transformation protocol described by Hinnen et al. / Proc. Natl. Acad. Sci. USA 75, 1929 (1978)/. We add 5 (lg) of each of the plasmid DNAs to 100 (l of spheroplast suspension and treat the mixture with polyethylene glycol. Spheroplasts are mixed with 10 ml of regeneration agar and planted in a plate with minimal yeast medium without leucine. After three days of incubation at 30°C, we obtain approx. 200 transformed cells.

Pick up one colony of each between yeast transformations.

We denote different colonies as:

Saccharomyces cerevisiae GRF18/pJDH207/PHO5-I-MOTPAAUPAB,

Saccharomyces cerevisiae GRF18/pJDB207/PHO5-I-MOUPAATPAB,

Saccharomyces cerevisiae GRF18/pJDB207/PHO5-I-MOUK2TPAB,

Saccharomyces cerevisiae GRF18/pJDB207/PHO5-I-MOUK2UPAB.

Yeast cells are grown for 24 hours with shaking at 30°C in 20 ml HE.17 medium (8.4 g Yeast Nitrogen Base (Difco), 10 g L-asparagus (Sigma), 1 g L-histidine (Sigma), 40 ml of 50% glucose to 1 l solution), in a 50 ml Erlenmayer flask, until a density of 8-10x107 cells/ml is reached. The cells are centrifuged and resuspended in 10 ml of 0.9% NaCl. We use 2 ml of resuspended cells to inoculate 50 ml of weak P1 minimal medium (as described in European Patent Application No. 143081), to which we add 10 g/1 L-asparagine and 10 g/1 L-histidine (Sigma), in Erlenmayer flasks of 250 ml. Incubation is at 30°C and 250 rpm.

Cells from 10 ml of low Pi minimal medium are collected after 48 hours by centrifugation at 3000 rpm. for 10 minutes in Falcon 2070 tubes. The cells are washed once with 10 ml of weak Pi medium and centrifuged. The cell pellet is suspended in lysis buffer /66 mM potassium phosphate with pH 7.4, 4 mM Zwittergent (Calbiochem)/. Add 8 g of glass beads (diameter 0.5-0.75 mm) and a glass rod to the cell suspension, then shake the suspension in a Vortex mixer (Scientific Instruments Inc., USA) at half speed 4 x 2 minutes in 2-minute intervals on the ice. More than 90% of the cells burst during this procedure. Cell pieces and glass beads are sedimented by centrifugation for 5 minutes at 3000 rpm at 4°C. We use the upper layer (supernatant) to determine PA activity and for purification and isolation of PA.

Example 17

Introduction of hybrid PA coding sequences into a mammalian cell expression vector

A) Introduction (insert) UPAATPAB, complete, hybrid code sequence

RF DNA mp18/KpnI-HindIII/MUPAATPAB is cut at the SmaI site, which is located directly above the initial coding sequence, and connected to the SacI linker (CGAGCTCG). The plasmid is then cut with SacI, which cuts at the position of the attached linkers and at the native ScaI site in the t-PA-derived part of the sequence, which codes for the hybrid PA. The smaller of the two resulting fragments was purified over an agarose gel and ligated to SacI-cut pCGA44 (see example 4), transformed into E.coli HB101, and DNA from candidate clones was tested with EcoRI. We list the clone with the expected restriction pattern as pCGCI and UPAATPAB.

B) Introduction of the UK2TPAB hybrid coding sequence

RF DNA mp18/KpnI-HindIII/MOUK2TPAB is cut at the SmaI site, located directly above the initial coding sequence, and ligated to SacI as above. After cutting with SacI, we clone the resulting smaller fragment into SacI-cut pCGA44, as described above, and designate the clone with the expected restriction pattern as pCGC2/UK2TPAB.

C) Introduction of the UK2UPAB hybrid coding sequence

RF DNA mp18/KpnI-HindIII/MOUK2UPAB is cut at the SmaI site, which is located above the u-PA code sequence and at the Xhoi site below the code sequence (in vector DNA). We fill in the sticky end of the DNA fragment using E.coli DNA polymerase I (see example 5D). The SacI linkers are connected to the blunt ends, the DNA is cut with SacI, the smaller of the two resulting fragments is purified over an agarose gel and cloned into SacI-cut pCGA44. We refer to the clone with the expected EcoRI restriction pattern as pCGC3/LTK2TPAB.

D) Introduction of TPAAUPAB, the complete coding sequence

Step 1: RF DNA mp18/BamHI/MOTPAAUPAB is cut with BamHI and the smaller (approximately 2.1 kb) between fragments is cloned into the BamHI cut pJDB207/PHO5-I-TPAAUPAB, (see example 9) vector. We select the correct orientation by digestion with Hind-III and name one correct plasmid pJDB207/PHO5-I -MOTPAAUPAB.

Step 2: ~ 600 bp SacI-NarI fragment from ptNC.UC (see example 3) and ~ 1350 bp NarI-XhoI fragment from pJDB207/PHO5-I-TPAAUPAB isolated and cloned into SacI-XhoI cut pCS16 (see example 7) vector We confirm the ~ 1.9 kb insert by digestion with SacI-XhoI and EcoRI. We name one proper plasmid pCS16/MOTPAAUPAB.

Step 3: Plasmid pCSl6/MOTPAAUPAB is cut at the Xhoi site, located below the u-PA coding sequence, and the sticky ends are filled using E.coli DNA polymerase I. SacI linkers are connected to the blunt ends and the DNA is cut with SacI. The smaller of the two fragments was purified over an agarose gel and cloned into the SacI-cut pBR4a (see example 5) vector fragment. The correct orientation and size of the inserts were confirmed by digestion with BamHI and SacI, respectively. We designate one proper plasmid as pCGC4a/TPAAUPAB.

Example 18

Construction of the following hybrid PA coding sequences and their introduction into a mammalian cell expression vector

A) Cloning of the pCGC4a/TPAAUPAB fragment into M13mp18

3 (g of pCGC4a/TPAAUPAB (see Example 17) was digested with 12 U of SacI (Bohringer) in 20 (l of 10 mM Tris-HCl pH 7.5, 6 mM MgCl2, 6 mM mercaptoethanol for one hour at 37°C. ~ 1 The .9 kb fragment is isolated on a 0.7% preparative agarose gel, the DNA is extracted by electroelution and precipitated.

0.5 g of M13mp19 (RF) was digested with SacI. The 7.3 kb vector fragment was isolated on a 0.7% preparative agarose gel. The DNA was electroeluted and precipitated.

100 fmol of M13mp18 SacI cut vector and 200 fmol of SacI insert are ligated in 10 (l 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 2 mM ATP, 0.5 (g gelatin with 400 U T4 DNA ligase for 7 hours at 15°C. We stop the reaction by incubating for 10 minutes at 65°C. We use 5 l of this binding mixture to transform E.coli JM101 competent cells. We collect six colorless plaques (plates) and prepare a single-stranded and replicate form (RF) DNA.On R-DNA analysis, four clones show correct insert size and correct orientation.One of these clones is referred to as mp18/SacI/TPAAUPAB (BC).

B) Cloning of the pBR4a Sac1 fragment into M13mp18

pBR4a (see example 5) of the SacI fragment in M13mp18. One of the clones has the correct insert size and orientation and is designated as mp18/SacI/TPAAUPAB (BR).

C) Deletion mutagenesis of the TPA-UPA hybrid construct

1) Construction of K2UPAB (BC) /eg. tPA (1-3)-tPA (176-275)-uPA (159-411)/

Deletion mutagenesis is performed as described in the general protocol (see example 4) on mp18/SacI/TPAAUPAB (BC). Positive clones obtained during hybridization were confirmed by restriction analysis with SacI. In the mutants we observe a ~1380 bp band, compared to the wild type which gives a ~1900 bp fragment. Mutants were further confirmed with EcoRI digestion. One mutant clone with the correct structure is listed as SacI/K2UPAB(BC). We verify the release by the method of chain-termonator sequencing using sequence comparison with the sequence

5'CCCAGTGCCTGGGCATTGGGGTTCTGTGCTGTG3'

This example is complementary to the coding strand t-PA(853-821) with a missense at position 838 (t-PA).

2) Construction FUPAB(BC) /e.g. tPA(1-49)-tPA(262-275)-uPA(159-411)

We performed the deletional mutagenesis as described in the general protocol (see example 14) on mp18/SacI/TPAAUPAB-(BC). Positive clones obtained during hybridization were confirmed by restriction analysis with SacI. In the mutants we use a ~1200 bp band compared to the wild type which gives a ~1900 bp fragment. Mutants were further confirmed with EcoRI digestion. One mutant clone with the correct structure is referred to as mp18/SacI/FUPAB(BC). Deletion is verified by the method of chain-termination sequencing using sequence comparison with the sequence

5'CAGAGCCCCCCGGTGC3'.

This example is complementary to the coding strand u-PA(666-682).

3) Construction FK2UPAB(BC) /e.g. tPA (1-49) -tPA (176-275) -uPA (159-411)

Deletion mutagenesis is performed as described in the general protocol (see example 14) on mp18/SacI/TPAAUPAB(BC). Positive clones obtained during hybridization were confirmed by restriction analysis with SacI. In the mutants we observe a ~1470 bp band compared to the wild type which gives a ~1900 bp fragment. Mutants are further confirmed with EcoRI digestion. One mutant clone with the correct structure is listed as mp18/SaeI/KF2UPAB(BC). Deletion is verified by the chain-termonator sequencing method using sequence comparison with the sequence,

5' CCCAGTGCCTGGGCATTGGGGTTCTGTGCTGTG 3'.

This example is complementary to the coding strand T-PA(853-821) with a missense at position 838 (t-PA).

4) Construction FGK2UPAB(BC) /eg. tPA(1-86)-tPA(176-275)-uPA(159-411)

Deletion mutagenesis is performed as described in the general protocol (see example 14) on mp18/SacI/TPAAUPAB(HC). Positive clones obtained during hybridization were confirmed by restriction analysis with SacI. In the mutants we observe a ~1580 bp band compared to the wild type which gives a ~1900 bp fragment. Mutants are further confirmed with EcoRI digestion. One mutant clone with the correct structure is referred to as mp18/SacI/FGK2UPAB(BC). Deletion is verified by the chain-termonator sequencing method using sequence comparison with the sequence

5' CCCAGTGCCTGGGCATTGGGGTTCTGTGCTGTG 3'.

This example is complementary to the coding strand T-PA(853-821) with a mis-splicing at position 838 (t-PA).

5) We use similar deletion mutagenesis protocols for creation

K2UPAB(BR) (tPA(1-3)-tPA(176-262)-uPA(132-411)(

FUPAB(BR) (tPA(1-49)-uPA(134-411)(

FK2UPAB(BR) (tPA(1-49)-tPA(176-262)-uPA(132-411))( and

FGK2UPAB(BR) (tPA(1-86)-tPA(176-262)-uPA(132-411)(.

D) introduction of hybrid coding sequences into the expression vector of mammalian cells

1) Introduction of FUPAB(BC), K2UPAB (BC), FK2UPAB (BC) and FGK2UPAB (BC)

RF DNA from mp18/SacI/K2UPAB(BC), mp18/SacI/FUPAB(BC), mp18/SacI/FK2UPAB(BC), mp18/SacI/TGK2UPAB(BC) is cut with SacI. The smaller of the two resulting fragments is isolated and ligated to the SacI-cut pBR4a (see example 5) vector fragment, transformed into E.coli HB101, and the correct orientation and correct size of the insert are confirmed by digestion with BamHI or SacI. We denote the resulting plasmids as pCGC5/K2UPAB, pCGC6/FUPAB(BC), pCGC7/FK2UPAB(BC) and pCGC8/FGK2UPAB (BC).

2) Similarly K2UPAB(BR), FUPAB (BR), FK2UPAB (BC) and FGK2UPAB (BR) DNA (see above) are introduced into pBR4a. We designate the obtained plasmids as pBR5, pBR6, pBR7 and pBR8, respectively.

Example 19

Mammalian expression vectors comprising the DHFR gene

Plasmid pSV2dhfr (ATCC 37145) is a plasmid that allows selection of cells containing DHFR transformants by selection using the antifolate drug methotrexate or selection of DHFR+ transformants of DHFR- CHO cells /DUKXBI cells; Mr. Urlaub, Proc. Natl. Acad. Sci. USA 77, 4216-4220 (1989)/.

A BamHI fragment of pCGA28 containing the modular t-PA gene was cloned into only one BamHI site of that plasmid. Plasmids containing either of the two possible orientations are designated as pCGA700a/tPA and pCGA700b/tPA. Both can be used to express t-PA in tissue culture cells, although pCGAa/tPA is preferred, where transcription of the t-PA gene is in the same direction as that of the DHFR gene, as this orientation often leads to slightly higher expression levels than with convergently expressed plasmids. transcribe.

In an analogous way, we can combine the modular genes coding for hybrid plasminogen activators (below) from plasmids pBRla/tPA, pBR2a/UPAATPAB, pCGC1/UPAATPAB and pCGC2/UK2TPAB, as BamHI fragments with the DHFR gene pCGA700a/tPA, to create plasmids pCGA70la/ tPA, pCGA702a /UPAATPAB, pCGC705a/UPAATPAB or pCGA707a/UK2TPAB, where the modular plasminogen activator gene is transcribed in the same direction as the DHFR gene, and pCGA701b/tPA, pCGA702b /UPAATPAB, pCGC705b/UPAATPAB, pCGA707b/UK2TPAB, where both genes are transcribed in opposite directions. Due to the presence of the BamHI sequence in the u-PA B-chain coding part, the modular plasminogen activator gene could only be isolated with a cleavage cut (2 out of 3 BamHI sites) of the neoR plasmid, followed by isolation of the appropriate fragment (see figures) by agarose gel electrophoresis .

Thus from pBR3a/uPA, pBR4a/UPAATPAB, pBR5/K2UPAB, pBR6/FUPAB, pBR7/FK2UPAB, pBRB/FGK2UPAB, pCGC3/UK2UPAB, pCGC4a/TPAAUPAB, pCGC/K2UPAB, pCGC6/FUPAB, pCGC7/FK2UPAB and pCGC8/FGK2UPAB we can konstruirati pCGC703a/uPA, pCGC704a/TPAAUPAB, pCGA705a/K2UPAB, pCGC708a/FUPAB, pCGA706a/FK2UPAB, pCGA707a/FGK2UPAB, pCGA709a/UK2UPAB, pCGA711a/TPAAUPAB, pCGA712a/K2UPAB, pCGA713a/FUPAB, pCGA714a/FK2UPAB odnosno pCGA715a/FGK2UPAB, gdje all plasminogen activator genes are transcribed (overwritten) in the same direction as the DHER gene and further pCGA703b/uPA, pCGA704b/TPAAUPAB, pCGA708b/FUPAB, pCGA705b/K2UPAB, pCGA706a/FK2UPAB, pCGA707b/FGK2UPAB, pCGA709b/UK2UPAB, pCGA711b/TPAAUPAB, pCGA712b /K2UPAB, pCGA713b/FUPAB, pCGA714b/FK2UPAB and pCGA715b/FGK2UPAB, where both genes are transcribed non-convergently.

Example 20

Preparation of hybrid plasminogen activators with transformed mammalian cells

A) Maintenance and DNA transfection of tissue culture cells; general procedure

We express the DNA constructs in DUKXBI, a mutant of Chinese hamster ovary (CHO) cells lacking the enzyme dihydrofolate reductase /G. Urlaub et al., Proc. Nat. Acad. Sci. USA 77, 4216-4220 (1980)/. We grow DUKXBI cells in alpha-MEM medium containing nucleosides (GIBCO) to which we added 5% fetal calf serum.

Cells are seeded at a density of 10,000/cm in multi-plates with 6 slots (diameter 3.4 cm) and transformed with 4 (g of DNA: DNA is dissolved in an amount of 50 (g/ml in 10 ml of Tric-HCl pH 7.0, which containing 0.1 mM EDTA, cooled on ice for 5 min, 0.25 volume of 1 M CaCl2 was added and incubated for 10 min on ice. The mixture was then mixed with an equal volume of 2 x HBS (50 mM Hepes, 280 mM NaCl, 0, 75 mM Na2HPO4, 0.75 mM NaH2PO4, pH 7.12, followed by another ten-minute incubation on ice. followed by a glycerol shock, i.e. the cells were washed with TBS (80 g/1 NaCl, 3.8 g/1 KCl, 1 g/1 Na2HPO4 (2H2O, 0.114 g/1 CaCl2 (2H2O, 0.11 g/1 MgCl2 ( 6H2O , 25 mM Tris-HCl pH 7.5) , incubate for 1 minute with 20% (vol./vol.) glycerol in TBS, wash again with TBS and grow for 24 hours in tissue culture medium. Cells are then trypsinized and transferred to Petri dishes bowls with a diameter of 8 cm culture medium without a selective agent with a medium containing 1 mg/1 geneticin. We replace the medium every third or fourth day. We can see colonies on about the 14th day. Cells from individual colonies are isolated by scraping with a conical pipette, while at the same time sucking them into a cone filled with trypsin solution, and transferring each one to a groove of a multiplate with 24 grooves, into which we feed the medium containing geneticin. If they are cofluent, we inoculate these cultures on multiplates with 6 slots and then in Petri dishes with a diameter of 8 cm.

B) experiments on agarose plate for plasminogen activators

For these sensitive experiments for plasminogen activators, agarose gels to which plasminogen was added are used (the resulting solution was prepared by dissolving plasminogen Sigma A-6877 in the amount of 1 mg/ml and by double dialysis against 100 volumes of 50 mM Tris-HCl pH 8.0), or casein (added as skimmed milk) or fibrin (added as fibrogen plus thrombin). The sample containing the plasminogen activator is introduced into the holes dug in a 4 mm thick layer of agarose, and the gel is then incubated at 37°C. Enzymatic activity is then ensured by plasminogen activator diffusing radially from the patterned slot, converting the plasminogen in the gel to plasmin that digests casein or fibrin, creating a clear ring in the opaque gel around the patterned slot. The radius of the hoop measured from the edge of the pattern slot is a measure of the amount of activated plasminogen. The experiment does not show a linear response to the amount of plasminogen activator added. For a preliminary experiment with smaller quantities of plasminogen activator, we can extend the incubation for several days. The method and calibration of the casein experiment were as described by Tang et al., /Anal. N.Y. Acad. Sci. 434, 536-540 (1984)/, except that instead of 2% (mass/volume) Carnation low-fat milk powder, we use 12.5% (vol./vol.) sterilized (UHT) low-fat milk from Migros Corp. (Switzerland). If we use fibrin /Granelli-Piperno and Reich, J. Exp. Honey. 148, 223-234 (1978) / as a substrate, dissolve 0.2 g of agarose in 15 ml of 0.9% NaCl and cool to 42°C. At this point we add 5 ml of 0.9% NaCl containing 80 mg of bovine fibrinogen (Sigma F-8630), 0.1 ml of plasminogen solution (above), and 0.1 ml of 100 mg/ml sodium azide at 42°C. Finally, add 0.2 ml of bovine thrombin (Sigma T-6634), dissolved in an amount of 16.6 NIH units/ml in 0.9% NaCl), after which the mixture is quickly poured into Petri dishes (diameter 8 cm) and let cool to room temperature for 1 hour. The resulting gel is approx. 4 mm can be stored at 4°C for several days, or it can be used immediately in the same way as the above gel, which contains casein.

C) preparation of hybrid PA proteins in hamster cells

CHO DUKXB1 cells were transformed with DNA plasmids pBRIA, pBR1B, pBR2B, pBR3A, pBR3B, pBR5, pBR7, pBRB, pCGC1, pCGC2, pCGC3, pCGC4a, pCGC5, pCGC6, pCGC7 and pCGC8, respectively, as described above (Example 20A). Colonies appear on about day 10, we pick them up on about day 15, as described above and 2 weeks later the number of cells has increased enough for us to measure PA, as described above. Untransformed cells and cell lines transformed with pBR1B, pBR2B, pBR3B; those containing an incorporated SacI fragment in the opposite orientation do not produce detectable amounts of PA.

D) Enzyme activity in media conditioned with transformed CHO cells

Conditioned medium from plasmid-transformed cells and control CHO cells is prepared by growing 200,000-500,000 cells/ml for 24 hours in Alpha-MEM with nucleosides and 5% fetal calf serum and 0.03 ml is incubated on agarose plates containing casein or fibrin , in the time period specified below. On the fibrin plate, we detect minimal background activity, probably due to one t-PA hamster in medium conditioned with DUKXBI. No ring appears on the casein plates if the hybrid protein samples are mixed with 3 µl of rabbit anti-PA antibodies (raised against purified Bowes melanoma t-PA) or with anti-urokinase antibodies (raised against Serono urokinase).

Anti-tPA antibody does not inhibit u-PA enzyme, nor does anti-urokinase antibody inhibit t-PA to a significant extent. The results are presented in Table 1.

Table 1: Efficacy of different plasminogen activators.

[image]

Example 21

Preparation of hybridoma cells and isolation of monoclonal antibodies

a) Source of immunogen: A sample of semi-purified native human melanoma t-PA with a purity grade above 90%.

b) Immunization protocol: Three groups of BALB/c mice (Tierfarm Sisseln, Switzerland), aged 10 to 14 weeks, were immunized by injection in both rear soles and subcutaneously with 100 (g of melanoma t-PA, emulsified in complete Freund's adjuvant (Difco). Then the first group (no. 405) received 10 (g t-PA in incomplete adjuvant every week for 6 weeks, while the second group (406) received the same amount every 2 weeks. The third group (407) was given twice 50 (g t -PA at intervals of 3 weeks. We take blood from all animals on the fourth and eighth week. For the last injection, we give 100 (g of t-PA in PBS i.p. and 4 days later we perform the fusion of spleen cells with the SP2/o myeloma line in accordance with the standard procedure. For fusion, we use only those mice that have an anti-tPA antibody titer.

c) Cell fusion: All fusion experiments are carried out in accordance with the procedure according to G. Kohler and C. Milstein /Nature 256, 495 (1975) using the non-exclusive Sp 2/O-Ag14 myeloma species /M. Shulman, C.D. Wilde and G. Kohler, Nature 276, 269 (1978)/. 108 spleen cells are mixed with 107 myeloma cells in the presence of 1 ml of 50% polyethylene glycol (PEG 1500, Serva). After washing the cells, resuspend them in 48 ml of standard Dulbecco minimal essential medium (Gibco No. 0422501). We add 3x106 normal mouse peritoneal exudate cells by fusion as nutrient cells. Divide the cells into 48x1 ml "costar" wells and feed them three times a week with standard HAT selection medium for 3 to 6 weeks. When growth of hybridoma cells becomes visible, overlay of supernatants with direct antigen binding assay (ELISA) and neutralization (casein) is performed (see below). The results of 4 fusion experiments are as follows: from 192 grafted slots we get 192 hybridomas. Of them, 24 produce anti-PA antibody. Of the 24 positive hybridomas, 14 of them were cloned and of the 574 clones obtained, we determined that 31 of them stably produce anti-t-PA mAb. We inject three of them (clones 405B.33.3, 406A.23.7 and 407A.15.27) into mice and produce ascites fluid for further study.

d) Isolation and purification of monoclonal antibody:

BALB/c mice, 8 to 10 weeks old (Tierfarm Sisseln, Switzerland) were intraperitoneally pretreated with 0.3 ml pristane (Aldrich). 2 to 3 weeks later we inoculate them intraperitoneally with 2 to 5x106 cloned hybridoma cells 405B.33.3, 406A.23.7 and 407A.15.27 and 0.2 ml of pristane. After 8 to 10 days, collect ascites fluid, centrifuge at 800 g and store at -20°.

The thawed ascites fluid is centrifuged at 50,000 g for 60 minutes. Carefully remove the layer of fat floating on the surface and adjust the protein concentration to 10 to 12 mg/ml.

Precipitate crude immunoglobulin by adding 0.9 volume equivalents of saturated ammonium sulfate at 0°C, then dissolve in 20 mM Tric-HCl/50 mM NaCl. (pH 7.9) and dialyzed against the same buffer. The immunoglobulin fraction with DEAE D52 was obtained by cellulose (Whatman) chromatography, using a buffer gradient system of 20 mM TrisHCl/25-400 mM NaCl, pH 7.9. Immunoglobulin is reprecipitated with ammonium sulfate and dissolved in PBS at a concentration of 10 mg/ml.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) shows a degree of purity above 95% for monoclonal antibodies.

e) Determination of classes and subclasses of monoclonal antibodies

The class and subclass of monoclonal antibodies produced with cloned hybridoma cells are determined by the well-known Ouchterlony immunodiffusion method (agarose-gel immunodiffusion method) with the use of class- and subclass-specific rabbit antibodies (Bionetics).

Subclasses of mAb are as follows:

405B.33.3 : γlk

406A.23.7 : γ2bk

407A.15.27 : δ2ak

f) Enzyme immunoassay (ELISA):

Cover the microtiter plates with 0.5 µg per well of t-PA preparation (purity above 95%) in 100 µl PBS. Adjust the free binding capacity of the plate with a buffer with 0.2% gelatin in PBS containing samples of 0.2% NaN3 (m/v), pH 7.4 100 µl, containing monoclonal antibodies 405B.33.3, 406A.23.7 and 407A respectively. 15.2, incubated in slots for 2 hours at 37°C. The plates are washed with PBS containing 0.05% Tween 20, then incubated for 2 hours at 37°C with a rabbit anti-mouse immunoglobulin preparation, conjugated with phosphatase. The fixed enzyme is developed by incubating (37°C, 30 to 60 minutes) with a solution of the enzyme substrate pnitrophenylphosphate (1 mg/ml in diethanolamine buffer, 10%, containing 0.5 mM MgCl2 and 0.02% (mass/volume) NaN3, pH 9.8) and measure the optical density at 405 nm.

We also perform the same ELISA experiment using urokinase. None of the mAbs bind to urokinase. All mAbs are t-PA specific.

g) Experiment with casein lysis (neutralization test):

To perform the inhibitory effect of MAbs, first mix t-PA with mAbs 405B.33.3, 406A.23.7 or 407A.15.2, and incubate for 30 to 60 minutes at 4°C, after which we perform the usual casein/plasminogen agar experiment (see example 20B ). None of the mAbs inhibits t-PA activity, only mAb 405B.33.3 causes a delay (more than 6 hours) in casein lysis.

Example 22

Purification of hybrid plasminogen activator; general procedure

Extracts from transformed yeast cells are prepared as described in example 16. Extracts from mammalian cells transformed with a plasmid, such as CHO cells, are prepared as follows:

We first grow the cells to 70 to 80% confluence. The cell monolayer is then washed with medium, as described above, only to drain the serum, followed by culturing the cells for an additional period of 5 to 7 days. We clean the medium every 24 hours, and at the same time bring fresh medium to the cells. The conditioned medium thus obtained is then centrifuged at 5000 g for 30 minutes and filtered through a 0.45 µm filter to remove unwanted cell fragments prior to affinity chromatography. As an affinity matrix, we use either immobilized protease inhibitor DE-3 from Erythrina latissima or immobilized antibodies to u-PA or t-PA.

From hybrid PAs containing the catalytic B-chain of t-PA, we purify conditioned medium, prepared as described above, or yeast cell extracts using a protocol originally developed for purifying medium conditioned with melanoma cells from t-PA /see C, Rieussen et al., J. Biol. Chem. 259, 11635-11638 (1984)/.

All hybrid PAs are purified using polyclonal antibodies raised in rabbits or goats, against parenteral u-PA and t-PA enzymes, or using monoclonal antibodies (mouse source) raised against parenteral enzymes, with a fence, so that only they recognize the epitope present in the studied hybrid PA (see example 21). The selected antibody is immobilized on an insoluble matrix such as Affigel or Sepharosi-4B. Conditioned medium prepared as described above, or yeast cell extract, is then applied to the affinity matrix column, and unwanted proteins are washed away using a suitable buffer, for example Dulbecco's PBS /0.1 g/1 CaCl2, 0.2 g/1 KCl, 0.2 g/1 KH2PO4, 0.047 g/1 MgCl2, 8.0 g/1 NaCl, 1, 15 g/1 Na2HPO4; J. Exp. Honey. 99, 167 (1954)/, then we elute PA from the column using the kaosotropic agent potassium thiocyanate /compare M. Erinarsson et al., Biochim. Biophys. Acta 830, 1-10 (1985) / or in a low pH buffer such as 0.1-0.2 M glycine-HCl (pH 2.1).

After purification using monoclonal antibodies, hybrid PAs have a purity above 90%.

Example 23

Cleaning UK2TPAB(BC)

a) Preparation of DE-3 Sepharose® column

To 1 ml of Sepharose 4B® (Pharmacia) activated with cyanogen bromide, add 5 mg of purified inhibitor from Erythrina latissima /F.J. Joubert et al., Hoppe-Seyler' Zeitsch. Physiol. Chem. 302, 531 (1981)/, in accordance with the manufacturer's instructions. The matrix is equilibrated with 0.2 ammonium acetate buffer with pH 7.0, containing 0.2 N NaCl % Synperonic® and 0.02 % sodium azide.

b) Chromatographic purification of UK2TPBB(BC) on Sepharose 4B®

Conditioned medium (see example 22) is prepared 0.1% with respect to Synperonic® and then applied to DE-3 Sepharose®. After gentle stirring for 1 hour at 4°C, pour DE-3 Sepharose 4B® onto the column and wash with 0.2 M NaCl, 0.1% Synperonic®, until the UV absorbance at 280 nm reaches baseline levels, indicating. absence of protein in the eluate. We then continue washing with 0.2 M ammonium acetate buffer with pH 7.0 containing 0.2 M ammonium thiocyanate and 0.1% Synperonic®. Then, when UV absorbance at 280 nm indicates the absence of protein in the eluate, the column is eluted with 0.2 M ammonium acetate buffer pH 7.0 containing 1.6 M ammonium thiocyanate and 0.1% Synperonic®. We will collect the fractions containing the highest amidolytic activity measured using a fluorometric experiment with Cbz-Gly-Gly-Arg-AMC as substrate /M. Zimmermann et al., Proc. Natl. Acad. Sci. USA 75, 750 (1978)/. At least 80% of the activity introduced into the DE-3 Sepharose 4B® material is obtained in just one peak value.

The collected active fractions are dialyzed against 0.2 M ammonium acetate buffer with pH 7.0, which contains 0.1% Synperonic®, and applied to a column containing the monoclonal antibody 407A.15.27, directed towards the first "kringle" domain of t-PA, loaded onto Sepharose 4B®, equilibrated in 0.2 M acetate buffer, pH 7.0, containing 0.1% Synperonic®, to remove endogenous t-PA. We will collect the effluent containing UK2TPAB (BC).

Reverse phase HPLC of purified UK2TPAB(BC) on a Nucleosil® 300-5-C18 column, with dimensions of 4 x 110 mm, shows only one peak with a linear gradient over 30 minutes, emerging from a 70% solution A, consisting of of water containing 0.1% trifluoroacetic acid, and 30% of solution B consisting of acetonitrile containing 0.08% trifluoroacetic acid, and we finish with 40% A and 60% B. Purified protein, at the N-terminal sequence analysis of the first ten amino acid residues, shows the sequence SNELHQVPSN, which is identical to the sequence you would expect from the DNA sequence encoding the molecule.

Example 24

Purification of FK2UPAB (BC) and K2UPAB (BC)

a) Preparation of antibody affinity columns

Rabbit anti-UPA antibodies, purified from rabbit anti-uPA serum, monoclonal antibodies 405B.33.3 and 4U6A.23.7, are applied to Sepharose 4B® (Pharmacia) activated with cyanogen bromide, according to the manufacturer's instructions, using 6 mg of antibody/ml activated Sepharose. The gel matrix is equilibrated with PBS containing 0.1% Synperonic® and 0.1% sodium azide.

b) Chromatographic purification of FK2UPAB (BC) and K2UPAB (BC) on antibody/Sepharose 4B

Conditioned medium (see Example 22) is made 0.1% with respect to Synperonic® and applied to anti-uPA Sepharose-4B or 405B.33.3 or 406.23.7 Sepharose 4B. Let's direct the last two antibodies towards the second "kringle" domain of t-PA. After gentle mixing for 2 hours at 4°C, the antibody/Sepharose is poured into the column and washed with PBS containing 1 M NaCl and 0.1% Synperonic®, while UV absorption at 28G nm indicates the absence of protein in the column: The column is then eluted with 0 .2 M glycine-HCl buffer with pH 2.5. Fractions are collected in test tubes containing a neutralized amount of 1 M Tris. We collect the fractions containing the highest amidolytic activity measured using a fluorometric experiment with Cbz-Gly-Gly-Arg-AMC as a substrate /M. Zimmermann et al., Proc. Natl. Acad. Sci. USA 75, 750 (1978)/.

The reserve phase of HPLC-purified FK2UPAB(BC) and K2UPAB(BC) on a Nucleosil® 300-5-C18 column with dimensions of 4 x 110 mm always shows one peak value when eluting with a linear gradient for 30 minutes, starting from a 70% of solution A consisting of water containing 0.1% trifluoroacetic acid and 30% solution B consisting of acetonitrile containing 0.08% trifluoroacetic acid, and ending with 40% A and 60% B. N- final sequence analysis of the first five residues of the purified proteins shows the sequence SYQGN for both K2UPAB (BC) and SYQVI for FK2UPAB (BC) which is identical to the sequences one would expect for the DNA sequences encoding each molecule.

Example 25

Test of the activity of hybrid plasminogen activators in the presence and absence of fibrinogen fragments

We use a dual experiment as described by Verheyen et al., /Thromb. Haemost. 48, 266 (1982)/, which relies on the conversion of plasminogen to plasmin with plasminogen activator, followed by the reaction of plasmin with the chromogenic plasmin substrate H-D-valyl-L-leucyl-Llysyl-p-nitro-anilide dichloride. We perform the experiment on a microtiter plate with 96 slots, and a Titertek® microtiter plate reader. The wells contain 120-X µl 0.1 mol/1 Tris-HCl buffer with ph 7.5, containing 0.1% Tween 80, 20 µl Glu-plasminogen at 1.3 µmol/l, in the aforementioned Tris buffer, 100 µl of plasmin substrate with 0.7 mmol/1 in Tris buffer, X µl sample of known concentration (X corresponds to 10, 20, 40 or 60 µl) or urokinase standard of defined activity, expressed in international units (INT.U) and 10 µl of stimulator (fibrinogen fragments) with 3 mg/ml in distilled water or in 10 µl of distilled water, if experiments are performed without stimulator. The increased light absorption divided by the square of the incubation time is proportional to the activator activity of plasminogen at a known concentration of the activator, and we express it in international units. As a standard, we use urokinase of high molecular mass and defined activity, expressed in international units (ie INT.U; American Diagnostics). Each of the plasminogen activators is tested under the same conditions, in the absence or presence of fibrinogen fragments. Under these conditions, the difference in activity obtained is a measure for the stimulation of plasminogen activators with fibrinogen fragments. Table 2 shows the results of the analysis indicating the absence of stimulation for the urokinase standard in contrast to the stimulation exerted by the fibrinogen fragments on the novel plasminogen activator molecules containing the urokinase catalytic domain. Regardless of the absence of one or more non-catalytic domains F, G, Kl or K2 of tissue plasminogen activator, we observe stimulation

fibrinogen fragments for all tested hybrid molecules.

Table 2.

[image] Example 26

Clot lysis activity of mutant plasminogen activators

Clot lysis activity is determined using the experiment described by R.D. Philo and P.J. Gaffney / Thromb. Haemost. 45, 107-108 (1971)/. The logarithmic amount of lysis time according to the concentration of plasminogen activator is expressed in a straight line. The specific activity of plasminogen activator is determined by comparing the curves obtained for a standard preparation of tissue plasminogen activator or urokinase.

The curves of all measured activators have approximately the same slope, which enables a direct connection with the time required for clot lysis and their specific activity. Since different plasminogen activators do not have the same molecular mass, to obtain meaningful criteria for the effectiveness of different molecules, the specific activities must be expressed in molecular concentration instead of the usual mass concentration. We found that UK2TPAB(BC) is at least as active as standard t-PA, while FGK2UPAB(BC) and FK2UPAB(BC) show activities almost equal to t-PA, although significantly higher than that of u-PA standard. We found that K2UPAB(BC) has an activity that is almost identical to the u-PA standard. Experiment activities are shown in the table.

Table 3.

[image]

*) Clot lysis units are expressed in picomoles of t-PA using the molecular weight of t-PA based on its amino acid sequence and specific activity of 400,000 clot lysis units per mg.

Example 27

Clearance of plasminogen activator mutant molecules from rabbit circulation

1. Marking

All mutant molecules are radiolabeled with 125J using the iodogenic method /P.J. Fraker et al., Biochem. Biophys. Crisp. Commun. 80, 849-857 (1978)/.

To remove excess free 125J mutant molecules are affinity purified either using the method described in example 23 (PAs having a t-PA B-chain) or according to the method described in example 24 (PAs having a u-PA B-chain).

We usually obtain specific radioactivities of 2-20 µCi/g of protein. We determine the homogeneity of the labeled molecules using SDS electrophoresis followed by X-ray autoradiography. In all examples, the mutant molecules migrate under non-reducing conditions as single bands and with Mr, which are identical to the unlabeled proteins.

2) Clearing study

We perform experiments on New Zealand white rabbits weighing 1.8 to 2.4 kg. Animals are anesthetized subcutaneously with 1750 mg/kg Urethan® (Merck, Darmstadt, Germany). A tracheotomy is performed and a plastic tube is inserted into the external jugular vein and the common carotid artery. We inject 0.5 ml of phosphate-buffered saline solution containing approximately 300 to 500 ng of PA mutant into the jugular vein and serially take blood samples (2 ml each time) at intervals of 60 minutes through the carotid artery.

Blood samples are collected on citrate, immediately centrifuged at 3000 revolutions per minute for 15 minutes and the plasma is decanted. We deposit aliquots in 10% trichloroacetic acid and count the pellets in a γ-counter.

Compared to t-PA, isolated from the Bowes melanoma cell line, the mutant molecules in circulation show the following half-life.

Table 4.

[image]

The discharge pattern of t-PA is significantly biexponential with a very fast α-phase, followed by a slower β-phase of elimination. The elimination of UK2TPAB(BC) and K2UPAB(BC) is almost monophasic, from which we conclude that the division into the second compartment is reversed.

3) Distribution in organs

We process the rabbits as above. 20 minutes after the injection of iodinated mutant molecules, the rabbits are sacrificed, their main organs are removed, their mass is measured, and after homogenization, an aliquot is counted on a γ-counter.

Table 5.

[image]

Mutant PAs show a higher fraction of radioactive molecules, which still remain in the circulation (supra), which coincides with a greatly reduced clearance from the liver. Reduced hepatic uptake therefore explained the longer half-life and monophasic elimination pattern of the mutant molecules, particularly UK2TPAB (BC) and K2UPAB (BC).

In examples 28-34, we use plasmids pCGC5/K2UPAB, pCGC6/FUPAB, pCGC7/FK2UPAB and pCGC8/FGK2UPAB for the construction of yeast expression plasmids (see example 18). The yeast invertase signal sequence is fused in frame with different coding sequences. They are expressed under the control of the inducible PHO5 promoter. However, some constructs have mutated glycosylation sites.

Example 28

Cloning of the phage F1 replication source into the expression vector pJDB207

Plasmids of the pEMBL family /Dente et al., Nucl. Acid: Res. 11, 1645-55 (-983)/ have regions of the phage F1 genome that provide all cis-acting elements for DNA replication and morphonogenesis. Only after superinfection with phage F1 (helper) are large amounts of single-stranded plasmid DNA secreted into the medium.

Plasmid peEMBL19(+) was digested with ScaI and EcoRI. A 2.2 kb fragment is isolated, which contains part of the pBR32 gene: resistant to ampicillin (ScaI site), F1 intergenic region and div β-galactosidase gene to the polylinker region (EcoRI site).

Plasmid pJDB207 is linearized by cutting with HpaI. 10 µu of the linearized plasmid was partially digested with 7.5 units of EcoRI in the presence of 0.1 mg/ml homidium bromide for 40 minutes at 37°C. Stop the reaction by adding 11 mM EDTA. We isolated the 1.8 kb EcoRI-HpaI fragment on a preparative 0.8% agarose gel.

3 µg of HpaI-cut pJDB207 were further digested with ScaI. We isolated a 4.8 kb HpaI-ScaI fragment. DNA fragments are electroeluted from agarose gel blocks, purified by DE52 chromatography and precipitation with ethanol.

We ligate 0.2 pmol of each of the 2.2 kb ScaI-EcoR: fragment and the 1.8 kb EcoU-HpaI fragment and 0.1 pmol of the HpaI ScaI vector fragment. We use the binding mixture for the transformation of E.coli HB101 Ca2+ competent cells.

Plasmid DNA of 12 colonies resistant to ampicillin was analyzed by double digestion with EcoRI/PstI. We select the DNA of only one clone with the correct restriction fragments and designate it as pJDB207FlLac.

Example 29

Construction of plasmid pJDB207/PHO5-I-FK2UPAB

The FK2UPAB coding sequence, present in the plasmid pJDB7/FK2UPAB, is prepared for expression in yeast by fusion of the yeast invertase signal sequence and expression of the gene under the control of the PHO5 promoter.

Plasmid pCGC7/FK2UPAB (see Example 18D) was digested with PstI and BamHI. The 1147 bp PstI-BamHI fragment contains FK2UPAB which encodes the sequence of the PstI site at nucleotide position 199 of t-PA (Fig. 1) to the BamHI site at position 1322 of u-PA (Fig. 3).

Plasmid jPDB207/PHO5-I-TPA (see example 6c) is cut with SalII and PstI. We isolate a fragment of 891 bp. It contains the PHO5 promoter, an invertase signal sequence and 19 bases of t-PA (PstI site).

Plasmids pJDB207/PHO5-I-UPA (see example 8) were digested with Sail and BamHI. 6.6 vector fragment contains the 3' part of the u-PA gene from the BamHI site at nucleotide position 1323 (Figure 3) to position 1441 (PvuII site with added XhoI linker) and PHO5 transcriptional end signals.

0.2 pmol of each of the 891 bp SaII-PstI fragment and the 1147 bp PstI-BamHI fragment and 0.1 pmol of the 6.6 kb SaII-BamHI vector fragment were ligated and used to transform E.coli HB101 Ca2+ cells.

8 colonies resistant to ampicillin are grown in LB medium containing ampicillin (100 ml/1). Plasmid DNA is isolated and analyzed by restriction digestion with EcoRi and HindIII. We select one plasmid with the expected restriction fragments and designate it as pJDB207/PHO5-I-FK2UPAB.

Plasmids pCGC6/FUPAB and pCGC8/FGK2UPAB can be used in the same way as pCGC7/FK2UPAB. The resulting yeast expression plasmids were designated as pJDB207/PHO5-I-FUPAB and pJDB207/PHO5-I-FGK2UPAB, respectively.

Example 30

Mutation of the glycosylation site at /Asn 302/ urokinase B-chain

a) cloning of the PstI-BamHI fragment of u-PA in m13mp18:

Plasmid pJDB207/PHO5-I-UPA (see Example 8) contains the complete coding region of urokinase. DNA is cut with PstI and BamHT. The 866 bp Pstl-BamHI fragment from the urokinase gene contains a glycosylation site (Asn 302) at nucleotide positions 1033-1041. The next fragment of the same size is further cut with BstEII. We isolated the 886 bp PstI-BamHI fragment on a preparative 0.8% agarose gel.

M13mp18 RF-DNA is cut with PstI and BamHI. The 7.3 kb fragment was isolated on a preparative 0.8% agarose gel. DNA fragments are electroeluted from agarose gel and purified by DE52 chromatography and ethanol precipitation.

0.1 pmol of the 7.3 kb PstI-BamHI cleaved vector and 0.2 pmol of the 886 kb PstI-BamHI u-PA fragment are connected. Use one µl and 3 µl of the binding mixture for the transformation of E.coli JM108 Ca2+ cells in accordance with the "M13 cloning and sequencing handbook" published by Amersham. We collect 12 colorless plaques and prepare single-stranded DNA /J. Messing, Methods in Enzymology 101, 21-78 (1983)/.

Single-stranded DNA is used for the preparation of partially double-stranded DNA by fusion and extension of M13 universal diameter with Klenow's polymerase. The reaction product is extracted with phenol/chloroform and the DNA is precipitated with ethanol. DNA is cut with PstI and BamHI. Fragment 866 indicates that the u-Pa fragment was cloned in the M13mp18 vector. We further analyze one clone and confirm the correct insert by sequencing. We designate the clone as M13mp18/UPA.

b) Mutation of the glycosylation site at Asn302:

302,

(F) Ser Thr

M13mp18 insert: 3'...AAA CCT TTT CTC TTA AGA TGG CTG ATA...5'

(a chain of the opposite

direction) 5'-GGA AAA GAG CAA TCT ACC GAC-3'

mutagenic example W:

the chain of the mutated 5'....TTT GGA AAA GAG CAA TCT ACC GAC TAT...3'

direction (F)

Example sequence: CTGCCCTCGATGATAACG

• •

967 985

Mutagenic and sequence examples are synthesized using the phosphoramidite method according to /M.H. Caruthers in: Chemical and Enzymatic Synthesis of Gene Fragments, (ed. H.G. Gassen and A. Zang) Verlag Chemie, Weinheirn, SRN/ on an Applied Biosystem Model 380B synthesizer.

Mutagenesis in vitro on a single-stranded template is performed as described by T.A. Kunkel / Proc. Nat. Acad. Sci. USA 82, 448-492 (1985)/. We produce a single-stranded DNA template containing uracil, with one cycle of growth on E.coli strain RZ1032 (dut-, ung-).

100 pmol of mutagenic oligonucleotide example W phosphorylated in 20 µl 50 Tris-HCl pH 7.5, 10 mM MgCl 2 5 mM DTT, 0.5 mM ATP and 20 units of T4 polynucleotide kinase (Boehringer). After 30 minutes at 37°C, stop the reaction by heating for 10 minutes at 70°C.

0.3 pmol of M13mp18/UPA template DNA, which contains uracil, is incubated with 10 pmol of phosphorylated mutagenic oligodeoxyribonucletide sample W and 10 pmol of M13 uraiversal sequence sample in 30 µl of 10 Tris-HCl pH 8.0 and 10 mM MgCl2. Heat the sample to 80°C and let it cool to room temperature in a small water bath.

c) Prolonged connection reaction:

To the above renatured sample, we add 10 µl of the enzyme-D-NTP mixture containing 1 mM dNTP, 10 mM Tris-HCl pH 8.0, 10 mM MgCl2, 20 mM DTT, 1 mM ATP, 400 units of T4 DNA ligase (Biolabs, 400 U / µl) and 6 units of Klenow DNA polymerase (Boehringer, 6 U/µl). Incubation takes place overnight at 15°C.

d) Transformation of E.coli BMH7l cells:

Dilute the binding mixture to 200 µl with TE. Each time, 0.1 µl, 1 µl and 10 µl of the extended binding mixture are added to Competent E.Coli BMH71 Ca2+ cells (Kunkel, supra). After 30 minutes on ice, heat shock the cells for 3 minutes at 42°C and then keep them on ice. Cover the cells with agar and E.coli JM101 indicator cells.

We collect 6 plaques and use them to infect E.coli JM109. Phages are isolated from the upper layer (supernatant) by precipitation with PEG. Single-stranded DNA is prepared by extraction with phenol and precipitation with ethanol. DNA templates are resuspended in TE.

The AAT codon (Asn302) to CAA codon (G1n302) mutation was confirmed for one clone by determining the DNA sequence using the aforementioned sequence comparison using the /F chain termination method. Sanger et al., Proc. Nat. Acad. Sci. USA, 5463-67 (1977)/. The mutation causes an Asn → Gln change in amino acid region 302 of u-PA and thus eliminates only one glycosylation site in urokinase. W indicates a mutation of the glycosylation site in uPA B-chain (Asn302 → G1n302). We denote the positive clone as M13mp18/UPA-W.

Example 31

Transfer of mutation /G1n302/ in urokinase B-chain to FK2UPAB hybrid

Plasmid pJDB207/PHO5-I-FK2UPAB was digested with SalII and XhoI. We isolated a 2.2 kb SalI-XhoI fragment, electroeluted from agarose gel, purified by DE52 chromatography and precipitated in ethanol. The DNA fragment contains two MstI sites in the PHO5 promoter and the u-PA sequence. 3 µg fragment of 2.2 kb SalI-XhoI was partially digested with 3 units of MstI for 10 minutes at 37°C. The reaction products are separated on a preparative 0.8% agarose gel and the 1,651 bp SalI-MstI fragment is isolated and eluted from the gel. The DNA fragment contains the SalI-BamHI sequence of pBR322, the PHO5 promoter, the invertase signal sequence and the FK2UPAB coding sequence up to the MstI site in the u-PA part at nucleotide position 935.

RF-DNA is prepared for M13mp18/UPA-W (see example 30) by the procedure of rapid DNA isolation / D.S. Holmes et al., Analyt. I'm a part of it. 114, 193-97 (1981)/. We digest 5 µg of DNA with BamHI and MstI. After adding 2 µg of RNase (Serva) and incubation for 5 minutes at 37°C, we isolated the 387 bp MstI-BamHI fragment on a preparative 0.8% agarose gel. The DNA fragment is electroeluted and precipitated in ethanol. The fragment contains an AAT → CAA mutation at nucleotide positions 1033-1035 (Asn302 → Gln) in the urokinase B-chain.

Plasmid pJDB207/PHO5-I-UPA was cut with SalI and BamHI. We isolate a 6.6 kb vector fragment (see Example 29). We connect 0.2 pmol 1651 bp SalI-MstI fragment, 0.2 pmol 387 bp Mstll-13amHI fragment and 0.1 pmol 6.6 kb SalI-BamHI vector fragment. We transform competent E.coli H8101 Ca2+ cells.

Grows 12 ampicillin-resistant transfornants. Plasmid DNA is isolated and analyzed with EcoRI and HindIII restriction enzymes. Mutation (W) at the glycosylation site destroys the EcoRI site at nucleotide positions 1032-1037. The presence of the mutation was confirmed by DNA sequencing. One plasmid DNA with a mutation in the u-PA B-chain is referred to as pJDB207/PHO5-I-FK2UPAB-W. This plasmid has an intact glycosylation site in "kringle" K2, but a mutant site W(Asn302 → Gln) in the u-PA B-chain.

Plasmids pJDB207/PHO5-I-FUPAB-W and pJDB207/PHO5-I-FGK2UPAB-W are constructed in the same way, starting from the corresponding unmutated plasmids (see example 29).

We replace the 4.8 kb SalI-HpaI vector fragment of pJDB207/PHO5-I-FK2UPAB-H with the 6.2 kb SalI-HpaI vector fragment of pJDB207F1Lac (see example 28). The 6.2 kb fragment has the 1.4 kb FlLac insert of pEMBL19 cloned into the 4.8 kb fragment of pJDB2O7. After ligation, transformation and analysis of the new construct, we present a proper plasmid with the inclusion of FlLac kac pJDB207FlLac/PHO5-I-FK2UPAB-W.

Plasmid pJDB207FlLac/PHO5-I-FGK2UPAB-W is obtained in the same way.

In the same way, replace the 4.8 kb SalI-HpaI vector part of pJDB207/PHO5-I-MOU-K2TPAB (see example 15C) with the 6.2 kb SalI-HpaI vector fragment of pJDB207FlLac. We designate the resulting plasmid as pJDB207FlLac/PHO5-I-UK2TPAB. Plasmids pJDB207FlLac/PHO5-I-UK2UPAB, pJDB207FlLac/PHO5-ITPAAUPAB and pJDB207FlLac/PHO5-I-UPAATPAB are obtained. in the same way from a plasmid without the FlLac vector fragment.

Example 32

Mutation of the glycosylation site /Asn184Gly-Ser in "kringle" K2FK2UPAB-W.

a) Preparation of single fiber template:

Plasmid pJDB207FlLac/PHO5-I-FK2UPAB-W is used for transformation of competent E.coli RZ1032 Ca2+ cells /T.A. Kunkel, supra/. One ampicillin-resistant colony was grown in LB medium to which 100 µg/ml ampicillin, 20 µg/ml thymidine and 20 µg/ml deoxyadenosine were added. At a cell density of 1,108/ml, we washed the pooled cells in LB medium and resuspended them in LB medium containing 100 µg/ml ampicillin and 0.25 µg/ml uridine. At OD600, we add 0.3 of helper phage R408 (Pharmacia-PL Biochemicals, Inc.) at m.o.i. 20. The culture is vigorously shaken for 5 hours at 37°C. Single-stranded DNA containing uracil is isolated from the medium as described by T.A. Kunkel (see above). Starting from pEMBL19(+) (see Example 28) we clone the F1 region into puDB207 in a counterclockwise orientation. Isolated single-stranded DNA is sensed Strand FK2UPAB included in the expression plasmid.

b) Mutation of glycosylation site at Asn184 "kringle" K2 t-PA

The mutation is made at the third position of the corresponding amino acid recognition sequence for glycosylation. Ser-186 was replaced with Ala.

SSDNA: 184 186

(chain of true Asn Gly (F)

directions) 5'-,..GGG AAT GGG TCA GCC TAC CGT...-3'

mutagenic 3'- CC TTA CCC CGT CGG ATG - -5'

example Y:

the chain of the mutated 5'-...GGG AAT GGG GCA GCC TAC CGT...-3'

directions: Asn Gly (F)

example sequence: 5'-CCACGGGAGGCAGGAGG-3

• •

791 775

The mutation protocol is the same as that described in example 30. Instead of the M13 universal sequence example, we use PHO5, an oligonucleotide and an example of the formula 5'-ATGCGAGGTTTAGTATGGC-3' which i. hybridizes to nucleotides -60 to -77 from ATG in PHO5 in the promoter. After the elongation and binding reaction, we transform competent E.coli BMH71 Ca2+ cells. /Kunkel, supra/. Colonies resistant to ampicillin are collected and grown in LB medium containing 100 mg/1 ampicillin.

We prepare plasmid DNA and analyze for the presence of DNA mutation by sequencing. Mutation of the TCA codon to GCA causes a Ser → Ala change at amino acid position 186 of t-PA. A mutation in the third position of the matching sequence removes the glycosylation site. One clone with mutated DNA is referred to as pJDB207FlLac/PHO5-I-FK2UPAB-WY.

Y indicates a mutation of the glycosylation site at Asn184 in K2 t-PA, and W a mutation at Asn302 in U-PA of the B-chain. The resulting non-glycolized FK2UPAB hybrid protein has two amino acid changes: Ser186 → Ala in t PA "kringle" K2 and Asn302 → Gln in u-PA B-chain.

An analogous mutation of plasmid pJDB207FlLac/PHO5-I-FGK2UPAB-W (see Example 31) leads to plasmid pJDB207F1Lac/PHO5-I-FK2UPAB-WY, which codes for a non-glycosylated FGK2UPAB hybrid protein.

Example 33

Construction of plasmid pJDB207FlLac/PHO5-I-K2UPAB-WY

The nucleotide sequence coding for the hybrid K2-UPAB protein, as defined by the amino acid sequence tPA (Ser1-Gln3) (G1y176-Arg275)-uPA (Ilel59-Leu411) is located in the plasmid pCGC5/K2UPAB. For expression in yeast, we use the inducible PHO5 promoter and connect the invertase signal sequence in frame with the K2UPAB coding region. Plasmid pCGC5/K2UPAB was cut with Bg1II and AccI. We isolate a 487 bp Bg1II-AccI fragment. It contains the coding sequence from the BglII site of t-PA (nucleotide position 178) to the AccI site in u-PA (nucleotide position 779). The fragment is cut with HphI, which gives 4 fragments.

Two oligodeoxyribonucleotides of the formula

Assn (F)

(I) 5'-CTGCATCTTACCAAGGAAACAGTGACTGCTACTTTGGGAATGGGGCAGCCTACCGTGGGCACG -3'

(II) 3'- AGAATGGTTCCTTTGTCACTGACGATGAAACCCTTACCCCGTCGGATGGCACCGTG -5'

synthesized using the phosphoramidite method on the Applied Biosystem Model 380B synthesizer. Oligonucleotides I and II form a double-stranded DNA linker. The 5-nucleotides at the exposed 5 end are part of the yeast invertase signal sequence, followed by the t-PA coding sequence (Serl-Gln3)-(G1y176-Thr191) to the first HphI cut site at nucleotide position 752 (see Figure 1). The glycosylation site at position 729-737 (AsnGlySer) was mutated in the synthetic sequence from TCA (Ser) to GCA (Ala), thereby removing the glycosylation recognition sequence. Mutation of the glycosylation site at amino acid positions 184186 of t-PA (eg, the second glycosylation site in the original t-PA) is designated as Y.

Oligonucleotides I and II are phosphorylated at their 5' ends, heated for 10 minutes at 85°C and renatured during cooling to room temperature. 10.5 µg (270 pmol) of quinalized, double-stranded linker DNA was ligated in a thirty-fold molar excess to the HphI-cut fragments (see above), as described in Example 8B. Excess linker molecules are removed by precipitation with isopropanol. DNA is further digested with ScaI. We isolated the 252 kb fragment on a preparative 1.5% agarose gel, electroeluted and precipitated in ethanol.

Plasmid P31RIT-12 (see Example 6B) was digested with SalI and XhoI. The isolated fragment was further digested with HgaI (see example 6C) and BamHI. We isolated the resulting 591 bp BamHI-HgaI fragment. It contains the PHO5 promoter and an invertase signal sequence.

Plasmid pJDB207/PHO5-I-K2UPAB-W was digested with BamHI. 5 linear DNAs are partially digested with 10 units of ScaI for 10 minutes. The reaction is stopped by adding 10 mM EDTA. The 7.7 kb BamHI-ScaI vector fragment was isolated, electroeluted and precipitated in ethanol. It contains the 3' part of the coding sequence of the ScaI site in t-PA (position 953) to the end of the u-PA B-chain (PvuII site at position 144- with an added XhoI linker), the PHO5 end and the pJDB207 vector sequence. We connect 0.2 pmol of each of the 591 bp BamHI-HgaI fragment and the 252 bp sticky ends (linker)-Scal fragment and 0.1 pmol of the 7.7 kb vector fragment. After transformation of E.coli HB101 Ca2+ cells by growing 12 colonies resistant to ampicillin. Plasmid DNA is isolated and analyzed by digestion with EcoRI and HindIII. We check the presence of mutations by DNA sequencing. We select one proper clone and designate it as pJDB207/PHO5-I-K2UPAB-WY. Glycosylated sites and "kringles" of K2 t-FA and u-PA of the B-chain are mutated (Y and W, respectively).

The resulting nonglycosylated K2UPAB hybrid protein has two amino acid changes: Ser186 → Ala in the t-PA K2 domain and Asn302 → Gln in the u-PA B-chain.

Example 34

Mutation of glycosylation sites /Asn184GlySer/ and /Asn44BArgThr/ in K2UPAB hybrid

Single fiber template /T.A. Kunkel, supra/ containing uracil; plasmid pJDB207/FlLac/PHO5-I-UK2TPAB (see example 31) is prepared as described in example 30. The mutation scheme for the glycosylation site at Asn184 is as described in example 32. Mutation of the glycosylation site at Asn448 causes an amino acid change Thr450 → Ala .

single-stranded DNA 448 450

(fibers of regular Asn Arg (F)

directions) 5'-...CTT AAC AGA ACA GTC ACC GAC A...-3'

mutagenic 3'-...GAA TTG TCT CGT CAG TGG CTG T…..-5'

example Z:

strand of the mutated 5'- CTT AAC AGA GCA GTC ACC GAC A -3'

directions: Asn Arg (F)

sequence example: 5'-TGGCAGGCGTCGTGCAA-3'

• •

1603 1587

The mutation protocol is described in Example 30. Both phosphorylated mutagenic examples Y and Z were renatured into the single-stranded template pJDB207FlLac/PHO5-I-UK2TPAB, which contains uracil. In this case we use another PHO5 oligonucleotide example (see example 32).

After the elongation and binding reaction, competent E.coli BMH71 Ca2+ cells are transformed. We prepare a plasmid of ampicillin-resistant transformants and analyze the presence of both mutations by DNA sequencing with marked sequence comparisons.

We refer to the plasmid DNA of one clone with both mutations as pJDB207FlLac/PHO5-I-UK2TPAB-YZ. Y denotes a mutation of the glycosylation site at Asn184, Z a mutation at Asn448. The non-glycolized hybrid protein UK2TPAB has two amino acid changes: Ser186 → Ala in the K2 "kringle" of t-PA and Thr450 → Ala in the B-chain of t-PA.

The mutation protocol was also used as a template

pJDB207FlLac/PHO5-I-UK2TPAB,

pJDB207FlLac/PHO5-I-TPAAUPAB and

pJDB207FlLac/PHO5-I-UPAATPAB- (see Example 31)

with the mutagenic example W for the mutation of the glycosylation site of the u-PA B-chain and/or the mutagenic examples Y and Z and others, published in the European patent application no. 225286, for mutation of glycosylation sites in t-PA.

Example 35

Transformation of Saccharomyces cerevisiae GRF18 and preparation of yeast cell extracts

Plasmids

pJDB207/PHO5-I-FK2UPAB,

pJDB207F1Lac/PHO5-I-FK2UPAB-W,

pJDB207F1Lac/PHO5-I-FR2UPAB-WY,

pJDB207F1Lac/PHO5-I-UK2TPAB,

pJDB207F1Lac/PHO5-I-UK2TPAB-YZ,

pJDB207/PHO5-I-K2UPAB-WY,

pJDB207/PHO5-I-FUPAB,

pJDB207/PHO5-I-FUPAB-W,

pJDB207/PHO5-I-FGK2UPAB,

pJDB207/PHO5-I-FGK2UPAB-W,

pJDB207F1Lac/PHO5-I-FGK2UPAB-W'.i

pJDB207F1Lac/PHO5-I-FGK2UPAB-WY

transform into Saccharomyces cerevisiae strain GRF18 (DSM 3665). Transformation, cell growth and preparation of cell extracts are described in Example 16.

The resulting hybrid plasminogen activators can be purified analogously to the method described in examples 22 to 24.

Example 36

Preparation of lyophilized, hybrid plasminogen activators

The solution obtained according to any of examples 22 to 24 is further purified and lyophilized as follows:

The solution is diluted with 10 volumes of 0.1 M ammonium acetate at pH 5.0 (total volume 80 ml) and applied to a column containing 5 ml of CM-Sepharose Fast Flow (Pharmacia) with a flow rate of 25 ml/hour at room temperature. The column was previously equilibrated with 0.1 M ammonium acetate. We discard the leachate, which does not contain the product. The column is washed with 15 ml of 0.1 M ammonium acetate at pH S.0 and with 10 ml of 0.1 M ammonium acetate at pH 7.0. Then we carry out elution of the absorbed hybrid PA with 1 M ammonium acetate with pH 8.6 at room temperature (flow rate 5 ml/hour). To prevent the formation of gas on the column, perform elution under elevated pressure of 1 to 1.5 bar. The content of hybrid PA in the eluate is measured with a UV monitor (280 nm). Let's collect the fractions containing approx. 90% of eluted hybrid PA and subjected to lyophilization. The purity of solid hybrid PA lyophilizate is approx. or above 95%, as assessed by HPLC. The product does not contain detergents.

Example 37

The first pharmaceutical composition for parenteral administration

The solution containing pure uPA(1-44)-tPA(176-527), obtained as described above, was dialyzed against 0.3 M sodium chloride, containing 0.01% Tween 80®, and stored at -80° C. Before administration, adjust the concentration to 75 µg/ml of total PA and 0.3 M NaCl. The solution is sterilized by filtration through a 0.22 µl membrane filter.

Instead of the above-mentioned PA, we can also use an equal amount of other PAs, described in the previous examples, such as:

uPA(1-158)-tPA(276-527),

uPA(1-131)-tPA(263-527), tPA(1-275)-uPA(159-411),

tPA(1-262)-uPA(132-411), uPA(1-44)-tPA(176-261)-uPA(134-411),

tPA(1-49)-tPA(262-275)-uPA(159-411), tPA(1-49)-uPA(134-411),

tPA(1-49)-tPA(176-275)-uPA(159-411),

tPA(1-49)-tPA(176-262)-uPA(132-411),

tPA(1-3)-tPA(176-275)-uPA(159-411);

tPA(1-86)-tPA(176-275)-uPA(159-411) or

tPA(1-86)-tPA(176-262)-uPA(132-411);

or mutant hybrid PA, such as

tPA(1-49)-tPA(262-275)-uPA(159-301, Gln, 303-411),

tPA(1-49)-tPA(176-185, Ala, 187-275)-uPA(159-301, Gln, 303-411),

uPA(1-44)-tPA(176-185, Ala, 187-449, Ala, 451-527),

tPA(1-3)-tPA(176-185, Als, 187-275)-uPA(159-301, Gln, 3D3-411) or

tPA(1-86)-tPA(176-185, Ala, 187-275)-uPA(159-301, Gln, 303-411).

Example 38

Other pharmaceutical composition for parenteral administration (dispersion for injections)

169.3 mg of soy lecithin (soy phosphatite NC 95, manufacturer: Nattermann, Koeln, SRN, purity 90 to 96%; composition of fatty acids: linoleic acid 61 to 71%, linolenic acid 4 to 7%, oleic acid 6 to 13% , palmitic acid 10 to 15%, stearic acid 1.5 to 3.5%) and 92.7 mg of pure sodium glycocholate are dissolved in 752.5 ml of sterilized water. Adjust the pH of the solution to 7.4 with 1N NaOH. Add 10 mg of lyophilized uPA(1-44)-tPA(176-527). We stir the mixture until we get a clear solution. Sterilize the solution by filtration through a 0.22 µm membrane filter and fill the ampoules.

Instead of the above-mentioned PA, we can also use an equal amount of another PA described in the previous examples, such as:

uPA(1-158)-tPA(276-527),

uPA(1-131)-tPA(263-527), tPA(1-275)-uPA(159-411),

tPA(1-262)-uPA(132-411), uPA(1-44)-tPA(176-261)-uPA(134-411),

tPA(1-49)-tPA(262-275)-uPA(159-411), tPA(1-49)-uPA(134-411),

tPA(1-49)-tPA(176-275)-uPA(159-411),

tPA(1-49)-tPA(176-262)-uPA(132-411),

tPA(1-3)-tPA(176-275)-uPA(159-411);

tPA(1-86)-tPA(176-275)-uPA(159-411) or

tPA(1-86)-tPA(176-262)-uPA(132-411),

or mutant hybrid PA, such as

tPA(1-49)-tPA(262-275)-uPA(159-301, Gln, 303-411),

tPA(1-49)-tPA(176-185, Ala, 187-275)-uPA(159-301, Gln, 303-411),

uPA(1-44)-tPA(176-185, Ala, 187-449, Ala, 451-527),

tPA(1-3)-tPA(176-185,'Ala, 187-275)-uPA(159-301, Gln, 303-411),

tPA(1-86)-tPA(176-185, Ala, 187-275)-uPA(159-301, Gln, 303-411).

Example 39

Third pharmaceutical composition for parenteral administration (including bolus infections)

100 mg of hybrid plasminogen activator or mutant hybrid plasminogen activator, for example such as those mentioned in examples 37 to 38, are dissolved in 1000 ml of 50 mM glutamic acid/sodium glutamate, containing 0.7% NaCl, with pH 4.5 We fill ampoules with the solution, and we can also use it for intravenous (bolus) infusion.

Deposition of microorganisms

We deposited the following species in 1987 at the Deutsche Sammlung fur Mikroorganismen (DSM), Grisebachs-strasse 8, D-3000 Göttingen, SRN (with given accession numbers):

E.coli HB101/pW349F Accession number:

E.coli.HB101/pCS16

E.coli HB101/pcUK176

E.coli HB101/pCGA26

E.coli HB101/pSV2911neo.

We deposited the following hybrid cell lines in 1987 in the "Collection Nationale de Cultures de Microorganismes", Institut Pasteur, Paris, (CNCM), France, under the given accession numbers.

Hybridomas: Accession number:

405B.33.3

406A.23.7

407A.15.27

Claims (27)

1. Single-chain hybrid plasminogen activator, characterized in that it consists of a) human t-PA "kringle" 2 domain, human catalytic u-PA domain and the junction sequence connecting the human t-PA "kringle" 2 domain with the human u-PA catalytic domain, wherein the junction sequence is selected from the group consists of a connecting sequence that connects the A-chain with the B-chain in human t-PA, a connecting sequence that connects the A-chain with the B-chain in human u-PA, and a hybrid connecting sequence composed of subsequences of said connecting sequences, whereby said splice sequences and hybrid splice sequences include a plasmin-cleavable processing site, in addition to an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a junction sequence N-terminally covering the "kringle" 2 domain in human t-PA or a fragment thereof, which junction sequence or fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences connecting the human t-PA "kringle" 2 domain and the human u-PA catalytic domain, and which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and hybrid linker sequences composed of subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that N-terminally covers the "kringle" 2 domain in human t-PA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, and which junction sequence or united junction sequence is located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and linker sequences connecting human t-PA "kringle" 2 domain with the human u-PA catalytic domain, which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and a hybrid splice sequence that is composed of subsequences of said splice sequences, wherein said splice sequences and hybrid splice sequences include a processing site that can be cleaved by plasmin, in addition, an N-terminal, cysteine residue that can form a sulfur bridge sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a junction sequence that C-terminally covers the "finger" domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the t-PA growth factor domain in human t-PA or a fragment thereof, or a combined junction sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or united junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of hybrid plasminogen activator. 2. Single-chain hybrid plasminogen activator according to claim 1, characterized in that it is selected from the group consisting of tPA(1-3)-tPA(176-275)-uPA-(159-411), tPA(1-49) -tPA(176-275)uPA(159-411) and tPA(1-86)-tPA(176-275)-uPA(159-411). 3. Single-chain hybrid plasminogen activator according to claim 1, characterized in that it is tPA(1-3)-tPA(176-275)-uPA(159-411). 4. A DNA sequence, indicated by the fact that it is coded for a single-stranded hybrid plasminogen activator, consisting of a) human t-PA "kringle" 2 domain, human catalytic u-PA domain and a junction sequence connecting the human t-PA, "kringle" 2 domain with the human u-PA catalytic domain, wherein the junction sequence is selected from the group that consists of a splice sequence that connects the A-chain to the B-chain in human t-PA, a splice sequence that connects the A-chain to the B-chain in human u-PA, and a hybrid splice sequence composed of subsequences of said splice sequences, wherein said junction sequences and hybrid junction sequences include a plasmin-cleavable processing site, in addition to an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a junction sequence N-terminally covering the "kringle" 2 domain in human t-PA or a fragment thereof, which junction sequence or fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which is the T-region or its fragment located at the N-terminus of hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences that connect the human t-PA "kringle" 2 domain and the human uPA catalytic domain, which connecting the sequence is selected from the group consisting of a junction sequence connecting the A-chain to the B-chain in human t-PA, a junction sequence connecting the A-chain to the B-chain in human u-PA, and a hybrid junction sequence composed of subsequences said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human uPA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that N-terminally covers the "kringle" 2 domain in human t-PA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, which is a junction sequence or a united junction sequence located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and linker sequences connecting human t-PA "kringle" 2 domain with the human u-PA catalytic domain, and which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, that hybrid junction sequence which is composed of subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, in addition an N-terminal, cysteine residue that can form a sulfur bridge -sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a junction sequence that C-terminally covers the "finger" domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the t-PA growth factor domain in human t-PA or a fragment thereof, or a combined junction sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or united junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of hybrid plasminogen activator. 5. The DNA sequence according to claim 4, characterized in that it encodes a single-chain hybrid plasminogen activator selected from the group consisting of tPA(1-3)-tPA(176-275)-uPA(159-411), tPA(1 -49)-tPA(176-275)-uPA(159-411) and tPA(1-86)tPA(176-275)-uPA(159-411). 6. The DNA sequence according to claim 4, characterized in that it is coded for a single-chain hybrid plasminogen activator, and that it is tPA(1-3)-tPA(176-275)-uPA-(159-411). 7. A hybrid vector, characterized in that it is for use in a eukaryotic host containing a DNA sequence encoded for a single-stranded hybrid plasminogen activator, consisting of a) human t-PA "kringle" 2 domain, human catalytic u-PA domain and the junction sequence connecting the human t-PA "kringle" 2 domain with the human u-PA catalytic domain, wherein the junction sequence is selected from the group consists of a splice sequence that connects the A-chain to the B-chain in human t-PA, a splice sequence that connects the A-chain to the B-chain in human u-PA, and a hybrid splice sequence composed of subsequences of said splice sequences, wherein said junction sequences and hybrid junction sequences include a plasmin-cleavable processing site, in addition to an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) junction sequences N-terminally covering the "kringle" 2 domain in human t-PA or a fragment thereof, which junction sequence or fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which is the T-region or its fragment located at the N-terminus of hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences connecting the human t-PA "kringle" 2 domain and the human u-PA catalytic domain, and which splice sequence is selected from the group consisting of a splice sequence connecting the A-chain to the B-chain in human t-PA, a splice sequence connecting the A-chain to the B-chain in human u-PA, and hybrid splice sequences composed of from subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that N-terminally covers the "kringle" 2 domain in human t-PA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, which is a junction sequence or a united junction sequence located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and linker sequences connecting human t-PA "kringle" 2 domain with the human u-PA catalytic domain, and which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, that hybrid splice sequence that is composed of subsequences of said splice sequences, wherein said splice sequences and hybrid splice sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form a sulfur bridge -sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a junction sequence that C-terminally covers the "finger" domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the t-PA growth factor domain in human t-PA or a fragment thereof, or a combined junction sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or seated junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of hybrid plasminogen activator. 8. Hybrid vector according to claim 7, characterized in that for use in a eukaryotic host containing a DNA sequence encoded for a single-chain hybrid plasminogen activator is selected from the group containing tPA(1-3)-tPA(176-275)-uPA-( 159-411), tPA(149)-tPA(176-275)-uPA(159-411) and tPA(1-86)-tPA(176-275)-uPA(159-411). 9. Hybrid vector according to claim 7, characterized in that it is for use in a eukaryotic host containing a DNA sequence encoded for a single-chain hybrid plasminogen activator, which is tPA(1-3)-tPA(176-275)-Upa-(159 -411). 10. A eukaryotic host cell, characterized in that it has been transformed with a hybrid vector containing a DNA sequence encoding a single-chain hybrid plasminogen activator consisting of a) human t-PA "kringle" 2 domains, human catalytic u-PA domains and a splice sequence linking the human t-PA "kringle" 2 domain to the human u-PA catalytic domain, wherein the splice sequence is selected from the group that consists of a junction sequence that connects the A-chain with the B-chain in human t-PA, a junction sequence that connects the A-chain with the B-chain in human u-PA, and a hybrid junction sequence composed of subsequences of said junction sequences, whereby said splice sequences and hybrid splice sequences include a plasmin-cleavable processing site, in addition to an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) junction sequences N-terminally covering the "kringle" 2 domain in human t-PA or a fragment thereof, which junction sequence or fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which is the T-region or its fragment located at the N-terminus of the hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences connecting the human t-PA "kringle" 2 domain and the human uPA catalytic domain, which the junction sequence is selected from the group consisting of a junction sequence connecting the A-chain to the B-chain in human t-PA, a junction sequence connecting the A-chain to the B-chain in human u-PA, and hybrid junction sequences consisting of subsequence a of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that N-terminally covers the "kringle" 2 domain in human t-PA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, and which junction sequence or united junction sequence is located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and linker sequences connecting human t-PA "kringle" 2 domain with the human u-PA catalytic domain, which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and a hybrid splice sequence that is composed of subsequences of said splice sequences, wherein said splice sequences and hybrid splice sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form a sulfur bridge sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a junction sequence that C-terminally covers the "finger" domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the t-PA growth factor domain in human t-PA or a fragment thereof, or a combined junction sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or seated junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of hybrid plasminogen activator. 11. The eukaryotic host cell according to claim 10, characterized in that it is transformed using a hybrid vector containing a DNA sequence encoded for a single-chain hybrid plasminogen activator selected from the group consisting of tPA(1-3)-tPA(176-275)-uPA -(159-411), tPA(1-49)-tPA(176-275)-uPA(159-411) and tPA(1-86)-tPA(176-275)-uPA(159-411). 12. The eukaryotic host cell according to claim 10, characterized in that it is transformed using a hybrid vector containing a DNA sequence encoded for a single-stranded hybrid plasminogen activator, which is tPA(1-3)-tPA(176-275)-uPA-(159 -411). 13. The method, characterized in that it is for the preparation of a single-chain hybrid plasminogen activator, which consists of a) human t-PA "kringle" 2 domain, human catalytic u-PA domain and the junction sequence connecting the human t-PA "kringle" 2 domain with the human u-PA catalytic domain, wherein the junction sequence is selected from the group consists of a splice sequence that connects the A-chain to the B-chain in human t-PA, a splice sequence that connects the A-chain to the B-chain in human u-PA, and a hybrid splice sequence composed of subsequences of said splice sequences, wherein said junction sequences and hybrid junction sequences include a plasmin-cleavable processing site, in addition to an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a junction sequence N-terminally covering the "kringle" 2 domain in human t-PA or a fragment thereof, which junction sequence or fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which is the T-region or its fragment located at the N-terminus of the hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences connecting the human t-PA "kringle" 2 domain and the human u-PA catalytic domain, and which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and hybrid linker sequences composed of subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that N-terminally covers the "kringle" 2 domain in human t-PA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, which sequence junction or combined sequence junction is located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and linker sequences connecting human t-PA "kringle" 2 domain with the human u-PA catalytic domain, which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and a hybrid splice sequence that is composed of subsequences of said splice sequences, wherein said splice sequences and hybrid splice sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form a sulfur bridge sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a junction sequence that C-terminally covers the "finger" domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the t-PA growth factor domain in human t-PA or a fragment thereof, or a combined junction sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or united junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; wherein said method includes culture of a transformed eukaryotic host containing DNA encoded for said hybrid plasminogen activator under suitable nutrient conditions, and isolation of said hybrid plasminogen activator. 14. The method according to claim 13, characterized in that for the preparation of single-chain hybrid plasminogen activator, selected from the group containing tPA(1-3)-tPA(176-275)-uPA-(159-411), tPA(1- 49)-tPA(176-275)-uPA(159-411) and tPA(1-86)-tPA(176-275)-uPA(159-411). 15. The method according to claim 13, characterized in that it is for the preparation of a single-chain hybrid plasminogen activator, which is tPA(1-3)-tPA(176-275)-uPA-(159-411). 16. Method, characterized in that it is for the preparation of a DNA sequence coded for a single-stranded hybrid plasminogen activator consisting of a) human t-PA "kringle" 2 domain, human catalytic u-PA domain and a junction sequence connecting the human t-PA, "kringle" 2 domain with the human u-PA catalytic domain, wherein the junction sequence is selected from the group that consists of a splice sequence that connects the A-chain to the B-chain in human t-PA, a splice sequence that connects the A-chain to the B-chain in human u-PA, and a hybrid splice sequence composed of subsequences of said splice sequences, wherein said junction sequences and hybrid junction sequences include a plasmin-cleavable processing site, in addition to an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a junction sequence N-terminally covering the "kringle" 2 domain in human t-PA or a fragment thereof, which junction sequence or fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which is the T-region or its fragment located at the N-terminus of hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences connecting the human t-PA "kringle" 2 domain and the human u-PA catalytic domain, and which junction sequence is selected from the group consisting of a junction sequence connecting the A-chain to the B-chain in human t-PA, a junction sequence connecting the A-chain to the B-chain in human u-PA, and hybrid junction sequences composed of subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that Nterminally covers the "kringle" 2 domain in human tPA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, and which is the splice sequence or the combined splice sequence located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and linker sequences connecting human t-PA "kringle" 2 domain with the human u-PA catalytic domain, which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and a hybrid splice sequence that is composed of subsequences of said splice sequences, wherein said splice sequences and hybrid splice sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form a sulfur bridge -sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a splice sequence that C-terminally covers the "finger" domain in D human t-PA or a fragment thereof, a splice sequence that N-terminally covers the t-PA domain of a growth factor in human t-PA or a fragment thereof, or a combined splice sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or united junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; wherein said method includes chemical DNA synthesis or preparation of fragments encoded for polynucleotide sequences for u-PA and t-PA cDNA, and their reconnection according to a predetermined order, optionally including one or more steps. 17. The method according to claim 16, characterized in that for the preparation of the DNA sequence coded for single-stranded hybrid plasminogen activator is selected from the group consisting of tPA(1-3)-tPA(176-275)-uPA-(159-411) , tPA(1-49)-tPA(176-275)-uPA(159-411) and tPA(1-86)-tPA(176-275)-uPA(159-411). 18. The method according to claim 16, characterized in that it is for the preparation of a DNA sequence coded for a single-chain hybrid plasminogen activator, which is tPA(1-3)-tPA(176-275)-uPA-(159411). 19. The method, characterized in that it is for the preparation of a hybrid vector for use in a eukaryotic host containing a DNA sequence coded for a single-stranded hybrid plasminogen activator, consisting of a) human t-PA "kringle" 2 domain, human catalytic u-PA domain and the junction sequence connecting the human t-PA "kringle" 2 domain with the human u-PA catalytic domain, wherein the junction sequence is selected from the group consists of a splice sequence that connects the A-chain to the B-chain in human t-PA, a splice sequence that connects the A-chain to the B-chain in human u-PA, and a hybrid splice sequence composed of subsequences of said splice sequences, wherein said junction sequences and hybrid junction sequences include a plasmin-cleavable processing site, in addition to an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a junction sequence N-terminally covering the "kringle" 2 domain in human t-PA or a fragment thereof, which junction sequence or fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which is the T-region or its fragment located at the N-terminus of hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences connecting the human t-PA "kringle" 2 domain and the human u-PA catalytic domain, and which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and hybrid linker sequences composed of subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that N-terminally covers the "kringle" 2 domain in human t-PA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, and which junction sequence or united junction sequence is located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and linker sequences connecting human t-PA "kringle" 2 domain with the human u-PA catalytic domain, which junction sequence is selected from the group consisting of the junction sequence connecting the A-chain to the B-chain in human t-PA, the junction of the sequence connecting the A-chain to the B-chain in human u-PA, that hybrid splice sequence that is composed of subsequences of said splice sequences, wherein said splice sequences and hybrid splice sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form a sulfur bridge -sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a junction sequence that C-terminally covers the "finger" domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the t-PA growth factor domain in human t-PA or a fragment thereof, or a combined junction sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or united junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; wherein said method involves linking DNA segments containing a eukaryotic promoter, a coding region for a hybrid plasminogen activator, a eukaryotic gene sequence covering the 3' position, and a DNA vector. 20. The method according to claim 19, characterized in that for the preparation of a hybrid vector for use in a eukaryotic host that includes a DNA sequence coded for a single-chain hybrid plasminogen activator selected from the group consisting of tPA(1-3)-tPA(176-275 )-uPA-(159-411), tPA(1-49)-tPA(176-275)-uPA(159-411) and tPA(1-86)-tPA(176-275)-uPA(159-411 ). 21. The method according to claim 19, characterized in that it is for the preparation of a hybrid vector for use in a eukaryotic host that includes a DNA sequence coded for a single-chain hybrid plasminogen activator, which is tPA(1-3)-tPA(176-275)-uPA -(159-411). 22. The method, characterized in that it is for the preparation of transformed eukaryotic cells, transformed with a hybrid vector containing a DNA sequence coded for a single-chain hybrid plasminogen consisting of a) human t-PA "kringle" 2 domain, human catalytic u-PA domain and the junction sequence connecting the human t-PA "kringle" 2 domain with the human u-PA catalytic domain, wherein the junction sequence is selected from the group consists of a junction sequence that connects the A-chain with the B-chain in human t-PA, a junction sequence that connects the A-chain with the B-chain in human u-PA, and a hybrid junction sequence composed of subsequences of said junction sequences, whereby said junction sequences and hybrid junction sequences include a processor site that can be cleaved by plasmin, in addition an N-terminal, cysteine residue capable of forming a sulfur-sulfur bridge to the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, and which junction sequence or a fragment thereof is located in the hybrid plasminogen activator N-terminal to the human t-PA "kringle" 2 domain ; you (ii) the T-region of human t-PA or its N-terminal fragment, which is the T-region or its fragment located at the N-terminus of hybrid plasminogen activator; b) human t-PA "finger" domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains and connecting sequences connecting the human t-PA "kringle" 2 domain and the human u-PA catalytic domain, and which linker sequence is selected from the group consisting of a linker sequence connecting the A-chain to the B-chain in human t-PA, a linker sequence connecting the A-chain to the B-chain in human u-PA, and hybrid linker sequences composed of subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form sulfur-sulfur bridges on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group consisting of (i) a splice sequence that C-terminally covers the "finger" domain in human t-PA, a splice sequence that N-terminally covers the "kringle" 2 domain in human t-PA, or a combined splice sequence that is composed of both said splice sequences or fragments thereof, which sequence junction or combined sequence junction is located between the t-PA "finger" domain and the t-PA "kringle" 2 domain in the hybrid plasminogen activator; and (ii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; (c) human t-PA "finger" domains, human t-PA growth factor domains, human t-PA "kringle" 2 domains, human u-PA catalytic domains, and a fusion of the human t-PA "kringle" linking sequence " 2 domain with the human u-PA catalytic domain, which junction sequence is selected from the group consisting of a junction sequence connecting the A-chain to the B-chain in human t-PA, a junction sequence connecting the A-chain to the B- chain in human u-PA, and a hybrid junction sequence that is composed of subsequences of said junction sequences, wherein said junction sequences and hybrid junction sequences include a processing site that can be cleaved by plasmin, and in addition an N-terminal, cysteine residue that can form a bridge sulfur-sulfur on the human u-PA catalytic domain; and optionally additionally one or more sequences selected from the group comprising (i) a junction sequence that C-terminally covers the "finger" domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the t-PA growth factor domain in human t-PA or a fragment thereof, or a combined junction sequence composed of of said both junction sequences or fragments thereof, wherein said junction sequences or united junction sequences are located between the "finger" domain and the growth factor domain in the hybrid plasminogen activator; (ii) a junction sequence that C-terminally covers the growth factor domain in human t-PA or a fragment thereof, a junction sequence that N-terminally covers the "kringle" 2 domain in human t-PA or a fragment thereof, or a combined junction sequence consisting from both mentioned junction sequences or from their fragments, wherein said junction sequences or united junction sequences are located between the growth factor and the "kringle" 2 domain in the hybrid plasminogen activator; you (iii) the T-region of human t-PA or its N-terminal fragment, which T-region or its fragment is located at the N-terminus of the hybrid plasminogen activator; wherein the method includes transforming eukaryotic host cells with said hybrid vector. 23. The method according to claim 22, characterized in that for the preparation of transformed eukaryotic cells, transformed using a hybrid vector containing a DNA sequence coded for a single-chain hybrid plasminogen activator selected from the group consisting of tPA(1-3)-tPA(176- 275)-uPA-(159-411), tPA(1-49)tPA(176-275)-uPA(159-411) and tPA(1-86)-tPA(176-275)-uPA(159-411 ). 24. The method according to claim 22, characterized in that it is for the preparation of transformed eukaryotic cells, transformed using a hybrid vector containing a DNA sequence encoded for a single-chain hybrid plasminogen activator, which is tPA(1-3)-tPA(176-275)- uPA-(159-411). 25. Pharmaceutical preparation, characterized in that it contains a single-chain hybrid plasminogen activator according to claims 1 to 3, together with pharmaceutically acceptable carrier substances. 26. Single-chain hybrid plasminogen activator according to claims 1 to 3, indicated to be used in a method of therapeutic prophylactic treatment in the human body. 27. Use of a single-chain hybrid plasminogen activator according to claims 1 to 3, characterized in that it is for the preparation of pharmaceutical preparations.