HK1136849B - Methods and compositions for expressing negative-sense viral rna in canine cells - Google Patents

Description

Methods and compositions for expressing negative-sense viral RNA in canine cells

1.Technical Field

In one aspect, the invention provides an isolated nucleic acid comprising a canine RNA polymerase I regulatory sequence. In other aspects, the invention provides expression vectors and cells comprising such nucleic acids, and methods of using such nucleic acids to prepare influenza viruses, including infectious influenza viruses.

2.Background

A global and dramatic increase in morbidity and mortality due to influenza disease is defined as an influenza pandemic. Several factors combine to affect the severity and extent of the pandemic, including low immunity in the population and the efficiency of transmission of the virus among the population. The latter is generally influenced not only by the virus itself, but also by population density and ease of access to the area. Viruses that cause pandemics are generally antigenic variants that have recently emerged and have not been previously exposed to most populations, and are therefore either non-immune or poorly immune. In addition, effective human to human transmission is a prerequisite for rapid transmission, and for example, animal infectious diseases such as animal viruses are transmitted to human populations, and the viruses must be adapted to replicate in the human body and also be able to be transmitted effectively.

Pandemic influenza spreads rapidly and can cause devastating effects. The most serious pandemic in the twentieth century was the one in 1918, with over 500,000 U.S. citizens dying and between 2 and 4 million deaths worldwide. Pandemics can produce a tidal stream of disease with high incidence peaks spaced from weeks to months. The relatively rapid onset and spread of pandemic influenza presents several problems for dealing with this degree of global invasiveness and imposes a tremendous burden on emergency responders (emergency responders) and health care workers. Rapid identification and response to an upcoming pandemic is clearly an essential element of the solution; there are currently several programs worldwide to monitor the emerging influenza viruses, including avian influenza viruses that occasionally cause illness in humans. These monitored data are used in conjunction with a predetermined level of pandemic warning to identify the likelihood of a threat and provide guidance for effective countermeasures.

Vaccination is the most important public health measure for the prevention of diseases caused by annual influenza epidemics. Identifying a brief interval between a potential pandemic and the onset of significant elevation in disease levels is a great problem for the preparation of effective vaccines to protect a large proportion of the population. Having vaccine preparation technology and production infrastructure in place before the next pandemic appears is critical to the substantial reduction of disease and death. The reaction time required to prepare a "pandemic vaccine" is not long, and therefore does not allow for long periods of research or development to provide an effective response.

To date, all commercially available influenza vaccines against non-pandemic strains in the united states have been bred in embryonated chicken eggs. Although influenza viruses grow well in eggs, vaccine production is dependent on available eggs. The supply of eggs must be organized to select strains for vaccine production months before the next flu outbreak season, limiting the flexibility of this approach, often resulting in lags and shortages in production and sales. Unfortunately, some influenza vaccine strains, such as the prototype A/Fujian/411/02 strain circulating in the season 2003-04, do not replicate well in embryonated chicken eggs and therefore have to be isolated by cell culture using costly and time consuming methods.

Systems for the Production of influenza viruses in cell culture have also been developed in recent years (see, e.g., Furminger, Vaccine Production, compiled in Nicholson et alTextbook of Influenza textbook) Pages 324 and 332; merten et al, (1996), Production of influenza viruses in cell cultures for vaccine preparation, compiled in Cohen and Shafferman,Novel Strategies in design and Production of VaccinesPage 141-151). These methods generally involve infecting a suitable immortalized host cell with a selected viral strain. Although many difficulties are overcome compared to the production of vaccines in eggs, not all influenza-causing strains can be grown and prepared well according to established tissue culture methods. In addition, many viral strains with desirable characteristics such as, for example, attenuation, temperature sensitivity, cold adaptation, and suitability for preparation of attenuated live vaccines cannot be successfully cultured in tissue culture using established methods.

Except that cells relying on infection of cell cultures with live virusesIn addition to the culture method, fully infectious influenza viruses can be produced in cell culture using recombinant DNA technology. The production of influenza viruses from recombinant DNA can significantly improve the flexibility and utility of tissue culture methods for producing influenza vaccines. Recently, systems for preparing influenza A and B viruses from recombinant plasmids incorporating cDNA encoding the viral genome have been reported, see, e.g., Neumann et al, (1999), Generation of influenza A virus derived cDNAs (influenza A viruses prepared entirely from cloned cDNA).Proc Natl Acad Sci USA96: 9345-9350; fodor et al, (1999), research of influenza Avirus from recombinant DNA (Rescue of influenza A virus from recombinant DNA).J.Virol73: 9679-9682; hoffmann et al, (2000), A DNA transfer system for the production of influenza A viruses from light plasmids (DNA transfection system for the preparation of influenza A viruses from8 plasmids), Proc Natl Acad Sci USA 97: 6108-6113; WO 01/83794; hoffmann and Webster, (2000), Universal RNA polymerase I-polymerase II transcription system for the generation of influenza A viruses from infectious plasmids (Unidirectional RNA polymerase I-polymerase II transcription system for the preparation of influenza A viruses from8 plasmids), 81: 2843 2847; hoffmann et al, (2002), research of influenza B viruses from8 plasmids (Rescue of influenza B virus from8 plasmids), 99 (17): 11411-11416; U.S. Pat. nos. 6,649,372 and 6,951,754; U.S. patent publication nos. 20050003349 and 20050037487, incorporated herein by reference. These systems are often referred to as "plasmid rescue" and thus make possible the production of recombinant viruses that express immunogenic HA and NA proteins from any selected viral strain.

However, these recombinant methods rely on the use of expression vectors that contain RNA polymerase i (RNA pol i) regulatory elements that drive transcription of viral genomic rRNA. Such regulatory elements are necessary to generate defined 5 'and 3' ends of the influenza virus genomic RNA, thereby enabling the production of fully infectious influenza viruses. Current recombinant systems, such as those described above, utilize the human RNA pol I regulatory system to express viral RNA. Due to the species specificity of the RNA pol I promoter, these regulatory elements are only active in human or primate cells. Thus, plasmid rescue of influenza virus has so far only been possible by transfection of suitable plasmids into human or primate cells.

Furthermore, such human or primate cells are often unable to produce influenza virus of sufficient titer for vaccine preparation. Alternatively, the vaccine virus strain can be replicated to a titer sufficient to prepare a commercial vaccine using Madin Darby canine kidney cells (MDCK cells). Thus, current plasmid rescue for the preparation of influenza vaccines requires the use of at least two different cell cultures. The identification and cloning of canine RNA pol I regulatory sequences allows plasmid rescue to be performed on the same cell culture as the virus replication, thereby eliminating the need for a separate rescue culture. Thus, there is also a need to identify and clone canine RNA pol I regulatory elements that can be used to construct suitable vectors for plasmid rescue in MDCK and other canine cells. The present invention provides these and other unmet needs.

Citation or discussion of a reference herein shall not be construed as an admission that such is prior art to the present invention. In addition, citation of a patent is not to be construed as an admission that it is available.

3.SUMMARY

Disclosed herein are nucleic acids comprising regulatory elements useful, for example, for expressing influenza genomic RNA in canine cells. Compositions such as isolated nucleic acids, vectors, and cells comprising the canine regulatory sequences of the present invention, as well as methods of using these compositions, are embodiments of the present invention.

Thus, in certain aspects, an isolated nucleic acid of the invention comprises a canine RNA polymerase i (pol i) regulatory sequence. In certain embodiments, the regulatory sequence comprises a promoter. In certain embodiments, the regulatory sequence comprises an enhancer. In certain embodiments, the regulatory sequence comprises both a promoter and an enhancer. In one embodiment, the regulatory sequence comprises nucleotides-250 to-1 (relative to the first nucleotide transcribed from the promoter, also referred to as +1 nucleotide) of the corresponding native promoter or a functional derivative thereof. In one embodiment, the regulatory sequence is operably linked to viral DNA, e.g., cloned viral cDNA. In one embodiment, the cloned viral cDNA encodes viral RNA of a minus-strand or plus-strand virus or the corresponding cRNA. In certain embodiments, the cloned viral cDNA encodes the genomic viral RNA (or corresponding cRNA) of an influenza virus.

In one embodiment, an isolated nucleic acid of the invention comprises a canine RNA polymerase I regulatory sequence and a transcription termination sequence. In certain embodiments, the transcription termination sequence is an RNA polymerase I termination sequence. In a specific embodiment, the transcription termination sequence is a human, monkey or canine pol I termination sequence.

In certain aspects, the invention provides an isolated nucleic acid comprising a canine RNA pol I promoter. The canine RNA pol I promoter is preferably operably linked to the nucleic acid to be transcribed, such as influenza virus genomic RNA. In one embodiment, introduction of the nucleic acid into the canine cell results in transcription of influenza virus genomic RNA, and the RNA transcript can be packaged into infectious influenza virus in the presence of appropriate influenza virus proteins. In one embodiment, an isolated nucleic acid is provided that comprises a canine RNA regulatory sequence of the present invention (e.g., a canine RNA pol I promoter), wherein the regulatory sequence is operably linked to a nucleic acid to be transcribed, and the isolated nucleic acid can be transcribed in the presence of a suitable protein (e.g., an RNP complex in the case of a nucleic acid encoding an influenza vRNA segment) in vitro or in vivo. In one embodiment, the nucleic acid to which the regulatory sequence is operably linked is an influenza vRNA segment.

In certain embodiments, a nucleic acid of the invention comprises a nucleic acid sequence that binds to a human, primate, mouse, or canine pol I polypeptide and is complementary to a sequence selected from the group consisting of SEQ ID nos: 1-28 or a functionally active fragment thereof, e.g., a canine RNA pol I regulatory sequence, having at least 100% or about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identity to one or more of the nucleotide sequences. In one embodiment, the polynucleotide sequence or functionally active fragment thereof also retains the ability to initiate transcription of a second polynucleotide sequence operably linked to the polynucleotide sequence in the presence of a suitable polypeptide, such as a human, primate, mouse, or canine pol I polypeptide. In one embodiment, SEQ ID No: 1-28 retain the "functionally active fragment" of the nucleic acids listed in SEQ ID Nos: 1-28, or a functional activity as described herein. For example, provided are the nucleic acid sequences as set forth in SEQ ID nos: 1, operably linked to a nucleic acid to be transcribed, transcribed in the presence of a suitable protein in vitro or in vivo.

In certain embodiments, a nucleic acid of the invention comprises a nucleic acid sequence that binds to a human, primate, mouse, or canine pol I polypeptide and/or to a polypeptide selected from the group consisting of SEQ ID nos: 1-28, or a fragment thereof, e.g., a canine RNA pol I regulatory sequence, having 100% or at least or about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identity to one or more nucleotide sequences. In one embodiment, the polynucleotide sequence or fragment thereof also retains the ability to initiate transcription of a second polynucleotide sequence operably linked to the nucleotide sequence in the presence of a suitable polypeptide, such as a human, primate, mouse, or canine pol I polypeptide.

In other embodiments, an isolated nucleic acid of the invention comprises a canine RNA polymerase I regulatory sequence and a ribozyme sequence. This may be, for example, hepatitis delta virus genomic ribozyme sequence or a functional derivative thereof.

In one embodiment, the nucleic acid of the invention encodes a genomic viral RNA of any negative strand RNA virus known to those of skill in the art (without limitation). In certain embodiments, the viral RNA encodes genomic viral RNA of a virus of the order mononegavirales. In certain embodiments, the viral RNA encodes a genomic viral RNA of a virus of the following virus families: paramyxoviridae (Paramyxoviridae), Pneumovirinae (Pneumovirinae), Rhabdoviridae (Rhabdoviridae), Filoviridae (Filoviridae), Bornaviridae (Bornaviridae), Orthomyxoviridae (Orthomyxoviridae), Bunyaviridae (Bunyaviridae) or Arenaviridae (Arenaviridae). In certain embodiments, the viral RNA encodes a genomic viral RNA of a virus of the following genera: respiratory viruses (Respirovirus), measles viruses (Morrilivirus), mumps viruses (Rubulavirus), Henipaviruses (Henipaviruses), mumps viruses (Avulaviruses), pneumoviruses (Pneumovirus), metapneumoviruses (Metapneumovirus), vesiculoviruses (Vesiculovirus), rabies viruses (Lyssavir), ephemeral fever viruses (Ephemerovirus), rhabdoviruses (Cyrhabdoviruses), rhabdoviruses (Nucleohyovirus), granulorhabdoviruses (Novindiabovirus), Marburg viruses (Marburgvirus), Ebolavirus (Ebolavirus), Bornavirus (Boavus), influenza A (Inzavirus), Tobovirus A (Tokavirus), Tokyvirus (Tokyvirus A), Tokyvirus (Tokyvirus), Tokyvirus A), Tokyvirus (Tokyvirus), Tokyvirus (Tokyvirus), Tokyvirus (Toky, Arenavirus (Arenavirus), citrus scale virus (Ophiovirus), rice stripe virus (Tenuivirus) or delta virus (Deltavirus). In certain embodiments, the viral RNA encodes genomic viral RNA of: sendai virus, measles virus, mumps virus, hendra virus, newcastle disease virus, human respiratory syncytial virus, avian pneumovirus, vesicular stomatitis indiana virus, rabies virus, bovine trihedral fever virus, lettuce necrotic yellows virus, potato yellow dwarf virus, infectious hematopoietic necrosis virus, victoria lake marburg virus, zaire ebola virus, borna virus, influenza a virus, influenza b virus, influenza c virus, sogator virus, infectious salmon anemia virus, bunyavirus, hantaan virus, darabi virus, rigourd fever virus, tomato spotted wilt virus, lymphocytic choriomeningitis virus, citrus scale virus, rice stripe virus, and hepatitis d virus.

In another aspect, the invention provides a vector comprising a nucleic acid of the invention. In certain embodiments, the vector is an expression vector. In certain embodiments, the vector comprises a bacterial origin of replication. In certain embodiments, the vector comprises an origin of replication of a eukaryotic cell. In certain embodiments, the vector comprises a selectable marker that is selectable in prokaryotic cells. In certain embodiments, the vector comprises a selectable marker that is selectable in eukaryotic cells. In certain embodiments, the vector comprises a multiple cloning site. In certain embodiments, the multiple cloning site is oriented relative to the canine RNA polymerase I regulatory sequence such that the polynucleotide sequence introduced into the multiple cloning site is transcribed from the regulatory sequence. In certain embodiments, the vector comprises a polynucleotide sequence that is capable of expression in canine cells, such as MDCK cells.

In one embodiment, the present invention provides expression vectors for recombinant rescue of viruses from cell cultures, such as MDCK cell cultures. Vectors are commonly used to rescue any virus known to those skilled in the art that is required to produce RNA with defined ends during its life cycle. These viruses include, without limitation, negative-sense RNA viruses, such as those described above. The virus is preferably an influenza virus, such as an influenza a virus, an influenza b virus, or an influenza c virus.

In certain embodiments, one or more vectors of the invention further comprise an RNA transcription termination sequence. In certain embodiments, the transcription termination sequence is selected from a RNA polymerase I transcription termination sequence, a RNA polymerase II transcription termination sequence, a RNA polymerase III transcription termination sequence, or a ribozyme.

In certain embodiments, the expression vector is a unidirectional expression vector. In other embodiments, the expression vector is a bidirectional expression vector. In some embodiments, the bi-directional expression vector of the present invention incorporates a first promoter inserted between a second promoter and a polyadenylation site, such as the SV40 polyadenylation site. In certain embodiments, the first promoter is a canine RNA pol I promoter. In certain embodiments, the second promoter is a canine RNA pol I promoter. In one embodiment, the first and second promoters flank at least one cloning site in opposite orientations.

In certain embodiments, the expression vector comprises a ribozyme sequence or transcription termination sequence located 3' to at least one cloning site relative to the canine RNA pol I promoter. In certain embodiments, the expression vector comprises a ribozyme sequence or transcription termination sequence that is located 3 ' of at least one cloning site relative to the canine RNA pol I promoter, thereby allowing intracellular synthesis of vRNA with distinct 5 ' and 3 ' ends.

In one embodiment, the gene or cDNA within the bidirectional expression vector of the invention is located between an upstream pol II promoter and a downstream canine pol I regulatory sequence (e.g., pol I promoter) of the invention. Transcription of a gene or cDNA from a pol II promoter can produce capped positive-sense viral mRNA, and transcription of a gene or cDNA from canine polI regulatory sequences can produce negative-sense, uncapped vRNA. Alternatively, in the one-way vector system of the present invention, the gene or cDNA is located downstream of the pol I and pol II promoters. The PolII promoter can produce capped positive sense viral mRNA and the pol I promoter can produce uncapped positive sense viral cRNA.

In another aspect, the invention provides a composition comprising 1, 2, 3, 4,5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 vectors, wherein the vectors comprise one or more nucleic acids of the invention (e.g., a canine pol I regulatory sequence of the invention) operably linked to a viral cDNA, such as an influenza cDNA.

In certain embodiments, 1, 2, 3, 4,5, 6, 7, 8, 9, 10, 11, 12, or more vectors of the invention are located within one plasmid. In certain embodiments, at least 1, 2, 3, 4,5, 6, 7, 8, 9, 10, 11, or 12 carriers are located within different plasmids. In certain embodiments, each vector is located within a different plasmid.

In certain embodiments, the vectors of the present invention are bidirectional expression vectors. The bidirectional expression vectors of the invention typically comprise a first promoter and a second promoter, wherein the first and second promoters are operably linked to both strands of the same double-stranded cDNA encoding a viral nucleic acid comprising an influenza virus genome segment, respectively. At least one of these promoters is typically a canine RNA pol I promoter. The bi-directional expression vector optionally comprises a polyadenylation signal and/or a termination sequence. For example, polyadenylation signals and/or termination sequences may flank the influenza genome segment between the two promoters. A preferred polyadenylation signal is the SV40 polyadenylation signal.

In one embodiment, the invention comprises a two-way plasmid-based expression system and a one-way plasmid-based expression system in which viral cDNA is inserted between the canine pol I regulatory sequences (e.g., pol I promoter) and the termination sequences (internal transcription units) of the invention. The internal transcription unit is flanked by an RNA polymerase ii (pol ii) promoter and a polyadenylation site (external transcription unit). In a one-way system, pol I and pol II promoters are located upstream of the cDNA, producing sense uncapped cRNA (from the pol I promoter) and sense capped mRNA (from the pol II promoter). The pol I promoter, pol I termination sequence, pol II promoter, and polyadenylation signal within the unidirectional system may be referred to as comprising an "upstream to downstream direction". In a bidirectional system, pol I and pol II promoters are located on opposite sides of the cDNA, with the upstream pol II promoter producing positive-sense capped mRNA and the downstream pol I promoter producing negative-sense uncapped viral RNA (vRNA). These pol I-pol II systems start transcribing two cellular RNA polymerases from their own promoters, possibly in different compartments of the nucleus. The pol I promoter and pol I termination sequences in a bidirectional system may be referred to as comprising a "downstream to upstream direction", while the pol II promoter and polyadenylation signals in a bidirectional system may be referred to as comprising an "upstream to downstream direction".

In other aspects, the invention disclosed herein includes compositions comprising an expression vector, wherein the expression vector comprises a canine RNA polymerase I transcribable polynucleotide sequence. In certain embodiments, the polynucleotide produces influenza virus vRNA or cRNA. In certain embodiments, the composition comprises a plurality of expression vectors, wherein each expression vector comprises a polynucleotide sequence that is transcribable by canine RNA polymerase I. In certain embodiments, the polynucleotide produces a plurality of influenza virus vrnas or crnas. In certain embodiments, the polynucleotide produces all 8 influenza vrnas or crnas.

In other aspects, the invention disclosed herein includes compositions comprising various expression vectors of the invention that, when introduced into canine cells in the absence/presence of helper virus, result in the production of influenza virus genomes.

In certain embodiments, the compositions of the invention comprise a plurality of expression vectors that, when introduced into canine cells in the absence/presence of helper virus, result in the production of infectious influenza virus. In certain embodiments, the infectious influenza virus is a cold-sensitive influenza virus. In certain embodiments, the infectious influenza virus is an attenuated influenza virus. In certain embodiments, the infectious influenza virus is a temperature sensitive influenza virus. In certain embodiments, the infectious influenza virus is a cold-adapted influenza virus. In certain embodiments, the infectious influenza virus is an attenuated, temperature sensitive, cold-adapted influenza virus.

In certain embodiments, the compositions of the invention comprise a vector comprising, from 5 'to 3', a promoter operably linked to a 5 'non-coding influenza virus sequence, the 5' non-coding influenza virus sequence linked to a cDNA linked to a 3 'non-coding influenza virus sequence, and the 3' non-coding influenza virus sequence linked to a transcription termination sequence. In certain embodiments, one or more cdnas within the vector are in the sense orientation. In certain embodiments, one or more cdnas within the vector are in an antisense orientation.

In certain embodiments, the present invention provides compositions comprising a plurality of carriers, wherein the plurality of carriers comprises: a vector comprising a canine regulatory sequence of the present invention operably linked to an influenza virus polymerase acid Protein (PA) cDNA linked to a transcription termination sequence; a vector comprising a canine regulatory sequence operably linked to an influenza virus polymerase basic protein 1(PB1) cDNA linked to a transcription termination sequence; a vector comprising a canine regulatory sequence operably linked to an influenza virus polymerase basic protein 2(PB2) cDNA linked to a transcription termination sequence; a vector comprising a canine regulatory sequence operably linked to an influenza virus Hemagglutinin (HA) cDNA linked to a transcription termination sequence; a vector comprising a canine regulatory sequence operably linked to an influenza Nucleoprotein (NP) cDNA linked to a transcription termination sequence; a vector comprising a canine regulatory sequence operably linked to an influenza virus Neuraminidase (NA) cDNA linked to a transcription termination sequence; a vector comprising a canine regulatory sequence operably linked to an influenza virus matrix protein cDNA, which is linked to a transcription termination sequence; and a vector comprising a canine regulatory sequence operably linked to an influenza virus NS cDNA linked to a transcription termination sequence. In certain embodiments, the composition further comprises one or more expression vectors that express mRNA encoding one or more influenza polypeptide selected from the group consisting of: PB2, PB1, PA, HA, NP, NA, matrix protein 1(M1), matrix protein 2(M2), and nonstructural proteins 1 and 2(NS1 and NS 2). In one embodiment, the composition produces infectious influenza virus when introduced into canine cells. In certain embodiments, the infectious influenza virus is a cold sensitive influenza virus. In certain embodiments, the infectious influenza virus is an attenuated influenza virus. In certain embodiments, the infectious influenza virus is a temperature sensitive influenza virus. In certain embodiments, the infectious influenza virus is a cold-adapted influenza virus. In certain embodiments, the infectious influenza virus is an attenuated, temperature sensitive, cold-adapted influenza virus.

In certain embodiments, the invention provides compositions that can produce infectious influenza viruses from cloned viral cdnas, the compositions comprising a set of plasmids, wherein each plasmid comprises a cDNA encoding at least one viral genome segment, wherein the viral cDNA corresponding to the viral genome segment is inserted between a canine RNA polymerase I regulatory sequence and a regulatory element (e.g., a canine pol I termination sequence) of the invention to synthesize vRNA or cRNA having an exact 3' end, thereby resulting in vRNA or cRNA expression.

In certain embodiments, the invention provides a composition for producing infectious influenza virus from cloned viral cDNA, the composition comprising a set of plasmids, wherein each plasmid comprises a cDNA encoding at least one viral genome segment, wherein a viral cDNA corresponding to the viral genome segment is inserted between the canine RNA polymerase I regulatory sequence and a regulatory element of the invention (e.g., a canine pol I termination sequence) to synthesize a vRNA or cRNA having an exact 3' end, resulting in expression of the vRNA or cRNA, wherein the canine RNA polymerase I regulatory sequence, viral cDNA and regulatory elements for the synthesis of vRNA or cRNA having a defined 3' end are inserted in sequence between the RNA polymerase II (pol II) promoter and the polyadenylation signal, resulting in the expression of viral mRNA and corresponding viral proteins, wherein expression of the complete set of vrnas or crnas and viral proteins results in assembly into an infectious influenza virus.

In certain embodiments, the regulatory element used to synthesize vRNA or cRNA having an exact 3' end is an RNA polymerase i (pol i) termination sequence. As will be appreciated by those skilled in the art, efficient replication and transcription of influenza vRNA requires very specific sequences at the 5 'and 3' ends of the vRNA. The skilled artisan can utilize the RNA polymerase I (pol I) termination sequence to ensure that the sequence at the 3' end of the prepared RNA transcript is indeed the exact end required for efficient replication and/or transcription of the genomic RNA. In certain embodiments, the regulatory element used to synthesize vRNA or cRNA having an exact 3' end is a ribozyme sequence. In certain embodiments, the pol I promoter is adjacent to the polyadenylation signal and the pol I termination sequence is adjacent to the pol II promoter. In certain embodiments, the pol I promoter is adjacent to the pol II promoter and the pol I termination sequence is adjacent to the polyadenylation signal. In certain embodiments, the influenza virus is an influenza a virus. In certain embodiments, the influenza virus is an influenza b virus.

In another aspect, the present invention provides a method for producing an influenza genomic RNA, comprising transcribing the nucleic acid of the present invention thereby producing an influenza genomic RNA. In certain embodiments, the influenza genomic RNA is transcribed in a cell-free system. In certain embodiments, the influenza genomic RNA is transcribed in canine cells, such as MDCK cells.

In one embodiment, the methods comprise transcribing a plurality of nucleic acids of the invention to produce a plurality of RNA molecules, e.g., a plurality of influenza genomic RNAs. In certain embodiments, 1, 2, 3, 4,5, 6, 7, or 8 influenza genomic RNAs are transcribed. In certain embodiments, a complete set of influenza genomic RNA is transcribed. In certain embodiments, when the influenza genomic RNA is transcribed in canine cells, such as MDCK cells, it expresses influenza virus proteins in the presence of PA, PB1, PB2, and NP. In certain embodiments, the influenza virus protein is selected from: PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS 2. In certain embodiments, a complete set of influenza virus genomic RNAs, when transcribed in canine cells, such as MDCK cells, expresses infectious influenza virus in the presence of PA, PB1, PB2, and NP. In certain embodiments, the methods comprise introducing PA, PB1, PB2, and NP with the influenza virus genomic RNA. In certain embodiments, PA, PB1, PB2, and NP are provided by helper viruses. In certain embodiments, the complete set of influenza genomic RNA is from a cold-adapted, temperature-sensitive, attenuated influenza virus.

One embodiment provides a method of transcribing a vRNA segment of an influenza virus, the method comprising the step of 1) contacting a nucleic acid comprising a sequence selected from the group consisting of SEQ ID nos: 1-28 (or an active fragment thereof) with one or more of the influenza virus proteins PB1, PB2, NP, and PA, wherein the nucleic acid is operably linked to a cDNA molecule encoding the vRNA segment; and 2) isolating the transcribed vRNA segment. In one embodiment, the method utilizes a helper virus.

In one aspect, the invention provides a method of producing a recombinant infectious recombinant virus (e.g., an infectious influenza virus) comprising a segmented RNA genome, comprising the steps of: culturing a canine host cell, such as an MDCK cell, wherein the host cell comprises one or more expression vectors of the invention comprising viral cdnas corresponding to genes in the viral genome and one or more expression vectors that express viral mrnas encoding one or more viral polypeptides; and isolating the infectious virus population. In one embodiment, the infectious virus population is an influenza virus population. In one embodiment, the method further comprises the step of introducing one or more expression vectors into the canine host cell prior to said culturing step. In one embodiment, the method further comprises the step of preparing one or more expression vectors prior to said introducing step.

One embodiment provides a method of producing a recombinant infectious recombinant virus (e.g., an infectious influenza virus) comprising a segmented RNA genome, the method comprising the steps of: a) inserting viral cdnas corresponding to respective genes in a viral genome into one or more expression vectors of the present invention; (b) introducing (e.g., by electroporation) the expression vector and one or more expression vectors that express viral mRNA encoding one or more viral polypeptides into a host cell (e.g., a canine cell) or a population of host cells; (c) cultivating the host cell; and d) isolating the infectious virus population. In one embodiment, the infectious recombinant virus is an influenza virus. In certain embodiments, the influenza virus is a cold-adapted, temperature sensitive, attenuated influenza virus.

One embodiment provides a method of producing an infectious recombinant virus (e.g., an infectious influenza virus) comprising a segmented RNA genome, wherein the method comprises the steps of: a) inserting viral cdnas corresponding to respective genes in a viral genome into one or more expression vectors of the present invention; (b) introducing (e.g., by electroporation) the expression vector into a host cell (e.g., a canine cell) or a population of host cells; (c) cultivating the host cell; and d) isolating the infectious virus population. In one embodiment, the infectious recombinant virus is an influenza virus. In certain embodiments, the influenza virus is a cold-adapted, temperature sensitive, attenuated influenza virus.

In one embodiment, the invention provides methods for producing infectious recombinant influenza viruses in host cells using the expression vectors of the invention to express vRNA segments or corresponding crnas and influenza virus proteins, particularly PB1, PB2, PA and NA. According to this embodiment, infectious recombinant influenza viruses may be produced with or without helper viruses.

In another embodiment, the invention provides a method of producing a recombinant influenza virus comprising culturing a canine cell comprising a plurality of nucleic acids, wherein the nucleic acids comprise a canine RNA polymerase I regulatory sequence operably linked to one or more cdnas encoding each influenza virus genomic RNA and expressing a nucleic acid encoding one or more influenza virus polypeptides: expression vectors for viral mRNA of PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS 2; and isolating the recombinant influenza virus from the cell.

In certain embodiments, the methods comprise introducing into a canine cell an expression vector that can direct the expression of a genomic or antigenomic viral RNA segment, a nucleoprotein, and an RNA-dependent polymerase intracellularly, thereby enabling the formation of a ribonucleoprotein complex and assembly of viral particles in the absence of a helper virus; and (b) culturing the cell in which the viral particles can be packaged and rescued. In certain embodiments, the recombinant minus-strand virus is a non-segmented virus. In certain embodiments, the recombinant negative-strand RNA virus is a segmented virus. In certain embodiments, the negative strand RNA virus is an influenza virus.

In certain embodiments, these methods comprise introducing into cultured canine cells an expression vector that directs the expression of a genomic or antigenomic RNA segment, a nucleoprotein, and an RNA-dependent polymerase of a segmented negative-strand RNA virus under conditions that enable the formation of an RNP complex comprising the viral genomic RNA segment and the assembly of viral particles in the absence of a helper virus; and culturing the cell in which the viral particles are produced. In certain embodiments, the expression vector directs the expression of a viral genomic RNA segment.

In certain embodiments, the canine cells used in the methods of the present invention comprise one or more expression vectors that express one or more proteins selected from the group consisting of: subunits of nucleoprotein and RNA-dependent RNA polymerase. In certain embodiments, the expression vector directs the expression of one or more nucleoproteins and subunits of the RNA-dependent RNA polymerase. In certain embodiments, one or more viral proteins are expressed from an expression vector under the control of regulatory sequences selected from the group consisting of: an adenovirus 2 major late promoter or a human cytomegalovirus immediate early promoter, or a functional derivative of a regulatory sequence, operably linked to a splicing tripartite leader sequence of a human adenovirus type 2.

In certain embodiments, the virus is an influenza a, b, or c virus. In certain embodiments, the virus is a reassortant virus (reassortant virus) containing vRNA segments derived from multiple parental viruses.

In certain embodiments, the methods of the invention comprise introducing a plurality of vectors of the invention, wherein each vector introduces a portion of the influenza virus into a population of host cells capable of supporting viral replication. The host cell can be cultured under conditions that allow for growth of the virus and influenza virus can be recovered. In certain embodiments, the influenza virus is an attenuated virus, a cold-adapted virus, and/or a temperature-sensitive virus. For example, in certain embodiments, the vector-derived recombinant influenza virus can be an attenuated, cold-adapted, temperature-sensitive virus, and thus suitable for administration as an attenuated live vaccine, e.g., in an intranasal vaccine formulation. In a typical embodiment, the virus is produced by introducing multiple vectors incorporating all or part of the influenza B virus/AnnArbor/1/66 genome, e.g., the ca B/Ann Arbor/1/66 virus genome.

In certain embodiments, multiple vectors comprising cdnas encoding at least 6 internal genomic segments of one influenza strain (e.g., genomic segments encoding all influenza virus proteins except HA and NA) and cdnas encoding one or more genomic segments of another influenza strain (e.g., HA and NA vRNA segments) can be introduced into a population of host cells. For example, at least 6 internal genome segments ("backbones") of a selected attenuated, cold-adapted and/or temperature-sensitive influenza a or B strain, such as the ca, att, ts strain of B/Ann Arbor/1/66 or an artificially engineered ca, att, ts influenza a or B strain, can be introduced into a population of host cells together with one or more segments encoding an immunogenic antigen derived from another strain. The immunogenic surface antigens typically include one or both of Hemagglutinin (HA) and/or Neuraminidase (NA) antigens. In embodiments where a single segment encoding an immunogenic surface antigen is introduced, 7 complementary segments of the selected virus are also introduced into the host cell.

In certain embodiments, the expression vector is transfected into the cell by electroporation. In certain embodiments, the expression vector is introduced into the cell by transfection into the cell in the presence of a liposomal transfection agent or by calcium phosphate precipitation. In certain embodiments, the expression vector is a plasmid. In certain embodiments, the expression vector comprises a different expression vector for expressing each genomic RNA segment or corresponding coding RNA of the virus. In certain embodiments, each genomic RNA segment or coding RNA is expressed under the control of a promoter sequence derived from the canine Pol I promoter described herein.

In certain embodiments, a plurality of plasmid vectors incorporating influenza virus genome segments are introduced into a population of host cells. For example, in certain embodiments, the entire influenza virus genome can be introduced into a host cell using 8 plasmids, each containing a different genome segment. Alternatively, a greater number of plasmids incorporating smaller genomic subsequences may also be utilized.

In another aspect, the invention provides a method for producing infectious viral particles of a segmented negative-strand RNA virus in cultured cells, wherein the negative-strand RNA virus has more than 3 genomic vRNA segments, e.g. an influenza virus, such as influenza a virus, the method comprising: (a) introducing a first set of expression vectors capable of expressing genomic vRNA segments within the cells to provide intact genomic vRNA segments of the virus into a population of cells capable of supporting growth of the virus; (b) introducing into said cells a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of said virus; and (c) culturing the cell thereby producing the viral particle. In certain embodiments, the cell is a canine cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the virus is an influenza b virus. In certain embodiments, the first set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the first set of expression vectors is contained within 1 plasmid. In certain embodiments, the second set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the second set of expression vectors is contained within 1 plasmid. In certain embodiments, the first, second, or both sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encodes each vRNA segment of an influenza virus. In certain embodiments, the second set of expression vectors encodes mRNA of one or more influenza polypeptide. In certain embodiments, the first or second set of expression vectors (or both sets) comprise a nucleic acid of the invention, e.g., a canine regulatory sequence of the invention (e.g., canine pol I). In certain embodiments, the first or second set (or both) of expression vectors encodes vRNA or mRNA of a second virus. For example, one set of vectors comprises one or more vectors encoding HA and/or NA mRNA and/or vRNA of a second influenza virus.

The invention also provides a method for producing infectious viral particles of a segmented negative-strand RNA virus in cultured cells, wherein the negative-strand RNA virus has more than 3 genomic vRNA segments, for example an influenza virus, such as influenza a virus, the method comprising: (a) introducing a set of expression vectors capable of expressing genomic vRNA segments within said cells to provide a complete genomic vRNA segment of said virus and further capable of expressing mRNA encoding one or more polypeptides of said virus into a population of cells capable of supporting growth of said virus; (b) culturing the cell to produce the viral particle. In certain embodiments, the cell is a canine cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the virus is an influenza b virus. In certain embodiments, the set of expression vectors is contained within 1-17 plasmids. In certain embodiments, the set of expression vectors is contained within 1-8 plasmids. In certain embodiments, the set of expression vectors is contained within 1-3 plasmids. In certain embodiments, the plurality of sets of expression vectors are introduced by electroporation. In certain embodiments, the set of expression vectors encodes each vRNA segment of an influenza virus. In certain embodiments, the set of expression vectors encodes mRNA of one or more influenza polypeptide. In certain embodiments, the set of expression vectors encodes each vRNA segment of an influenza virus and mRNA of one or more influenza virus polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, e.g., a canine regulatory sequence of the invention (e.g., canine pol I). In certain embodiments, the set of expression vectors encodes vRNA or mRNA of a second virus. For example, the set of vectors comprises one or more vectors encoding HA and/or NA mRNA and/or vRNA of the second influenza virus. In certain embodiments, the first or second set (or both) of expression vectors encodes vRNA or mRNA of a second virus. For example, one set of vectors comprises one or more vectors encoding HA and/or NA mRNA and/or vRNA of a second influenza virus.

In certain embodiments, the methods further comprise performing one or more additional cell infection steps using cells that are the same as or different from the canine cells to amplify viral particles produced by the canine cells. In certain embodiments, the methods further comprise isolating the infectious viral particles. In certain embodiments, these methods further comprise a viral attenuation or killing step. In certain embodiments, the methods further comprise incorporating attenuated or killed viral particles within the vaccine composition.

In one embodiment, the method of producing a virus of the invention results in a virus titer (24, 36, 48 hours, 3 days, or 4 days after introduction of the vector of the invention into the host cell) of at least 0.1X 10³PFU/ml, or at least 0.5X 10³PFU/ml, or at least 1.0X 10³PFU/ml, or at least 2X 10³PFU/ml, or at least 3X 10³PFU/ml, or at least 4X 10³PFU/ml, or at least 5X 10³PFU/ml, or at least 6X 10³PFU/ml, or at least 7X 10³PFU/ml, or at least 8X 10³PFU/ml, or at least 9X 10³PFU/ml, or at least 1X 10⁴PFU/ml, or at least 5X 10⁴PFU/ml, or at least 1X 10⁵PFU/ml, or at least 5X 10⁵PFU/ml, or at least 1X 10⁶PFU/ml, or at least 5X 10⁶PFU/ml, or at least 1X 10⁷PFU/ml, or in the range of 0.1 to 1X 10³PFU/ml, or in the range of 1X 10³-1×10⁴PFU/ml, or in the range of 1X 10⁴-1×10⁵PFU/ml, or in the range of 1X 10⁵-1×10⁶PFU/ml, or in the range of 1X 10⁶-1×10⁷PFU/ml range, or higher than 1X 10⁷PFU/ml. Thus, the invention provides methods of rescuing viruses wherein the titer of the rescued virus at 24-36 hours or 2-3 days is at least 0.1X 10³PFU/ml, or at least 0.5X 10³PFU/ml, or at least 1.0X 10³PFU/ml, or at least 2X 10³PFU/ml, or at least 3X 10³PFU/ml, or at least 4X 10³PFU/ml, or at least 5X 10³PFU/ml, or at least 6X 10³PFU/ml, or at least 7X 10³PFU/ml, or at least 8X 10³PFU/ml, or at least 9X 10³PFU/ml, or at least 1X 10⁴PFU/ml, or at least 5X 10⁴PFU/ml, or at least 1X 10⁵PFU/ml, or at least 5X 10⁵PFU/ml, or at least 1X 10⁶PFU/ml, or at least 5X 10⁶PFU/ml, or at least 1X 10⁷PFU/ml or in the range of 0.1 to 1X 10³PFU/ml, or in the range of 1X 10³-1×10⁴PFU/ml, or in the range of 1X 10⁴-1×10⁵PFU/ml, or in the range of 1X 10⁵-1×10⁶PFU/ml, or in the range of 1X 10⁶-1×10⁷PFU/ml range, or higher than 1X 10⁷PFU/ml。

In some embodiments, the influenza virus corresponds to influenza b virus. In some embodiments, the influenza virus corresponds to influenza a virus. In certain embodiments, the methods comprise recovering recombinant and/or reassortant influenza viruses that elicit an immune response following administration, e.g., intranasal administration, to a subject. In some embodiments, the virus is inactivated prior to administration, and in other embodiments, a live attenuated virus is administered. Recombinant and reassortant influenza a and b viruses produced according to the methods of the invention are also a feature of the invention. In certain embodiments, the virus comprises an attenuated influenza virus, a cold-adapted influenza virus, a temperature sensitive influenza virus, or a virus having any combination of these desirable properties. In one embodiment, the influenza virus incorporates an influenza B/Ann Arbor/1/66 strain virus, e.g., a cold-adapted, temperature sensitive attenuated strain of B/Ann Arbor/1/66. In another embodiment, the influenza virus incorporates an influenza A/Ann Arbor/6/60 strain virus, e.g., a cold-adapted, temperature sensitive attenuated strain of A/Ann Arbor/6/60.

Optionally, reassortant viruses are generated by the combined introduction of vectors encoding 6 internal vrnas of the virus strain selected for its superior properties of vaccine production and vectors encoding vRNA segments of selected, e.g., pathogenic strains' surface antigens (HA and NA). For example, the HA segment is preferably selected from the virulence related strains H1, H3 or B, which are routine for vaccine production. Similarly, the HA segment may be selected from a newly emerging pathogenic strain such as the H2 strain (e.g., H2N2), the H5 strain (e.g., H5N1), or the H7 strain (e.g., H7N 7). Alternatively, the 7 complementary gene segments of the first virus strain may be introduced in combination with the HA or NA encoding segments. In certain embodiments, the internal gene segment is derived from influenza B/Ann Arbor/1/66 or influenza A/Ann Arbor/6/60 strain. Furthermore, influenza viruses comprising a modified HA gene may be produced (e.g., H5N1, H9N2, H7N7, or HxNy (where x ═ 1-9, y ═ 1-15)). For example, the HA gene can be modified by removing the multi-base cleavage site.

In another aspect, the invention provides a host cell comprising a nucleic acid or expression vector of the invention. In certain embodiments, the cell is a canine cell. In certain embodiments, the canine cell is a kidney cell. In certain embodiments, the canine kidney cell is an MDCK cell. In other embodiments, the cell is selected from the group consisting of: c6 cells, BHK cells, PCK cells, MDCK cells, MDBK cells, 293 cells (e.g., 293T cells), and COS cells. In certain embodiments, a co-culture mixture of at least two of these cell lines, e.g., a combination of COS and MDCK cells or a combination of 293T and MDCK cells, comprises the host cell population.

Host cells comprising the influenza vectors of the invention can be cultured under conditions in which the virus can replicate and assemble. Host cells incorporating influenza plasmids are typically cultured at less than 37 ℃ and preferably at a temperature of 35 ℃ or less. In certain embodiments, the cells are cultured at between 32 ℃ and 35 ℃. In some embodiments, the cells are cultured at between about 32 ℃ and 34 ℃, e.g., about 33 ℃. After a suitable incubation time to allow the virus to replicate to a particular titer, the recombinant virus can be recovered. The recovered virus may optionally be inactivated.

In yet another aspect, the present invention provides methods of engineering influenza viruses to limit their growth to only certain types of cells, including but not limited to: MRC-5, WI-38, FRhL-2, PerC6, 293, NIH3T3, CEF, CEK, DF-1, Vero, MDCK, Mv1Lu, human epithelial cells and SF9 cell types. In one embodiment, growth is limited such that influenza virus cannot grow in human primary cells (e.g., PerC 6). In another embodiment, growth is limited such that influenza virus cannot grow in human epithelial cells. One skilled in the art will recognize that the growth-limiting phenotype may be combined with one or more other phenotypes, such as cold-adapted, temperature-sensitive, attenuated, and the like. It is also understood that mutations that result in growth-limiting phenotypes may also result in and/or be responsible for other phenotypes, such as those listed above.

In another aspect, the present invention provides novel methods for rescuing recombinant or reassortant influenza a or b viruses (i.e., wild-type and mutant strains of influenza a and/or influenza virus) from MDCK cell cultures. In certain embodiments, multiple vectors incorporating influenza genomes are introduced into MDCK cell populations by electroporation, wherein the canine regulatory sequences of the present invention control transcription of the genomes. The cells may be grown under conditions in which the virus replicates, e.g., in the case of cold-adapted, attenuated, temperature sensitive virus strains, MDCK cells may be grown at temperatures below 37 ℃, preferably at or below 35 ℃. The cells are usually cultured at a temperature between 32 ℃ and 35 ℃. In some embodiments, the cells are cultured at a temperature between about 32 ℃ and 34 ℃, e.g., about 33 ℃. MDCK cells are optionally (e.g., for vaccine production) grown in serum-free media without any animal-derived products.

In some embodiments of the above methods, the influenza virus can be recovered after culturing the host cell incorporating the influenza virus genomic plasmid. In some embodiments, the recovered virus is a recombinant virus. In some embodiments, the virus is a reassortant influenza virus having more than one parental strain genetic component. The recovered recombinant or reassortant virus may optionally be passaged in cultured cells or chicken eggs for further expansion.

The recovered virus may optionally be inactivated. In some embodiments, the recovered virus comprises an influenza vaccine. For example, the recovered influenza vaccine can be a reassortant influenza virus (e.g., a 6:2 or 7:1 reassortant virus) having HA and/or NA antigens derived from a selected strain of influenza a or b. In one embodiment, the HA or NA antigen is modified. In certain preferred embodiments, the reassortant influenza virus has an attenuated phenotype. The reassortant virus is optionally cold-adapted and/or temperature sensitive, e.g., an attenuated, cold-adapted or temperature sensitive influenza a or b virus. Such influenza viruses are useful, for example, as live attenuated vaccines to prophylactically generate an immune response specific to a selected, e.g., pathogenic influenza virus strain. Influenza viruses, e.g., attenuated reassortant viruses, made according to the methods of the invention are also additional features of the invention.

In another aspect, the invention relates to a method of producing a recombinant influenza virus vaccine comprising introducing a plurality of vectors incorporating an influenza virus genome into a population of host cells capable of supporting influenza virus replication, wherein a canine regulatory sequence of the invention (e.g., a canine RNA pol I promoter) controls transcription of the genome; culturing the host cell at a temperature of less than or equal to 35 ℃; and recovering influenza virus capable of eliciting an immune response upon administration to the subject. The vaccine may comprise a strain of influenza a or b virus.

In some embodiments, the influenza vaccine virus comprises an attenuated influenza virus, a cold-adapted influenza virus, or a temperature sensitive influenza virus. In certain embodiments, the virus has a combination of these desirable properties. In one embodiment, the influenza virus incorporates the influenza A/Ann Arbor/6/60 strain virus. In another embodiment, the influenza virus incorporates the influenza B/Ann Arbor/1/66 strain virus. Alternatively, the vaccine may comprise an artificially engineered influenza a or B virus incorporating at least one substituted amino acid that affects characteristic biological properties of ca a/Ann Arbor/6/60 or ca/B/Ann Arbor/1/66, such as unique amino acids from these strains.

One embodiment provides a vaccine comprising a population of recombinant viruses (or viruses derived therefrom) produced by the methods of the invention. In a specific embodiment, the vaccine comprises a live virus produced by the method of the invention. In another embodiment, the vaccine comprises a killed or inactivated virus produced by the methods of the invention. In another embodiment, the vaccine comprises an immunogenic composition prepared using live, killed or inactivated virus produced by the method of the invention. In another embodiment, the vaccine comprises an immunogenic composition prepared from an attenuated live influenza virus, a cold-adapted influenza virus, a temperature sensitive influenza virus produced by the methods of the invention. In another embodiment, the vaccine comprises an attenuated live influenza virus, cold-adapted influenza virus, or temperature sensitive influenza virus, or a virus derived therefrom, produced by the methods of the invention.

4.Brief Description of Drawings

FIG. 1 shows growth curves of wild type and ca B strains (B/Beijing/243/97) in PerC6 and MDCK cells; viral titers were determined at each time point by TCID50 assay.

FIG. 2 shows growth curves of wild type and ca A strains (A/Sydney/05/97 and B/Beijing/262/95) in PerC6 and MDCK cells; viral titers were determined at each time point by TCID50 assay.

FIG. 3 shows growth curves of wild type and ca A strains (A/Ann Arbor/6/60) in PerC6 and MDCK cells; viral titers were determined at each time point by TCID50 assay.

FIG. 4 shows M-segment specific Taqman using viral RNA(Paroarotoro Molecular Systems, Calif.; Palo Alto, Calif.) probes real-time analyze A/Sydney viral RNA in PerC6 and MDCK cells.

FIG. 5 shows the growth curve of ca A/Vietnam/1203/2004(H5N1) in MDCK cells; viral titers were determined at each time point by TCID50 assay.

FIG. 6 shows the rescue of individual influenza gene segments as 7:1 reassortants by the 8-plasmid rescue technique.

FIG. 7 shows growth curves for each 7:1 reassortant in PerC6 cells; viral titers were determined at each time point by TCID50 assay.

FIG. 8 shows a restriction map of an Eco RI fragment comprising canine RNA pol I regulatory sequences.

FIGS. 9A, 9B and 9C represent the nucleotide sequence of an approximately 3.5kB nucleic acid (SEQ ID NO: 1) cloned from canine genomic DNA, encoding at least a portion of the 18s rRNA gene, starting at nucleotide 1809(+1) of the sequence shown.

FIG. 10 shows a diagram of plasmid pAD3000, which can be readily adapted for use in the preparation of expression vectors of the invention.

FIG. 11 shows the MDCK pol I promoter construct used in the minigenome experiments.

FIG. 12 shows the results of the minigenome test. EGFP signals generated from-1, +1, and +2MDCK pol I promoter constructs are shown in the top left, middle, and top right panels, respectively. The negative promoter control showed only background fluorescence (bottom left). Cells transfected with the CMV-EGFP construct served as positive controls (lower right panel).

FIG. 13 shows the sequence of plasmid expression vector pAD4000(SEQ ID NO: 29) which contains a 469bp fragment of the MDCK EcoRI-BamHI subclone (bases 1340-1808 of SEQ ID NO: 1) (bases 1-469 in pAD 4000). Note that: the 469bp fragment is shown in reverse complement orientation, with the adaptor sequence underlined and in bold.

FIG. 14 shows the annealing positions of primers used for RT-PCR reaction of rescued viral RNA.

FIG. 15 shows the sequences of primers used in RT-PCR reactions on rescued viral RNA.

FIGS. 16A-B show the partial sequences of the NS and PB1 segments and the positions of the introduced silent mutations.

5.Detailed Description

Plasmid rescue of influenza viruses typically involves the introduction of an expression vector that expresses viral proteins and transcription of viral genomic RNA within appropriate cells. Transcription of viral genomic RNA is typically performed with RNA polymerase I, since these enzymes can produce transcripts with ends suitable for use as viral genomes. Thus, the RNA pol I promoter and other regulatory elements can be used to initiate transcription of genomic RNA during plasmid rescue. Unfortunately, the RNA pol I promoter is highly species specific. That is, RNA pol I of one species may or may not bind efficiently to RNA pol I promoters of an unrelated species. Thus, the available RNA pol I promoters limit the cells that can undergo plasmid rescue. Prior to the present invention, plasmid rescue was not possible in canine cells. According to the following disclosure, plasmid rescue in canine cells is possible for the first time.

Thus, in a first aspect, there is provided an isolated nucleic acid of the invention comprising a canine RNA polymerase I regulatory sequence. In certain embodiments, the regulatory sequence is a promoter. In one embodiment, the regulatory sequence is a canine pol I promoter sequence. In another embodiment, the regulatory sequence is operably linked to the cloned viral cDNA. In yet another embodiment, the cloned viral cDNA encodes viral RNA of a minus-strand or plus-strand virus or the corresponding cRNA. In a specific embodiment, the cloned viral cDNA encodes the genomic viral RNA (or corresponding cRNA) of an influenza virus.

In a specific embodiment, an isolated nucleic acid of the invention comprises a canine RNA polymerase I regulatory sequence and a transcription termination sequence. In certain embodiments, the transcription termination sequence is a pol I termination sequence. In certain embodiments, the transcription termination sequence is a human, monkey or canine pol I termination sequence.

In certain embodiments, a nucleic acid of the invention comprises a nucleic acid sequence that binds to a human, primate, mouse, or canine pol I polypeptide and is complementary to a sequence selected from the group consisting of SEQ ID nos: 1-28 or a functionally active fragment thereof, e.g., a canine RNA pol I regulatory sequence, having at least 100% or about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identity to one or more of the nucleotide sequences. In one embodiment, the polynucleotide sequence or functionally active fragment thereof also retains the ability to initiate transcription of a second polynucleotide sequence operably linked to the nucleotide sequence in the presence of a suitable polypeptide, such as a human, primate, mouse, or canine pol I polypeptide. In one embodiment, seq id No: 1-28 retain the nucleic acid sequence of SEQ ID No: 1-28 full length sequence of one or more of the functional activities described herein. For example, provided are the nucleic acid sequences as set forth in SEQ ID nos: 1 operably linked to a nucleic acid to be transcribed, which is transcribed in the presence of a suitable protein in vitro or in vivo. In one embodiment, the nucleic acid of the invention comprises SEQ ID NO: 26.

In certain embodiments, a nucleic acid of the invention comprises a nucleic acid sequence that binds to a human, primate, mouse, or canine pol I polypeptide and/or to a polypeptide selected from the group consisting of SEQ ID nos: 1-28, or a fragment thereof, e.g., a canine RNA pol I regulatory sequence, having 100% or at least or about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70%, or 65% identity to one or more nucleotide sequences. In one embodiment, the polynucleotide sequence or fragment thereof also retains the ability to initiate transcription of a second polynucleotide sequence operably linked to the nucleotide sequence in the presence of a suitable polypeptide, such as a human, primate, mouse, or canine pol I polypeptide.

In certain aspects, the invention provides an isolated nucleic acid comprising a canine RNA pol I promoter. The canine rnatol I promoter is preferably operably linked to a nucleic acid to be transcribed, such as an influenza genomic RNA. Introduction of the nucleic acid into canine cells results in transcription of influenza virus genomic RNA, and in the presence of appropriate influenza virus proteins, the RNA transcripts can be packaged into infectious influenza viruses. One embodiment provides an isolated nucleic acid comprising a canine RNA regulatory sequence of the present invention (e.g., a canine RNA pol I promoter), wherein the regulatory sequence is operably linked to the nucleic acid to be transcribed, and is transcribed in the presence of a suitable protein, in vitro or in vivo. In one embodiment, the nucleic acid to which the regulatory sequence is operably linked is an influenza vRNA segment.

In another aspect, the invention provides vectors and methods for producing recombinant influenza viruses entirely from cloned viral DNA in canine cell culture. For example, influenza viruses can be produced as follows: introducing into a canine host cell a plurality of vectors comprising cloned cdnas encoding each viral genome segment under the control of a canine RNA regulatory sequence of the present invention (e.g., a canine pol I promoter); culturing the canine cells; and isolating the produced recombinant influenza virus from the cell culture. When a vector encoding the influenza virus genome is so introduced (e.g., by electroporation) into canine cells, recombinant viruses suitable for use as vaccines can be recovered by standard purification methods. Using the vector systems and methods of the present invention, reassortant viruses incorporating 6 internal gene segments and immunogenic HA and NA segments from selected, e.g., pathogenic strains, selected for their desirable characteristics associated with vaccine production, can be produced rapidly and efficiently in tissue culture. Thus, the systems and methods described herein can be used to rapidly produce recombinant and reassortant influenza a and b viruses, including viruses suitable for use as vaccines, including live attenuated vaccines, in canine cell cultures. Vaccines prepared according to the methods of the invention may be delivered intranasally or intramuscularly.

For each of the a and B subtypes, a single Master Donor Virus (MDV) strain is typically selected. In the case of live attenuated vaccines, the main donor virus strain is usually selected for its superior properties in connection with vaccine production, e.g. temperature sensitivity, cold adaptation and/or attenuation. For example, typical master donor virus strains include such temperature sensitive, attenuated and cold adapted strains of A/Ann Arbor/6/60 and B/Ann Arbor/1/66, respectively.

For example, a selected master donor type A virus (MDV-A) or master donor type B virus (MDV-B) can be generated from viral cDNAs of multiple clones that make up the viral genome. In one exemplary embodiment, recombinant viruses are prepared from viral cdnas of 8 clones. The 8 viral cdnas representing selected MDV-a or MDV-B sequences of PB2, PB1, PA, NP, HA, NA, M and NS were cloned into an expression vector, e.g., a bidirectional expression vector such as a plasmid (e.g., pad3000 or pad4000), so that viral genomic RNA can be transcribed from the canine RNA polymerase i (pol i) promoter of one strand, while viral mRNA is synthesized from the RNA polymerase ii (pol ii) promoter of the other strand. Optionally, any gene segment may be modified, including HA segments (e.g., removal of multiple base cleavage sites).

Plasmids carrying 8 viral cDNAs are transfected into suitable host cells, such as MDCK cells, and infectious recombinant MDV-A or MDV-B viruses are recovered. Using the plasmids and methods described herein, the invention can be used, for example, to generate a 6:2 reassortant influenza vaccine by co-transfecting the 6 internal genes (PB1, PB2, PA, NP, M, and NS) of a selected virus (e.g., MDV-A, MDV-B, PR8) with HA and NA derived from different types (a or b) of influenza virus. For example, the HA segment is preferably from a pathologically relevant H1, H3 or B strain, which is a routine procedure for vaccine production. The HA segment can be similarly selected from strains that are related to pathogenic strains, including, for example, the H2 strain (e.g., H2N2), the H5 strain (e.g., H5N1), or the H7 strain (e.g., H7N 7). Reassortants incorporating 7 genomic segments of MDB and the HA or NA genes of the selected strain can also be generated (7:1 reassortant). In addition, the system can be used to determine the molecular basis of phenotypic features associated with vaccine production, such as, for example, the attenuated (att), cold-adapted (ca), and temperature-sensitive (ts) phenotypes.

5.1 Definition of

Unless defined otherwise, all scientific and technical terms are to be understood as having the same meaning as commonly used in the art to which they pertain. For the purposes of the present invention, the following terms are defined below.

The terms "nucleic acid", "polynucleotide sequence" and "nucleic acid sequence" refer to a single-or double-stranded deoxyribonucleic acid or ribonucleic acid polymer, or a chimera or analog thereof. The term as used herein also includes polymers of natural nucleotide analogs having the basic properties of natural nucleotides, wherein they can hybridize to single-stranded nucleic acids (e.g., peptide nucleic acids) in a manner similar to natural nucleotides. Unless otherwise indicated, a particular nucleic acid sequence of the invention includes complementary sequences in addition to the sequence explicitly indicated.

The term "gene" is used broadly to refer to any nucleic acid associated with a biological function. Thus, a gene includes coding sequences and/or regulatory sequences required for its expression. The term "gene" applies to a particular genomic sequence as well as to the cDNA and mRNA encoded by that genomic sequence.

Genes also include non-expressed nucleic acid segments, e.g., nucleic acid segments that form recognition sequences for other proteins. Non-expressed regulatory sequences include "promoters" and "enhancers," to which binding of a regulatory protein, such as a transcription factor, results in transcription of adjacent or nearby sequences. A "tissue-specific" promoter or enhancer is a promoter or enhancer that can only regulate transcription in one or more specific tissue types or cell types.

A "promoter" or "promoter sequence" is a DNA regulatory region capable of initiating transcription of a nucleic acid sequence to which it is operably linked, in the presence of a suitable transcription-associated enzyme, e.g., an RNA polymerase, which is functional, under conditions such as culture or physiological conditions. The promoter may be located upstream or downstream of the nucleic acid sequence whose transcription is initiated. The promoter sequence located upstream of the cDNA is linked at its 3 'end to the transcription start site and extends upstream (5' direction) to include as few bases or elements as necessary to initiate transcription at detectable levels above background. The promoter sequence (expression (-) RNA) located downstream of the cDNA is linked at its 5 'end to the transcription start site and extends downstream (3' direction) to include few bases or elements necessary to initiate transcription at a detectable level above background. The bidirectional system of the present invention comprises both an upstream promoter and a downstream promoter; whereas the unidirectional system contains only the upstream promoter. The transcription initiation site is located within or near the promoter sequence (as may be conveniently determined, for example, by mapping with the ribozyme S1), and may further comprise a protein binding domain (consensus sequence) that drives, regulates, enhances, or is responsible for RNA polymerase binding.

As used herein, a "canine RNA polymerase I regulatory sequence" or "canine RNA polymerase I regulatory element" (or functionally active fragment thereof) refers to a nucleic acid sequence that is capable of enhancing transcription of a nucleic acid sequence to which it is operably linked, in the presence of canine RNA polymerase I and optionally associated transcription factors (the enzymes being functional), under conditions such as culture or physiological conditions. Examples of canine RNA polymerase I regulatory sequences include the canine RNA polymerase I promoter, which can bring the level of transcription of nucleic acids to which it is operably linked above background levels; and a canine RNA polymerase I enhancer, which can enhance transcription of a nucleic acid operably linked to the canine RNA polymerase I promoter beyond that observed in the absence of the canine RNA polymerase I enhancer. One experiment to identify canine RNA polymerase I regulatory elements is to introduce putative canine RNA polymerase I regulatory elements operably linked to a nucleic acid of interest into suitable canine cells, e.g., MDCK cells, and detect transcription of the nucleic acid of interest using routine assays, e.g., Northern blots. Comparison of the level of nucleic acid transcription in the presence and absence of the putative canine RNA polymerase I regulatory element allows the skilled artisan to determine whether the nucleic acid element is a canine RNA polymerase I regulatory element.

The term "vector" refers to a nucleic acid, such as a plasmid, viral vector, recombinant nucleic acid, or cDNA, that can be used to introduce a heterologous nucleic acid sequence into a cell. The vectors of the invention typically comprise a regulatory sequence of the invention. The vector may or may not be autonomously replicating. The vector may also be a naked RNA polynucleotide incapable of autonomous replication, a naked DNA polynucleotide, a polynucleotide consisting of DNA and RNA in the same strand, polylysine-conjugated DNA or RNA, peptide-conjugated DNA or RNA, liposome-conjugated DNA, or the like. The most common vector of the present invention is a plasmid.

An "expression vector" is a vector, such as a plasmid, capable of promoting expression (e.g., transcription) of a nucleic acid incorporated therein. Expression vectors of the invention typically comprise regulatory sequences of the invention. The expression vector may or may not be autonomously replicating. The nucleic acid to be expressed is usually "operably" linked to a promoter and/or enhancer, under the transcriptional regulatory control of the promoter and/or enhancer.

A "bidirectional expression vector" is typically characterized by two promoters that are oriented in opposite directions relative to the nucleic acid between the two promoters, thereby enabling expression in both directions, resulting in, for example, transcription of RNA in the plus (+) or sense strand and the minus (-) or antisense strand. Alternatively, the bidirectional expression vector may be an ambisense vector in which viral mRNA and viral genomic rna (crna) are expressed from the same strand.

For the purposes of the present invention, the term "isolated" refers to biological material, such as nucleic acids or proteins, that are substantially free of components with which they are associated or interact in their natural environment. The isolated material optionally includes material not found in its natural environment, e.g., cells. For example, if a material is in its natural environment, e.g., within a cell, the material is in a location (e.g., a genome or genetic element) within the cell where the material is not naturally found in that environment. For example, a native nucleic acid (e.g., coding sequence, promoter, enhancer, etc.) becomes isolated if it is introduced by a non-native means into a genomic location (e.g., a vector, such as a plasmid or viral vector, or an amplicon) that is different from the location in which the nucleic acid is naturally found. Such nucleic acids are also referred to as "heterologous" nucleic acids.

The term "recombinant" indicates a material (e.g., a nucleic acid or protein) that is artificially altered or synthetically altered (non-natural) by human intervention. Changes may be made to a material that is within, or removed from, its natural environment or state. In particular, if referring to a virus, such as an influenza virus, the virus is recombinant when the virus is produced by expression of a recombinant nucleic acid.

The term "reassortant" when referring to a virus, indicates that the virus comprises genetic and/or polypeptide components derived from a plurality of parental virus strains or sources. For example, a 7:1 reassortant contains 7 viral genome segments (or gene segments) derived from a first parental virus and one complementary viral genome segment of a second parental virus, e.g., a segment encoding hemagglutinin or neuraminidase. The 6:2 reassortant contains 6 genomic segments, most commonly 6 internal genes, derived from a first parental virus, and two complementary segments of a different parental virus, such as hemagglutinin and neuraminidase segments.

When the term "introduced" refers to a heterologous or isolated nucleic acid, it refers to the incorporation of the nucleic acid into a eukaryotic or prokaryotic cell, where the nucleic acid can be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA). The term includes methods such as "infection", "transfection", "transformation" and "transduction". For the purposes of the present invention, nucleic acids can be introduced into prokaryotic cells by a variety of methods, including electroporation, calcium phosphate precipitation, lipid-mediated transfection (lipofection), and the like.

The term "host cell" denotes a cell which is capable of, or has taken up, a nucleic acid, e.g., a vector, and supports the replication and/or expression of the nucleic acid, and optionally produces one or more encoded products, including polypeptides and/or viruses. The host cell may be a prokaryotic cell, e.g., E.coli, or a eukaryotic cell, such as a yeast, insect, amphibian, avian or mammalian cell, including a human cell. For the purposes of the present invention, typical host cells include Vero (african green monkey kidney) cells, per.c6 cells (human embryonic retina cells), BHK (baby hamster kidney) cells, Primary Chicken Kidney (PCK) cells, madu-darby canine kidney (MDCK) cells, madu-darby bovine kidney (MDBK) cells, 293 cells (e.g., 293T cells), and COS cells (e.g., COS1, COS7 cells). The term host cell includes a combination or mixture of cells, including, for example, a mixed culture of different cell types or cell lines (e.g., Vero and CEK cells). For example, PCT/US04/42669, filed on 22.12.2004, describes co-culturing electroporated SF Vero cells, which is incorporated by reference in its entirety.

The term "artificially engineered" as used herein indicates that a virus, viral nucleic acid or virus-encoded product, e.g., a polypeptide, vaccine, comprises the introduction of at least one mutation by recombinant means, e.g., directed mutagenesis, PCR mutagenesis, and the like. When the expression "artificially engineered" refers to a virus (or viral component or product) comprising one or more nucleotide mutations and/or amino acid substitutions, it indicates that the viral genome or genome segment encoding the virus (or viral component or product) is not derived from a natural source, e.g. a natural virus strain produced by non-recombinant methods (e.g. progressive passaging at 25 ℃) or a previously existing laboratory virus strain, e.g. a wild-type or cold-adapted a/Ann Arbor/6/60 or B/anrbnaor/1/66 strain.

The term "% sequence identity" is used interchangeably herein with the term "% identity" and refers to the level of amino acid sequence identity between two or more peptide sequences, or the level of nucleotide sequence identity between two or more nucleotide sequences, when aligned using a sequence alignment program. For example, 80% identity, as used herein, refers to the same case as 80% sequence identity as determined by a given algorithm, which means that a given sequence is at least 80% identical to another sequence of another length. Exemplary levels of sequence identity include, but are not limited to, 60, 70, 80, 85, 90, 95, 98% or more sequence identity to a given sequence.

The term "% sequence homology" is used interchangeably herein with the term "% homology" and refers to the level of amino acid sequence homology between two or more peptide sequences, or the level of nucleotide sequence homology between two or more nucleotide sequences, when aligned using a sequence alignment program. For example, herein, 80% homology refers to the same situation as 80% sequence homology as determined by a given algorithm, and thus, homologues of a given sequence have more than 80% sequence homology over the length of the given sequence. Exemplary levels of sequence homology include, but are not limited to, 60, 70, 80, 85, 90, 95, 98% or more sequence homology to a given sequence.

Exemplary computer programs that can be used to determine identity between two sequences include, but are not limited to, the BLAST suite of programs, such as BLASTN, BLASTX, and TBLASTX, BLASTP, and TBLASTN, which are publicly available at the NCBI website and can be found on the Internet. See also Altschul et al, 1990, j.mol.biol.215: 403-10 (reference may be made in particular to the published default settings, i.e. parameters w-4, t-17) and Altschul et al, 1997, Nucleic Acids res, 25: 3389-3402. If the identity of a given amino acid sequence is to be assessed relative to the amino acid sequences in the GenBank protein sequences and other public databases, sequence searches are generally performed using the BLASTP program. The BLASTX program is preferably used to search nucleic acid sequences translated in all reading frames based on the amino acid sequences in the GenBank protein sequences and other public databases. Both BLASTP and BLASTX can be run with default parameters, i.e., an open gap penalty of 11.0 and an extended gap penalty of 1.0, using the BLOSUM-62 matrix. As above.

To determine "% identity" between two or more sequences, the selected sequences can be preferably aligned using the CLUSTAL-W program, version 6.5 of MacVector6, which is run using an open gap penalty of 10.0, an extension gap penalty of 0.1, and a BLOSUM 30 similarity matrix.

"specifically hybridize" or "selectively hybridize" refers to the presence of a particular nucleotide sequence in a complex mixture (e.g., of a total cell) of DNA or RNA to which a nucleic acid molecule preferentially binds, forms a duplex, or hybridizes under stringent conditions.

The term "stringent conditions" refers to conditions under which a probe preferentially hybridizes to its target subsequence, hybridizes to other sequences to a lesser extent, or does not hybridize at all. For nucleic acid hybridization assays, such as Southern and Northern hybridizations, "stringent hybridization" and "stringent hybridization wash conditions" are sequence dependent and differ under different environmental parameters. A more extensive guide to nucleic Acid Hybridization is found in Tijssen, 1993, laboratory techniques in Biochemistry and Molecular Biology-Hybridization with nucleic Acid Probes, section I, Chapter 2, "Overview of Hybridization and the protocol of nucleic Acid probe assays (Overview of Hybridization principles and nucleic Acid probe analysis strategies)," New York Asville (Elsevier, NY); sambrook et al, 2001, Molecular Cloning: a laboratory Manual, Cold Spring harbor laboratory (Cold Spring harbor laboratory), third edition, New York; and Ausubel et al, latest edition, Current protocols Molecular Biology (New edition Molecular Biology), New Youglein Publishing Co-Ltd and Wiley Interscience, N.Y..

At a particular ionic strength and pH, high stringency hybridization and wash conditions are typically selected to be about 5 ℃ lower than the thermal melting point (Tm) for the particular sequence. The Tm is the temperature (under specified ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are chosen to be equal to the Tm for a particular probe.

In Southern or Northern blots, an example of stringent hybridization conditions for hybridizing complementary nucleic acids containing more than about 100 complementary residues to a filter is 50% formalin containing 1mg heparin, at 42 ℃ overnight. An example of high stringency washing conditions is 0.15M NaCl, 72 ℃ for about 15 minutes. An example of stringent wash conditions is a wash in 0.2 XSSC for 15 minutes at 65 ℃. The SSC buffer is described in Sambrook et al. A low stringency wash can be performed prior to a high stringency wash to remove background probe signal. For duplexes of, for example, more than about 100 nucleotides, an exemplary medium stringency wash is 45 ℃,1 x SSC, 15 minutes. For duplexes of, for example, more than about 100 nucleotides, an exemplary low stringency wash is 4-6 XSSC at 40 ℃ for 15 minutes. In a particular hybridization assay, a signal-to-noise ratio 2-fold (or greater) higher than that observed for an unrelated probe indicates that specific hybridization is detected.

As used herein, unless otherwise indicated, the term "about" refers to a number that is no more than 10% above or below the number modified by the term. For example, the term "about 5. mu.g/kg" means a range from 4.5. mu.g/kg to 5.5. mu.g/kg. As another example, "about 1 hour" means a range from 48 minutes to 72 minutes.

The term "encoding" as used herein refers to the property of a nucleic acid, e.g., a deoxyribonucleic acid, to transcribe a complementary nucleic acid, including nucleic acids that can be translated into a polypeptide. For example, deoxyribonucleic acid can encode RNA transcribed from deoxyribonucleic acid. Deoxyribonucleic acids can similarly encode polypeptides translated from RNA transcribed from the deoxyribonucleic acid.

5.2 Nucleic acids comprising canine RNA Pol I regulatory elements

One embodiment provides an isolated nucleic acid comprising a canine RNA regulatory sequence (e.g., a canine RNA pol I promoter) of the invention. The regulatory sequence may, for example, be operably linked to the nucleic acid to be transcribed and may be transcribed in the presence of a suitable protein in vitro or in vivo. In one embodiment, the nucleic acid to which the regulatory sequence is operably linked is an influenza vRNA segment.

In certain aspects, the invention provides an isolated nucleic acid comprising a canine RNA pol I promoter. The canine rnatol I promoter is preferably operably linked to a nucleic acid to be transcribed, such as an influenza genomic RNA. Introduction of the nucleic acid into canine cells results in transcription of influenza virus genomic RNA, and one or more RNA transcripts can be packaged into influenza viruses, e.g., infectious influenza viruses, in the presence of appropriate influenza virus proteins.

In certain embodiments, a nucleic acid of the invention comprises a nucleic acid sequence that binds to a human, primate, mouse, or canine pol I polypeptide and is complementary to a sequence selected from the group consisting of SEQ ID nos: 1-28, or a fragment thereof, that is at least or about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identical to one or more of the nucleotide sequences of seq id no. In one embodiment, the RNA pol I regulatory sequence or fragment thereof further retains the ability to initiate transcription of a gene to which the nucleotide sequence is operably linked. In certain embodiments, the nucleic acid of the invention comprises a nucleotide sequence identical to SEQ ID No:29, or a polynucleotide sequence that is at least or about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, or 60% identical thereto.

In addition, the nucleic acids of the invention also include derivatives of the nucleic acids that comprise the canine RNA pol I promoter. Such derivatives may be prepared from the canine RNA polI regulatory sequences identified below by any method known to those skilled in the art, but are not limited to these methods. For example, derivatives can be made by site-directed mutagenesis, including substitution, insertion, or deletion of 1, 2, 3,5, 10, or more nucleotides in the nucleic acid. Alternatively, the first and second electrodes may be,derivatives can be prepared by random mutagenesis. The method for randomly mutagenizing nucleic acid comprises adding 0.1mM MnCl₂And amplifying the nucleic acid in a PCR reaction in the presence of an unbalanced nucleotide concentration. These conditions increase the rate of misincorporation by the polymerase in the PCR reaction, leading to random mutagenesis of the amplified nucleic acid. The derivative nucleic acid preferably retains the ability to initiate transcription of a gene to which the nucleotide sequence is operably linked. In certain embodiments, the nucleic acid of the invention comprises a nucleotide sequence selected from the group consisting of SEQ ID nos: 1-28, at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 consecutive nucleotides of one or more nucleotide sequences. The nucleic acid preferably comprises a sequence which is capable of initiating transcription of a gene operably linked to the nucleotide sequence in canine cells and is therefore a functional derivative. In one embodiment, the nucleic acid comprises a sequence that binds a canine polI polypeptide in canine cells and initiates (in vitro or in vivo) transcription of influenza virus vRNA. One embodiment provides a polypeptide comprising SEQ ID NO:26, wherein said nucleic acid sequence is capable of directing the expression of an influenza vRNA when operably linked to cDNA encoding said influenza vRNA and introduced into MDCK cells. Another embodiment provides a polypeptide comprising an amino acid sequence substantially identical to SEQ ID NO:26, wherein said nucleic acid sequence is capable of directing the expression of an influenza vRNA when operably linked to cDNA encoding said influenza vRNA and introduced into MDCK cells. Another embodiment provides a nucleic acid molecule comprising a nucleotide sequence capable of hybridizing under stringent hybridization conditions to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-26, wherein said nucleic acid sequence is capable of directing the expression of an influenza vRNA when operably linked to a cDNA encoding said influenza vRNA and introduced into an MDCK cell. In certain embodiments, the nucleic acid of the invention comprises SEQ ID No:29 of at least about 400, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1,2000 or 3000 consecutive nucleotides.

In certain embodiments, the nucleic acid sequences of the invention comprise SEQ ID NOs: 1 (with respect to the first nucleotide transcribed from the promoter, also referred to as +1 nucleotide) or a functional derivative thereof, or consists of these nucleotides. In other embodiments, the nucleic acid sequence of the invention comprises SEQ ID NO:1 (with respect to the first nucleotide transcribed from the promoter, also referred to as +1 nucleotide) or a functional derivative thereof, or consists of these nucleotides. SEQ ID NO:1 the +1 nucleotide of the 18S ribosomal RNA expressed from the canine RNA pol I regulatory sequence is SEQ ID NO:1, nucleotide 1809. One embodiment provides a polypeptide comprising SEQ ID NO:26, a complement thereof, a reverse complement thereof, or a functionally active fragment thereof.

The invention also provides SEQ ID NO: 1(a.t.c.c. sub-sequence of the nucleotide sequence of the deposited clone with accession number PTA-7540). Thus, the invention also provides a polypeptide selected from SEQ ID NO:1 by deletion of one or more nucleic acid residues at the amino terminus of the nucleotide sequence set forth in seq id no. SEQ ID NO:1 can be described by the general formula m-3537, wherein m is an integer from 2 to 3512, m corresponds to the amino acid sequence set forth in SEQ ID NO:1 or deposited clone (a.t.c.c. accession No. PTA-7540). The invention also provides a polypeptide selected from SEQ ID NO:1 by deletion of one or more nucleic acid residues at the carboxy terminus of the nucleotide sequence set forth in seq id no. SEQ ID NO:1 can be described by the general formula 1-n, wherein n is an integer from 2 to 3512, n corresponds to the amino acid sequence shown in SEQ ID NO:1 or deposited clone (a.t.c.c. accession No. PTA-7540).

The invention also provides SEQ ID NO:26 (subsequence of deposited cloned nucleotide sequence, a.t.c.c. accession No. PTA-7540). Thus, the invention also provides a polypeptide selected from SEQ id nos: 26 by deletion of one or more nucleic acid residues at the amino terminus of the nucleotide sequence set forth in seq id no. SEQ ID NO:26 can be described by the general formula m-469, where m is an integer from 2 to 450, and m corresponds to the amino acid sequence shown in SEQ ID NO:26, or a position of the nucleic acid residue identified in seq id no. The invention also provides a method for producing a polypeptide from seq id NO:26 by deletion of one or more nucleic acid residues at the carboxy terminus of the nucleotide sequence set forth in seq id no. SEQ ID NO:26 can be described by the general formula 1-n, wherein n is an integer from 2 to 450, and n corresponds to the amino acid sequence shown in SEQ ID NO:26, or a position of the nucleic acid residue identified in seq id no.

In certain embodiments, the canine RNA pol I regulatory sequence of the present invention comprises or consists of an isolated nucleic acid (or a complement thereof) that hybridizes under stringent hybridization conditions to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID nos: 1-28 hybridize to and are capable of initiating transcription of a gene operably linked to the regulatory sequence in canine cells.

In one embodiment, the canine RNA pol I regulatory sequence of the present invention comprises a nucleic acid sequence that binds to a canine RNApol I polypeptide and is capable of (in one embodiment) initiating transcription of a gene operably linked to the regulatory sequence in a canine cell. In one embodiment, the nucleic acid comprises a sequence that binds to a eukaryotic pol I polypeptide and initiates (in vitro or in vivo) transcription of influenza virus vRNA. In certain embodiments, the binding of a canine RNA pol I polypeptide to a canine RNA pol I regulatory sequence can be assayed by ribozyme protection experiments. In certain embodiments, binding of the canine RNA pol I polypeptide to the canine RNA pol I regulatory sequence can be assayed by the BIACORE system (BIACORE International AG, Uppsala, Sweden) of International corporation of Uppsala, Sweden, to assess protein interactions.

In certain embodiments, the nucleic acid comprises a sequence that binds canine RNA pol I. In certain embodiments, the sequence binds canine RNA pol I with higher affinity than RNA polymerase selected from the group consisting of: primate RNA pol I, human pol I, and mouse pol I. In certain embodiments, the sequence binds with higher affinity to canine RNA pol I than to canine RNA pol II. In certain embodiments, the sequence binds with higher affinity to canine RNA pol I than to canine RNA pol III. In certain embodiments, binding to canine RNA pol I regulatory sequences can be assayed by the BIACORE system of international corporation of uppsalabacco, sweden to assess protein interactions.

In certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

ATTCCCGGTGAGGCTGCCTCTGCCGCGCGTGGCCCTCCACCTCCCCTGGCCCGAGCCGGGGTTGGGGACGGCGGTAGGCACGGGGCGGTCCTGAGGGCCGCGGGGGACGGCCTCCGCACGGTGCCTGCCTCCGGAGAACTTTGATGATTTTTCAAAGTCTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCGCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGT (SEQ ID NO: 26), which is a subsequence of the nucleotide sequence of the deposited clone of A.T.C.C. accession No. PTA-7540.

In certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACA(SEQ ID NO：2)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCGCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACA(SEQ ID NO：20)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACA(SEQ ID NO：3)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACA(SEQ ID NO：4)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACA(SEQ ID NO：5)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACA(SEQIDNO：6)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

AGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACA(SEQ ID NO：7)。，

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG(SEQ ID NO：8)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCGCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG(SEQ ID NO：21)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCC(SEQID NO：9)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCGCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCC(SEQ ID NO：22)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATC(SEQ ID NO：10)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCGCGTATC(SEQ ID NO：23)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGT(SEQ ID NO：11)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGT(SEQ ID NO：24)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：12)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TTGATGATTTTTCAAAGTCTCCTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCGCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：25)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：13)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGTCTCCACCGACCGCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：27)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：14)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQID NO：15)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：16)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：17)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GGCGTGGCGTCTCCACCGACCCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：18)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

GGCGTGGCGTCTCCACCGACCGCGTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTTGGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：28)。

in certain embodiments, the canine RNA pol I promoter comprises or consists of the nucleotide sequence:

TCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAG(SEQ ID NO：19)。

5.3 vectors and expression vectors

In another aspect, the invention provides vectors comprising the nucleic acids of the invention, including expression vectors for recombinant rescue of viruses from cell culture. The expression vector can generally be used to rescue any virus known to those skilled in the art that requires the production of RNA with defined ends during its life cycle. For example, as described above, the influenza genomic RNA should contain defined 5 'and 3' ends to allow efficient replication and packaging in recombinant systems. See also Neumann et al, (2002), 83: 2635 overview 2662. The following discussion focuses on expression vectors suitable for use with influenza (virus); it should be noted that other viruses can be rescued using the vectors of the invention.

In accordance with the present invention, in one embodiment, cDNA encoding viral genomic RNA corresponding to each of 8 influenza virus genome segments (segments may be from different influenza viruses, e.g., 6 from strain X and 2 from strain Y) can be inserted into an expression vector, thereby enabling the manipulation and production of influenza viruses. Various vectors including viral vectors, plasmids, cosmids, phages and artificial chromosomes can be used in the present invention. For ease of manipulation, the cDNA is typically inserted into a plasmid vector which provides one or more origins of replication capable of functioning in bacterial and eukaryotic cells and optionally a marker to facilitate screening or selection of cells containing the plasmid sequence. See, e.g., Neumann et al, 1999, PNAS. USA 96: 9345-9350.

In one embodiment, the vector of the invention is a bidirectional expression vector capable of initiating transcription of a viral genome segment from an inserted cDNA in either direction, that is, producing (+) and (-) strand RNA molecules. For bidirectional transcription, each viral genome segment is inserted into an expression vector containing at least two independent promoters such that a first RNA polymerase promoter (e.g., the canine RNA Pol I promoter) can transcribe viral genomic RNA copies from one strand and viral mRNA is synthesized from a second RNA polymerase promoter (e.g., the canine RNA Pol II promoter or other promoter capable of initiating transcription by RNA Pol II in canine cells). Thus, the two promoters may be arranged in opposite orientations, flanking at least one cloning site (i.e., a restriction enzyme recognition sequence), preferably a unique cloning site suitable for insertion into a viral genomic RNA segment. Alternatively, "ambisense" expression vectors can be used, in which (+) strand mRNA and (-) strand viral RNA (cRNA) are transcribed from the same strand of the vector. As described above, the pol I promoter used for transcription of viral genomic RNA is preferably a canine pol I promoter.

To ensure that each vRNA or cRNA expressed has an exact 3' end, each vRNA or cRNA expression vector may have inserted downstream of the RNA coding sequence a ribozyme sequence or a suitable terminator sequence (e.g., a human, mouse, primate, or canine RNA polymerase I termination sequence). Such a sequence may be, for example, a hepatitis delta virus genomic ribozyme sequence or a functional derivative thereof, or a murine rDNA terminator sequence (Genbank accession number M12074). Alternatively, for example, Pol I terminator sequences may be used (Neumann et al, 1994, Virology 202: 477-. RNA expression vectors can be constructed in the same manner as vRNA expression vectors described in the following references: pleschka et al, 1996, J.Virol.70: 4188-4192; hoffmann and Webster, 2000, j.gen virol.81: 2843 2847; hoffmann et al, 2002, Vaccine 20: 3165 and 3170; fodor et al, 1999, J.Virol.73: 9679-9682; neumann et al, 1999, P.N.A.S.USA 96: 9345-9350; and Hoffmann et al, 2000, Virology 267: 310-317, each of which is incorporated by reference herein in its entirety.

In other systems, the viral sequences transcribed by the pol I and pol II promoters may be transcribed from different expression vectors. In these embodiments, vectors encoding the various viral genome segments under the control of the canine regulatory sequences of the present invention, e.g., the canine pol I promoter ("vRNA expression vectors") and vectors encoding one or more viral polypeptides under the control of the pol II promoter, e.g., influenza PA, PB1, PB2 and NP polypeptides ("protein expression vectors") may be used.

For pol II promoters, the influenza virus genomic segment to be expressed is in each case operatively linked to suitable transcriptional control sequences (promoters) to direct mRNA synthesis. Various promoters are suitable for use in expression vectors to regulate transcription of influenza virus genome segments. Certain embodiments utilize the Cytomegalovirus (CMV) DNA-dependent RNA polymerase ii (pol ii) promoter. If desired, for example to regulate conditional expression, other promoters may be substituted to induce RNA transcription under specific conditions, or in specific tissues or cells. Many viral and mammalian, e.g., human, promoters are available or may be isolated depending on the particular application contemplated. For example, other promoters from animal and human viruses include promoters such as adenovirus (e.g., adenovirus 2), papilloma virus, hepatitis B virus and polyoma virus, as well as various retroviral promoters. Mammalian promoters include, but are not limited to: actin promoter, immunoglobulin promoter, heat shock promoter, and the like. In one embodiment, the regulatory sequences include the adenovirus 2 major late promoter linked to the splicing triplet leader sequence of human adenovirus 2, as described by Berg et al (Bio technologies 14: 972-. In addition, phage promoters can also be used in conjunction with cognate RNA polymerases, such as the T7 promoter.

The expression vector for expressing viral proteins, particularly viral proteins forming an RNP complex, preferably expresses viral proteins homologous to the desired virus. The viral proteins expressed by these expression vectors may be regulated by any regulatory sequence known to those skilled in the art. The regulatory sequence may be a constitutive promoter, an inducible promoter or a tissue-specific promoter. Other examples of promoters that may be used to control viral protein expression in protein expression vectors include, but are not limited to: SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290: 304-; prokaryotic expression vectors such as the beta-lactamase promoter (Villa-Kamaroff et al, 1978, Proc. Natl. Acad. Sci. USA 75: 3727-one 3731), or the tac promoter (DeBoer et al, 1983, Proc. Natl. Acad. Sci. USA 80: 21-25); see also "Useful proteins of recombinant bacterial origin", in Scientific American (science usa), 1980, 242: 74-94; plant expression vectors comprising the promoter region of nopaline synthase (Herrera-Estrella et al, Nature 303: 209-213) or the cauliflower mosaic virus 35S RNA promoter (Gardner et al, 1981, Nucl. acids Res.9: 2871), and the promoter of the photo-synthase ribulose diphosphate carboxylase (Herrera-Estrella et al, 1984, Nature 310: 115-120); yeast or other fungal promoter elements such as the Gal 4 promoter, ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerate kinase) promoter, alkaline phosphatase promoter, and the following animal transcriptional control regions, all of which exhibit tissue specificity and have been used in transgenic animals: the elastase I gene control region which is active in pancreatic acinar cells (Swift et al, 1984, Cell 38: 639-646; Omitz et al, 1986, Cold spring harbor Symp. Quant. biol. 50: 399-409; MacDonald, 1987, Hepatology 7: 425-515); an insulin gene control region active in pancreatic beta cells (Hanahan, 1985, Nature 315: 115-122), an immunoglobulin gene control region active in lymphoid cells (Grosschedl et al, 1984, Cell 38: 647-, 1987, Genes and Devel.1: 161-171), the beta-globin gene control region active in myeloid cells (Mogram et al, 1985, Nature 315: 338-340; koilias et al, 1986, Cell 46: 89-94); the myelin basic protein gene control region which is active in oligodendrocytes in the brain (Readhead et al, 1987, Cell 48: 703-712), the myosin light chain 2 gene control region which is active in skeletal muscle (Sani, 1985, Nature 314: 283-286), and the gonadotropin-releasing hormone gene control region which is active in the hypothalamus (Mason et al, 1986, Science 234: 1372-1378).

In one embodiment, the protein expression vectors of the invention comprise a promoter operably linked to a nucleic acid sequence, one or more origins of replication, and optionally one or more selectable markers (e.g., an antibiotic resistance gene). In another embodiment, the protein expression vector of the invention is capable of producing a bicistronic mRNA, and such a vector may be prepared by inserting a bicistronic mRNA sequence. Certain Internal Ribosome Entry Site (IRES) sequences can be utilized. Preferred IRES elements include, but are not limited to, mammalian BiP IRES and hepatitis c virus IRES.

In one embodiment, the nucleic acid of the invention can be inserted into plasmid pAD3000 or a derivative thereof. See U.S. patent application publication 20050266026 and fig. 10. Thus, in certain embodiments, the expression vector is a bidirectional expression vector. In certain embodiments, the expression vector comprises an SV40 polyadenylation signal flanked by influenza virus genome segments within two promoters. In certain embodiments, the expression vector comprises a Cytomegalovirus (CMV) DNA-dependent RNA Pol II promoter. In one embodiment, the nucleic acid of the invention can be inserted into plasmid pAD4000 or a derivative thereof. In one embodiment, the nucleic acid of the invention comprises SEQ ID NO:29 or consists of the sequence of pad4000.

Vectors containing inserted genes can be identified by, for example, three general methods: (a) nucleic acid hybridization; (b) the presence or absence of "marker" gene function; and, in the case of an expression vector, (c) expression of the insertion sequence. In the first method, the presence or absence of an inserted viral gene in a vector can be detected by nucleic acid hybridization using a probe containing a sequence homologous to the inserted gene. In the second approach, recombinant vector/host systems can be identified and selected based on the presence or absence of certain "marker" gene functions (e.g., antibiotic resistance and transformation phenotype) resulting from the insertion of the gene into the vector. In a third approach, expression vectors can be identified by examining the expressed gene product. Such assays may be performed, for example, based on the physical or functional properties of the viral protein in an in vitro assay system, such as binding of the viral protein to an antibody.

In one embodiment, the one or more protein expression vectors encode and express viral proteins necessary for RNP complex formation. In another embodiment, one or more protein expression vectors encode and express viral proteins necessary for the formation of viral particles. In another embodiment, the one or more protein expression vectors encode and express all viral proteins of a particular negative-strand RNA virus.

Transcription of the expression vector may optionally be enhanced by the inclusion of enhancer sequences. Enhancers are usually shorter, e.g., 10-500bp, and are able to coordinate with promotersThe molecules act synergistically to enhance the transcription of cis-acting DNA elements. Many enhancer sequences have been isolated from mammalian genes (hemoglobin, elastase, albumin, alpha-fetoprotein, and insulin) and eukaryotic viruses. Enhancers may be spliced into the vector at a position 5 ' or 3 ' to the heterologous coding sequence, but are typically inserted at a site 5 ' to the promoter. Promoters and, if desired, other transcription enhancing sequences are typically selected to optimize the expression of the introduced heterologous DNA in the host cell type (Scharf et al (1994), "Heat stress promoters and transcription factors"Results Probl Cell Differ20: 125-62; kriegler et al (1990), Assembly of enhancers, promolers, and splice signals to control transformed genes (Assembly of enhancers, promoters and splicing signals to control expression of the transferred gene)Methods in Enzymol185: 512-27). The amplicon may also optionally contain a ribosome binding site or Internal Ribosome Entry Site (IRES) for initiating translation.

The expression vectors of the invention may also comprise sequences for transcription termination and stabilization of mRNA, such as polyadenylation sites or termination sequences (e.g., human, mouse, primate, or canine RNA polymerase I termination sequences). Such sequences are usually present in the 5 'and (occasionally) 3' untranslated regions of eukaryotic or viral DNA or cDNA. In certain embodiments, the SV40 polyadenylation sequence provides a polyadenylation signal.

In addition, as noted above, the vector may also contain one or more selectable marker genes to select for phenotypic characteristics of the transformed host cell, and in addition to the genes described above, markers such as dihydrofolate reductase or neomycin resistance are also suitable for selection in eukaryotic cell cultures.

Host cells which permit expression of the protein may be transformed with an expression vector comprising the appropriate DNA sequences described above, as well as appropriate promoter or control sequences. Although the expression vector of the present invention can replicate in bacterial cells, it is most often preferred to introduce it into mammalian cells, such as Vero cells, BHK cells, MDCK cells, 293 cells, COS cells, more preferably MDCK cells, for expression.

The expression vectors of the invention can be used to direct the expression of genomic vrnas or corresponding crnas comprising one or more mutations (e.g., removal or inactivation of a multiple base cleavage site in the HA gene of a particular influenza pandemic strain, such as H5N 1). These mutations can lead to attenuation of the disease virus. For example, the vRNA segment can be a vRNA segment of influenza a virus containing attenuated base pair substitutions in the panhandle-like double stranded promoter region, particularly known attenuated base pair substitutions, such as a-substituted C and U-substituted G at positions 11-12' in the double stranded region of the NA-specific vRNA (Fodor et al, 1998, j.virol.6923-6290). By generating recombinant negative-strand RNA viruses using the methods of the invention, novel attenuating mutations can be identified.

In addition, any of the expression vectors described in U.S. Pat. nos. 6,951,754, 6,887,699, 6,649,372, 6,544,785, 6,001,634, 5,854,037, 5,824,536, 5,840,520, 5,820,871, 5,786,199, and 5,166,057 and U.S. patent application publication nos. 20060019350, 20050158342, 20050037487, 20050266026, 20050186563, 20050221489, 20050032043, 20040142003, 20030035814, and 20020164770 may be used in the present invention. The vectors described in these publications can be engineered to be suitable for use in the present invention by introducing a nucleic acid of the invention described herein (e.g., a canine regulatory sequence of the invention such as a canine pol I promoter sequence) into an expression vector to direct viral vRNA or cRNA synthesis.

5.3.1 Other expression elements

Most often, the genomic segment encoding the influenza virus protein comprises any other sequences required for its expression, including translation into a functional viral protein. In other cases, a minigene or other artificial construct encoding a viral protein, such as an HA or NA protein, may be used. In such cases, it is generally preferred to include specific initiation signals that facilitate efficient translation of the heterologous coding sequence. These signals include, for example, the ATG initiation codon and its adjacent sequences. To ensure translation of the complete insert, the start codon is inserted in the correct reading frame relative to the viral proteins. Exogenous transcription elements and initiation codons can be of various origins, both natural and synthetic. Expression efficiency can be increased by inserting appropriate enhancers into the cell system used.

If desired, polynucleotide sequences encoding other expression elements, such as signal sequences, secretion or localization sequences, and the like, which are generally in-frame with the gene of interest, e.g., to target polypeptide expression to a desired cell compartment, membrane or organelle, or into the cell culture medium, can be incorporated into the vector. Such sequences are known to the skilled person and include secretory leader peptides, organelle targeting sequences (e.g., nuclear localization sequences, ER retention signals (ER retention signals), mitochondrial transport sequences), membrane localization/anchoring sequences (e.g., stop transport sequences, GPI anchoring sequences), etc.

5.4 Expression vector for producing chimeric virus

Chimeric viruses that express heterologous sequences of the viral genome can also be prepared using the expression vectors of the invention. Expression vectors which direct the expression of vRNA or corresponding cRNA are introduced into host cells along with expression vectors which direct the expression of viral proteins to produce novel infectious recombinant negative-strand RNA viruses or chimeric viruses. See, for example, U.S. patent application publication No. US 20040002061. Heterologous sequences that can be engineered into these viruses include antisense nucleic acids and nucleic acids, such as ribozymes. Alternatively, heterologous sequences expressing peptides or polypeptides may be engineered into these viruses. Heterologous sequences encoding the following peptides or polypeptides may be engineered into these viruses: 1) an antigen characteristic of a pathogen; 2) antigens characteristic of autoimmune diseases; 3) an antigen characteristic of an allergen; and 4) antigens characteristic of tumors. For example, heterologous gene sequences that can be engineered to be inserted into the chimeric viruses of the invention include, but are not limited to: epitopes of Human Immunodeficiency Virus (HIV) such as gp 160; hepatitis b virus surface antigen (HbsAg); glycoproteins of herpes virus (e.g., gD, gE); VP1 of poliovirus; and antigenic determinants of non-viral pathogens such as bacteria and parasites (by way of example only).

Antigens characteristic of autoimmune diseases are typically derived from the cell surface, cytoplasm, nucleus, mitochondria, etc. of mammalian tissues, including antigens characteristic of diabetes, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, pernicious anemia, addison's disease, scleroderma, autoimmune atrophic gastritis, juvenile diabetes, and discoid lupus erythematosus.

Antigens that are allergens are typically proteins or glycoproteins, including antigens derived from pollen, dust, mold, spores, dander, insects, and food.

Antigens characteristic of tumor antigens are typically derived from the cell surface, cytoplasm, nucleus, organelles, etc. of the tumor tissue cells. Examples include antigens characteristic of tumor proteins, including proteins encoded by mutated oncogenes; tumor-associated viral proteins; and a glycoprotein. Tumors include, but are not limited to, those derived from the following cancer types: lip cancer, nasopharyngeal cancer, pharyngeal and oral cancer, esophageal cancer, gastric cancer, colon cancer, rectal cancer, liver cancer, gallbladder cancer, pancreatic cancer, laryngeal cancer, lung and bronchial cancer, cutaneous melanoma, breast cancer, cervical cancer, uterine cancer, ovarian cancer, bladder cancer, kidney cancer, uterine cancer, cancer of the brain and other parts of the nervous system, thyroid cancer, prostate cancer, testicular cancer, hodgkin's disease, non-hodgkin's lymphoma, multiple myeloma, and leukemia.

In a particular embodiment of the invention, the heterologous sequence is derived from the genome of a Human Immunodeficiency Virus (HIV), preferably human immunodeficiency virus-1 or human immunodeficiency virus-2. In another embodiment of the invention, a heterologous coding sequence can be inserted into the negative strand RNA viral gene coding sequence, thereby allowing expression of a chimeric gene product comprising a heterologous peptide sequence within the viral protein. In this embodiment of the invention, the heterologous sequence may also be derived from the genome of a human immunodeficiency virus, preferably human immunodeficiency virus-1 or human immunodeficiency virus-2.

In the case where the heterologous sequence is derived from HIV, such sequences include, but are not limited to: sequences derived from the env gene (i.e., sequences encoding all or a portion of gp160, gp120 and/or gp 41), the pol gene (i.e., sequences encoding all or a portion of reverse transcriptase, endonuclease, protease and/or integrase), the gag gene (i.e., sequences encoding all or a portion of p7, p6, p55, p17/18, p 24/25), tat, rev, nef, vif, vpu, vpr and/or vpx.

One method of constructing these hybrid molecules is to insert a heterologous coding sequence into the complementary DNA of a minus-strand RNA viral gene such that the heterologous sequence flanks viral sequences required for viral polymerase activity, e.g., the canine RNA pol I promoter and polyadenylation site. In another approach, an oligonucleotide encoding the canine rnatol I promoter (e.g., a complement (complement) at the 3' end or both ends of a segment of the viral genome) can be ligated to a heterologous coding sequence to construct a hybrid molecule. Previously, the placement of a foreign gene or a segment of a foreign gene within a target sequence was limited by the presence of an appropriate restriction enzyme site within the target sequence. Recent advances in molecular biology have greatly alleviated this problem. Restriction sites are readily placed at any position in the target sequence by site-directed mutagenesis (see, e.g., the techniques described by Kunkel, 1985, Proc. Natl. Acad. Sci. U.S.A.82: 488). Improved versions of the Polymerase Chain Reaction (PCR) techniques described also allow for specific insertion of sequences (i.e., restriction sites) and ease of construction of hybrid molecules. Alternatively, PCR reactions can be used to prepare recombinant templates without cloning. For example, a PCR reaction can be used to prepare a double-stranded DNA molecule comprising a promoter for a DNA-directed RNA polymerase (e.g., bacteriophage enzyme (bacteriophase) T3, T7, or SP6) and a hybridization sequence comprising a heterologous gene and the canine RNA pol I promoter. The RNA template can then be transcribed directly from the recombinant DNA. In another embodiment, recombinant vRNA or corresponding cRNA can be prepared by linking RNA of negative polarity of the indicated heterologous gene to the canine RNA pol I promoter using RNA ligase.

Bicistronic mRNA can be constructed to internally initiate translation of viral sequences and to express foreign protein coding sequences from regular terminal start sites. Alternatively, a bicistronic mRNA sequence can be constructed in which the viral sequence is translated from a regular terminal open reading frame, while (translation of) the foreign sequence is initiated from an internal site. Certain Internal Ribosome Entry Site (IRES) sequences can be utilized. The IRES sequence selected should be short enough so as not to interfere with viral packaging limitations. Therefore, the IRES length selected for this bicistronic method is preferably no more than 500 nucleotides, more preferably less than 250 nucleotides. Furthermore, the IRES used preferably has no sequence or structural homology with the picornaviral element. Preferred IRES elements include, but are not limited to: mammalian BiP FRES and hepatitis C Virus IRES.

Alternatively, the foreign protein may be expressed from an internal transcription unit, wherein the transcription unit contains an initiation site and a polyadenylation site. In another embodiment, the foreign gene is inserted into a minus-strand RNA viral gene, and the resulting expressed protein is a fusion protein.

5.5 Method for producing recombinant viruses

The present invention provides methods for introducing a protein expression vector of the invention and an expression vector expressing a vRNA or corresponding cRNA into a host cell in the absence of helper virus to produce an infectious recombinant negative-strand RNA virus. The host cell is preferably a canine cell, such as an MDCK cell. The invention also provides methods for introducing a protein expression vector of the invention and an expression vector for expressing a vRNA or corresponding cRNA into a host cell in the presence of a helper virus to produce an infectious recombinant negative-strand RNA virus. The host cell may be, for example, a canine cell (e.g., MDCK cell), Vero cell, per.c6 cell, BHK cell, PCK cell, MDCK cell, MDBK cell, 293 cell (e.g., 293T cell), and COS cell.

The protein expression vector and the expression vector that directs the expression of the vRNA or corresponding cRNA can be introduced into the host cell using any technique known to those skilled in the art, but is not limited to these techniques. For example, the expression vectors of the invention can be introduced into host cells using electroporation, DEAE-dextran, calcium phosphate precipitation, liposomes, microinjection, and particle bombardment (see, e.g., Sambrook et al, molecular cloning: A Laboratory Manual, second edition, 1989, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.). The expression vectors of the invention may be introduced into the host cell simultaneously or sequentially.

In one embodiment, one or more expression vectors that direct the expression of vRNA or corresponding cRNA are introduced into the host cell prior to introduction of the expression vector that directs the expression of viral proteins. In another embodiment, one or more expression vectors that direct the expression of viral proteins are introduced into the host cell prior to introducing one or more expression vectors that direct the expression of vRNA or corresponding cRNA. According to these embodiments, the expression vectors directing the expression of the vRNA or the corresponding cRNA may be introduced together or separately in different transfections. Furthermore, according to these embodiments, the expression vectors directing the expression of the viral proteins may be introduced together or separately in different transfections.

In another embodiment, one or more expression vectors that direct the expression of vRNA or corresponding cRNA may be introduced into the host cell simultaneously with one or more expression vectors that direct the expression of viral proteins. In certain embodiments, liposomes can be used to introduce all expression vectors into a host cell.

One embodiment provides a method of producing a recombinant influenza virus comprising introducing into a population of canine cells an expression vector capable of expressing a genomic vRNA segment in said cells, thereby providing a complete genomic vRNA segment of said virus, wherein said expression vector comprises the nucleotide sequence set forth in SEQ ID NO:26, nucleotides 1-469, or a functionally active fragment thereof; (b) introducing an expression vector into said cell, said expression vector being capable of expressing mRNA encoding one or more polypeptides of interest of said virus; and (c) culturing the cell, thereby producing an influenza virion. In one embodiment, the titer of influenza virus particles produced by culturing the cells for 48-72 hours is at least 1.0 x 10⁴PFU/ml or at least 1.0 x 10⁵PFU/ml。

One embodiment provides a method of producing a recombinant influenza virus, the method comprising introducing an expression vector into a population of canine cellsAn expression vector capable of expressing a genomic vRNA segment in said cell, thereby providing a complete genomic vRNA segment of said virus, wherein said expression vector comprises SEQ ID NO:26, nucleotides 1-469, or a functionally active fragment thereof; (b) introducing an expression vector into said cell, said expression vector capable of expressing mRNA encoding one or more polypeptides of said virus; and (c) culturing the cell, thereby producing an influenza virion. In one embodiment, the titer of influenza virus particles produced by culturing the cells for 48-72 hours is at least 1.0 x 10⁴PFU/ml or at least 1.0 x 10⁵PFU/ml。

Routine experimentation can determine the appropriate number and proportion of expression vectors to use in carrying out the methods of the invention. As a guide, in the case of using liposome transfection or calcium phosphate precipitation to introduce plasmids into host cells, it is estimated that it is preferable to use several micrograms, e.g., 1-10. mu.g, of each plasmid, e.g., diluted to a final total DNA concentration of about 0.1. mu.g/ml, and then mixed with transfection agent in a conventional manner. The concentration of vectors expressing the NP and/or RNA dependent RNA polymerase subunits is preferably higher than those expressing vRNA segments. One skilled in the art will appreciate that the number and ratio of expression vectors may vary depending on the host cell.

In one embodiment, at least 0.5. mu.g, preferably at least 1. mu.g, at least 2.5. mu.g, at least 5. mu.g, at least 8. mu.g, at least 10. mu.g, at least 15. mu.g, at least 20. mu.g, at least 25. mu.g or at least 50. mu.g of one or more protein expression vectors of the invention are introduced into a host cell to produce an infectious recombinant negative-strand RNA virus. In another embodiment, at least 0.5 μ g, preferably at least 1 μ g, at least 2.5 μ g, at least 5 μ g, at least 8 μ g, at least 10 μ g, at least 15 μ g, at least 20 μ g, at least 25 μ g, or at least 50 μ g of one or more expression vectors of the invention that direct the expression of vRNA or cRNA are introduced into a host cell to produce an infectious recombinant negative-strand RNA virus.

Host cells useful for producing minus-strand RNA viruses of the invention include primary cells, cultured or secondary cells, and transformed or immortalized cells (e.g., 293 cells, 293T cells, CHO cells, Vero cells, PK, MDBK, OMK, and MDCK cells). The host cell is preferably an animal cell, more preferably a mammalian cell, most preferably a canine cell. In a preferred embodiment, the infectious recombinant negative-strand RNA virus of the invention is produced in MDCK cells.

The present invention provides methods for producing infectious, recombinant negative-strand RNA viruses in stably transduced host cell lines. Stably transduced host cell lines of the invention can be generated by introducing into a host cell a cDNA and a selectable marker controlled by appropriate expression control elements (e.g., promoter, enhancer sequences, transcription termination sequences, polyadenylation sites, etc.). After introduction of the foreign DNA, the transduced cells can be grown in enrichment medium for 1-2 days and then transferred to selection medium. The selectable marker confers tolerance on the cell, thereby enabling the cell to stably integrate the DNA into its chromosome. Transduced host cells stably incorporating the DNA can be cloned and expanded into cell lines.

Many selection systems are available, including but not limited to: herpes simplex virus thymidine kinase (Wigler et al, 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyl transferase (Szybalska and Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48: 2026) and adenine ribosyltransferase (Lowy et al, 1980, Cell 22: 817) genes, which can be used in tk-, hgprt-or aprt-cells, respectively. Antimetabolite tolerance can also be used as a basis for selecting the following genes: dhfr gene, resulting in resistance to methotrexate (Wigler et al, 1980, Natl.Acad.Sci.USA 77: 3567; O' Hare et al, 1981, Proc.Natl.Acad.Sci.USA 78: 1527); the gpt gene, conferring tolerance to mycophenolic acid (Mullgan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072); neo gene, conferring tolerance to the aminoglycoside G-418 (Colberre-Garapin et al, 1981, J.mol.biol.150: 1); and the hygro Gene, which confers tolerance to hygromycin (Santerre et al, 1984, Gene 30: 147).

Non-attenuated, infectious, recombinant negative-strand RNA viruses produced by the methods of the invention can be attenuated or inactivated by, for example, classical methods. For example, the recombinant minus-strand RNA virus of the present invention can be inactivated by heat treatment or formalin treatment, thereby rendering the virus incapable of replication. The non-attenuated, recombinant negative-strand RNA viruses of the present invention can be attenuated, for example, by passage in a non-natural host to produce progeny viruses that are immunogenic and non-pathogenic.

The attenuated live or killed viruses produced by the present invention may then be incorporated into vaccine compositions in a conventional manner, or used to produce additional viruses, for example, in eggs. If such a virus contains a chimeric vRNA segment encoding a foreign antigen as described above, it can be formulated to achieve immunization against multiple pathogens simultaneously. Attenuated recombinant viruses produced by the present invention that contain chimeric vRNA segments can also be designed for other therapeutic uses, such as anti-tumor drugs or gene therapy tools, in which case the virus can be produced and incorporated into a suitable pharmaceutical composition along with a pharmaceutically acceptable carrier or diluent.

Helper-free virus rescue of the present invention is particularly advantageous for the production of reassortant strains of virus, especially reassortant influenza virus required for vaccines, since the helper virus culture need not be removed by selection methods.

The methods of the invention can be modified to incorporate aspects of methods well known to those skilled in the art to increase the efficiency of rescue of infectious viral particles. For example, reverse genetics techniques include the preparation of synthetic recombinant viral RNAs containing non-coding regions of negative-strand viral RNAs that are necessary for the viral polymerase to recognize and generate the packaging signals required for the mature virion. Recombinant RNA can be synthesized from recombinant DNA templates and reconstituted in vitro with purified viral polymerase complexes to form recombinant Ribonucleoproteins (RNPs) that can be used to transfect cells. More efficient transfection can be achieved if viral polymerase proteins are present during in vitro or in vivo transcription of synthetic RNA. The synthesized recombinant RNPs can be rescued into infectious viral particles. The following documents describe the prior art: U.S. patent No.5,166,057 issued 11/24/1992; U.S. patent No.5,854,037 issued at 29/12/1998; U.S. patent No.5,789,229 issued at 8/4 of 1998; european patent publication EP 0702085a1, published on day 2/20 of 1996; U.S. patent application serial No. 09/152,845; international patent publication No. PCR WO 97/12032 published 3/4/1997; WO 96/34625 published 11/7/1996; european patent publication EP-A780475; WO 99/02657 published 21/1/1999; WO 98/53078 published on 26/11/1998; WO 98/02530 published on 22/1/1998; WO 99/15672 published on 1.4.1999; WO 98/13501 published on 4/2/1998; WO 97/06720 published on 20/2/1997; and EPO 78047 SA1 published 25/6/1997, each of which is incorporated by reference herein in its entirety.

5.5.1 Embodiments of segmented negative-strand RNA viruses

The present invention provides methods for producing infectious recombinant viral particles of segmented negative-strand RNA viruses having more than 3 genomic vRNA segments in cultured cells, including, for example, influenza viruses such as influenza a viruses, comprising: (a) introducing a first set of expression vectors into a population of cells, said expression vectors capable of expressing genomic vRNA segments within said cells to provide intact genomic vRNA segments of said virus, and said cells capable of supporting growth of said virus; (b) introducing into said cells a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of said virus; and (c) culturing the cell thereby producing the viral particle. In certain embodiments, the cell is a canine cell. In certain embodiments, the cell is a MDCK cell. In certain embodiments, the recombinant virus is an influenza a or b virus. In certain embodiments, the first set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the first set of expression vectors is contained within 1 plasmid. In certain embodiments, the second set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the second set of expression vectors is comprised within 1 plasmid. In certain embodiments, the first, second, or both sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encodes each vRNA segment of an influenza virus. In certain embodiments, the second set of expression vectors encodes mRNA of one or more or all influenza polypeptides. In certain embodiments, the first or second set of expression vectors (or both sets) comprise a nucleic acid of the invention, e.g., a canine RNA pol I regulatory sequence of the invention (e.g., a canine RNA pol I promoter). In certain embodiments, the first or second set of expression vectors (or both sets) encode vRNA or mRNA of a second virus. For example, one set of vectors comprises one or more vectors encoding HA and/or NA mRNA and/or vRNA of a second influenza virus. In one embodiment, the method utilizes a helper virus. In one embodiment, the cultured cells used in the method are canine cells.

The present invention provides a method of producing infectious recombinant viral particles of a segmented negative-strand RNA virus, including for example influenza virus such as influenza a virus, having more than 3 genomic vRNA segments in cultured cells, comprising: (a) introducing into a population of cells a set of expression vectors capable of expressing genomic vRNA segments within said cells to provide for expression of mRNA encoding one or more polypeptides of said virus as well as whole genomic vRNA segments of said virus, said cells capable of supporting growth of said virus; (b) culturing the cell to produce the viral particle. In certain embodiments, the cell is a canine cell. In certain embodiments, the cell is a MDCK cell. In certain embodiments, the virus is an influenza a or b virus. In certain embodiments, the set of expression vectors is comprised within 1-17 plasmids. In certain embodiments, the set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the set of expression vectors is comprised within 1-3 plasmids. In certain embodiments, the set of expression vectors is contained within 1 plasmid. In certain embodiments, the set of expression vectors is introduced by electroporation. In certain embodiments, the set of expression vectors encodes each vRNA segment of an influenza virus. In certain embodiments, the set of expression vectors encodes mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors encodes each vRNA segment of an influenza virus and mRNA of one or more influenza virus polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, e.g., a canine RNA pol I regulatory sequence of the invention (e.g., a canine RNA pol I promoter). In certain embodiments, the set of expression vectors encodes vRNA or mRNA of a second virus. For example, the set of vectors comprises one or more vectors encoding HA and/or NA mRNA and/or vRNA of the second influenza virus. In certain embodiments, the first or second set (or both) of expression vectors encodes vRNA or mRNA of a second virus. For example, one set of vectors comprises one or more vectors encoding HA and/or NA mRNA and/or vRNA of a second influenza virus. In one embodiment, the method utilizes a helper virus. In one embodiment, the cultured cells used in the method are canine cells.

The present invention provides a method for producing infectious recombinant viral particles of a negative-strand RNA virus in cultured cells, said method comprising: (a) introducing a first set of expression vectors into a population of cells, said expression vectors capable of expressing genomic vRNA segments in said cells to provide complete genomic vRNA segments of said virus, said cells capable of supporting growth of said virus; (b) introducing into said cells a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of said virus; and (c) culturing the cell thereby producing the viral particle. In certain embodiments, the cell is a canine cell. In certain embodiments, the cell is a MDCK cell. In certain embodiments, the virus is an influenza b virus. In certain embodiments, the first set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the first set of expression vectors is contained within 1 plasmid. In certain embodiments, the second set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the second set of expression vectors is comprised within 1 plasmid. In certain embodiments, the first, second, or both sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encodes each vRNA segment of an influenza virus. In certain embodiments, the second set of expression vectors encodes mRNA of one or more influenza polypeptide. In certain embodiments, the first or second set of expression vectors (or both sets) comprise a nucleic acid of the invention, e.g., a canine RNA pol I regulatory sequence of the invention (e.g., a canine RNA pol I promoter). In one embodiment, the method utilizes a helper virus. In one embodiment, the cultured cells used in the method are canine cells.

The present invention provides a method for producing infectious recombinant viral particles of a negative-strand RNA virus in cultured cells, said method comprising: (a) introducing into a population of cells a set of expression vectors capable of expressing genomic vRNA segments within said cells to provide for expression of mRNA encoding one or more polypeptides of said virus as well as whole genomic vRNA segments of said virus, said cells capable of supporting growth of said virus; (b) culturing the cell to produce the viral particle. In certain embodiments, the cell is a canine cell. In certain embodiments, the cell is a MDCK cell. In certain embodiments, the virus is an influenza b virus. In certain embodiments, the set of expression vectors is comprised within 1-17 plasmids. In certain embodiments, the set of expression vectors is comprised within 1-8 plasmids. In certain embodiments, the set of expression vectors is comprised within 1-3 plasmids. In certain embodiments, the set of expression vectors is introduced by electroporation. In certain embodiments, the set of expression vectors encodes each vRNA segment of an influenza virus. In certain embodiments, the set of expression vectors encodes mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors encodes each vRNA segment of an influenza virus and mRNA of one or more influenza virus polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, e.g., a canine RNA pol I regulatory sequence of the invention (e.g., a canine RNA pol I promoter). In certain embodiments, the set of expression vectors encodes vRNA or mRNA of a second virus. For example, the set of vectors comprises one or more vectors encoding HA and/or NA mRNA and/or vRNA of the second influenza virus. In one embodiment, the method utilizes a helper virus. In one embodiment, the cultured cells used in the method are canine cells.

The present invention provides methods for producing infectious viral particles of segmented negative-strand RNA viruses having more than 3 genomic vRNA segments in cultured canine cells, including, for example, influenza viruses such as influenza a viruses, comprising: (a) providing a first population of canine cells capable of supporting the growth of said virus and incorporating a first set of expression vectors capable of directing expression of a genomic vRNA segment in said canine cells in the absence of a helper virus to provide a complete genomic vRNA segment of said virus or a corresponding cRNA, thereby providing any such RNA segment, said canine cells being further capable of providing a nucleoprotein and an RNA-dependent RNA polymerase, thereby allowing formation of an RNP complex comprising a genomic vRNA segment of said virus and assembly of said viral particles within said canine cells; and (b) culturing the canine cell thereby producing the viral particle. In certain embodiments, the canine cell is an MDCK cell.

The present invention also provides a method for producing infectious viral particles of a segmented negative-strand RNA virus in cultured canine cells, said method comprising: (i) providing a first population of canine cells capable of supporting growth of said virus and modified to (a) provide genomic vRNA of said virus in the absence of helper virus and (b) provide a nucleoprotein and RNA-dependent RNA polymerase such that an RNA complex comprising said genomic vRNA is formed and said viral particles are assembled, said genomic vRNA being directly expressible within said cells under the control of canine RNA pol I regulatory sequences or functional derivatives thereof; and (ii) culturing the canine cell thereby producing the viral particle.

The present invention also provides a method for producing infectious viral particles of a segmented negative-strand RNA virus in cultured cells, the method comprising: (i) providing a population of canine cells capable of supporting growth of said virus and modified to (a) provide genomic vRNA of said virus in the absence of helper virus and (b) provide nucleoprotein and RNA-dependent RNA polymerase such that RNP complexes comprising said genomic vRNA are formed and said viral particles are assembled, said genomic vRNA being expressible in said canine cells under the control of a canine RNA Pol I regulatory sequence or a functional derivative thereof, such as the canine RNA Pol I promoter described above; and (ii) culturing the canine cell thereby producing the viral particle.

In a specific embodiment, an infectious, recombinant negative-strand RNA virus having at least 4, at least 5, at least 6, at least 7, or at least 8 genomic vRNA segments can be produced in a canine host cell using the methods described herein.

In a specific embodiment, the invention provides methods for producing infectious recombinant influenza viruses in host cells using expression vectors to express vRNA segments or corresponding crnas and influenza virus proteins, particularly PB1, PB2, PA and NA. According to this embodiment, infectious recombinant influenza viruses may be produced with or without the use of helper viruses.

The infectious recombinant influenza viruses of the invention may or may not replicate and produce progeny. The infectious recombinant influenza viruses of the invention are preferably attenuated. The attenuated infectious recombinant influenza virus may, for example, have a mutation in the NS1 gene.

In certain embodiments, the infectious recombinant viruses of the present invention can be used to produce other viruses that can be used to prepare the vaccine compositions of the present invention. In one embodiment, the recombinant or reassortant viruses produced by the methods of the invention are used to produce other viruses for use as vaccines. For example, a population of recombinant or reassortant viruses produced by the methods of the invention that comprise a canine RNA pol I regulatory sequence of the invention (e.g., a canine RNA pol I promoter). The virus population is then propagated in eggs or other cultures to produce additional viruses for use in preparing vaccines or immunogenic compositions.

In certain embodiments, the infectious recombinant influenza viruses of the invention express heterologous (i.e., non-influenza virus) sequences. In another embodiment, the infectious recombinant influenza viruses of the invention express influenza virus proteins of different influenza virus strains. In another preferred embodiment, the infectious recombinant influenza virus of the invention expresses a fusion protein.

5.5.2 Introduction of vectors into host cells

Vectors comprising influenza virus genome segments can be introduced (e.g., transfected) into host cells to introduce heterologous nucleic acids into eukaryotic cells according to methods well known in the art (see, e.g., U.S. patent application publication nos. US20050266026 and 20050158342), including, for example, calcium phosphate co-precipitation, electroporation, microinjection, lipofection, and transfection using polyamine transfection reagents. For example, a vector, such as a plasmid, can be transfected into a host cell, such as an MDCK cell, a COS cell, a 293T cell, or a combination thereof, using the polyamine transfection reagent TransIT-LT1(Mirus) according to the manufacturer's instructions. About 1. mu.g of each vector to be introduced into the host cell population is mixed with about 2. mu.l of TransIT-LT1 diluted with 160. mu.l of medium (preferably serum-free medium) in a total volume of 200. mu.l. DNA: the transfection reagent mixture was incubated at room temperature for 45 minutes and then 800. mu.l of medium was added. The transfection mixture is then added to the host cells and the cells are cultured as described above. Thus, to produce recombinant or reassortant viruses in cell culture, a vector containing each of the 8 genomic segments (PB2, PB1, PA, NP, M, NS, HA and NA) was mixed with about 20. mu.l TransIT-LT1 and transfected into host cells. Optionally, the serum-containing medium is replaced with serum-free medium, such as Opti-MEM I, prior to transfection, and incubated for 4-6 hours.

Alternatively, electroporation can be used to introduce a vector comprising an influenza virus genome segment into a host cell. See, for example, U.S. patent application publications US20050266026 and 20050158342, incorporated herein by reference. For example, electroporation can be used to introduce plasmid vectors containing influenza a or b viruses into MDCK cells according to the following protocol. Briefly, for example, 5 × 10 cells grown in Modified Eagle Medium (MEM) supplemented with 10% Fetal Bovine Serum (FBS)⁶MDCK cells were suspended in 0.3ml OptiMEM and placed in electroporation vessels. A volume of up to 25. mu.l of 20. mu.g DNA was added to the cells in the electroporation vessel and gently mixed by tapping. Electroporation was performed according to the manufacturer's instructions (e.g., Burley Gene pulser II (BioRad Gene pulser II) with Capacitance Extender Plus attached) with parameters of 300 volts, 950 microfarads, and time constants between 35-45 milliseconds. The cells were mixed again by gentle tapping and 0.7ml of OPTI-MEM was added directly to the electroporation vessel about 1-2 minutes after electroporation. The cells were then transferred to two wells of a standard 6-well tissue culture plate containing 2ml of serum-free OPTI-MEM. The vessel was washed to recover any remaining cells and the wash suspension was dispensed in two wells. The final volume was about 3.5 ml. The cells are then incubated under conditions that allow virus growth, e.g., a cold adapted virus strain is incubated at about 33 ℃.

Further guidance for introducing vectors into host cells can be found, for example, in U.S. Pat. nos. 6,951,754, 6,887,699, 6,649,372, 6,544,785, 6,001,634, 5,854,037, 5,824,536, 5,840,520, 5,820,871, 5,786,199, and 5,166,057 and U.S. patent application publication nos. 20060019350, 20050158342, 20050037487, 20050266026, 20050186563, 20050221489, 20050032043, 20040142003, 20030035814, and 20020164770.

5.6 Cell culture

The virus can generally be propagated in a medium composition in which the host cells are routinely cultured. Suitable host cells for influenza virus replication include, for example, Vero cells, per.c6 cells, BHK cells, MDCK cells, 293 cells, and COS cells, including 293T cells, COS7 cells. MDCK cells are preferred in the present invention. The use of non-tumorigenic MDCK cells as host cells is also an embodiment of the invention. Co-cultures comprising two of the above cell lines, e.g. MDCK cells and 293T cells or COS cells, may also be used, e.g. in a ratio of 1:1, to increase the efficiency of replication. See, for example, 20050158342. The cells are usually cultured in a standard commercial medium, such as Dulbecco's modified Eagle's medium supplemented with serum (e.g., 10% fetal bovine serum), or in serum-free medium under conditions suitable for maintenanceControlled humidity and CO at neutral buffered pH (e.g., pH between 7.0 and 7.2)₂And (4) concentration. The culture medium may optionally comprise antibiotics to prevent bacterial growth, such as penicillin, streptomycin, etc., and/or other nutrients, such as L-glutamine, sodium pyruvate, non-essential amino acids, other additives to promote favorable growth characteristics, such as trypsin, beta-mercaptoethanol, etc.

Methods for maintaining mammalian cells in culture have been widely reported and are well known to those skilled in the art. General methods are provided in, for example, Freshney (1983)Culture of Animal Cells：Manual of Basic Technique(culture of animal cells: basic technical Manual), Allians, New York (Alan R.Liss, New York); paul (1975)Cell and Tissue Culture(cell and tissue culture), 5 th edition, Edinburgh Riwenston corporation (Livingston, Edinburgh); adams, (1980),Laboratory Techniques in Biochemistry and Molecular Biology-Cell Culture for Biochemists(Experimental techniques in biochemistry and molecular biology-cell culture used by biochemists), Work and Burdon eds, Elsevier, Amsterdam. Other details of tissue culture methods of particular interest in the in vitro Production of influenza viruses include, for example, Merten et al, (1996), Production of influenza virus cell cultures for vaccine Production in cell culture, published in Cohen and Shafferman,Novel Strategies in Design and Production of Vaccines(novel strategies for designing and preparing vaccines), which is incorporated herein in its entirety. In addition, modifications suitable for the methods of the invention can be readily determined by routine experimentation.

The cells for producing influenza virus can be cultured in a serum-containing or serum-free medium. In some cases, for example for the preparation of purified viruses, it is preferred to culture the host cells under serum-free conditions. Cells can be cultured in small scale, e.g., less than 25ml of culture medium, culture tubes or flasks, or on shaken large flasks, spinner flasks or microcarrier beads in flask, flask or reactor cultures (e.g., DEAE-dextran microcarrier beads, such as the Dormacell of PL corporation (Pfeifer & Langen); Superbed of Flow Laboratories; styrene copolymer-tris-methylamine beads, such as Hillex, SoloHill, Ann Arbor). Microcarrier beads are small spheres (between 100 and 200 microns in diameter) that provide a large surface area per unit volume of cell culture fluid for adherent cell growth. For example, 1 liter of medium may contain more than 2 million microcarrier beads, providing a growth surface of more than 8000 square centimeters. For commercial production of viruses, such as vaccine production, it is often preferred to culture the cells in a bioreactor or fermentor. Existing bioreactors have volumes ranging from below 1 liter to above 100 liters, such as the Cyto3 bioreactor (Osmonics, Minnetonka, MN), NBS bioreactor (NBS science and technology, New Brunswick Scientific, Edison, N.J.) of Minn.Y., laboratory and commercial scale bioreactor (BB Biotech International, Melsungen, Germany), of Melson, N.Y.).

Regardless of the culture volume, for the purposes of the present invention, the culture can be maintained at a temperature of less than or equal to 35 ℃ to ensure efficient recovery of recombinant and/or reassortant strains of influenza virus, particularly cold-adapted, temperature-sensitive, attenuated recombinant and/or reassortant strains of influenza virus. For example, cells are cultured at a temperature of between about 32 ℃ and 35 ℃, typically between about 32 ℃ and about 34 ℃, usually at about 33 ℃.

Regulators that sense and maintain the temperature of cell culture systems, such as thermostats or other devices, are commonly used to ensure that the temperature does not exceed 35 ℃ during virus replication.

5.7 Recovery of viruses

The virus is typically recovered from the medium in which the infected (transfected) cells have been grown. Typically, the crude medium is clarified and the influenza virus is concentrated. Common methods include filtration, ultrafiltration, barium sulfate adsorption andelution, and centrifugation. For example, the crude medium infecting the culture is first clarified by centrifugation, e.g., 1000-. In addition, the medium was filtered through a 0.8 μm cellulose acetate filter to remove intact cells and other large particles. The clarified culture supernatant is then optionally centrifuged to pellet the influenza virus, for example at 15,000 Xg for about 3 to 5 hours. After resuspending the viral pellet in a suitable buffer, such as STE (0.01M Tris-HCl; 0.15M NaCl; 0.0001M EDTA) or Phosphate Buffered Saline (PBS) pH7.4, the virus is concentrated by density gradient centrifugation over sucrose (60% -12%) or potassium tartrate (50% -10%). Continuous or stepwise gradients, e.g. a 12% to 60% sucrose gradient of 12% over 4 steps, are suitable. The speed and time of gradient centrifugation should be sufficient to concentrate the virus into a visible band for recovery. In addition, for large scale commercial applications, zonal centrifuge rotors operating in continuous mode are used to elutriate viruses from density gradients. Additional details sufficient to instruct the skilled artisan to prepare influenza viruses from tissue culture are provided in, for example, Furminger, Vaccine Production (Vaccine Production), published in Nicholson et al (eds),Textbook of Influenza(influenza textbook), pages 324-332; merten et al, (1996), Production of influenza viruses in cell cultures for vaccine Production, published in Cohen and Shafferman,Novel Strategies in Design and Production of Vaccines(novel strategy for vaccine design and production), pp 141-151, and U.S. patent No.5,690,937, U.S. published application nos. 20040265987, 20050266026 and 20050158342, which are incorporated herein by reference. If desired, the recovered virus can be stored at-80 ℃ in the presence of sucrose-phosphate-glutamate (SPG) as a stabilizer.

5.8 Influenza virus

The genome of influenza virus consists of 8 segments of linear (-) strand ribonucleic acid (RNA) encoding immunogenic Hemagglutinin (HA) and Neuraminidase (NA) proteins and 6 internal core polypeptides: nucleocapsid Nucleoprotein (NP); a matrix protein (M); non-structural proteins (NS); and 3 RNA polymerase (PA, PB1, PB2) proteins. During replication, genomic viral RNA is transcribed in the host cell nucleus into (+) strand messenger RNA and (-) strand genomic cRNA. Each of the 8 genome segments is packaged into a ribonucleoprotein complex that contains, in addition to RNA, NP and polymerase complexes (PB1, PB2 and PA).

Influenza viruses that can be produced in the MDCK cells of the invention by the methods of the invention include, but are not limited to: reassortant viruses comprising selected hemagglutinin and/or neuraminidase antigens of an approved attenuated, temperature sensitive main virus strain. For example, the virus may comprise a primary virus strain (e.g., A/Ann Arbor/6/60, B/AnnArbor/1/66, PR8, B/Leningrad/14/17/55, B/14/5/1, B/USSR/60/69, B/Leningrad/179/86, B/Leningrad/14/55, B/England/2608/76, A/puerto Rico/8/34 (i.e., PR8), etc., as one or more of, for example, a temperature sensitive strain (ts), a cold adapted strain (ca), or an attenuated strain (att), or an antigenic variant or derivative thereof.

5.9 Influenza virus vaccine

Historically, influenza vaccines were produced in embryonated chicken eggs using strains selected based on empirical predictions of the relevant strain. Recently reassortant viruses were generated containing selected hemagglutinin and/or neuraminidase antigens of an approved attenuated temperature sensitive master strain. The influenza virus is recovered after multiple subcultures of the virus in chicken eggs, and the recovered influenza virus is optionally inactivated, for example using formaldehyde and/or beta-propiolactone. However, there are several significant disadvantages to producing influenza vaccines in this manner. The residual contaminants of eggs are highly antigenic, pyrogenic and often cause significant side effects after administration. More importantly, the virus strain used for production must often be selected and distributed several months before the next influenza season comes, so that there is time to produce and inactivate the influenza vaccine. In attempting to produce recombinant and reassortant vaccines in cell culture, the obstacle is that any viral strain approved for vaccine production cannot grow efficiently under standard cell culture conditions.

The present invention provides vector systems, compositions and methods for producing recombinant and reassortant strains of virus in culture, thereby enabling rapid production of vaccines corresponding to one or more selected antigenic virus strains. In particular, conditions and strains are provided that enable efficient production of viruses from a multiple plasmid system in cell culture. If desired, the virus may optionally be further amplified in eggs or in cell cultures different from those used for virus rescue.

For example, it has not previously been possible to culture the main strain of influenza B virus B/Ann Arbor/1/66 under standard cell culture conditions, such as 37 ℃. In the methods of the invention, plasmids each comprising an influenza virus genome segment are introduced into suitable cells and maintained in culture at less than or equal to 35 ℃. The culture is generally maintained at a temperature of between about 32 ℃ and 35 ℃, preferably between about 32 ℃ and about 34 ℃, for example about 33 ℃.

Cultures are typically maintained in a system such as a cell incubator under controlled humidity and CO₂Next, a constant temperature is maintained using a temperature regulator, such as a thermostat, to ensure that the temperature does not exceed 35 ℃.

Reassortant influenza viruses are readily obtained by introducing a subset of vectors comprising cdnas encoding genomic segments of a primary influenza virus and a complementary segment derived from a strain of interest (e.g., an antigenic variant of interest). The main virus strain is usually selected according to the desired properties associated with vaccine administration. For example, to produce a vaccine, such as to produce an attenuated live vaccine, a master donor virus strain may be selected that has an attenuated phenotype, cold-adaptation, and/or temperature sensitivity. In this regard, influenza A strain caA/Ann Arbor/6/60; influenza B strain ca B/Ann Arbor/1/66; or other strains selected for their desirable phenotypic properties, such as attenuated, cold-adapted and/or temperature sensitive strains, are preferred as the primary donor strains.

In one embodiment, a plasmid comprising cDNA encoding the 6 internal vRNA segments of the main virus strain of influenza (i.e., PB1, PB2, PA, NP, NB, M1, BM2, NS1, and NS2) along with cDNA encoding hemagglutinin and neuraminidase vRNA segments of a virus strain with the desired antigenicity (e.g., a virus strain predicted to cause significant local or global influenza infection) is transfected into a suitable host cell. The reassortant virus is recovered after replication of the reassortant virus in cell culture at a suitable temperature for effective recovery, e.g., at or below 35 ℃, e.g., between about 32 ℃ and about 34 ℃, or about 33 ℃. Optionally, the recovered virus is inactivated with a denaturant, such as formaldehyde or beta-propiolactone.

5.10 Methods and compositions for prophylactic administration of vaccines

Recombinant and reassortant strains of the invention formulated with suitable carriers or excipients may be administered prophylactically to stimulate a specific immune response against one or more influenza virus strains. The carrier or excipient is typically a pharmaceutically acceptable carrier or excipient, such as sterile water, saline solution, buffered saline solution, aqueous dextrose solution, aqueous glycerol solution, ethanol, allantoic fluid from uninfected eggs (i.e., normal allantoic fluid "NAF"), or a combination thereof. Such solutions can be prepared according to methods known in the art to ensure sterility, pH, isotonicity and stability. The carrier or excipient selected is generally selected to minimize allergic and other adverse effects and to suit the particular route of administration, e.g., subcutaneous, intramuscular, intranasal, etc.

Influenza viruses of the invention are typically administered in an amount sufficient to stimulate a specific immune response against one or more influenza virus strains. Administration of influenza viruses preferably elicits a protective immune response. Those skilled in the art are aware of the dosages and methods for eliciting a protective immune response against one or more influenza virus strains. For example, HID can be administered in a dose range of about 1 to about 1000 per dose to provide inactivated influenza virus₅₀(human infectious dose), i.e., about 10⁵-10⁸pfu (plaque forming unit). Alternatively, the dose may be about 10-50 μ g, e.g., about 15 μ g HA, administered without adjuvant and smaller doses administered with adjuvant. The dose to be administered may generally be determined according to, for example, age, physical condition, body weight, sex, diet, time of administration andother clinical factors are adjusted within this range. Prophylactic vaccine formulations can be administered systemically, for example, by subcutaneous or intramuscular injection with a needle and syringe or a needle-free injection device. Alternatively, the vaccine formulation may be administered intranasally by drop, large particle aerosol (above about 10 microns) or spray into the upper respiratory tract. Although any of the above delivery routes produce a protective systemic immune response, intranasal administration may elicit mucosal immunity at the entry site of the influenza virus, thereby producing additional benefits. For intranasal administration, live attenuated virus vaccines are generally preferred, such as attenuated, cold-adapted and/or temperature sensitive recombinant or reassortant strains of influenza virus. While it is preferred to stimulate a protective immune response by a single administration, additional doses may be administered by the same or different routes to achieve the desired prophylactic effect.

Alternatively, targeting dendritic cells ex vivo or in vivo with influenza viruses can be used to stimulate an immune response. For example, the expanded dendritic cells are contacted with a sufficient amount of virus for a sufficient time to allow the dendritic cells to capture influenza virus antigens. The cells are then transferred into the subject to be vaccinated by standard vein grafting methods.

The formulation for prophylactic administration of influenza virus or subunits thereof optionally further comprises one or more adjuvants that enhance the immune response against influenza virus antigens. Suitable adjuvants include: saponins, mineral gels such as aluminium hydroxide, surface-active substances such as lysolecithin, pluronic (pluronic), polyols, polyanions, peptides, oil or hydrocarbon emulsions, bacillus calmette-guerin (BCG), Corynebacterium parvum (Corynebacterium parvum) and synthetic adjuvants QS-21 and MF 59.

If desired, a prophylactic vaccine for influenza virus can be administered in combination with one or more immunostimulatory molecules. Immunostimulatory molecules include various cytokines, lymphokines, and chemokines, e.g., interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-12, IL-13) having immunostimulatory, immunopotentiating, and proinflammatory activities; growth factors (e.g., granulocyte-macrophage (GM) -Colony Stimulating Factor (CSF)); and other immunostimulatory molecules such as macrophage inflammatory factor, Flt3 ligand, B7.1, B7.2, and the like. The immunostimulatory molecule may be administered in the same formulation as the influenza virus, or may be administered separately. The protein or expression vector encoding the protein may be administered to produce an immunostimulatory effect.

In another embodiment, the heterologous nucleic acid can be introduced into a host organism or host cell, e.g., a mammalian cell, e.g., a cell derived from a human subject, using a vector of the invention comprising an influenza virus genome segment, along with a suitable pharmaceutical carrier or excipient as described above. The heterologous nucleic acid is typically inserted into a non-essential region of a gene or gene segment, such as the M gene of segment 7. The heterologous polynucleotide sequence may encode a polypeptide or peptide, or an RNA, such as an antisense RNA or ribozyme. The heterologous nucleic acid is then introduced into the host or host cell by producing a recombinant virus comprising the heterologous nucleic acid, which is administered as described above. In one embodiment, the heterologous polynucleotide sequence is not derived from an influenza virus.

Alternatively, the vectors of the invention comprising a heterologous nucleic acid can be introduced into a host cell and expressed by co-transfecting the vector into a cell infected with an influenza virus. The cells are then optionally returned or delivered to the subject, typically to the site where they were obtained. In some applications, cells are transferred to a tissue, organ or system site of interest (as described above) using existing transfer or transplantation procedures. For example, stem cells of hematopoietic lineage, such as bone marrow, cord blood, or peripheral blood-derived hematopoietic stem cells, can be delivered to a subject using standard delivery or infusion techniques.

Alternatively, a vector comprising a heterologous nucleic acid can be delivered to a cell in a subject. Such methods generally involve administering carrier particles to a target cell population (e.g., blood cells, skin cells, liver cells, nerve (including brain) cells, kidney cells, uterus cells, muscle cells, intestinal cells, cervical cells, vaginal cells, prostate cells, and the like, as well as tumor cells derived from cells, tissues, and/or organs). Administration can be systemic, such as by intravenous injection of the viral particles, or by various methods of directly transferring the viral particles to the site of interest, including injection (e.g., using a needle or syringe), needleless vaccine delivery, topical administration, or propelling a tissue, organ, or skin site. For example, viral vector particles can be delivered by inhalation, oral, intravenous, subcutaneous, subdermal, intradermal, intramuscular, intraperitoneal, intrathecal, or by vaginal or rectal administration, or by placement of the viral particles within a body cavity or other site (e.g., during surgery).

The above methods are useful for the therapeutic and/or prophylactic treatment of diseases or disorders by introducing a vector of the invention comprising a heterologous polynucleotide encoding a therapeutically or prophylactically effective polypeptide (or peptide) or RNA (e.g., an antisense RNA or ribozyme) into a target cell population in vitro, ex vivo or in vivo. Polynucleotides encoding a polypeptide (or peptide) or RNA of interest are typically operatively linked to appropriate regulatory sequences as described in the section "expression vectors" and "other expression elements". Multiple heterologous coding sequences are optionally incorporated into a single vector or virus. For example, in addition to polynucleotides encoding therapeutically or prophylactically active polypeptides or RNAs, the vector may comprise other therapeutically or prophylactically polypeptides, such as antigens, co-stimulatory molecules, cytokines, antibodies, etc., and/or markers, etc.

In one embodiment, the invention provides a composition comprising a reassortant of the invention and a recombinant virus (or portions thereof) which has been treated with an agent such as benzonase to eliminate potential oncogenes. Thus, oncogene-free vaccine compositions are specifically included in embodiments of the present invention.

The methods and vectors of the invention are useful for the therapeutic or prophylactic treatment of various diseases, including genetic and acquired diseases, e.g., as vaccines for infectious diseases caused by viruses, bacteria, etc.

5.11 Reagent kit

To facilitate the use of the vectors and vector systems of the invention, any vector, e.g., consensus influenza virus plasmids, variant influenza virus polypeptide plasmids, influenza virus polypeptide library plasmids, and the like, and other components useful for influenza virus packaging and infection for experimental or therapeutic purposes, e.g., buffers, cells, culture media, and the like, can be packaged in the form of a kit. In addition to the components described above, the kit may generally contain other materials such as instructions, packaging materials and containers for carrying out the methods of the invention.

5.12 Manipulation of viral nucleic acids and proteins

For purposes of the present invention, nucleic acids or other nucleic acids, expression vectors, influenza virus nucleic acids and/or proteins, etc., comprising canine RNA pol I regulatory sequences of the present invention can be manipulated according to well-known molecular biology techniques. Many such methods, including detailed protocols for amplification, cloning, mutagenesis, transformation, etc., are described in: for example, Ausubel et al,Current Protocols in Molecular Biology(New molecular biology laboratory Manual) (2000 supplement), John Wiley father, John Wiley&Sons), new york ("Ausubel"); the contents of Sambrook et al,Molecular Cloning-A Laboratory Manual(molecular cloning-A laboratory Manual) (2 nd edition), volume 1-3, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.), 1989 ("Sambrook"); the combination of Berger and Kimmel,Guide to Molecular Cloning Techniques，Methods in Enzymology(molecular cloning techniques guide, methods in enzymology), Vol.152, San Diego, Calif. (Academic Press, Inc., San Diego, Calif.) ("Berger").

In addition to the above references, protocols that can be used, for example, in vitro amplification techniques for amplifying the cDNA probes of the invention, such as Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR), Q β -replicase amplification and other RNA polymerase mediated techniques (e.g., NASBA) are described in: mullis et al, (1987), U.S. Pat. Nos. 4,683,202;PCR Protocols A Guide to Methods and Applications(instructions for PCR protocols-methods and applications) (Innis et al), Academic Press Inc. san Diego, Calif. (1990) ("Innis"); arnheim and Levinson (1990)C&EN 36；The Journal Of NIH Research(1991)3: 81; kwoh et al (1989)Proc Natl Acad Sci USA 861173; guatelli et al (1990)Proc Natl Acad Sci USA87: 1874; lomell et al (1989)J Clin Chem35: 1826; landegren et al (1988)Science 241：1077；Van Brunt(1990)Biotechnology8: 291; wu and Wallace (1989)Gene4: 560; barringer et al (1990)Gene89: 117; sooknanan and Malek (1995)Biotechnology13: 563. other methods for cloning nucleic acids in the present invention include U.S. Pat. No.5,426,039 to Wallace et al. Improved methods for amplifying nucleic acids by PCR are summarized in Cheng et al (1994)Nature369: 684 and references therein.

Various solid phase strategies may be employed to synthesize certain polynucleotides, e.g., oligonucleotides, of the present invention, including phosphoramidite coupling chemistry based on mononucleotides and/or trinucleotides. For example, a nucleic acid sequence can be synthesized by sequentially adding activated monomers and/or triplets to an extended polynucleotide strand. See, e.g., Caruthers, M.H., et al, (1992)Meth Enzymol 211：3。

In synthesizing The desired sequence, essentially any nucleic acid can be ordered from a number of companies, such as Midland Certified Reagent Company (mccolignos. com), The general American Gene Company (The Great American Gene Company) (www.genco.com), express Gene Co., Inc. (www.expressgen.com), Operon Technologies, Inc. (Operon Technologies, Inc.) (www.operon.com), and many others.

In addition, selected amino acid residues in the viral polypeptide can be substituted, for example, by site-directed mutagenesis. For example, a viral polypeptide comprising amino acid substitutions functionally associated with a desired phenotypic characteristic, e.g., an attenuated phenotype, cold-adaptation, temperature sensitivity, etc., can be produced by introducing specific mutations into a segment of viral nucleic acid encoding the polypeptide. Site-directed mutagenesis methods are well known in the art and are described, for example, in Ausubel, Sambrook and Berger, supra. A number of kits for site-directed mutagenesis are commercially available, for example the Chameleon site-directed mutagenesis kit from Stelata Gene, Inc. of Laohoa (Stratagene, La Jolla), according to the manufacturer's instructions, for introducing, for example, one or more amino acid substitutions into a genomic segment encoding an influenza A or B polypeptide, respectively.

5.13 Other viruses

The nucleic acids, vectors and methods of the invention are also useful for the expression and purification of other recombinant viruses. The following discussion provides guidance for considering the engineering of vectors to be suitable for use with other such viruses.

If the target virus comprises a positive-stranded segmented RNA genome, the canine RNA pol I promoter is preferably located upstream of the cDNA in the internal transcription unit (one-way system). In this embodiment, positive-stranded RNA is generated for direct incorporation into the new virus. However, embodiments that utilize a one-way system to produce a target virus comprising a negative-stranded segmented RNA genome are also within the scope of the invention.

If the target virus comprises a negative-stranded segmented RNA genome, the canine RNA pol I promoter is preferably located downstream of the cDNA in the internal transcription unit (bidirectional system). In this embodiment, negative strand RNA is generated for direct incorporation into the new virus. Embodiments that utilize a two-way system to produce a target virus comprising a positive-stranded segmented RNA genome are also within the scope of the invention.

The invention can also be used to produce viruses comprising infectious or non-infectious non-segmented RNA genomes (single-stranded or double-stranded). Simple introduction of infectious viral genomic RNA into a host cell is often sufficient to initiate the intracellular viral life cycle and ultimately the production of intact virus. For example, simple introduction of picornavirus genomic RNA into a host cell is sufficient to produce an intact picornavirus. Initiation of the life cycle of a virus comprising a non-infectious genomic RNA usually requires additional introduction of other viral proteins, which are usually carried along with the genome within the viral particle. For example, parainfluenza virus III carries an RNA-dependent RNA polymerase, the presence of which is essential for initiating viral genomic RNA replication and viral mRNA transcription in newly infected host cells; without the presence of this polymerase, the parainfluenza virus III genomic RNA is non-infectious. In embodiments of the invention where viruses are produced that comprise infectious non-segmented genomic RNA, simply introducing a dual expression plasmid of the invention carrying nucleic acid comprising the viral genome into a suitable host cell is sufficient to produce the complete virus. In embodiments where viruses are produced that contain non-infectious non-segmented genomic RNA, other expression plasmids may also have to be introduced into the host cell along with a dual expression plasmid carrying the viral genome. Other plasmids should express proteins necessary to initiate the viral life cycle, which are typically introduced into the host cell after infection (e.g., RNA-dependent RNA polymerase).

In embodiments where a picornavirus is produced that comprises an infectious non-segmented RNA genome, a cDNA comprising the entire viral genome is inserted into the dual promoter expression plasmid of the invention. An upstream promoter, preferably a pol II promoter, in the external transcription unit directs the production of a positive strand mRNA comprising the entire viral genome-the polyprotein is translated from the mRNA, and the individual proteins are cleaved from the polyprotein and released (e.g., by proteases within the polyprotein). Since the viral genome comprises positive-stranded RNA, a second upstream promoter, preferably canine RNA polI, in the internal transcription unit (one-way system) can direct the production of positive-stranded copies of the genome. If the viral genome comprises negative-strand RNA, then a second downstream promoter, preferably canine RNA pol I, in the internal transcription unit (bidirectional system) can direct the production of a negative-strand copy of the genome. Embodiments utilizing a one-way system to generate negative-strand non-segmented RNA viruses are within the scope of the present invention. Likewise, embodiments that utilize a bidirectional system to produce positive-stranded non-segmented RNA viruses are also within the scope of the invention.

The invention can also be used to produce viruses comprising non-infectious non-segmented RNA genomes, wherein no polyprotein is produced. For example, the present system can be used to produce Rhabdoviridae or Paramyxoviridae, preferably parainfluenza virus III, whose life cycle typically involves the production of multiple monocistronic mRNAs from genomic negative strand RNA by a virally-derived RNA-dependent RNA polymerase; each protein was expressed from a monocistronic mRNA. In these embodiments, the external transcription unit comprising a promoter, preferably a pol II promoter, directs the production of a plus strand polycistronic copy of the viral genome, from which only the first gene (NP) is typically translated. In addition, an internal transcription unit comprising a promoter, preferably a pol I promoter, directs the expression of copies of genomic RNA for incorporation into the new virus. Since the parainfluenza virus III viral genome comprises negative strand RNA, the promoter of the internal transcription unit is preferably located downstream of the cDNA (bidirectional system). If the viral genome comprises positive-stranded RNA, the promoter of the internal transcription unit is preferably located upstream of the cDNA (one-way system). Embodiments in which a virus comprising a positive-stranded RNA genome is produced using a two-way system and embodiments in which a virus comprising a negative-stranded RNA genome is produced using a one-way system are within the scope of the invention. Other viral proteins (in addition to those expressed from polycistronic mRNA) are also required for viral transcription and replication (L and P), and these proteins can be provided separately from different expression plasmids.

The invention also includes embodiments for producing a virus comprising a double-stranded segmented RNA genome. In these embodiments, plasmids containing the respective genes in the target viral genome are inserted into the dual promoter expression plasmids of the present invention. The plasmid may be a one-way plasmid or a two-way plasmid. The promoter, preferably pol II promoter, in the external transcription unit directs the expression of the mRNA transcript of each gene, which is translated into the encoded protein. Promoters within the internal transcription unit, preferably pol I promoters, direct transcription of the positive strand (unidirectional system) or the negative strand (bidirectional system). The first strand produced can then be used as a template to produce a complementary strand using viral RNA polymerase. The resulting double stranded RNA product is incorporated into a new virus.

6. Detailed description of the preferred embodiments

1. An isolated nucleic acid comprising a canine RNA polymerase I regulatory sequence.

2. The nucleic acid of embodiment 1, wherein the regulatory sequence is a promoter.

3. The nucleic acid of embodiment 1, wherein the regulatory sequence is an enhancer.

4. The nucleic acid of embodiment 1, wherein the regulatory sequence is an enhancer and a promoter.

5. The nucleic acid of embodiment 1, wherein the RNA polymerase regulatory sequence comprises SEQ id no:1 from nucleotide 1 to 1808 or a functionally active fragment thereof.

6. The nucleic acid of embodiment 1, 2, 3, 4 or 5, wherein the regulatory sequence is operably linked to a cDNA encoding a minus-strand viral genomic RNA or a corresponding cRNA.

7. The nucleic acid of embodiment 6, wherein the minus-strand viral genomic RNA is an influenza viral genomic RNA.

8. The nucleic acid of embodiment 6 or 7, wherein the nucleic acid further comprises a transcription termination sequence.

9. An expression vector comprising the nucleic acid of embodiment 1, 2, 3, 4,5, 6, 7, or 8.

10. The expression vector of embodiment 9, wherein the expression vector comprises a bacterial origin of replication.

11. The expression vector of embodiment 9, wherein the expression vector comprises a selectable marker that is selectable in a prokaryotic cell.

12. The expression vector of embodiment 9, wherein the expression vector comprises a selectable marker that is selectable in a eukaryotic cell.

13. The expression vector of embodiment 9, wherein the expression vector comprises a multiple cloning site.

14. The expression vector of embodiment 13, wherein said multiple cloning site is oriented with respect to said canine RNA polymerase I regulatory sequence such that a coding sequence for introducing the multiple cloning site is expressed from said regulatory sequence.

15. A method for producing an influenza genomic RNA, comprising transcribing the nucleic acid of embodiment 7, thereby producing an influenza genomic RNA.

16. A method for producing a recombinant influenza virus comprising culturing a canine cell comprising the expression vector of embodiment 9, 10, 11, 12, 13, or 14 and one or more expression vectors that express mRNA encoding one or more influenza polypeptide, wherein the influenza polypeptide is selected from the group consisting of: PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS 2; and isolating the recombinant influenza virus.

17. The method of embodiment 16, wherein a helper virus is used.

18. The method of embodiment 16, wherein the influenza virus produced is infectious.

19. The method of embodiments 16, 17 or 18, wherein the method can produce at least 1 x 10³PFU/ml influenza virus.

20. A cell comprising the nucleic acid of embodiment 1, 2, 3, 4,5, 6, 7, or 8.

21. A cell comprising the expression vector of embodiment 9, 10, 11, 12, 13, or 14.

22. The cell of embodiment 20 or 21, wherein the cell is a canine cell.

23. The canine cell of embodiment 22, wherein the canine cell is a kidney cell.

24. The canine kidney cell of embodiment 23, wherein the canine kidney cell is an MDCK cell.

25. A method of producing a recombinant segmented negative-strand RNA virus having more than 3 genomic vRNA segments in cultured canine cells, the method comprising: (a) introducing a first set of expression vectors into a population of canine cells, said first set of expression vectors capable of expressing genomic vRNA segments in said cells to provide complete genomic vRNA segments of said virus; (b) introducing into said cell a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of said virus; and (c) culturing the cell thereby producing a viral particle.

26. The method of embodiment 25, wherein infectious influenza virus particles are produced.

27. The method of embodiment 25 or 26, wherein a helper virus is utilized.

28. A method of producing infectious influenza virus particles in cultured canine cells, the method comprising: (a) introducing a set of expression vectors into a population of canine cells, wherein the expression vectors are capable of expressing within the cells (i) a genomic vRNA segment to provide a complete genomic vRNA segment of the virus and (ii) mRNA encoding one or more polypeptides of the virus; (b) culturing the cell to produce the viral particle.

29. A method of transcribing a vRNA segment of an influenza virus, the method comprising contacting a canine pol I polymerase polypeptide with a nucleic acid comprising a sequence selected from the group consisting of SEQ ID nos: 1-28, wherein said nucleic acid is operably linked to a cDNA molecule encoding said vRNA segment of said minus-strand virus; and isolating the transcribed vRNA segment.

30. The method of embodiment 29, wherein the vRNA is transcribed in the host cell.

31. The method of embodiment 16, 17, 18, 19, 25, 26, 27 or 28, wherein each expression vector is on a separate plasmid.

32. A composition comprising a plurality of carriers, wherein the plurality of carriers comprises the following carriers: a vector comprising a canine pol I promoter operably linked to an influenza virus PA cDNA linked to a transcription termination sequence; a vector comprising a canine pol I promoter operably linked to an influenza virus PB1 cDNA linked to a transcription termination sequence; a vector comprising a canine pol I promoter operably linked to an influenza virus PB2 cDNA linked to a transcription termination sequence; a vector comprising a canine pol I promoter operably linked to an influenza virus HA cDNA linked to a transcription termination sequence; a vector comprising a canine pol I promoter operably linked to an influenza virus NP cDNA, the latter linked to a transcription termination sequence; a vector comprising a canine pol I promoter operably linked to an influenza virus NA cDNA linked to a transcription termination sequence; a vector comprising a canine pol I promoter operably linked to an influenza virus M cDNA, which is linked to a transcription termination sequence; and a vector comprising a canine pol I promoter operably linked to an influenza virus NS cDNA, the latter linked to a transcription termination sequence.

33. The composition of embodiment 32, further comprising one or more expression vectors that express mRNA, wherein the mRNA encodes one or more influenza polypeptide selected from the group consisting of: PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS 2.

34. A host cell comprising the composition of embodiment 32 or 33.

35. A vaccine comprising the virus produced by the method of embodiment 16, 17, 18, 19, 25, 26, 27 or 28.

36. A vaccine comprising an immunogenic composition prepared from a virus, wherein the virus is produced according to the method of embodiment 16, 17, 18, 19, 25, 26, 27 or 28.

37. The composition of embodiment 35 or 36, wherein each expression vector is on a separate plasmid.

7.Examples

The following examples are intended to illustrate the invention and are not intended to limit the invention in any way.

7.1 Example 1: culturing influenza strains in MDCK cells

This example describes the characterization of several cell lines that culture influenza viruses. Several different cell lines and primary cells were evaluated, including MRC-5, WI-38, FRhL-2, PerC6, 293, NIH3T3, CEF, CEK, DF-1, Vero and MDCK for the ability to produce wild-type (wt) and genetic reassortants derived from laboratory engineered, e.g., cold-adapted (ca), influenza A and B strains. Although many cell types support replication of certain cold-adapted influenza virus strains to a limited extent, only MDCK has been able to produce high titers of type a and type b viruses. For example, PerC6 cells were found to support certain wt and ca b virus replication at levels similar to those observed in MDCK cells, despite the different growth kinetics (see fig. 1). In contrast, PerC6 was unable to support many ca A virus replications. FIG. 2 shows growth curves for wt and ca A/Sydney/05/97 and A/Beijing/262/95 viruses. In both cases, the ca strain did not replicate well in PerC6 cells. FIG. 3 similarly depicts growth curves for wt and ca A/Ann Arbor/6/60, demonstrating that the ca strain is not able to replicate efficiently in PerC cells, and that wt A/Ann Arbor/6/60 is not as stable in MDCK cells. Real-time PCR analysis of influenza virus replication in PerC cells showed that within the first 24 hours post-infection, there was an increase in viral rna (vrna) for ca and wt influenza a strains, but only the wt strain continued to increase above 120 hours, which was not the case for the ca strain. In comparison, both wt and ca vRNA increased in MDCK cells and reached a plateau phase (plateau) at day 3. See fig. 4.

The ability of MDCK cells to support replication of a potential pandemic vaccine (viral strain) caA/Vietnam/1203/2004 was also examined. MDCK cells were infected with a low multiplicity of infection of ca A/Vietnam/1203/2004 and the virus in the supernatant was quantitated at various time points post-infection. At 48 hours post-infection, ca A/Vietnam/1203/2004 titers reached about 8 logs₁₀TCID₅₀mL, then stable for 3 to 4 days. See fig. 5.

In this experiment, MDCK cells from ATCC (accession number CCL-34) were expanded a limited number of times in medium containing 10% fetal bovine serum from the united states or suitable serum-free medium (e.g., SFMV100) to generate a pre-master cell (pre-master cell) stock for preliminary characterization studies. Suitable serum-free media are described in U.S. provisional application No. 60/638,166 filed on 23/12/2004; U.S. provisional application No. 60/641,139 filed on 5.1.2005; and U.S. patent application No. 11/304,589 filed on 16.12.2005, each of which is incorporated herein by reference in its entirety. Cells were readily grown in both types of media, and both cell stocks supported replication of cold-adapted vaccine strains and pandemic strains, as shown in table 1 below and fig. 5, respectively.

TABLE 1

Comparison of productivity of cold-adapted influenza strains produced by serum-and serum-free cultured MDCK cells

To investigate the gene segments responsible for restricted growth in PerC cells, a 7:1 reassortant of each gene segment of influenza strain A/AA/6/60 was generated using 8-plasmid rescue techniques. A representative description of the 8-plasmid influenza virus rescue system can be found, for example, in U.S. Pat. No. 6,951,754. FIG. 6 shows a schematic and naming strategy for each 7:1 reassortant. The resulting reassortants were then tested for their ability to replicate in PerC cells. See fig. 7. The growth-limiting phenotype appears to be localized to the PB2 and PB1 gene segments. The precise location responsible for this phenotype can be mapped in detail using methods well known in the art. For example, specific differences can be determined by comparing the sequences of the wt and ca strains in the identified gene segments, and then back-mutations can be made in either the wt or ca strains. These mutants were then analyzed for their ability to grow in PerC6 cells. Any mutation that prevents growth of the wt strain or allows growth of the ca strain can be identified as a mutation that causes a growth-limiting phenotype.

7.2 Example 2: nodulation of MDCK cell line

Evaluation of the potential tumorigenicity of two pre-master cell stocks of MDCK cells using athymic nude mouse modelThe preparations were cultured in serum-containing medium and serum-free medium, respectively, and the model was at a stage representing the 5 th generation of cells, and thereafter expected to be useful for vaccine production. To assess tumorigenicity, 10⁷Cells were injected subcutaneously into multiple groups of 10 mice each, and animals were sacrificed and examined 84 days later. Tumor formation was observed in 6 out of 10 mice inoculated with cells passaged in serum-free medium. In contrast, no evidence of tumor formation was seen in mice inoculated with cells passaged in medium supplemented with 10% fetal bovine serum, and although some fibrosarcoma was observed at the inoculation site, as shown in table 2, the cells passaged in serum were non-tumorigenic.

TABLE 2

Tumorigenicity and karyotype of MDCK cells passaged in two different media

^*TP₅₀: number of cells required to induce tumors in 50% of mice

ND: is not made

As shown in table 2, karyotyping was performed on two pre-main cell stocks at passage 4 and passage 20 in the respective media. Non-neoplastic cells passaged in 10% FCS have a median metaphase chromosome of 78, and the distribution of cells with other chromosome numbers (70 to 82) is relatively limited. Whereas the median metaphase chromosome number of cells passaged in serum-free medium was also 78, significantly more cells were observed with aneuploid chromosome numbers ranging from 53 to 82 metaphase chromosomes. In both cases, the karyotype was not altered by passaging.

7.3 Example 3: adaptation of MDCK cells to growth in serum-free media

MDCK cells of ATCC were passaged in medium containing γ -irradiated FBS. These cells were then passaged a limited number of times in a serum-free medium formulation selected to support cell bank production. Serum-free media are described in U.S. provisional application nos. 60/638,166 and 60/641,139 and U.S. patent application No. 11/304,589. These additional passages can be carried out at 37 ℃ or 33 ℃. MDCK cells were passaged in three media containing plant-derived additives instead of serum, resulting in cells with a karyotype similar to that of MDCK cells passaged in FCS-containing media (data not shown).

7.4 Example 4: cloning of MDCK cells

Cells were biologically cloned by limiting dilution to ensure that the producing cells were derived from a certain unique genetic background. Clones were screened for phenotypic properties including doubling time and relative nodulation, as well as virus production capacity. In preliminary experiments of concept discussion, 54 MDCK clones were obtained in FCS-containing medium. These clones were passaged and each clone was infected with ca A/New Caledonia/20/99 at low multiplicity of infection. The supernatant was removed several days after infection and passed TCID₅₀The amount of virus in the supernatant was determined. A few clones produced higher titers of virus than the non-cloned parental cells. The Master Cell Bank (MCB) was created using clones with superior biological and physiological properties, as described below.

7.5 Testing and characterization of master cell libraries

The MCB was thoroughly checked to ensure that no foreign material was present. For example, one or more PCR and/or antibody-specific assays are performed to detect available viral material, as shown in table 3 below.

TABLE 3

Test protocol for MCB

7.6 Example 6: preclinical characterization of cell culture derived influenza viruses

This example describes the characterization of influenza virus strains produced from cell cultures and eggs, and compares the viruses produced by the two systems. Such influenza viruses are generally suitable for use as human vaccines, and their biological properties make the viruses suitable for such use. In this example, the influenza virus was cold-adapted (ca; ability to replicate efficiently at lower temperatures), temperature-sensitive (ts; replication limited at higher temperatures in vitro), and attenuated (att; undetectable replication in ferret lung tissue), referred to herein as the cathatt virus strain. The comparisons made include: biochemical, antigenic and genetic evaluation (sequencing) of viral products; biological and biochemical characterization of viruses after replication in human cells; replication in a permitted biological model; and immunogenicity in approved animal models.

7.6.1 genetics, biochemistry and antigenicity comparison

The titer of the ca ts att strains of A/H1N1, A/H5N1, A/H3N2, and type B replicated relatively high in MDCK cells. Furthermore, passage of the ca ts att virus strain in MDCK cells did not change their genomic sequence. Three ca ts att strains, ca A/Sydney/05/97, caA/Beijing/262/95 and ca B/Ann Arbor/1/94, were passaged once or twice in MDCK cells, the entire coding regions of all 6 internal genes were sequenced and compared to the starting material. No nucleotide changes were observed, demonstrating that such passage through this substrate did not change the genetic makeup of these strains. Additional sequence characterization of different vaccine strains produced in MDCK cells was performed under conditions estimated to mimic the production process, including medium composition, input dose (moi), incubation temperature and harvest time. From these preliminary data, it was estimated that the genomic sequence of MDCK-produced viruses was unchanged.

Since the genome is genetically stable after passage in MDCK cells, it is not expected to be able to distinguish the biological properties of vaccines produced in chicken eggs or MDCK cells. However, the primary viral products of cell cultures are somewhat more subtle than the products of chicken eggs, particularly in terms of post-translational modifications of viral proteins including HA and NA, or in terms of lipid composition in the viral membrane; both of which may alter the overall physical properties of the virion. Preliminary preclinical data on the antigenicity of cell culture produced and egg produced vaccines suggest that no difference was detected in this important parameter. Egg stocks of several vaccine strains were passaged through MDCK cells and tested for antigenicity of both products using a reference antiserum to determine HAI titers. As shown in table 4, all HAI titers were within 2-fold of each other, indicating that the vaccine (strain) replicated intracellularly unchanged in antigenicity of the vaccine compared to the egg-derived material.

TABLE 4

HAI titre of viral strains produced in eggs and MDCK cells

Example 7: infecting cultured human epithelial cells

In one embodiment, to assess the biochemical, biological and structural similarity of MDCK and chicken egg produced vaccines after replication in human cells, the vaccines can be passaged 1 time in relevant diploid human cells, such as normal human bronchial epithelial cells (NHBE). This passage can be used to mimic a single infection event in the human airways, thus enabling comparison of progeny viruses, i.e., viruses ultimately responsible for eliciting an effective immune response. The hemagglutinin (binding and fusion) and neuraminidase activities of the vaccine can be studied from these materials, and other biochemical and structural studies can be evaluated, including electron microscopy, infectious particle to total particle ratio, and viral genome equivalents. In summary, these comparisons can be used to demonstrate that cell-derived vaccines are as effective and safe as vaccines produced in eggs. The analytical studies are summarized in table 5.

TABLE 5

Preclinical studies comparing cell and egg produced vaccines

In vivo (ferret)	In vitro＊
		Extent of attenuation/replication in upper airway replication kinetics in upper airway	Binding of viral-bound hemagglutination titers to different sialic acids
Immunogenic cross-reactivity kinetics	Physical properties morphological infectious particles of EM: total particle (genome)
		Infection Performance detection the dose required for replication to produce an antibody response	Optimal pH and temperature for fusion activity
	Genomic sequence
			Neuraminidase Activity

^*Comparing the primary products with products passaged once in human cells

7.8 Example 8: preclinical animal model

Ferrets are stable animal models for evaluating the attenuation properties and immunogenicity of attenuated influenza vaccines and component vaccine strains. The performance of influenza virus strains derived from MCB-produced cells was compared to the same strains produced in eggs. Head-to-head comparison of these materials in controlled studies can ensure high levels of comparability of these viral products.

To assess the ability of both vaccines to infect ferrets or to achieve "entry" into ferrets, the ferrets were lightly anaesthetised, virus preparations were produced by intranasal inoculation of cells or eggs. Nasal wash material was collected at several time points after inoculation and the viral load was assessed using one of several methods available to assess the kinetics and extent of viral replication in the upper respiratory tract of ferrets. Experiments were performed in a dose range including multiple strains and different trivalent mixtures, to generalize the relative infectivity of cell culture-grown strains and egg-produced strains. These studies have also been used to assess the immunogenicity of influenza strains, a property that is inherently linked to the ability of the virus to initiate infection. Blood samples of ferrets were taken at various time points (weeks) after inoculation and nasal washes were collected; these samples were used to assess serum antibody and nasal IgA responses to infection. Infectivity, serum antibody and mucosal antibody responses, and extreme values of these data can be used to compare and assess the infectivity of cell-produced vaccines and egg-produced vaccines. The most likely outcome is expected to be that vaccine strains produced by cells and eggs have similar infectivity and immunogenicity. If the cell-derived vaccine is more infectious or immunogenic than the egg-derived product, further studies are conducted to assess the possibility of using lower doses.

A number of immunogenicity and replication studies were performed in the ferret model to evaluate single unit human doses of cell culture derived vaccines. Infection with the ca ts att strain generally elicits a strong and rapid antibody response in ferrets. In addition, each ca ts att virus strain was routinely tested and showed that replication of the virus in the nasopharynx to higher titers could not be detected in the lungs of these animals and expressed an attenuated (att) phenotype. The effect of cell culture growth on these biological properties was also evaluated. However, it is not possible to observe all differences, since the att phenotype is an undivided part of the genetic composition of these strains. Growth kinetics and cross-reactivity of these strains were evaluated after a single human dose administration to these animals. This elicits serum antibodies that cross-react with multiple strains of virus within the genetic lineage; the same is expected for cell-derived vaccines.

These comparative evaluations should provide a more significant understanding of the underlying biochemical and/or biophysical differences of the primary virus product and show the effect of epigenetic differences detected by first passage of the virus in human cells or animal studies on the characteristics of the ca ts att virus strain. Based on the sequence information to date, production with MDCK cells is not expected to have an effect on the immunogenic properties of the ca ts att virus strain.

Ferrets are a well-known animal model of influenza and are commonly used to assess the attenuation performance and immunogenicity of ca ts att strains. Animals of 8-10 weeks of age are typically evaluated for attenuation properties; the study design is typically such that n-3-5 animals are evaluated per test or control group. Immunogenicity studies were performed using 8 weeks to 6 months old animals, typically requiring 3-5 animals per experimental or control group. These numbers may provide sufficient information to make statistically significant or observably significant comparisons between the two groups. In most studies, influenza-like signs may be observed, but with little probability. Ferrets do not show signs of appetite or weight loss, runny nose or ocular secretions; observation of the signs of influenza-like disease is an essential part of the study, without intervention such as analgesics. If there are other signs of discomfort, such as mouth ulcers or significant weight loss, the animal may be properly disposed of after consultation with the attending veterinarian.

7.9 Example 9: establishment of Master Virus Seed (MVS)

Avian cells were co-transfected with wild-type virus and MDV type A or B and progeny viruses of the desired 6:2 gene layout (genetic conjugation) were isolated and screened to generate the current influenza vaccine strains. This process requires multiple passages of the virus in avian cell cultures and/or SPF eggs. Recently, plasmid rescue was applied to produce influenza virus preparations. In this process, Vero (african green monkey) cells of a widely studied and characterized cell bank are electroporated with, for example, 8 DNA plasmids, each plasmid containing a cDNA copy of one of the 8 influenza virus RNA segments. Several days after electroporation, the supernatants of these electroporated cells contained influenza virus. The supernatant was then inoculated into SPF eggs to amplify and biologically clone the vaccine strain. Both of these processes produce vaccine strains that can be inoculated into SPF eggs to produce MVS. Although plasmid rescue has a number of advantages, including more reliable timing, genetically more precise gene segments, and a lower likelihood of contamination by foreign material from wild-type isolates, the MVSs produced by these two methods are indistinguishable from one another and can be used to initiate large-scale vaccine production. When the methods and compositions of the present invention are utilized, the methods are adapted for plasmid rescue using MDCK cells rather than Vero cells.

Final expansion of vaccine strains was performed in cells derived from MDCK cell banks. This final amplification can be achieved with small scale cultures (<20L) of MDCK cells. Supernatants of these cells were collected, concentrated and characterized/examined to generate MVS.

7.10 Cloning of Canine RNA PolI regulatory sequences

This example describes the cloning of the canine 18S ribosomal RNA gene and the nucleic acid sequence 5' to the gene.

First, genomic DNA of MDCK cells (accession CCL-34, ATCC) was isolated using MasterPure DNA purification kit from Madison Biotechnology, Inc. (EPICENTRE Biotechnologies; Madison, Wis.). Sequence alignment showed that the 18S rRNA gene was about 90% identical in dogs, humans, mice, rats and chickens. Primer pairs were designed based on the sequence in a conserved region near the 5' end of the 18S rRNA gene for PCR amplification of an approximately 500bp fragment from MDCK genomic DNA that can be used as a probe to detect digested fragments with complementary sequences on the membrane by Northern hybridization. A restriction enzyme fragment was identified by digesting genomic DNA with BamH I (about 2.2kb) and EcoR I (about 7.4kb), respectively. Both fragments were cloned into pGEM7 vector from Promega Corp.; Madison, Wis.) of Madison, Wis. The plasmid containing the EcoR I fragment has been filed on 2006, 19.4, with the american type culture collection designated a.t.c.c. accession No. PTA-7540 and a date of collection 2006, 20.4.2006.

The two clones obtained were aligned by restriction digest analysis and the orientation of the two clones was determined by sequencing both ends of the two clones. The restriction map of the EcoR I fragment is shown in FIG. 8. Then, the complete nucleic acid sequence of the fragment between the 5 'EcoR I site and the next BamH I site in the 3' direction was determined and assembled into a nucleotide sequence comprising about 3536 bases. The sequence is shown in FIGS. 9A-C (SEQ ID NO: 1).

Primer extension experiments were then performed to identify the starting nucleotide of transcripts expressed from the canine RNA pol I regulatory elements. Briefly, total RNA was isolated from MDCK cells. The labeled oligonucleotide primers anneal to the RNA and serve to initiate DNA synthesis to the 5' end of the 18s rRNA. To identify the first nucleotide of the transcript, the rRNA was sequenced using the same primers using a conventional dideoxynucleotide method. The first base of 18s rRNA can be determined by comparing the length of the nucleic acid obtained by primer extension with the length of each nucleic acid obtained by sequencing reaction. The first transcribed nucleotide (+1 position) is the 1809 base of the nucleotide sequence shown in FIGS. 9A-C.

To confirm that the sequence upstream of the nucleotide contains sufficient regulatory elements to direct transcription of the downstream gene, constructs containing the EGFP gene under the control of the regulatory sequences were constructed using standard techniques. The EGFP gene used in this construct was Hoffmann et al ((2000), "Ambisense" for the generation of influenza A viruses: vRNA and mRNA synthesis from an expression "(the" Ambisense "method for producing influenza A viruses: vRNA and mRNA synthesis from an expression from one template)Virology15: 267(2): 310-7)) described EGFP gene. This construct is then transfected into MDCK cells using conventional techniques. 24 hours after transfection, RNA was isolated from transfected cells and subjected to Northern blot analysis with labeled DNA encoding the EGFP gene. Detection of transcripts of appropriate size confirmed that the plasmid transfected into MDCK cells contained regulatory sequences that directed transcription of sequences 3' to the regulatory elements.

7.11 Example 11: identification of Canine RNA polymerase I regulatory elements

This example describes the identification and characterization of canine RNA polymerase I regulatory elements (canine RNA polymerase I promoter).

The canine rnatol I promoter and other regulatory regions can be identified by examining the canine promoter sequence 5' to the 18s rRNA transcription origin. In addition, simple deletion experiments can be performed to identify sequences necessary to efficiently initiate transcription. In one such deletion experiment, restriction sites were introduced into, or identified in, a plasmid encoding the nucleotide sequence shown in FIGS. 9A-C by site-directed mutagenesis. This restriction site is introduced at about 50 nucleotides 3' to the +1 nucleotide identified above, the +1 nucleotide being nucleotide 1809 of the sequence shown in FIGS. 9A-C. Another restriction site is identified or introduced by site-directed mutagenesis on the 5' side of the nucleotide sequence shown in FIGS. 9A-C relative to the +1 position.

The vector containing these restriction sites is then linearized by digestion with appropriate restriction enzymes. The linear nucleic acid is then digested with a suitable nuclease (e.g., exonuclease I, exonuclease III, etc.). By terminating the reaction at different time points, deletions of different sizes in the region 5' to the transcription start site can be obtained. The linearized plasmid is then recircularized and transformed into suitable host cells, and screened to identify plasmids containing the desired deletion. Alternatively, suitable oligonucleotides comprising sequences flanking the introduction of the deletion may be synthesized. Derivatives containing loop-out deletions are then prepared using such oligonucleotides using standard techniques. Site-directed substitutions may also be generated using oligonucleotides using standard techniques.

The ability of the different deletion or substitution mutants to initiate transcription can be determined by transfecting the plasmid into MDCK cells and detecting RNA transcribed from the plasmid by Northern blot as described above. By comparing the sequence of the plasmid that is transcribable with the plasmid that is not transcribable, the sequence of the canine RNA polymerase I promoter can be identified. The nucleic acid encoding the sequence is then cloned using conventional techniques.

Alternatively, the canine RNA pol I promoter can be mapped from the nucleic acid shown in SEQ ID NO:1 using other methods well known in the art, such as the minigenome method. The use of a reporter of the small genome of influenza virus, designated pFilu-CAT, can be found, for example, in published U.S. patent application 20050266026, which contains a negative-sense CAT gene cloned under the control of a pol I promoter. See also, Hoffmann et al ((2000), "Ambisense" for the generation of influenza A viruses: vRNAAad and mRNA synthesis from one template "(A" Ambisense "method for preparing influenza A viruses: synthesis of vRNA and mRNA from one template)Virology15: 267(2): 310-7) the EGFP minigenome; and the CAT minigenome system pPOLI-CAT-RT described by Pleschka et al ((1996) J.Virol.70 (6): 4188-.

To identify and characterize sequences required for efficient transcription initiation using these systems, the various deletion/substitution mutants described above or the sequences of SEQ ID NOs: 1 into a reporter plasmid (e.g., PFlu-CAT, EGFP minigenome) selected so that transcription of negative-sense copies of the reporter gene is dependent on the transcriptional initiation of the deletion or substitution mutant. The EGFP-containing constructs described above are generally useful for making such deletion or substitution mutants. The viral RNA-dependent RNA polymerase can then synthesize positive-strand mRNA from the negative-strand RNA transcribed from the reporter plasmid. The cellular machinery then translates the positive strand mRNA, allowing the detection of reporter protein (EGFP or CAT) activity.

In these experiments, a panel of expression plasmids containing the cDNA of PB1, PB2, PA and NP or PB1, PA, NP (-PB2 as negative control) was transfected into MDCK cells together with plasmids containing the influenza a virus EGFP minigenome or pFlu-CAT reporter under the control of putative canine RNA pol I regulatory sequences. The cells are then cultured under conditions that permit transcription and translation of the reporter sequence.

The activity of the reporter protein is detected using conventional techniques. For EGFP, transfected cells were observed with a phase contrast microscope or a fluorescence microscope 48 hours after transfection. Alternatively, flow cytometry can also be used to detect EGFP expression. In an assay using a minigenome containing the CAT gene, polymerase activity was detected using pPlu-CAT. In such assays, CAT expression can be determined by direct detection of CAT protein (e.g., by ELISA), detection of mRNA encoding CAT (e.g., by Northern blotting), or detection of CAT activity (e.g., detection of transfer of radiolabeled acetyl groups to an appropriate substrate) as an indicator of reporter activity.

For example, a DNA fragment of an MDCK clone exhibiting promoter activity (see primer extension and transcription experiments above) was cloned upstream of an insert comprising 5 'and 3' untranslated regions of influenza virus fused to the 5 'and 3' ends, respectively, of an antisense EGFP gene, followed by a murine Pol I terminator (see fig. 11). Three different constructs were co-prepared, differing in the inserted MDCK sequence: SEQ ID NO:1, 1-1807(-1), 1-1808(+1) and 1-1809(+ 2). These constructs were combined with expression plasmids for influenza replication proteins (PB1, PB2, PA and NP), respectively, and introduced into MDCK cells by electroporation. Cells were examined by fluorescence microscopy 24 hours after electroporation. As shown in fig. 12, all three MDCK fragments, -1, +1, and +2 (top left, top center, and top right, respectively) produce EGFP fluorescence, whereas constructs lacking promoter activity only display background fluorescence (bottom left). The 1-1808(+1) fragment produced the highest level of fluorescence. A plasmid containing the CMV promoter driving EGFP expression was used as a positive control (lower right panel).

The influenza replication proteins replicate only the authentic influenza vRNA ends. The EGFP signal of each plasmid containing the MDCK polI sequence indicates that the canine regulatory sequence fragment contains promoter activity, thereby producing RNA containing the correct influenza virus vRNA terminus, and thus supporting influenza virus replication.

Other assays that may be used to identify and characterize canine RNA pol I regulatory sequences include RNA footprint assays. In this method, an RNA molecule comprising, for example, the sequence shown in FIGS. 9A-C is contacted with one or more subunits of canine RNA polymerase I. One or more subunits of canine RNA pol I bind to the appropriate RNA sequence according to its particular affinity. The RNA unprotected by one or more of the subunits of canine RNA polymerase is then degraded by an RNase, such as RNase I. Subsequently, the RNase is inactivated and the protected RNA fragments are isolated from one or more protective subunits of RNA polymerase I. The isolated fragment contains a sequence that binds to one or more subunits of RNA polymerase I, which is an excellent candidate sequence for promoter/enhancer activity. In addition, these footprint experiments can also be performed in the presence of different subunits of canine RNA polymerase I to identify which subunit binds to which RNA sequence. These experiments help to determine the activity of different binding sequences, for example, by comparing the sequences of different canine Pol I polymerase subunits with RNA polymerase I subunits of other species whose sequence and binding specificity are known.

Transcription from putative canine RNA pol I regulatory sequences can also be monitored using in vitro techniques. In these techniques, the various deletion/substitution mutants described above or the amino acid sequence of SEQ ID NO:1 or 26 is operably linked to the transcript of interest. A set of canine RNA polymerase I proteins required for transcription is then added to the transcript. Efficient transcription is detected by detecting RNA transcripts prepared from canine RNA polymerase I protein (e.g., by Northern blotting).

Similar experiments can be used to identify other canine RNA pol I regulatory elements, such as enhancers, repressors, or other elements that affect transcription of RNA pol I. In such an assay, the nucleic acid molecule comprising SEQ ID NO:1 with the deletion, substitution or subsequence of seq id No. 1, and comparing the expression level of the microrna polI promoter identified above. By comparing the expression levels, the presence or absence of elements associated with increased or decreased transcription can be identified.

7.12 Example 12: influenza virus rescue in MDCK cells

This example describes the rescue of influenza virus in MDCK cell culture using the canine RNA pol I regulatory element cloned in example 10.

Conventional molecular biology techniques were used to construct 8 expression vectors encoding viral genomic RNA under the control of the canine RNA pol I promoter. Specifically, plasmid expression vector pAD4000(SEQ ID NO:29, FIG. 13) was constructed from the pAD3000 vector (Hoffman et al, PNAS (2002), 99 (17): 11411 and 11416, FIG. 10) by replacing the 213bp human Pol I promoter sequence in pAD3000 with the 469bp fragment (bases 1-469 in pAD4000) of the MDCK EcoRI-BamHI subclone (bases 1808 and 1340 of SEQ ID NO: 1). Note that: the 469bp fragment in FIG. 13 is shown as bases 1-469, but in a reverse complementary orientation. The 469bp MDCK fragment contains a functional canine Pol I promoter. In addition, the 18bp linker sequence AGGAGACGGTACCGTCTC (SEQ ID NO: 30) in pAD3000 was replaced with the 24bp linker sequence AGAGTCTTCTCGAGTAGAAGACCG (SEQ ID NO: 31) in pAD 4000.

8 influenza virus segments encoding MDV B genomes were cloned into 8 independent pAD4000 expression vectors (under the control of a functional canine Pol I promoter), 2 of the 8 influenza virus segments (NS, SEQ ID NO: 32 and PB1, SEQ ID NO: 40) containing silent mutations (SEQ ID NOS: 33 and 41, respectively, and FIG. 16). Then in Invitrogen (Invitrogen) serum-free Opti-MEMThe 8 expression vectors were electroporated into MDCK cells in medium I, and the supernatant of the cells was used to inoculate eggs. Viruses were collected from HA-positive eggs after 72 hours incubation at 33 ℃. RT-PCR reactions (see, primer sequences (SEQ ID NOS: 34-39) and annealing positions in FIGS. 14 and 15) were performed on RNA extracted from viruses, followed by nucleotide sequence analysis of the PCR products. Based on the presence of PB1 and NS segments containing silent mutations, it was determined that infectious live influenza viruses had been rescued in MDCK cells.

Found rescued viruses in the supernatant (MDV-B and MDV-Bm [ MDV-B with silent mutations]) The titer of (a) is unexpectedly high. See table 6. For example, 4-5log was detected on day 3₁₀PFU/ml virus. Viral titers rescued by the human Pol I promoter system on Vero cell basis were generally only those on days 2 to3<100 pfu. Thus, the canine Pol I plasmid rescue system described herein appears to be far more effective than the existing plasmid rescue techniques described by others.

TABLE 6

The effectiveness of the canine Pol I plasmid rescue system was demonstrated by rescue of the b and a strains ca primary donor virus (MDV) and a number of reassortants, type a and type b. For reassortants, 6 internal gene segments of the appropriate MDV (a or B strain) were combined with HA and NA segments of H1N1, H2N2, H3N2, a strain of H5N1 subtype or a B strain of Yamagata or B/Victoria lineage. Table 7 summarizes the rescued MDV strains and reassortants. These viruses were rescued essentially as described above. Influenza virus segments encoding the genome of the a or b virus strains were cloned into different pad4000 expression vectors (containing the functional canine Pol I promoter described above). Then encoding to rescue strains of all 8 influenza virus segments of 8 expression vectors were transfected into serum-free Opti-MEMI MDCK cells in medium (invitrogen) were used to inoculate eggs with cell supernatants. In these experiments, transfection was carried out using the non-liposomal transfection reagent from PK of Germany (PromoFectin catalogue number PK-CT-2000, PromoKine, Germany) according to the manufacturer's instructions. HA was collected from HA positive eggs after 72 hours incubation at 33 ℃.

TABLE 7

Although the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all of the techniques and devices described above may be used in various combinations. All publications, patents, patent applications, or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent application, or other document were individually indicated to be incorporated by reference for all purposes. Further, the following patent applications are incorporated herein by reference in their entirety for all purposes: PCT patent application Ser. No. PCT/US2006/023867, filed on 20/6/2006; U.S. patent application serial No. 11/455,734 filed on 20/6/2006; 11/501,067 filed on 8/9/2006; U.S. provisional patent application No. 60/793,522 filed on 19/4/2006; U.S.60/793,525 filed on 19/4/2006; U.S.60/702,006 filed on 22/7/2005; U.S.60/699,556, filed on 7/15/2005; U.S.60/699,555, filed on 7/15/2005; U.S.60/692,965, filed on 21/6/2005; and U.S.60/692,978 filed on 21/6/2005.

Sequence listing

<110> Middy Minini Co., Ltd (MedImune Vaccines, Inc)

G. Duke (Duke, Gregory)

G. Canbao (Kemble, George)

J. Poplar (Young, James)

King call sound box (Wang, Zhaoti)

<120> methods and compositions for expressing negative-sense viral RNA in canine cells

<130>FL412PCT2

<150>11/501,067

<151>2007-08-09

<150>11/455,734

<151>2006-06-20

<150>60/793,522

<151>2006-04-19

<150>60/793,525

<151>2006-04-19

<160>41

<170>PatentIn version 3.3

<210>1

<211>3537

<212>DNA

<213> dog (Canis familiaris)

<400>1

aattctggag aaacagattg tgttataaga aagaaagaaa gaaagaaaga aagaaagaaa 60

gagaaaatcc ttatgttctt tgagcctccc ctccccccca gaattgagtt cctcttccac 120

gacctcttct cattcaaccc aatagacaag tatttggggg ggggggtcag gtcccagacg 180

ctgagagggt ggaggtgaag gtggtgcggg gggggggggg cacaccgtcc tctccagcgc 240

ctttggttca gacctccttc gtgacctccc tccctccctc cctccctcct ccctcctcct 300

cctcctccct cttcgtctta taaatatata aataaaatcc taaagaaaag aaaaagaaaa 360

aaaaaaaaag gaaggacacg agaaaaaacg gtgcatccgt tgccgtcctg agagtcctcg 420

cctggtttcg gctctacgtt ccctccctga cctcggaaac gtgcctgagt cgtcccggga 480

gccccgcgcg gcgagcgcga ccccctttcg ggcggcagcg ggcccggacg gacggacgga 540

cggacggacg ggttttccaa ggctcccccg ccccgggagg acgggggttc gcggtgcgcg 600

gccgtgtgct ccggggccct ccgccgtccc cgggccgaga ggcgagatcc gaggcgcctg 660

acggcctcgc cgcccggatc tgtcccgctg tcgttcgcgc cggttgtcgg gtgccactgg 720

cggccgcttt tatagagcgt gtccctccgg aggctcggcg gcgacaggca aggaacagct 780

ttggtgtcgg tttcccgggg ccgagttcca ggaggagggc ggctccggcg cgagcgtctg 840

tcgccggggc ctcggcgcga tgcgctcgcc ggagattgga ctccggagct gcgagggagt 900

gtcgccgtcg cccgtgtcgc ccgtgtccgc tccgcctcgc tcccggagga ggccgtgcgg 960

gccgcctggg tgggtcgacc agcaccgccg gtggctcctc ctcgcccgcg cggaccgacc 1020

tgggcgcctc gggggcgggg gacagggtgt gtcccgccgt ccgtcctgtg gctccgggcg 1080

atcttcgggc cttccttccg tgtcactcgg ttgtctcccg tggtcacgcc ctggcgacgg 1140

ggaccggtct gagcctggag gggaagcccg tgggtggcgc gacagacccg gctgcgggca 1200

cgtgtggggg tcccgggcgt cggacgcgat tttctcccct ttttccgagg cccgctgcgg 1260

aggtgggtcc cgggcggtcg gaccgggtgc cacgcggggg tgggcgggcc gtccgttcgg 1320

gcgtccggcc ccggtggcga ttcccggtga ggctgcctct gccgcgcgtg gccctccacc 1380

tcccctggcc cgagccgggg ttggggacgg cggtaggcac ggggcggtcc tgagggccgc 1440

gggggacggc ctccgcacgg tgcctgcctc cggagaactt tgatgatttt tcaaagtctc 1500

ctcccggaga tcactggctt ggcggcgtgg cggcgtggcg gcgtggcggc gtggcggcgt 1560

ggcggcgtgg cgtctccacc gaccgcgtat cgcccctcct cccctccccc cccccccccg 1620

ttccctgggt cgaccagata gccctggggg ctccgtgggg tgggggtggg ggggcgccgt 1680

ggggcaggtt ttggggacag ttggccgtgt cacggtcccg ggaggtcgcg gtgacctgtg 1740

gctggtcccc gccggcaggc gcggttattt tcttgcccga gatgaacatt ttttgttgcc 1800

aggtaggtgc tgacacgttg tgtttcggcg acaggcagac agacgacagg cagacgtaaa 1860

agacagccgg tccgtccgtc gctcgcctta gagatgtggg cctctgggcg cgggtggggt 1920

tccgggcttg accgcgcggc cgagccggtc cctgtcctcg ctcgctggag cctgagccgt 1980

ccgcctgggc ctgcgcgccg gctctcgtgc tggactccag gtggcccggg tcgcggtgtc 2040

gccctccggt ctccggcacc cgagggaggg cggtgtgggc aggtggcggt gggtctttta 2100

cccccgtgcg ctccatgccg tgggcacccg gccgttggcc gtgacaaccc ctgtctcgca 2160

aggctccgtg ccgcgtgtca ggcgtccccc gctgtgtctg gggttgtccg gtcgctcctg 2220

cccccccccc cccgggggtc gaggggcttg ccggtgaggc ggaagcaggt ccccccggtc 2280

gccgtcctcg ctgggctttt gctcctcggg aagccccctc ggggccgcag cttgctgccg 2340

atcgatcgat gtggtgatct cgtgctctcc tgggccgggc ctaagccgcg tcagacgagg 2400

gacgggcgtc cacggcggat gcgaccgctc ttctcgttct gcccgcgggc ccctccctcc 2460

ccggctcctc cgcgcccggc cgtcgtggcg ggtgcgcggg gggcgcgcgc cggggttggg 2520

ggtggtgcgg actccggccc gaccccggcc tcccgccttc ttgcctcgcg gcgctggcgg 2580

gaccggggtc ctcggacgcg gcggacactc tcgccggcct ttcccgaagg ccctgggtcc 2640

gtggcgagcg gccctcccct cctccgcggg ggagggccgg cccgacgccg cgctgctcac 2700

cgcccggcct gggcgcgctt gagcgcgttg cgcccggccc tccgtggtgc ccctggagcg 2760

ctccaggtcg cctcaggtgc ctgaggccga gcggtggcgt cgtttccttc cccggcgact 2820

cccctcgggc tgccgccgcc gtcgtcggcg tgtccgagga gcgggtggtg gaagaagtcg 2880

gcaagggagg cgcacccgtg cccctggcgg gggcgcgggc gcctcgtctt ccttcccctc 2940

tcctctcctc ccccctcgcg cgccggcggg gggtgggtgg cgtggggcgg tgtgactcgg 3000

aggacttggc ggggctcgtg aggccgcggc gggccgggcc acgccgcggc gcttgccagc 3060

cgaggggctg cccctctctc cggcacgggt cgtgtccccg tctccgtccc tctctctcgc 3120

gctcgcggga ggcggggagc tctctcctct gggcggtgac gtgaccacgc cgtgcgcggg 3180

cgaggcgggg gtggcgtcct cgagggggca ccggccgcga gcgctcgggg ttgccctgtg 3240

cctgtccctt gccggagatc cgccccccgc cccgcgagcc tgtcggcccc ggagcgccgc 3300

ctggtggggc ccgtttggga ggacgaacgg gtggggcgat gcgccctcgg tgagaaagcc 3360

ttctctagcg atccgagagg gtgccttggg gtaccggagc ccccagccgc tgcccctcct 3420

ctgcgcgtgt agtgtggcca gcgacgcggg gttggactcc cgtcgcgacg tgtttgggca 3480

gagtgccgct ctttgcctac ctacccgcgc tgcgctcccc cctccgagac gggggag 3537

<210>2

<211>333

<212>DNA

<213> dog (Canis familiaris)

<400>2

ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60

cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120

cctccccccc cccccccgtt ccctgggtcg accagatagc cctgggggct ccgtggggtg 180

ggggtggggg ggcgccgtgg ggcaggtttt ggggacagtt ggccgtgtca cggtcccggg 240

aggtcgcggt gacctgtggc tggtccccgc cggcaggcgc ggttattttc ttgcccgaga 300

tgaacatttt ttgttgccag gtaggtgctg aca 333

<210>3

<211>168

<212>DNA

<213> dog (Canis familiaris)

<400>3

gggctccgtg gggtgggggt gggggggcgc cgtggggcag gttttgggga cagttggccg 60

tgtcacggtc ccgggaggtc gcggtgacct gtggctggtc cccgccggca ggcgcggtta 120

ttttcttgcc cgagatgaac attttttgtt gccaggtagg tgctgaca 168

<210>4

<211>140

<212>DNA

<213> dog (Canis familiaris)

<400>4

gccgtggggc aggttttggg gacagttggc cgtgtcacgg tcccgggagg tcgcggtgac 60

ctgtggctgg tccccgccgg caggcgcggt tattttcttg cccgagatga acattttttg 120

ttgccaggta ggtgctgaca 140

<210>5

<211>114

<212>DNA

<213> dog (Canis familiaris)

<400>5

tggccgtgtc acggtcccgg gaggtcgcgg tgacctgtgg ctggtccccg ccggcaggcg 60

cggttatttt cttgcccgag atgaacattt tttgttgcca ggtaggtgct gaca 114

<210>6

<211>85

<212>DNA

<213> dog (Canis familiaris)

<400>6

gtgacctgtg gctggtcccc gccggcaggc gcggttattt tcttgcccga gatgaacatt 60

ttttgttgcc aggtaggtgc tgaca 85

<210>7

<211>59

<212>DNA

<213> dog (Canis familiaris)

<400>7

aggcgcggtt attttcttgc ccgagatgaa cattttttgt tgccaggtag gtgctgaca 59

<210>8

<211>164

<212>DNA

<213> dog (Canis familiaris)

<400>8

ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60

cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120

cctccccccc cccccccgtt ccctgggtcg accagatagc cctg 164

<210>9

<211>137

<212>DNA

<213> dog (Canis familiaris)

<400>9

ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60

cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120

cctccccccc ccccccc 137

<210>10

<211>109

<212>DNA

<213> dog (Canis familiaris)

<400>10

ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60

cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatc 109

<210>11

<211>55

<212>DNA

<213> dog (Canis familiaris)

<400>11

ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgt 55

<210>12

<211>299

<212>DNA

<213> dog (Canis familiaris)

<400>12

ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60

cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120

cctccccccc cccccccgtt ccctgggtcg accagatagc cctgggggct ccgtggggtg 180

ggggtggggg ggcgccgtgg ggcaggtttt ggggacagtt ggccgtgtca cggtcccggg 240

aggtcgcggt gacctgtggc tggtccccgc cggcaggcgc ggttattttc ttgcccgag 299

<210>13

<211>244

<212>DNA

<213> dog (Canis familiaris)

<400>13

ggcggcgtgg cggcgtggcg gcgtggcggc gtggcgtctc caccgacccg tatcgcccct 60

cctcccctcc cccccccccc ccgttccctg ggtcgaccag atagccctgg gggctccgtg 120

gggtgggggt gggggggcgc cgtggggcag gttttgggga cagttggccg tgtcacggtc 180

ccgggaggtc gcggtgacct gtggctggtc cccgccggca ggcgcggtta ttttcttgcc 240

cgag 244

<210>14

<211>190

<212>DNA

<213> dog (Canis familiaris)

<400>14

gcccctcctc ccctcccccc ccccccccgt tccctgggtc gaccagatag ccctgggggc 60

tccgtggggt gggggtgggg gggcgccgtg gggcaggttt tggggacagt tggccgtgtc 120

acggtcccgg gaggtcgcgg tgacctgtgg ctggtccccg ccggcaggcg cggttatttt 180

cttgcccgag 190

<210>15

<211>134

<212>DNA

<213> dog (Canis familiaris)

<400>15

gggctccgtg gggtgggggt gggggggcgc cgtggggcag gttttgggga cagttggccg 60

tgtcacggtc ccgggaggtc gcggtgacct gtggctggtc cccgccggca ggcgcggtta 120

ttttcttgcc cgag 134

<210>16

<211>106

<212>DNA

<213> dog (Canis familiaris)

<400>16

gccgtggggc aggttttggg gacagttggc cgtgtcacgg tcccgggagg tcgcggtgac 60

ctgtggctgg tccccgccgg caggcgcggt tattttcttg cccgag 106

<210>17

<211>80

<212>DNA

<213> dog (Canis familiaris)

<400>17

tggccgtgtc acggtcccgg gaggtcgcgg tgacctgtgg ctggtccccg ccggcaggcg 60

cggttatttt cttgcccgag 80

<210>18

<211>217

<212>DNA

<213> dog (Canis familiaris)

<400>18

ggcgtggcgt ctccaccgac ccgtatcgcc cctcctcccc tccccccccc cccccgttcc 60

ctgggtcgac cagatagccc tgggggctcc gtggggtggg ggtggggggg cgccgtgggg 120

caggttttgg ggacagttgg ccgtgtcacg gtcccgggag gtcgcggtga cctgtggctg 180

gtccccgccg gcaggcgcgg ttattttctt gcccgag 217

<210>19

<211>56

<212>DNA

<213> dog (Canis familiaris)

<400>19

tcgcggtgac ctgtggctgg tccccgccgg caggcgcggt tattttcttg cccgag 56

<210>20

<211>336

<212>DNA

<213> dog (Canis familiaris)

<400>20

ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60

ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120

tcccctcccc cccccccccc gttccctggg tcgaccagat agccctgggg gctccgtggg 180

gtgggggtgg gggggcgccg tggggcaggt tttggggaca gttggccgtg tcacggtccc 240

gggaggtcgc ggtgacctgt ggctggtccc cgccggcagg cgcggttatt ttcttgcccg 300

agatgaacat tttttgttgc caggtaggtg ctgaca 336

<210>21

<211>167

<212>DNA

<213> dog (Canis familiaris)

<400>21

ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60

ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120

tcccctcccc cccccccccc gttccctggg tcgaccagat agccctg 167

<210>22

<211>140

<212>DNA

<213> dog (Canis familiaris)

<400>22

ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60

ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120

tcccctcccc cccccccccc 140

<210>23

<211>112

<212>DNA

<213> dog (Canis familiaris)

<400>23

ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60

ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tc 112

<210>24

<211>57

<212>DNA

<213> dog (Canis familiaris)

<400>24

ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgt 57

<210>25

<211>302

<212>DNA

<213> dog (Canis familiaris)

<400>25

ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60

ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120

tcccctcccc cccccccccc gttccctggg tcgaccagat agccctgggg gctccgtggg 180

gtgggggtgg gggggcgccg tggggcaggt tttggggaca gttggccgtg tcacggtccc 240

gggaggtcgc ggtgacctgt ggctggtccc cgccggcagg cgcggttatt ttcttgcccg 300

ag 302

<210>26

<211>469

<212>DNA

<213> dog (Canis familiaris)

<400>26

attcccggtg aggctgcctc tgccgcgcgt ggccctccac ctcccctggc ccgagccggg 60

gttggggacg gcggtaggca cggggcggtc ctgagggccg cgggggacgg cctccgcacg 120

gtgcctgcct ccggagaact ttgatgattt ttcaaagtct cctcccggag atcactggct 180

tggcggcgtg gcggcgtggc ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac 240

cgaccgcgta tcgcccctcc tcccctcccc cccccccccc gttccctggg tcgaccagat 300

agccctgggg gctccgtggg gtgggggtgg gggggcgccg tggggcaggt tttggggaca 360

gttggccgtg tcacggtccc gggaggtcgc ggtgacctgt ggctggtccc cgccggcagg 420

cgcggttatt ttcttgcccg agatgaacat tttttgttgc caggtaggt 469

<210>27

<211>245

<212>DNA

<213> dog (Canis familiaris)

<400>27

ggcggcgtgg cggcgtggcg gcgtggcggc gtggcgtctc caccgaccgc gtatcgcccc 60

tcctcccctc cccccccccc cccgttccct gggtcgacca gatagccctg ggggctccgt 120

ggggtggggg tgggggggcg ccgtggggca ggttttgggg acagttggcc gtgtcacggt 180

cccgggaggt cgcggtgacc tgtggctggt ccccgccggc aggcgcggtt attttcttgc 240

ccgag 245

<210>28

<211>218

<212>DNA

<213> dog (Canis familiaris)

<400>28

ggcgtggcgt ctccaccgac cgcgtatcgc ccctcctccc ctcccccccc ccccccgttc 60

cctgggtcga ccagatagcc ctgggggctc cgtggggtgg gggtgggggg gcgccgtggg 120

gcaggttttg gggacagttg gccgtgtcac ggtcccggga ggtcgcggtg acctgtggct 180

ggtccccgcc ggcaggcgcg gttattttct tgcccgag 218

<210>29

<211>3100

<212>DNA

<213> Artificial

<220>

<223> plasmid

<400>29

acctacctgg caacaaaaaa tgttcatctc gggcaagaaa ataaccgcgc ctgccggcgg 60

ggaccagcca caggtcaccg cgacctcccg ggaccgtgac acggccaact gtccccaaaa 120

cctgccccac ggcgcccccc cacccccacc ccacggagcc cccagggcta tctggtcgac 180

ccagggaacg gggggggggg gggaggggag gaggggcgat acgcggtcgg tggagacgcc 240

acgccgccac gccgccacgc cgccacgccg ccacgccgcc acgccgccaa gccagtgatc 300

tccgggagga gactttgaaa aatcatcaaa gttctccgga ggcaggcacc gtgcggaggc 360

cgtcccccgc ggccctcagg accgccccgt gcctaccgcc gtccccaacc ccggctcggg 420

ccaggggagg tggagggcca cgcgcggcag aggcagcctc accgggaata tcgggcccgt 480

cacctcagac atgataagat acattgatga gtttggacaa accacaacta gaatgcagtg 540

aaaaaaatgc tttatttgtg aaatttgtga tgctattgct ttatttgtaa ccattataag 600

ctgcaataaa caaggatctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 660

gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 720

ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 780

acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 840

cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 900

caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 960

gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 1020

tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt 1080

aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 1140

ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 1200

cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 1260

tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc 1320

tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 1380

ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 1440

aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 1500

aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa 1560

aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat 1620

gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct 1680

gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg 1740

caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag 1800

ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta 1860

attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg 1920

ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg 1980

gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct 2040

ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta 2100

tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg 2160

gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc 2220

cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg 2280

gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga 2340

tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg 2400

ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat 2460

gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc 2520

tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca 2580

catttccccg aaaagtgcca cctgacgtcg atatgccaag tacgccccct attgacgtca 2640

atgacggtaa atggcccgcc tggcattatg cccagtacat gaccttatgg gactttccta 2700

cttggcagta catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt 2760

acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg 2820

acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca 2880

actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca 2940

gagctctctg gctaactaga gaacccactg cttactggct tatcgaaatt aatacgactc 3000

actataggga gacccaagct gttaacgcta gctagcagtt aaccggagta ctggtcgacc 3060

tccgaagttg ggggggagag tcttctcgag tagaagaccg 3100

<210>30

<211>18

<212>DNA

<213> Artificial

<220>

<223> synthetic linker

<400>30

aggagacggt accgtctc 18

<210>31

<211>24

<212>DNA

<213> Artificial

<220>

<223> synthetic linker

<400>31

agagtcttct cgagtagaag accg 24

<210>32

<211>119

<212>DNA

<213> influenza B virus

<400>32

aaaaattcct caaatagcaa ctgtccaaac tgcaattgga ccgattaccc tccaacacca 60

ggaaagtgcc ttgatgacat agaagaagaa ccggagaatg ttgatgaccc aactgaaat 119

<210>33

<211>119

<212>DNA

<213> influenza B virus

<400>33

aaaaattcct caaatagcaa ctgtccaaac tgcaattgga ccgattaccc tccaacgcca 60

ggaaagtgcc ttgatgacat agaagaagaa ccggagaatg ttgatgaccc aactgaaat 119

<210>34

<211>20

<212>DNA

<213> Artificial

<220>

<223> synthetic primer

<400>34

ggcactaatg gtcacaactg 20

<210>35

<211>22

<212>DNA

<213> Artificial

<220>

<223> synthetic primer

<400>35

atcagagggt ttgtattagt ag 22

<210>36

<211>20

<212>DNA

<213> Artificial

<220>

<223> synthetic primer

<400>36

tgggctgtct ctggttattc 20

<210>37

<211>20

<212>DNA

<213> Artificial

<220>

<223> synthetic primer

<400>37

tctctttatg aggaaaccct 20

<210>38

<211>20

<212>DNA

<213> dog (Canis familiaris)

<400>38

gtgagcctga aagtaaaagg 20

<210>39

<211>20

<212>DNA

<213> Artificial

<220>

<223> synthetic primer

<400>39

gcaacaagtt tagcaacaag 20

<210>40

<211>423

<212>DNA

<213> influenza B virus

<400>40

tcattgattc attggacaaa cctgaaatga ctttcttctc ggtaaagaat ataaagaaaa 60

aattgcctgc taaaaacaga aagggtttcc tcataaagag aataccaatg aaggtaaaag 120

acagaataac cagagtggaa tacatcaaaa gagcattatc attaaacaca atgacaaaag 180

atgctgaaag aggcaaacta aaaagaagag caattgccac cgctgggata caaatcagag 240

ggtttgtatt agtagttgaa aacttggcta aaaatatctg tgaaaatcta gaacaaagtg 300

gtttgccagt aggtgggaac gagaagaagg ccaaactgtc aaatgcagtg gccaaaatgc 360

tcagtaactg cccaccagga gggatcagca tgacagtgac aggagacaat actaaatgga 420

atg 423

<210>41

<211>423

<212>DNA

<213> influenza B virus

<400>41

tcattgattc attggacaaa cctgaaatga ccttcttctc ggtaaagaat ataaagaaaa 60

aattgcctgc taaaaacaga aagggtttcc tcataaagag aataccaatg aaggtaaaag 120

acagaataac cagagtggaa tacatcaaaa gagcattatc attaaacaca atgacaaaag 180

atgctgaaag aggcaaacta aaaagaagag caattgccac cgctgggata caaatcagag 240

ggtttgtatt agtagttgaa aacttggcta aaaatatctg tgaaaatcta gaacaaagtg 300

gtttgccagt aggtgggaac gagaagaagg ccaaactgtc aaatgcagtg gccaaaatgc 360

tcagtaactg cccaccagga gggatcagca tgacggtgac aggagacaat actaaatgga 420

atg 423

Claims (23)

1. A canine RNA polymerase I promoter shown as SEQ ID NO. 26.

2. An isolated nucleic acid consisting of the promoter of claim 1, a cDNA encoding a negative-strand viral genomic RNA or a corresponding cRNA, and optionally one or more expression control elements, wherein the promoter is operably linked to the cDNA encoding a negative-strand viral genomic RNA or a corresponding cRNA.

3. The isolated nucleic acid of claim 2, wherein said one or more expression control elements are selected from the group consisting of an enhancer sequence and a transcription termination sequence.

4. The isolated nucleic acid of claim 2 or 3, wherein the minus-strand viral genomic RNA is an influenza genomic RNA.

5. A method of producing an influenza genomic RNA, comprising transcribing the isolated nucleic acid of claim 4 in a cell, thereby producing an influenza genomic RNA.

6. An expression vector comprising the isolated nucleic acid of claim 4.

7. A method for producing an influenza genomic RNA, comprising introducing the expression vector of claim 6 into a cell to thereby produce an influenza genomic RNA.

8. A cell comprising the expression vector of claim 6.

9. The cell of claim 8, wherein the cell is a canine cell.

10. The cell of claim 9, wherein the canine cell is a kidney cell.

11. The cell of claim 10, wherein the kidney cell is an MDCK cell.

12. A method of producing a recombinant influenza virus, the method comprising culturing a canine cell comprising the expression vector of claim 6 and one or more expression vectors that express mRNA encoding one or more influenza polypeptide selected from the group consisting of: PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS2, wherein each influenza polypeptide is used; and isolating the recombinant influenza virus.

13. The method of claim 12, wherein the influenza virus particles produced are infectious.

14, expression vector pAD4000 shown in SEQ ID NO. 29.

15. A method of producing a recombinant influenza virus, the method comprising:

(a) introducing an expression vector into a population of canine cells, said expression vector capable of expressing a genomic vRNA segment within said cells to provide a complete genomic vRNA segment of said virus, wherein said expression vector comprises a canine RNA polymerase I promoter as set forth in SEQ ID No. 26;

(b) introducing into said cell an expression vector capable of expressing mRNA encoding one or more polypeptides of said virus, wherein each influenza polypeptide is used; and

(c) culturing the cell to produce influenza virus particles.

16. The method of claim 15, wherein the titer of influenza virions produced by culturing said cells for 48 to 72 hours is at least 1.0 x 10⁴PFU/ml。

17. The method of claim 15, wherein the titer of influenza virions produced by culturing said cells for 48 to 72 hours is at least 1.0 x 10⁵PFU/ml。

18. The method of claim 15, wherein the influenza virus particles produced are infectious.

19. The method of claim 15, wherein the method utilizes a helper virus.

20. A method of producing a recombinant influenza virus, the method comprising:

i) introducing an expression vector into a population of canine cells, said expression vector

a) (ii) capable of expressing the genomic vRNA segment in said cell to provide a complete genomic vRNA segment of said virus, wherein one or more of said expression vectors comprises a canine RNA polymerase I promoter as set forth in SEQ ID No. 26; and

b) further capable of expressing in said cell an mRNA encoding one or more influenza polypeptide selected from the group consisting of: PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS2, wherein each influenza polypeptide is used; and

ii) culturing the cell thereby producing influenza virus particles.

21. The method of claim 20, wherein the titer of influenza virions produced by culturing said cells for 48 to 72 hours is at least 1.0 x 10⁴PFU/ml。

22. The method of claim 20, wherein the titer of influenza virions produced by culturing said cells for 48 to 72 hours is at least 1.0 x 10⁵PFU/ml。

23. The method of claim 20, wherein the method utilizes a helper virus.