KR101436176B1 - Methods and compositions for expressing negative-sense viral rna in canine cells - Google Patents

Abstract

The present invention provides novel dog polI regulatory nucleic acid sequences useful for expressing nucleic acid sequences in dog cells, e.g., MDCK cells. The present invention also provides a method for producing an influenza virus, for example, an infectious influenza virus, using an expression vector comprising such a nucleic acid, a cell, and the nucleic acid.

Description

METHODS AND COMPOSITIONS FOR EXPRESSING NEGATIVE-SENSE VIRAL RNA IN CANINE CELLS [0002]

1. Field of the Invention

In one aspect, the invention provides a separate nucleic acid comprising the RNA RNA polymerase I regulatory sequence. In another aspect, the present invention provides a method for producing an influenza virus, for example, an infectious influenza virus, using an expression vector and a cell comprising such a nucleic acid, and using the nucleic acid.

2. BACKGROUND ART

The epidemic of influenza is characterized by a doubling of the prevalence and mortality rates of the world population due to influenza-induced diseases. Several factors that influence the severity and extent of this epidemic include reduced human immunity, and transfection efficiency of inter-human viruses. Among these factors, metastatic efficiency is generally influenced not only by the virus itself, but also by the population density and the ease with which a particular area can travel through travel. The virus that causes this epidemic is an emerging antigenic variant that has been infected with little or no immunity since most people have never been infected before. In addition, in order for this disease to spread rapidly, it must necessarily transfer efficiently between humans. When the animal virus infiltrates into the human community in a common form, the virus must adapt to replicate in the human body, Transition must be efficient.

Influenza has a very rapid rate of diffusion and its impact is tremendous. The most serious of the twentieth century was in 1918, when more than 500,000 US citizens died, and between 20,000 and 40,000 deaths worldwide. These infectious diseases float to infect individuals, and develop from weeks to months after infection. The onset and spread of infectious influenza is relatively rapid and presents a number of challenges in dealing with terrible catastrophes that can lead the world to panic, putting a tremendous burden on first aid officials and health officials. It is clear that prompt identification and action of the recent epidemic is an essential component of a solution to these problems; Currently, several programs are being implemented worldwide to monitor the recent influenza viruses, including the avian influenza virus, which is rare but causes human disease. The surveillance data obtained through this process are used together with a pandemic alert level, which is set in advance to identify the threat of the disease and to provide effective countermeasures against the disease.

Vaccination is the most important public health tool in preventing influenza-induced illness every year. If the interval is short enough to detect a potential infectious disease and significantly increase the onset level, it is quite disadvantageous to produce enough vaccines to protect a large number of humans. Prior to the next epidemic of the epidemic, vaccine production techniques and the necessary basic facilities will be important in significantly reducing morbidity and mortality. Reducing the response times required to produce a "pandemic vaccine" will also shorten the time to develop a study period or methods to provide an effective response.

Currently, all influenza vaccines against non-communicable strains marketed in the United States have been propagated in hatched eggs. Since influenza viruses are well propagated in eggs, the production of vaccines depends on the egg's ability to survive. In this case, the eggs must be supplied systematically, and the strains necessary for vaccine production must be selected several months before the onset of the subsequent influenza season, so that there is a limit to adaptability in the production of vaccines, and sometimes the production and supply of the vaccine is delayed Not only this, but also the supply of such a vaccine is disrupted. Unfortunately, several influenza vaccine strains, for example, the ancestral type A / Fujian / 411/02 strains, which were prevalent from 2003 to 2004, were not replicated well in hatching eggs, It had to be separated through culture.

In addition, a system for producing influenza viruses in cell culture fluids has also been developed recently (see, for example, Furminger. Vaccine Production, Nicholson et al. (Eds) Textbook of Influenza pp. 324-332; Merten et al. (1996) Production of influenza virus in cell cultures for vaccine preparation, Cohen & Shafferman (eds) Novel Strategies in Design and Production of Vaccines pp. 141-151]. Typically, such methods comprise infecting a suitable infinite proliferative host cell with a selected strain of the virus. By eliminating many of the obstacles associated with producing vaccines in eggs, not all pathogenic strains of the influenza virus are well proliferating nor can they be produced according to established tissue culture methods. In addition, a number of strains which are suitable for the production of live attenuated vaccines and have the desired properties, for example, attenuation, temperature sensitivity and cold adaptation, It does not proliferate successfully in tissue culture medium.

In addition to a cell culture method based on infecting a cell culture with a living virus, there is also a method of producing a completely infectious influenza virus using a recombinant DNA technique in a cell culture medium. Production of influenza virus using recombinant DNA significantly increases the applicability and usefulness of tissue culture methods for influenza vaccine production. Recently, a system has been reported for producing influenza A virus and influenza B virus from recombinant plasmids in which the cDNA encoding the viral genome is integrated. For example, Neumann et al. (1999) Generation of influenza A virus entirely from cloned cDNAs. Proc Natl Acad Sci USA 96: 9345-9350; Fodor et al. (1999) Rescue of influenza A virus from recombinant DNA. J. Virol 73: 9679-9682; Hoffmann et al. (2000) A DNA transfection system for generation of influenza viruses from eight plasmids Proc Natl Acad Sci USA 97: 6108-6113; WO 01/83794; Hoffmann and Webster (2000), Unidirectional RNA polymerase I-polymerase II transcription system for the generation of influenza viruses from eight plasmids, 81: 2843-2847; Hoffmann et al. (2002), Rescue of influenza B viruses from 8 plasmids, 99 (17): 11411-11416; U.S. Patent Nos. 6,649,372 and 6,951,754; U.S. Patent Publications 20050003349 and 20050037487; Quot; herein incorporated by reference. Such a system (sometimes referred to as "plasmid rescue") provides the possibility to produce recombinant virus expressing immunogenic HA protein and NA protein from any selected strain.

However, such a recombinant method is based on the use of an expression vector containing an RNA polymerase I (RNA polI) regulatory element that induces transcription of the viral genome rRNA. Such regulatory elements are necessary to generate the defined 5 ' and 3 ' ends of influenza genomic RNA, thereby producing a fully infectious influenza virus. Current recombinant systems For example, in the systems described above, a human RNA pol I regulatory system is used to express viral RNA. Due to the species specificity of the RNA polI promoter, such regulatory elements are only active in human or primate cells. Therefore, plasmid salvage of influenza virus is only possible by transfecting a suitable plasmid into human or primate cells.

In addition, such human or primate cells often do not display sufficient influenza virus titer as is necessary for vaccine production. Alternatively, using Madin-Darby dog kidney cells (MDCK cells), the vaccine strain can be replicated so that it exhibits sufficient potency to produce a commercial vaccine. Therefore, two or more different cell cultures should be used to produce the influenza vaccine using plasmid salvage. Identification and cloning of the intracellular RNA polI regulatory sequence does not require the preparation of a separate culture solution for rescue because the plasmid can be rescued in the same cell culture medium as the cell culture solution required for viral replication. Therefore, there is a need to identify and clone dog RNA polI regulatory elements that can be used to construct vectors suitable for plasmid remediation in MDCK cells and other < RTI ID = 0.0 > These and other needs are met by the present invention.

The references or discussions referred to herein are not to be construed as an admission that such are prior art to the present invention. Also, references to patents should not be construed as acknowledging its usefulness.

3. Outline of invention

Disclosed herein are nucleic acids, including, for example, regulatory elements that can be used to express influenza genomic RNA in dog cells. Composition For example, isolated nucleic acids, vectors and cells comprising the inventive expression control sequences and methods of using them correspond to embodiments of the present invention.

Thus, in certain aspects, the isolated nucleic acid of the present invention comprises the RNA polymerase I (polI) regulatory sequence. In certain embodiments, the regulatory sequence comprises a promoter. In certain embodiments, the regulatory sequence comprises an enhancer. In certain embodiments, the regulatory sequence comprises both a promoter and an enhancer. In one embodiment, the regulatory sequence comprises a nucleotide or functional derivative thereof at the -250 to-1 position of the corresponding original promoter (based on the first nucleotide (also known as +1 nucleotide) transcribed from the promoter) . In one embodiment, the regulatory sequence is operably linked to a viral DNA, e. G., A cloned viral cDNA. In one embodiment, the cloned viral cDNA encodes a viral RNA of a negative or positive chain virus or a corresponding cRNA. In certain embodiments, the cloned virus cDNA encodes genomic viral RNA (or the corresponding cRNA) of influenza virus.

In one embodiment, the isolated nucleic acid of the invention comprises the RNA polymerase I regulatory sequence and the transcription termination sequence. In certain embodiments, the transcription termination sequence is an RNA polymerase I termination sequence. In certain embodiments, the transcription termination sequence is a human, monkey or polI termination sequence.

In certain aspects, the invention provides isolated nucleic acids comprising the < RTI ID = 0.0 > RNA polI < / RTI > promoter. Preferably, the two RNA polI promoters are operably linked to a nucleic acid to be transcribed, for example, influenza genomic RNA. In one embodiment, when a nucleic acid is introduced into a dog cell, the influenza genome RNA is transcribed, and in this case, if the appropriate influenza protein is present, the RNA transcript may be packaged with an infectious influenza virus. In one embodiment, there is provided a separate nucleic acid comprising an individual RNA control sequence of the invention (e. G., A single RNA pol I promoter), wherein the regulatory sequence is operably linked to the nucleic acid to be transcribed, When an appropriate in vitro or in vivo protein (for example, an RNP complex in the case of a nucleic acid encoding an influenza vRNA segment) is present, this regulatory sequence is transcribed. In one embodiment, the nucleic acid operably linked to the regulatory sequence is an influenza vRNA segment.

In certain embodiments, the nucleic acid of the invention binds to a human, primate, mouse or can polI polypeptide and comprises one or more nucleotide sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 28, Polynucleotide sequences or functionalially active fragments thereof that are identical to, for example, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% . In one embodiment, the polynucleotide sequence, or a functionally active fragment thereof, is also operably linked to a nucleotide sequence operatively linked to the nucleotide sequence in the presence of a suitable polypeptide (e. G., A human, primate, mouse or can polI polypeptide) It also has the ability to initiate transcription of polynucleotide sequences. In one embodiment, the "functional active fragment" of the nucleic acid set forth in SEQ ID NO: 1 to SEQ ID NO: 28 retains one or more of the functional activities (as described herein) of the full-length sequence of SEQ ID NO: 1 to SEQ ID NO: For example, the functionally active fragment of the regulatory sequence recited in SEQ ID NO: 1 is operably linked to the nucleic acid to be transcribed in such a way that the regulatory sequence fragments are operably provided to be transcribed in vitro or in vivo when the appropriate protein is present.

In certain embodiments, the nucleic acid of the invention binds to and / or binds to a human, primate, mouse or can polI polypeptide, or has a nucleotide sequence that is at least 100% identical to at least one nucleotide sequence selected from the group consisting of SEQ ID NOS: , Or a polynucleotide sequence or fragment thereof about 99%, 98%, 97%, 96%, 95%, 90%, 85% Sequence. In one embodiment, the polynucleotide sequences or fragments thereof of the present invention may also be operatively linked to a second sequence operably linked to the nucleotide sequence in the presence of a suitable polypeptide (e. G., Human, primate, mouse or can polI polypeptide) RTI ID = 0.0 > polynucleotide < / RTI >

In another embodiment, the isolated nucleic acid of the invention comprises the RNA polymerase I regulatory sequence and the ribozyme sequence. This may be, for example, a hepatitis delta virus genomic ribozyme sequence or a functional derivative thereof.

In one embodiment, the nucleic acid of the invention optionally encodes the genomic virus RNA from any negative strand RNA virus known to those skilled in the art. In certain embodiments, the viral RNA encodes the genomic viral RNA of a virus belonging to the Mononegavirales family. In certain embodiments, the viral RNA is selected from the group consisting of Paramyxoviridae, Pneumovirinae, Rhabdoviridae, Filoviridae, Bornaviridae, Orthomic Consumption Or genomic viral RNAs of the virus belonging to the family Orthomyxoviridae, Bunyaviridae or Arenaviridae. In certain embodiments, the viral RNA is selected from the group consisting of Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, Avulavirus, Pneumovirus, The compounds of the present invention can be used for the treatment of metapneumovirus, Vesiculovirus, Lyssavirus, Ephemerovirus, Cytorhabdovirus, Nucleorhabdovirus, Novirhabdovirus, Marburgvirus, Ebolavirus, Bornavirus, influenza virus A, influenza virus B, influenza virus C, Thogotovirus, Isavirus, Orthobunyavirus, Hantavirus, Nairovirus, Phlebovirus, The Spokane virus (Tospovirus), the viral RNA genome of the virus Arena (Arenavirus), Opio en Provence virus belonging to the virus (Ophiovirus), Te nyuyi virus (Tenuivirus) or delta virus (Deltavirus) codes. In certain embodiments, the viral RNA is selected from the group consisting of Sendai virus, measles virus, chicken pox virus, Hendra virus, Newcastle disease virus, human respiratory syncytial virus, Viruses such as avian pneumovirus, vesicular stomatitis Indiana virus, rabies virus, bovine ephemeral fever virus, lettuce necrotic yellows virus, potato yellow dwarf virus Potato yellow dwarf virus, Infectious hematopoietic necrosis virus, Lake Victoria marburg virus, Zaire ebolavirus, Borna disease virus, Influenza A virus , Influenza B virus, influenza C virus, Viruses such as tobacco virus, infectious salmon-anemia virus, Bunyamwera virus, Hantan virus, Dugbe virus, Rift Valley fever virus, Tomato spotted wilt virus, A virus genome virus selected from the group consisting of Lymphocytic choriomeningitis virus, Citrus psorosis virus, Rice stripe virus and Hepatitis delta virus. Lt; / RTI >

In another aspect, the invention provides a vector comprising a nucleic acid of the invention. In certain embodiments, the vector is an expression vector. In certain embodiments, the vector comprises a bacterial origin of replication. In certain embodiments, the vector comprises a eukaryotic replication origin. In certain embodiments, the vector comprises a selectable marker that can be selected in a prokaryotic cell. In certain embodiments, the vector comprises a selectable marker that can be screened in a eukaryotic cell. In certain embodiments, the vector comprises multiple cloning sites. In certain embodiments, the multiple cloning site is oriented relative to the < RTI ID = 0.0 > intracellular < / RTI > RNA polymerase I regulatory sequences so that the polynucleotide sequences introduced at the multiple cloning site can be transcribed by the regulatory sequences. In certain embodiments, the vector comprises a polynucleotide sequence that can be expressed in a dog cell, e.g., a MDCK cell.

In one embodiment, the invention provides an expression vector useful for recombinantly delivering a virus from a cell culture fluid, for example, a MDCK cell culture. In general, the vector is useful for the recovery of any viruses known to those skilled in the art as necessary to produce RNA with a defined end, during the life cycle of the virus. Such viruses include, but are not limited to, negative-sense-strand RNA viruses, such as those described above. Preferably, the virus is an influenza virus, for example, an influenza A virus, an influenza B virus or an influenza C virus.

In certain embodiments, one or more of the vectors of the invention further comprise an RNA transcription termination sequence. In certain embodiments, the transcription termination sequence is selected from the group consisting of an RNA polymerase I transcription termination sequence, an RNA polymerase II transcription termination sequence, an RNA polymerase III transcription termination sequence, and a ribozyme.

In certain embodiments, the expression vector is a uni-directional expression vector. In another embodiment, the expression vector is a bi-directional expression vector. In some embodiments, the bi-directional expression vector of the invention has a first promoter inserted between the second promoter and a polyadenylation site, e.g., the SV40 polyadenylation site. In certain embodiments, the first promoter is the dog RNA polI promoter. In certain embodiments, the second promoter is the < RTI ID = 0.0 > RNA < / RTI > polI promoter. In one embodiment, the first promoter and the second promoter may be aligned in opposite directions while being in contact with one or more cloning sites.

In certain embodiments, the expression vector comprises a ribozyme sequence or a transcription termination sequence at the 3 ' end of one or more cloning sites in association with the < RTI ID = 0.0 > In certain embodiments, the expression vector comprises a ribozyme sequence or a transcription termination sequence at the 3 ' end of one or more cloning sites relative to the < RTI ID = 0.0 > RNA polI < / RTI ≪ / RTI >

In one embodiment, within the bi-directional expression vector of the invention, the gene or cDNA is located between the upstream pol II promoter of the invention and a downstream pol I regulatory sequence (e.g., pol I promoter). When the gene or cDNA is transcribed from the polII promoter, capped positive-sense viral mRNA is produced, and when the gene or cDNA is transcribed from the pol I regulatory sequence, uncapped negative-sense vRNA is produced do. Alternatively, in the unidirectional vector system of the present invention, the gene or cDNA is located downstream of the pol I and pol II promoters. The pol II promoter produces a capped positive-sense virus mRNA, which produces a non-capped positive-sense virus cRNA.

In another aspect, the present invention is directed to a composition comprising one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, , 16, or 17 vectors, wherein the vector comprises a viral cDNA, e.g., one or more nucleic acids of the invention operably linked to an influenza virus cDNA (e. G., The invention 0.0 > polI < / RTI >

In certain embodiments, one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, Lt; / RTI > In certain embodiments, one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve or more vectors are contained within a separate plasmid exist. In certain embodiments, each vector is on a separate plasmid.

In certain embodiments, the vector of the invention is a bi-directional expression vector. The bi-directional expression vector of the present invention typically comprises a first promoter and a second promoter, wherein said first promoter and said second promoter are selected from the group consisting of viral nucleic acids, such as the same double-stranded nucleic acid encoding the segments of the influenza virus genome is operably linked to an alternative chain of cDNA. Generally, at least one of these promoters is the < RTI ID = 0.0 > RNA polI < / RTI > promoter. Optionally, the bi-directional expression vector may comprise a polyadenylation signal and / or a termination sequence. For example, the polyadenylation signal and / or the termination sequence may be located side by side with the segment of the influenza virus genome present between the two promoters. One preferred polyadenylation signal is the SV40 polyadenylation signal.

In one embodiment, the invention encompasses a bi-directional plasmid based expression system and an unidirectional plasmid based expression system, wherein the viral cDNA comprises an open polI regulatory sequence (eg, a polI promoter) and a terminator sequence Internal transfer unit). These internal transcription units are present side by side with the RNA polymerase II (polII) promoter and the polyadenylation site (external transcription unit). In one-way systems, the pol I and pol II promoters produce an unencapsulated positive-sense cRNA (from the polI promoter) and a capped positive-sense mRNA (from the pol II promoter) upstream of the cDNA. The polI promoter, polI terminator sequence, pol II promoter and polyadenylation signal in the unidirectional system can be said to include an "upstream-to-downstream orientation ". In a two-way system, the pol I and pol II promoters are located on opposite sides of the cDNA, where the upstream pol II promoter produces the capped positive-sense mRNA and the downstream pol I promoter encodes the unencapsulated negative-sense viral RNA (vRNA) Production. Such polI-polII systems begin to operate by initiating transcription of two cellular RNA polymerases from their own promoters (presumably in different compartments of the nucleus). While the polI promoter and polI terminator sequences in a two-way system can be said to include "downstream-to-upstream orientation ", the polII promoter and polyadenylation signal in a bi- "Can be said to include.

In another aspect, the invention disclosed herein includes a composition comprising an expression vector comprising a polynucleotide sequence that can be transcribed by an intronic RNA polymerase I. In certain embodiments, the polynucleotide produces influenza vRNA or cRNA. In certain embodiments, the composition comprises a plurality of expression vectors (each comprising a polynucleotide sequence that can be transcribed by RNA polymerase I). In certain embodiments, the polynucleotide produces a plurality of influenza vRNA or cRNA. In certain embodiments, the polynucleotide produces all eight influenza vRNA or cRNA.

In another aspect, the invention disclosed herein includes a composition comprising a plurality of expression vectors of the invention that produce an influenza genome when introduced into a dog cell in the absence / presence of a helper virus.

In certain embodiments, a composition of the invention comprises a plurality of expression vectors that produce an infectious influenza virus when introduced into a dog cell in the absence / presence of helper virus. In certain embodiments, the infectious influenza virus is a cold-sensitive influenza virus. In certain embodiments, the infectious influenza virus is an attenuated influenza virus. In certain embodiments, the infectious virus is temperature-sensitive influenza virus. In certain embodiments, the infectious influenza virus is a cold-adapted influenza virus. In certain embodiments, the infectious influenza virus is an attenuated, temperature sensitive, cold-adapted influenza virus.

In certain embodiments, the compositions of the invention are operably linked in the 5 'to 3' direction, i.e., the promoter is a 5 'non-coding influenza virus sequence, and the 5' non- coding influenza virus sequence is cDNA, which is linked to a 3 ' non-coding influenza virus sequence, and the 3 ' non-coding influenza virus sequence comprises a vector that is linked to a transcription termination sequence. In certain embodiments, at least one of the cDNAs in the vector is present in a sense orientation. In certain embodiments, at least one of the cDNAs in the vector is present in an anti-sense orientation.

In certain embodiments, the invention provides a composition comprising a plurality of vectors, wherein the plurality of vectors is operably linked to an influenza virus polymerase acid protein (PA) cDNA that is linked to a transcription termination sequence A vector comprising the regulatory sequence of one of the four genes, a vector comprising the regulatory sequence operably linked to the influenza virus polymerase basic protein 1 (PB1) cDNA that is linked to the transcription termination sequence, the influenza virus A vector comprising the regulatory sequences of the dogs operably linked to the viral polymerase basic protein 2 (PB2) cDNA, a vector operably linked to influenza virus hemagglutinin (HA) cDNA coupled to a transcription termination sequence, A vector comprising a regulatory sequence, an influenza < RTI ID = 0.0 > A vector containing the regulatory sequences of the dogs operably linked to the viral nucleoprotein (NP) cDNA, a vector containing the control sequences operably linked to influenza virus neuraminidase (NA) cDNA coupled to the transcription termination sequence A vector comprising a regulatory sequence operably linked to an influenza virus matrix protein cDNA coupled to a transcription termination sequence, and a vector comprising a control sequence operably linked to an influenza virus NS cDNA coupled to a transcription termination sequence Lt; / RTI > regulatory sequences. In certain embodiments, the composition is also comprised of PB2, PB1, PA, HA, NP, NA, matrix protein 1 (M1), matrix protein 2 (M2), and non-structural proteins 1 and 2 (NS1 and NS2) Lt; RTI ID = 0.0 > mRNA < / RTI > encoding at least one influenza polypeptide selected from the group consisting of: In one embodiment, when the composition is introduced into a dog cell, an infectious influenza virus is produced. In certain embodiments, the infectious influenza virus is a cold-sensitive influenza virus. In certain embodiments, the infectious influenza virus is an attenuated influenza virus. In certain embodiments, the infectious influenza virus is a thermophilic influenza virus. In certain embodiments, the infectious influenza virus is a cold-adapted influenza virus. In certain embodiments, the infectious influenza virus is an influenza virus that is attenuated, temperature sensitive, and cold-adaptive.

In certain embodiments, the present invention provides a composition for producing an infectious influenza virus from a cloned viral cDNA, wherein each plasmid comprises cDNA encoding one or more viral genome segments, wherein the viral genome segment The corresponding viral cDNA is inserted between the RNA RNA polymerase I regulatory sequence of the present invention and a regulatory element (e. G., Three polI terminator sequences) for synthesizing a vRNA or cRNA having the correct 3 ' end, Or a set of plasmids expressing cRNA.

In certain embodiments, the present invention provides a composition for producing an infectious influenza virus from a cloned viral cDNA, wherein each plasmid comprises cDNA encoding one or more viral genome segments, wherein the viral genome segment The corresponding viral cDNA is inserted between the RNA polymerase I regulatory sequences of the present invention and a regulatory element (e. G., PolI termination sequence) for the synthesis of vRNA or cRNA having the correct 3 ' cRNA, and a regulatory element for synthesizing vRNA or cRNA having three RNA polymerase I regulatory sequences, viral cDNA and precise 3 ' ends, in turn, is inserted between the RNA polymerase II (polII) promoter and the polyadenylation signal To express the viral mRNA and the corresponding viral protein, When the Russ protein is expressed, it contains a set of plasmids that form an infectious influenza virus assembly.

In certain embodiments, the regulatory element for the synthesis of vRNA or cRNA having the correct 3 ' end is the RNA polymerase I (polI) termination sequence. As is known to those skilled in the art, efficient replication and transcription of influenza vRNA requires highly specific sequences at the 5 'and 3' ends of vRNA. The inventors use an RNA polymerase I (polI) termination sequence to confirm that the 3 'terminal sequence of the produced RNA transcript has an accurate terminal end, which is desirable for efficiently producing the replication and / or transcription of the genomic RNA. . In certain embodiments, the regulatory element for the synthesis of vRNA or cRNA having the correct 3 ' end is a ribozyme sequence. In certain embodiments, the pol I promoter is present adjacent to the polyadenylation signal, wherein the pol I termination sequence is contiguous to the pol II promoter. In certain embodiments, the pol I promoter is present adjacent to the pol II promoter, and the pol I termination sequence is adjacent to the polyadenylation signal. In certain embodiments, the influenza virus is an influenza A virus. In certain embodiments, the influenza virus is influenza B virus.

In another aspect, the invention provides a method of producing an influenza genomic RNA, comprising transcribing a nucleic acid of the invention to produce an influenza genomic RNA. In certain embodiments, the influenza genomic RNA is transcribed in a cell-free system. In certain embodiments, the influenza genomic RNA is transcribed in MDCK cells, e.

In one embodiment, the method of the present invention comprises transcribing a plurality of nucleic acids of the invention to produce a plurality of RNA molecules, for example, a plurality of influenza genomic RNAs. In certain embodiments, one, two, three, four, five, six, seven or eight influenza genomic RNAs are transcribed. In certain embodiments, a complete set of influenza genomic RNA is transcribed. In certain embodiments, the influenza genomic RNA expresses influenza proteins when transduced in the presence of PA, PB1, PB2 and NP, in a cell, e. G., MDCK cells. In certain embodiments, the influenza protein is selected from the group consisting of PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS2. In certain embodiments, the complete set of influenza genomic RNA expresses infectious influenza virus when transfected in the presence of PA, PB1, PB2 and NP, in a cell, e. G., MDCK cells. In certain embodiments, the method comprises introducing PA, PB1, PB2 and NP together with an influenza genomic RNA. In certain embodiments, PA, PB1, PB2, and NP are provided by the helper virus. In certain embodiments, the complete set of influenza genomic RNA is cold-adapted, temperature-sensitive, and derived from attenuated influenza virus.

In one embodiment, there is provided a method of transcribing a vRNA segment of influenza virus comprising: 1) contacting a polynucleotide comprising a nucleic acid selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 28 (or an active fragment thereof ) And one or more influenza proteins such as PB1, PB2, NP and PA, wherein the nucleic acid is operably linked to a cDNA molecule encoding the vRNA segment; And 2) isolating the transcribed vRNA segment. In one particular embodiment, a helper virus is used in the methods of the invention.

In one aspect, the invention provides a method of producing a recombinant infectious recombinant virus (e. G., An infectious influenza virus) comprising a segmented RNA genome, Culturing an autologous cell, e.g., MDCK cell, comprising at least one expression vector of the invention comprising a corresponding viral cDNA and at least one expression vector expressing a viral mRNA encoding one or more viral polypeptides; And isolating the infectious virus community. In one embodiment, the infectious virus community is an influenza virus community. In one embodiment, the method further comprises introducing one or more expression vectors into the can host cell prior to performing the incubating step. In one embodiment, the method further comprises the step of preparing one or more expression vectors prior to performing said introducing step.

In one embodiment, there is provided a method of producing a recombinant infectious recombinant virus (e. G., An infectious influenza virus) comprising a segmented RNA genome comprising: a) contacting a viral genome with one or more expression vectors of the invention Inserting a virus cDNA corresponding to each gene; (b) expressing the expression vector and one or more expression vectors expressing a viral mRNA encoding one or more viral polypeptides in a host cell (e. g., a cell) or a host cell population thereof (e. g., by electroporation) ); (c) incubating the host cell; And (d) isolating the infectious virus community. In one embodiment, the infectious recombinant virus is influenza. In certain embodiments, the influenza virus is a cold-adapted, temperature-sensitive, attenuated influenza virus.

In one embodiment, there is provided a method of producing an infectious recombinant virus (e. G., An infectious influenza virus) comprising a segmented RNA genome comprising the steps of: a) Inserting a virus cDNA corresponding to the gene; (b) introducing the expression vector into a host cell (e. g., a dog cell) or a host cell population (e. g., by electroporation); (c) incubating the host cell; And (d) isolating the infectious virus community. In one embodiment, the infectious recombinant virus is influenza. In certain embodiments, the influenza virus is a cold-adapted, temperature-sensitive, attenuated influenza virus.

In one embodiment, the invention provides a method for expressing vRNA segments or the corresponding cRNA and influenza virus proteins, in particular PB1, PB2, PA and NA, using an expression vector of the invention, Lt; RTI ID = 0.0 > recombinant < / RTI > influenza virus. According to this embodiment, the helper virus can be used or can not be used to produce infectious recombinant influenza virus.

In another embodiment, the invention provides a method of producing a recombinant influenza virus, comprising administering to a subject one or more cDNAs encoding each influenza genomic RNA, the RNA polymerase I regulatory sequence being operably linked The present invention provides a method of culturing a cell comprising a plurality of nucleic acids encoding at least one influenza polypeptide and at least one expression vector expressing a virus mRNA encoding at least one influenza polypeptide (PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS2) ; And separating the recombinant influenza virus from the cell.

In certain embodiments, the method comprises the steps of (a) expressing genomic or antigen viral RNA segments, nuclear proteins and RNA-dependent polymerases in the cells to form a ribonucleoprotein complex, Introducing an expression vector that allows the particles to be assembled in the absence of the helper virus; And (b) culturing the cells so that the viral particles are packaged and salvaged. In certain embodiments, the recombinant negative strand virus is a non-segmented virus. In certain embodiments, the recombinant negative strand RNA virus is a segmental virus. In any of the embodiments, the negative strand RNA virus is an influenza virus.

In certain embodiments, the method of the invention allows the cultured dog cells to be infected with the RNP complex containing the genomic RNA segment of the virus, even in the absence of the helper virus, Introducing an expression vector capable of expressing genomic or antigenic RNA segments of the RNA virus, a nuclear protein, and an RNA-dependent polymerase; And culturing the cell from which the virus particle is produced. In certain embodiments, the expression vector expresses a genomic RNA segment of the virus.

In certain embodiments, the dog cells used in the methods of the invention comprise at least one protein selected from a nuclear protein and at least one expression vector expressing a subunit of an RNA-dependent RNA polymerase. In certain embodiments, the expression vector expresses at least one of the nuclear proteins and a subunit of the RNA-dependent RNA polymerase. In certain embodiments, the expression of one or more viral proteins from the expression vector is selected from the group consisting of adenovirus 2 major late promoter (s) coupled to a spliced leader sequence of human adenovirus type 2 , Or a human cytomegalovirus immediate-early promoter, or a functional derivative of this regulatory sequence.

In certain embodiments, the virus is an A, B or C influenza virus. In certain embodiments, the virus is a reassortment virus having vRNA segments derived from one or more parent viruses.

In certain embodiments, the methods of the invention include introducing multiple vectors of the invention into a host cell population capable of supporting replication of the virus, wherein each vector contains a portion of the influenza virus . The host cell can be cultured under conditions in which the virus can grow, in which case the influenza virus can be recovered. In some embodiments, the influenza virus is an attenuated virus, a cold-adapted virus, and / or a temperature sensitive virus. For example, in certain embodiments, the vector-derived recombinant influenza virus can be an attenuated, cold-adapted, thermophilic virus, for example, a live attenuated vaccine, for example, to be administered as an intranasal vaccine formulation It is appropriate. In an exemplary embodiment, the virus is an influenza B / Ann Arbor / 1/66 viral genome, for example, a plurality of vectors in which all or part of the ca B / n arbor / 1/66 viral genome is integrated .

In some embodiments, cDNA encoding six or more internal genomic segments of an influenza strain (e.g., genomic segments encoding all influenza proteins except HA and NA) and genomic segments of different influenza strains For example, HA and NA vRNA fragments). A number of vectors containing cDNA encoding one or more can be introduced into the host cell population. For example, the selected attenuated, cold-adapted and / or thermophilic influenza A or B strains, for example ca, att, ts strains or artificially engineered ca, att, ts Influenza A Or at least six of the internal genomic segments ("backbone") of strain B may be introduced into the host cell population, along with one or more fragments encoding immunogenic antigens from other viral strains. Typically, immunogenic surface antigens comprise either or both hemagglutinin (HA) and / or neuraminidase (NA) antigens. In embodiments in which a segment encoding an immunogenic surface antigen is introduced, seven complementary segments of the selected virus are also introduced into the host cell.

In certain embodiments, the expression vector is transfected into a cell by electroporation. In certain embodiments, the expression vector is transfected into a cell in the presence of a liposome transfection reagent, or introduced into a cell by calcium phosphate precipitation. In certain embodiments, the expression vector is a plasmid. In certain embodiments, the expression vector comprises a separate expression vector for expressing each genomic RNA segment of the virus or the corresponding coding RNA. In certain embodiments, the expression of each genomic RNA segment or coding RNA is under the control of a promoter sequence derived from an open polI promoter, as described above.

In certain embodiments, multiple of the plasmid vectors into which the influenza viral genome segments are integrated are introduced into the host cell population. For example, in certain embodiments, eight plasmids, each plasmid containing a different genomic segment, can be used to introduce the entire influenza genome into the host cell. Alternatively, a number of plasmids integrating small genomic sequence sequences can be used.

In another aspect, the invention provides a method for producing an infectious viral particle of a segment negative strand RNA virus, e.g., influenza virus, e.g., influenza A virus, having three or more genomic vRNA segments in cultured cells, The method comprises the steps of: (a) introducing into a population of cells capable of supporting the growth of a virus a first set of expression vectors capable of expressing genomic vRNA segments in said cells, providing vRNA segments; (b) introducing into the cell a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of the virus; And (c) culturing the cell to produce the virus particle. In certain embodiments, the cell is a dog cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the virus is an influenza B virus. In certain embodiments, a first set of expression vectors is contained in from 1 to 8 plasmids. In certain embodiments, a first set of expression vectors is contained in one plasmid. In certain embodiments, a second set of expression vectors is contained in from 1 to 8 plasmids. In certain embodiments, a second set of expression vectors is contained in one plasmid. In certain embodiments, the first set, the second set, or both the first and second sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encode each vRNA segment of influenza virus. In certain embodiments, the second set of expression vectors encode the mRNA of one or more influenza polypeptides. In certain embodiments, the first or second set of expression vectors (or both the first set and the second set) may comprise a nucleic acid of the invention, for example, an expression regulatory sequence of the invention ). In certain embodiments, the first or second set of expression vectors (or both the first and second sets) encode the vRNA or mRNA of the second virus. For example, the vector set comprises one or more vectors encoding HA and / or NA mRNA and / or vRNA of the second influenza virus.

The present invention also provides a method for producing an infectious viral particle of a cleavage negative strand RNA virus having three or more genomic vRNA segments in a cultured cell, for example, an influenza virus, for example, an influenza A virus, (A) an expression vector capable of expressing a genomic vRNA segment in a cell to provide a complete genomic vRNA segment of the virus and expressing an mRNA encoding one or more polypeptides of the virus; Introducing the set into a population of cells capable of supporting the growth of the virus; (b) culturing the cells to produce the virus particles. In certain embodiments, the cell is a dog cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the virus is an influenza B virus. In certain embodiments, the expression vector set is contained in from 1 to 17 plasmids. In certain embodiments, the expression vector set is contained in from 1 to 8 plasmids. In certain embodiments, a set of expression vectors is contained in one to three plasmids. In certain embodiments, the set of expression vectors is introduced by electroporation. In certain embodiments, the set of expression vectors encode each vRNA segment of influenza virus. In certain embodiments, the set of expression vectors encodes the mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors encodes each vRNA segment of influenza virus and mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, e. G., An opening regulation sequence of the invention (e. G., PolI). In certain embodiments, the set of expression vectors encode the vRNA or mRNA of the second virus. For example, the vector set comprises one or more vectors encoding HA and / or NA mRNA and / or vRNA of the second influenza virus. In certain embodiments, the first or second set of expression vectors (or both the first and second sets) encode the vRNA or mRNA of the second virus. For example, the vector set comprises one or more vectors encoding HA and / or NA mRNA and / or vRNA of the second influenza virus.

In certain embodiments, the methods of the invention also include amplifying the viral particles produced by the dog cells by one or more additional cell infection steps using the same or different cells as the dog cells. In certain embodiments, the method further comprises isolating the infectious viral particles. In certain embodiments, the method further comprises a virus attenuating step or a killing step. In certain embodiments, the method further comprises incorporating the attenuated or killed viral particles into the vaccine composition.

In one embodiment, the virus titer (potency at 24 hours, 36 hours, 48 hours, 3 days, or 4 days after introduction of the vector of the invention into the host cell) to 0.1 × 10 ³ PFU / ㎖ or more, or 0.5 × 10 ³ PFU / ㎖ or more, or 1.0 × 10 ³ PFU / ㎖ or more, or 2 × 10 ³ PFU / ㎖ or more, or ³ × 10 3 PFU / ㎖ above, or 4 × 10 ³ PFU / ㎖ or more, or 5 × 10 ³ PFU / ㎖ or more, or 6 × 10 ³ PFU / ㎖ or more, or 7 × 10 ³ PFU / ㎖ or more, or 8 × 10 ³ PFU / ㎖ above, or 9 × 10 ³ PFU / ㎖ or more, or 1 × 10 ⁴ PFU / ㎖ or more, or 5 × 10 ⁴ PFU / ㎖ or more, or 1 × 10 ⁵ PFU / ㎖ or more, or ⁵ × 10 5 PFU / ㎖ above, or 1 × 10 ⁶ PFU / ㎖ or more, or 5 × 10 ⁶ PFU / ㎖ or more, or 1 × 10 ⁷ PFU / ㎖ above, or 0.1~l × 10 ³ PFU / ㎖, or 1 × 10 ³ ~1 × 10 ⁴ PFU / ㎖, or ^{1 × 10 4 ~1 × 10 5} PFU / ㎖, or ^{1 × 10 5 ~1 × 10 6} PFU / ㎖, or ^{1 × 10 6 ~1 × 10 7} PFU / ㎖, or 1 × 10 < ⁷ > PFU / ml Can be made. Therefore, the present invention provides a method for relieving a virus, wherein the activity of the rescued virus (activity at 24 to 36 hours or at 2 to 3 days) is 0.1 × 10 ³ PFU / or 0.5 × 10 ³ PFU / ㎖ or more, or 1.0 × 10 ³ PFU / ㎖ or more, or 2 × 10 ³ PFU / ㎖ or more, or ³ × 10 3 PFU / ㎖ or more, or 4 × 10 ³ PFU / ㎖ above, Or 5 x 10 ³ PFU / ml or more, or 6 x 10 ³ PFU / ml or more, or 7 x 10 ³ PFU / ml or more, or 8 × 10 ³ PFU / ml or more, or 9 × 10 ³ PFU / ml or more. Or 1 × 10 ⁴ PFU / ㎖ or more, or 5 × 10 ⁴ PFU / ㎖ or more, or 1 × 10 ⁵ PFU / ㎖ or more, or ⁵ × 10 5 PFU / ㎖ or more, or 1 × 10 ⁶ PFU / ㎖ above, or 5 × 10 ⁶ PFU / ㎖ or more, or 1 × 10 ⁷ PFU / ㎖ above, or 0.1~l × 10 ³ PFU / ㎖, or ^{1 × 10 3 ~1 × 10 4} PFU / ㎖, or 1 × 10 ⁴ to 1 a × 10 ⁵ PFU / ㎖, or ^{1 × 10 5 ~1 × 10 6} PFU / ㎖, or ^{1 × 10 6 ~1 × 10 7} PFU / ㎖, or more than 1 × 10 ⁷ PFU / ㎖.

In some embodiments, the influenza virus corresponds to the influenza B virus. In some embodiments, the influenza virus corresponds to the influenza A virus. In some embodiments, the methods comprise recovering recombinant and / or reclassified influenza viruses that upon administration to a subject, for example, can induce an immune response upon intranasal administration to the subject. In some embodiments, the virus is inactivated prior to administration, and in other embodiments, live attenuated virus is administered. Recombinant and reclassified influenza A viruses and influenza B viruses produced according to the method of the present invention also characterize the present invention. In certain embodiments, the virus comprises a virus having an attenuated influenza virus, a cold-adapted influenza virus, an influenza virus, or any combination of such desirable characteristics. In one embodiment, the influenza virus comprises a cold-adaptive, thermophilic, attenuated strain of influenza B / Ann Arbor / 1/66 strain virus, for example B / Ann Arbor / 1/66. In another embodiment, the influenza virus comprises a cold-adaptive, thermophilic, attenuated strain of influenza A / Ann Arbor / 6/60 strain virus, for example A / Ann Arbor / 6/60.

Optionally, the reclassification virus codes a vector encoding six internal vRNAs of the selected viral strain for the desired characteristics associated with vaccine production, with the vRNA segment of the selected strain, e. G., Surface antigens (HA and NA) Lt; RTI ID = 0.0 > of < / RTI > For example, the HA segment may be selected from strains H1, H3 or B, preferably pathologically related, such as in vaccine production. Similarly, the HA segment may be selected from a suddenly occurring pathogenic strain, such as an H2 strain (e.g., H2N2), an H5 strain (e.g., H5N1) or an H7 strain (e.g., H7N7) . Alternatively, the seven complementary gene segments of the first strain are introduced with HA or NA coding segments. In certain embodiments, the internal gene segments are derived from influenza B / Ann Arbor / 1/66 or A / Ann Arbor / 6/60 strains. In addition, influenza viruses (e.g., H5N1, H9N2, H7N7 or HxNy (where x = 1 to 9 and y = 1 to 15) comprising the modified HA gene can be produced. For example, the HA gene can be modified by removing the polyvalent base cleavage site.

In another aspect, the invention provides a host cell comprising a nucleic acid or expression vector of the invention. In certain embodiments, the cell is a dog cell. In certain embodiments, the dog cells are kidney cells. In certain embodiments, the kidney cells are MDCK cells. In other embodiments, the cell is selected from the group consisting of Vero cells, Per.C6 cells, BHK cells, PCK cells, MDCK cells, MDBK cells, 293 cells (e.g., 293T cells), and COS cells. In some embodiments, a co-culture mixture comprising two or more of said cell lines, for example a culture mixture of COS cells and MDCK cells or a culture mixture of 293T cells and MDCK cells constitute a host cell population.

The host cells comprising the influenza vector of the present invention can be grown in a culture medium under conditions that support the replication and assembly of viruses. Typically, the host cells into which the influenza plasmids are integrated can be cultured at a temperature below 37 ° C, preferably below 35 ° C. In certain embodiments, the cells are cultured at a temperature of 32-35 [deg.] C. In some embodiments, the cells are incubated at about 33 ° C, for example about 32 ° C to about 34 ° C. The virus can be replicated to show a specific titer, after which the recombinant virus can be recovered. Optionally, the recovered virus may be inactivated.

In another aspect, the present invention provides a method of treating influenza virus, wherein the growth of the virus is inhibited by a specific cell type such as MRC-5, WI-38, FRhL-2, PerC6, 293, NIH 3T3, CEF, CEK, DF-1, Vero, MDCK, MvlLu, human epithelial cells and SF9 cell types. In one embodiment, the growth of the virus can be restricted so that the influenza virus can not be grown in human primary cells (e. G., PerC6). In another embodiment, the growth is limited so that the influenza virus can not grow in human epithelial cells. The skilled artisan will appreciate that phenotypes resulting from limiting growth may appear with one or more additional phenotypes, such as low-temperature-adaptability, temperature sensitivity, and toxicity. It will also be appreciated that mutations that are involved in the growth limiting phenotype may contribute to / contribute to, for example, the additional phenotypes described above.

In another aspect, the invention provides a novel method of relieving recombinant or reclassified influenza A or influenza B virus (i.e., wild type and variant strains of influenza A and / or influenza virus) from MDCK cells in a culture medium . In certain embodiments, a plurality of vectors transfected with the influenza viral genome are integrated so that they are transduced into the MDCK cell population. These cells can be grown under conditions that support viral replication, for example, in the case of cold-adapted, attenuated, and temperature sensitive viral strains, MDCK cells are maintained at a temperature below 37 ° C, preferably below 35 ° C Lt; / RTI > Typically, the cells are cultured at a temperature of 32 to 35 占 폚. In some embodiments, the cells are cultured at a temperature of about 32-34 [deg.] C, for example about 33 [deg.] C. Optionally, the MDCK cells (for example in vaccine production) are grown in serum-free medium containing no animal-derived products.

In some embodiments of the aforementioned methods, the influenza virus may be recovered after incubation of an influenza genome plasmid integrated host cell. In some embodiments, the recovered virus is a recombinant virus. In some embodiments, the virus is a reclassified influenza virus having a genetic characteristic derived from one or more parental strains. Optionally, the recovered recombinant or reclassified virus may also be propagated by subculturing in cultured cells or eggs.

Optionally, the recovered virus may be inactivated. In some embodiments, the recovered virus comprises an influenza vaccine. For example, the recovered influenza vaccine may be a reclassified influenza virus (e.g., a 6: 2 or 7: 1 reclassified virus) having HA and / or NA antigens derived from selected strains of influenza A or influenza B. have. In one embodiment, the HA or NA antigen is modified. In certain preferred embodiments, the reclassified influenza virus exhibits an attenuated phenotype. Optionally, the reclassified virus is a cold-adaptive and / or temperature sensitive virus, e. G., Attenuated, cold-adapted or thermophilic influenza A or influenza B virus. Such influenza viruses are useful, for example, as live attenuated vaccines, to produce prophylactics of selected strains, e. G., Immune responses specific for pathogenic influenza strains. Influenza viruses produced by the method of the present invention, for example, attenuated reclassified viruses, constitute an additional feature of the present invention.

In another aspect, the invention is directed to a method of producing a recombinant influenza virus vaccine, which method comprises administering an influenza virus genome, wherein the influenza virus genome is transcriptionally regulated by an open regulation sequence of the invention (e. G., The RNA polI promoter) Introducing into a host cell population capable of supporting replication of an influenza virus, culturing the host cell at a temperature of less than or equal to 35 ° C, and administering to the subject an influenza virus capable of inducing an immune response And collecting the collected data. The vaccine may comprise influenza A or influenza B strain virus.

In some embodiments, the influenza vaccine virus comprises an attenuated influenza virus, a cold-adapted influenza virus or a temperature-sensitive influenza virus. In certain embodiments, the virus has a combination of desirable characteristics. In one embodiment, the influenza virus comprises influenza A / Ann Arbor / 6/60 strain virus. In another embodiment, the influenza virus comprises the influenza B / Ann Arbor / 1/66 strain virus. Alternatively, the vaccine may contain one or more substituted amino acids that affect the characteristic biological characteristics of ca A / Ann Arbor / 6/60 or ca B / Ann Arber / 1/66, for example, Lt; RTI ID = 0.0 > influenza A < / RTI > virus.

In one embodiment, there is provided a vaccine comprising a recombinant virus family collection (or a virus derived therefrom) produced by the method of the present invention. In certain embodiments, the vaccine comprises a live virus produced by the method. In another specific embodiment, the vaccine comprises a killed or inactivated virus produced by the method. In other specific embodiments, the vaccine comprises an immunogenic composition produced by the method, which is made from a live, killed or inactivated virus. In certain other embodiments, the vaccine comprises an immunogenic composition produced by influenza virus produced by the method, which is live, mildly toxic, cold-adaptive, and temperature sensitive. In another specific embodiment, the vaccine comprises a live, mildly toxic, low temperature-adaptive, and temperature-sensitive influenza virus produced by the method, or a virus derived therefrom.

4. Brief description of drawing

Figure 1 shows the growth curves of the wt and ca B strains (B / Beijing / 243/97) in both PerC6 and MDCK cells; Here, the virus titers at each time point were measured by TCID50 assay.

Figure 2 shows the growth curves of wt and ca A strains (A / Sydney / 05/97 and A / Beijing / 262/95) in both PerC6 and MDCK cells; Here, the virus titers at each time point were measured by TCID50 assay.

Figure 3 shows the growth curves of the wt and ca A strains (A / Ann Arber / 6/60) in both PerC6 and MDCK cells; Here, the virus titers at each time point were measured by TCID50 assay.

Figure 4 shows the results of real-time analysis of A / Sidney viral RNA in PerC6 cells and MDCK cells using Taqman (Roche Molecular Systems, Palo Alto, Calif.) Probe specific for the M segment of viral RNA Lt; / RTI >

Figure 5 shows the growth curves of ca A / Vietnam / 1203/2004 (H5N1) in MDCK cells; Here, the virus titers at each time point were measured by TCID50 assay.

Figure 6 is a graphical representation of the remission of each influenza gene segment as a 7: 1 reassortant produced by the 8-plasmid salvage technique.

Figure 7 shows the growth curves for each of the 7: 1 reassortants in PerC6 cells; Here, the virus titers at each time point were measured by TCID50 assay.

Figure 8 shows a restriction map of the EcoRI fragment containing the < RTI ID = 0.0 > RNA polI < / RTI > regulatory sequences.

Figures 9a to 9c show the nucleotide sequence (SEQ ID NO: 1) of the approximately 3.5 kb nucleic acid cloned from the canine genomic DNA, which contains at least a portion of the 18s rRNA gene (starting from nucleotide 1809 in the presented sequence (+1) Lt; / RTI >

Fig. 10 shows a map of the plasmid pAD3000 prepared so that the expression vector of the present invention can be easily prepared.

Figure 11 is a schematic representation of the MDCK polI promoter construct used in the mini-genome assay.

Figure 12 shows the results of a mini-genome assay. EGFP signals from MDCK polI promoter constructs at -1, +1, and +2 positions are shown in the upper left, middle upper, and upper right panels, respectively. (-) promoter control showed only background fluorescence (lower left). (+) Control cells were also transfected with the CMV-EGFP construct (lower right).

13 shows the sequence of pAD4000, a plasmid expression vector (SEQ ID NO: 29), containing a 469 bp fragment (base 1 to 469 of pAD4000) (from base 1340 to base 1808 of SEQ ID NO: 1) derived from MDCK EcoRI-BamHI subclone ). Note: The 469 bp fragment is present in reverse complement orientation and the linker sequence is underlined and shown in bold.

Fig. 14 shows the annealing positions of the primers used for carrying out the RT-PCR reaction on the RNA of the viral virus.

15 shows the sequence of a primer used for carrying out an RT-PCR reaction on the RNA of a virus to be rescued.

16A and 16B show the partial sequence of the NS and PB1 fragments and the position of the introduced silent mutation.

5. DETAILED DESCRIPTION OF THE INVENTION

Plasmid remediation of influenza virus generally involves the step of introducing an expression vector into an appropriate host cell in order to express the viral protein and transcribe the viral genomic RNA. Transcription of viral genomic RNA is generally carried out using an RNA polymerase I enzyme, since the enzyme produces transcripts with a suitable tail to be used as the viral genome. Therefore, the RNA polI promoter and other regulatory elements are used to initiate transcription of the genomic RNA upon plasmid rescue. Unfortunately, the RNA polI promoter is highly species specific. That is, an RNA polI derived from one species can bind efficiently or not bind to an RNA polI promoter derived from an irrelevant species. Therefore, the bioavailability of the RNA polI promoter limits the number of cells for which plasmid remediation can be performed. Prior to the development of the present invention, plasmid rescue could not be done in dog cells. For the first time, plasmid remediation carried out in dog cells can be carried out on the basis of the contents of the present invention as follows.

Thus, in a first aspect, there is provided a separate nucleic acid of the invention comprising a RNA polymerase I regulatory sequence. In certain embodiments, the regulatory sequence is a promoter. In one embodiment, the regulatory sequence is a pol I promoter sequence. In another embodiment, the regulatory sequence is operably linked to the cloned viral cDNA. In another embodiment, the cloned viral cDNA encodes a viral RNA of a negative or positive chain virus or a corresponding cRNA. In one embodiment, the cloned virus cDNA encodes genomic viral RNA (or a corresponding cRNA) of an influenza virus.

In one particular embodiment, the isolated nucleic acid of the invention comprises two RNA polymerase I regulatory sequences and a transcription termination sequence. In certain embodiments, the transcription termination sequence is a polI termination sequence. In certain embodiments, the transcription termination sequence is a human, monkey or polI termination sequence.

In certain embodiments, the nucleic acid of the invention binds to a human, primate, mouse, or polI polypeptide and comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 28 and at least 100% Polynucleotide sequences or functionalally active fragments thereof, such as, for example, 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% Sequence. In one embodiment, the polynucleotide sequence, or a functional active fragment thereof, comprises a suitable polypeptide (e. G., A human, primate, mouse or polI polypeptide) and a second polypeptide operably linked to the nucleotide sequence Further retaining the ability to initiate transcription in the presence of the nucleotide sequence. In one embodiment, the "functional active fragment" of the nucleic acid set forth in SEQ ID NO: 1 to SEQ ID NO: 28 retains one or more of the functional activities of the full-length sequence of SEQ ID NO: 1 to SEQ ID NO: 28 as disclosed herein. For example, a functionally active fragment of the regulatory sequence set forth in SEQ ID NO: 1 is operably linked to a nucleic acid to which the regulatory sequence segment is to be transcribed, such that it is transcribed in vitro or in vivo when the appropriate protein is present. In certain embodiments, the nucleic acid of the invention comprises a polynucleotide sequence of a nucleic acid as set forth in SEQ ID NO: 26.

In certain embodiments, the nucleic acid of the invention binds to and / or binds to a human, primate, mouse, or polI polymerase, or hybridizes to at least one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: Or a polynucleotide sequence or fragment thereof of about 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%, 70% polI regulatory sequences. In one embodiment, the polynucleotide sequence or fragment thereof may also comprise an appropriate polypeptide (e. G., Human, primate, mouse or polI polypeptide) and a second polynucleotide sequence operably linked to the nucleotide sequence In the presence, further retains the ability to initiate transcription.

In certain embodiments, the invention provides isolated nucleic acids comprising a < RTI ID = 0.0 > RNA < / RTI > polI promoter. Preferably, the two RNA polI promoters are operably linked to a nucleic acid to be transcribed, for example, influenza genomic RNA. When the nucleic acid is introduced into the cell, the influenza genome RNA is transcribed, and when the appropriate influenza protein is present, the RNA transcript can be packaged with the infectious influenza virus. In one embodiment, there is provided a separate nucleic acid comprising an individual RNA control sequence of the invention (e. G., RNA pol I promoter), wherein said regulatory sequence is operably linked to the nucleic acid to be transcribed , And in vitro or in vivo when appropriate protein is present. In one embodiment, the nucleic acid operably linked to the regulatory sequence is an influenza vRNA segment.

In another embodiment, the invention provides a method for producing recombinant influenza virus from fully cloned viral DNA in a canine cell culture, and a vector therefor. For example, influenza viruses can be produced by transfecting multiple vectors, including cloned cDNAs, encoding each viral genome segment under the transcriptional control of the individual RNA control sequences of the invention (e. G., PolI promoter) Into a cell, culturing the canine cell, and isolating the recombinant influenza virus produced from the cell culture broth. When the vector encoding the influenza virus genome is introduced into a cell (e. G., By electroporation), the recombinant virus suitable as a vaccine can be recovered by standard purification methods. By using the vector system and the method of the present invention, the six internal gene segments of the strain selected as having desirable characteristics in relation to vaccine production and the immunogenic HA and NA fragments derived from selected strains, for example, pathogenic strains, The reclassified viruses can be rapidly and efficiently produced in a tissue culture solution. Thus, the systems and methods disclosed herein are useful for the rapid production of recombinant and reclassified influenza A viruses and B viruses, for example, vaccines, for example, viruses suitable as live attenuated vaccines in canine cell culture fluids. Vaccines produced by the methods of the present invention may be delivered intranasally or intramuscularly.

Typically, a single master donor virus (MDV) strain is selected for each of the A and B subtypes. In the case of live attenuated vaccines, the master donor virus strains are typically selected to have desirable properties of the viral strain associated with vaccine production, e. G., Temperature sensitive, cold-adapted and / or drug toxicity. Representative master donor strains include, for example, thermostable, attenuated and cold-adapted strains of A / Ann Arbor / 6/60 and B / Ann Arbor / 1/66, respectively.

For example, a selected master donor type A virus (MDV-A) or a master donor type B virus (MDV-B) can be produced from a plurality of cloned virus cDNAs constituting the viral genome. In an exemplary embodiment, the recombinant virus is produced from eight cloned viral cDNAs. Eight viral cDNAs expressing the selected MDV-A or MDV-B sequences of PB2, PB1, PA, NP, HA, NA, M and NS can be obtained from expression vectors such as bi-directional expression vectors, For example, pAD3000 or pAD4000, wherein the viral genomic RNA can be transcribed from a promoter of the RNA polymerase I (polI) derived from a single chain, and the viral mRNA can be transcribed from RNA polymerase II (pol II) promoter. Optionally, any of the gene segments, e. G., HA segments, can be modified to not include, for example, a multi-basic cleavage site.

Thereafter, the infectious recombinant MDV-A or MDV-B virus is recovered after transfecting the plasmid carrying the eight viral cDNAs into a suitable host cell, for example MDCK cells. (MDV-A, MDV-B, PR8) together with HA and NA from different corresponding types (A or B) influenza viruses using the plasmids and methods disclosed herein, For example, a 6: 2 reclassified influenza vaccine, with the six internal genes (PB1, PB2, PA, NP, M and NS) For example, the HA segment is preferably selected from the pathologically correlated H1, H3 or B strains, as is commonly done in vaccine production. Similarly, HA segments are selected from strains closely related to pathogenic strains such as H2 strains (e.g., H2N2), H5 strains (e.g., H5N1) or H7 strains (e.g., H7N7) . A reclassified body in which seven genomic segments of MDV and either the HA or NA genes of the selected strain (7: 1 reclast) are integrated can also be produced. In addition, the system is useful in assessing the molecular basis for phenotypic traits, such as drug toxicity (att), cold-adaptability (ca) and warmth (ts), in connection with vaccine production.

5.1 Definitions

Unless defined otherwise, all scientific and technical terms should be understood to have the same meanings as commonly used in the art to which the terms belong. The following terms used in the present invention are defined below.

The terms "nucleic acid", "polynucleotide", "polynucleotide sequence" and "nucleic acid sequence" are intended to refer to a single chain or double chain deoxyribonucleotide or ribonucleotide polymer, or a chimera or analog thereof. Optionally, the term as used herein includes, in the sense that the polymer of a naturally occurring nucleotide analog hybridizes with a single chain nucleic acid in a manner similar to a naturally occurring nucleotide (e. G., A peptide nucleic acid) Of a polymer. Unless otherwise specifically defined, the specific nucleic acid sequence of the present invention includes complementary sequences thereof in addition to the sequences clearly shown.

The term "gene " means, in its broadest sense, any nucleic acid associated with a biological function. Thus, the gene includes coding sequences and / or regulatory sequences necessary for expression of the coding sequences. The term "gene " applies not only to a particular genomic sequence, but also to cDNA or mRNA encoded by the genomic sequence.

The gene also includes, for example, non-expressing nucleic acid segments that form cognitive sequences for other proteins. Non-expression regulatory sequences include regulatory proteins, such as "promoters" and "enhancers" that transcribe sequences that are present in or adjacent to a transcription factor when bound thereto. "Tissue-specific" promoter or enhancer refers to a sequence that regulates transcription in a particular tissue type (s) or cell type (s).

By "promoter" or "promoter sequence" is meant a nucleic acid sequence operably linked to a suitable transcription-related enzyme, for example, when the RNA polymerase is operative under conditions, eg, in culture or physiological conditions, Quot; means a DNA regulatory region capable of initiating transcription of the nucleic acid sequence. The promoter may be upstream or downstream of the nucleic acid sequence from which the transcription is initiated. The promoter sequence upstream of the cDNA forms a boundary with its transcription initiation site at its 3 'end and is upstream (5' direction) containing at least the bases or elements necessary to initiate transcription to a background level or higher ). A promoter sequence downstream of the cDNA (thus expressing (-) RNA) forms a boundary with its transcription initiation site at its 5 ' end and is capable of detecting bases or elements (3 ' direction) including at least the downstream side (3 ' direction). The two-way system of the present invention includes both upstream and downstream promoters; Unidirectional systems only include upstream promoters. In the promoter sequence or in its immediate vicinity, a transcription initiation site (conveniently located, for example, as defined by mapping by nuclease S1) is found and promotes, regulates, enhances or engages the binding of the RNA polymerase Lt; / RTI > (common sequence).

As used herein, "RNA polymerase I regulatory sequence" or "RNA polymerase I regulatory element" (or a functional active fragment thereof) refers to RNA polymerase I and, optionally, a related transcription factor, Means a nucleic acid sequence operably linked to a nucleic acid sequence and capable of increasing the transcription of the nucleic acid sequence when the enzyme becomes functional under conditions or physiological conditions. Examples of RNA polymerase I regulatory sequences are operably linked to an RNA polymerase I promoter that increases the transcription of the nucleic acid operably linked to its regulatory sequence to a background level or greater and a RNA polymerase I promoter And a RNA polymerase I enhancer that increases the transcription of the nucleic acid present in the absence of the RNA polymerase I enhancer above the level observed. One test method for identifying the RNA polymerase I regulatory elements is to introduce the putative RNA polymerase I regulatory element operably linked to the target nucleic acid into appropriate canine cells, for example MDCK cells, For example, there is a method of detecting the transcription of a target nucleic acid using Northern blotting. By comparing the level of transcription of the nucleic acid in the presence and absence of the putative RNA polymerase I regulatory element, the skilled artisan can ascertain whether this nucleic acid element is an RNA polymerase I regulatory element.

The term "vector " means a nucleic acid, e.g., a plasmid, a viral vector, a recombinant nucleic acid or cDNA, which can be used to introduce a heterologous nucleic acid sequence into a cell. The vector of the present invention will typically comprise the regulatory sequences of the invention. Vectors can be replicated spontaneously, or they can not replicate spontaneously. The vector may also be a nested RNA polynucleotide, a nested DNA polynucleotide, a polynucleotide consisting of both DNA and RNA in the same chain, a poly-lysine-junction DNA or RNA, a peptide-junction DNA or RNA, a liposome- Junction DNA or the like. Most commonly, the vector of the invention is a plasmid.

By "expression vector" is meant a nucleic acid integrated into a vector, eg, a vector capable of promoting transcription, eg, a plasmid. The expression vectors of the present invention will typically comprise the regulatory sequences of the present invention. Expression vectors can be replicated spontaneously or not spontaneously. Typically, the nucleic acid to be expressed is "operably linked" to a promoter and / or enhancer, and transcriptional control activity is also controlled by the promoter and / or enhancer.

A " bi-directional expression vector "is usually oriented in the opposite direction to the nucleic acid present between the two promoters so that expression can be initiated in both directions, resulting in, for example, Characterized in that it comprises two alternative promoters which transcribe both positive (+) or sense strand RNA and negative (-) or antisense strand RNA. Alternatively, the bi-directional expression vector may be an ambisense vector, wherein the viral mRNA and the viral genome RNA (cRNA) are expressed from the same chain.

The term "isolated " in the context of the present invention refers to a state in which a biological material, e.g., a nucleic acid or protein, is substantially separated from a component that normally accompanies or interacts with it in its natural state. The separated material optionally includes a substance that is not found in the natural environment, for example, with a particular substance in the cell. For example, if a substance is present in a natural environment, e. G., In a cell, the substance is not localized to a substance found in such an environment, It exists. For example, if a naturally occurring nucleic acid is introduced by non-naturally occurring means (e.g., a vector, e.g., a plasmid or viral vector or an amplicon) at a location in the genome that is not native to the nucleic acid, The resulting nucleic acid (e. G., Coding sequence, promoter and enhancer etc.) is isolated. This nucleic acid is also referred to as a "heterologous" nucleic acid.

The term "recombinant " means that a particular substance (e.g., nucleic acid or protein) has been modified (naturally) by artificial or synthetic intervention by human intervention. Deformation can occur either in the environment or state in which the particular material originally resides, or separated from it. Specifically, when referring to a virus, for example, an influenza virus, the virus will be recombinant when it is produced as the recombinant nucleic acid is expressed.

The term "reassortant " when referring to a virus, means that the virus comprises a genetic component and / or a polypeptide component derived from one or more parent virus strain or source. For example, a 7: 1 reassortant can contain seven viral genome segments (or gene segments) derived from a first parent virus and one complementary viral genome segment derived from a second parent virus, for example, hemagglutinin Lt; RTI ID = 0.0 > Nuclear < / RTI > The 6: 2 reclassification body refers to six internal genomes derived from the first parent virus, six genomic segments, most commonly six internal genes, and two complementary segments derived from different parental viruses, for example, ≪ RTI ID = 0.0 > maglutinin < / RTI > and neuraminidase.

The term "introduced" when referring to a heterologous nucleic acid or a separate nucleic acid means that the nucleic acid is integrated into the genome of the cell (e.g., chromosome, plasmid, plasmid or mitochondrial DNA) Or transiently expressed (e. G., In the case of transfected mRNA), the nucleic acid is integrated into a eukaryotic cell or prokaryotic cell. The term also includes methods such as "infection", "transfection", "transformation" and "transduction". Various methods of the present invention can be used, for example, to introduce nucleic acid into prokaryotic cells, such as electroporation, calcium phosphate precipitation, lipid-mediated transfection (lipofection), and the like.

The term "host cell" refers to a cell that is capable of absorbing or absorbing a nucleic acid, such as a vector, to assist in the production of one or more encoded products, including replication and / or expression of the nucleic acid and optionally viruses and / or polypeptides . The host cell may be a prokaryotic cell, e. G. E. coli or a eukaryotic cell, e. G., Yeast, insect, amphibian, avian or mammalian cell, e. Representative host cells of the present invention include Vero (African green monkey kidney) cells, Per.C6 cells (human embryonic retinal cells), BHK (baby hamster kidney) cells, early developmental chick kidney (PCK) cells, (MDCK) cells, mammalian-dubbed kidney (MDBK) cells, 293 cells (e.g., 293T cells), and COS cells (e.g., COS1, COS7 cells). The term host cell is meant to include a combination or mixture of cells, e.g., a mixed culture of different cell types or cell lines (e. G., Vero and CEK cells). Co-cultivation of electroporated SF Vero cells is disclosed in PCT / US04 / 42669, filed December 22, 2004, which is incorporated herein by reference in its entirety.

The term "artificially engineered " as used herein means that a product, for example, a polypeptide or vaccine, encoded by a virus, viral nucleic acid or virus, is recombinantly produced by recombinant methods such as position-directed mutagenesis, PCR mutagenesis Quot; includes at least one mutation introduced by < / RTI > The phrase "artificially engineered" when referring to a virus (or viral component or product) comprising one or more nucleotide mutations and / or amino acid substitutions means that the viral genome encoding the virus (or virus component or product) Or a genomic segment produced by a non-recombinant method (e. G., A gradual subculture method at 25 캜), for example, a naturally occurring virus strain or a previously prepared laboratory strain For example, does not originate from a wild-type or low-temperature-adaptive A / Ann Arbor / 6/60 or B / Ann Arbor / 1/66 strain.

The term " percent sequence identity "is used herein interchangeably with the term" percent identity "herein to refer to the percent identity of two or more nucleotides between two or more peptide sequences when aligned using a sequence alignment program Quot; means a nucleotide sequence identity level between nucleotides. For example, in the present specification, 80% identity means 80% sequence identity as measured by a predetermined algorithm, and 80% or more identity with another sequence having a different length It is also meant to be. Representative levels of sequence identity include, but are not limited to, 60, 70, 80, 85, 90, 95 or 98% or more of a given sequence.

The term "sequence homology%" is used herein interchangeably with the term "homology%" as used herein to refer to an amino acid sequence homology level between two or more peptide sequences when aligned using a sequence alignment program, Nucleotide sequence identity " means the nucleotide sequence homology level between nucleotides. For example, in the present application, the term "% homology" means 80%, meaning that% of sequence homology measured by a predetermined algorithm means 80%, so that the sequence for a predetermined sequence length of a homolog of a predetermined sequence Homology is over 80%. Representative levels of sequence homology include, but are not limited to, 60, 70, 80, 85, 90, 95 or 98% or more of a given sequence.

Representative computer programs that can be used to determine identity between two sequences include, but are not limited to, BLAST program families such as BLASTN, BLASTX and TBLASTX, BLASTP and TBLASTN (available to the public via the NCBI website on the Internet) But is not limited thereto. See, for example, Altschul et al., 1990, J. Mol. Biol. 215: 403-10 (specific reference to the published default setting or parameter (w = 4, t = 17)), and Altschul et al., 1997, Nucleic Acids Res., 25: 3389-3402 . Sequence searches are typically performed using the BLASTP program, which is used to evaluate a given amino acid sequence for the amino acid sequence in GenBank protein sequences and other publicly available databases. The BLASTX program is preferably used to search for translated nucleic acid sequences within all the reading frames against the GenBank protein sequence and other amino acid sequences in publicly available databases. Both BLASTP and BLASTX are performed using the default parameters [open gap penalty = 11.0, extended gap penalty = 1.0] and the BLOSUM-62 matrix [see above].

The preferred alignment of selected sequences to measure "percent identity" between two or more sequences can be determined using, for example, the BLOSUM 30 similarity matrix with default parameters (e.g., open gap penalty = 10.0 and extension gap penalty = 0.1) , Using the CLUSTAL-W program (MacVector 6.5 version).

By "specific hybridization" or "specific hybridization" or "selectively hybridizing to ", when specific nucleotide sequences are present in a complex mixture (e.g. total cell) DNA or RNA, Refers to the case where a nucleic acid molecule preferentially binds, doubles, or hybridizes to a nucleotide sequence.

The term "stringent conditions " refers to conditions under which a probe preferentially hybridizes to its target partial sequence, and hybridizes to a lesser degree or less to other sequences. Nucleic acid hybridization experiments "Strict hybridization" and "stringent hybridization wash conditions" of experiments such as Southern hybridization and northern hybridization are sequence dependent and differ according to different environmental parameters. For more detailed guidance on the hybridization of nucleic acids, see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, part I, chapter 2, assays ", Elsevier, NY; Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 3rd ed., NY; And Ausubel et al., Eds., Current Edition, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, NY.

Generally, highly stringent hybridization and washing conditions are selected to be about 5 ° C lower than the melting point (Tm) for a given sequence at a given ionic strength and pH. The Tm is the temperature at which the target hybridizes to a probe in which 50% of the target sequence is perfectly matched under a predetermined ionic strength and pH. Very stringent conditions are chosen to be equal to Tm for a particular probe.

In the Southern or Northern blotting, one example of stringent hybridization conditions in which complementary nucleic acids having about 100 or more complementary residues are hybridized on the filter include treatment with 1 mg of heparin and 50% of formalin at 42 캜, . As an example of very stringent washing conditions, there is a case where 0.15 M NaCl is treated at 72 캜 for about 15 minutes. An example of stringent washing conditions is washing with 0.2 x SSC at 65 占 폚 for 15 minutes. For a description of SSC buffers, see Sambrook et al. In highly stringent cleaning, first, low stringency is preceded by cleaning, which removes the background probe signal. For example, for duplexes of about 100 nucleotides or more, a typical medium severity wash is done by adding 1 x SSC at 45 占 폚 for 15 minutes. For example, for duplexes of about 100 nucleotides or more, a typical low stringency wash is done by adding 4-6 x SSC at 40 占 폚 for 15 minutes. Generally, the signal-to-noise ratio reaches twice (or more) the rate observed for unrelated probes in a specific hybridization assay, meaning that specific hybridization is observed.

As used herein, the term " about "means, unless otherwise stated, a case where the amount is above or below 10% of the value defined by the term. For example, the term "about 5 μg / kg" means a range of 4.5-5.5 μg / kg. As another example, "about 1 hour" means a range of 48 to 72 minutes.

As used herein, the term "coding " refers to a property of a nucleic acid, e.g., deoxyribonucleic acid, that is, a property of transcribing a nucleic acid that can be translated into a complementary nucleic acid, e.g., a polypeptide. For example, deoxyribonucleic acid can encode RNA that is transcribed from deoxyribonucleic acid. Similarly, deoxyribonucleic acid can encode a polypeptide that is translated from RNA transcribed from deoxyribonucleic acid.

Nucleic acid containing 5.2 RNA polI regulatory elements

In one embodiment, a separate nucleic acid is provided comprising an individual RNA control sequence of the invention (e. G., A single RNA pol I promoter). Regulatory sequences may, for example, be operably linked to a nucleic acid to be transcribed and transcribed in vitro or in vivo when the appropriate protein is present. In one embodiment, the nucleic acid operably linked to the regulatory sequence is an influenza vRNA segment.

In certain aspects, the invention provides isolated nucleic acids comprising the < RTI ID = 0.0 > RNA polI < / RTI > promoter. Preferably, the intracellular polI promoter is operably linked to a nucleic acid to be transcribed, for example, influenza genomic RNA. When the nucleic acid is introduced into the dog cells, the influenza genome RNA can be transcribed, and when the appropriate influenza protein is present, the RNA transcript (s) can be packed with an influenza virus, for example, an infectious influenza virus.

In certain embodiments, the nucleic acid of the invention binds to a human, primate, murine or canine poli polypeptide and comprises about 99%, 98% or more of one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: , 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82% %, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66% 64%, 63%, 62%, 61%, or 60% or more identical to SEQ ID NO: 1 or fragments thereof. In one embodiment, the RNA pol I regulatory sequence or fragment thereof further retains the ability to initiate transcription of a gene operably linked to a nucleotide sequence. In certain embodiments, the nucleic acid of the present invention comprises at least about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90% 78%, 77%, 76%, 75%, 74%, 73%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79% , 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or 60% identical to the polynucleotide sequence.

In addition, the nucleic acids of the present invention also include derivatives of nucleic acids comprising the < RTI ID = 0.0 > polynucleotide < / RTI > polI promoter. Such derivatives may be prepared from the individual RNA pol I regulatory sequences defined below using any method known to those skilled in the art. For example, a derivative can be produced by substitution, insertion or deletion of one, two, three, five or ten or more nucleotides that make up a nucleic acid, for example by a position-specific mutagenesis method. Alternatively, the derivative can be prepared by a random mutagenesis method. One method of randomly mutating nucleic acids involves amplifying the nucleic acids through PCR reactions in the presence of 0.1 mM MnCl ₂ and under unbalanced nucleotide concentrations. This condition raises the rate of misincorporation of the polymerase used in the PCR reaction, thus randomly mutating the amplified nucleic acid. Preferably, the derivative nucleic acid retains the ability to initiate transcription of a gene operably linked to a nucleotide sequence. In certain embodiments, the nucleic acid of the present invention comprises at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, or even more than about 100 nucleotides of one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or more than 1000 consecutive nucleotides. Preferably, the nucleic acid of the present invention is a functional derivative, since it contains a sequence capable of initiating transcription of a gene operably linked to a nucleotide sequence in a canine cell. In one embodiment, the nucleic acid of the invention comprises a sequence capable of binding to the polI polypeptide and initiating the transcription (in vitro or in vivo) of influenza vRNA in the dog cells. In one embodiment, there is provided an isolated nucleic acid sequence comprising at least 250, or at least 350, or at least 450 consecutive nucleotides of the sequence set forth in SEQ ID NO: 26, wherein said nucleic acid sequence encodes an influenza vRNA operably linked to a cDNA to, when introduced into MDCK cells, express said influenza vRNA. In another embodiment, there is provided a separate nucleic acid sequence comprising a polynucleotide having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 26, wherein said nucleic acid sequence is operably linked to a cDNA encoding influenza vRNA When introduced into MDCK cells, the influenza vRNA can be expressed. In another embodiment, under stringent hybridization conditions, there is provided a separate nucleic acid sequence comprising a polynucleotide that hybridizes with a nucleic acid selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 26, wherein said nucleic acid sequence is influenza vRNA , And when introduced into MDCK cells, can express the influenza vRNA. In certain embodiments, the nucleic acid of the invention comprises about 400, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000 or 3000 consecutive nucleotides of SEQ ID NO: 29.

In certain embodiments, the nucleic acid sequence of the invention comprises a nucleotide at position -469 to-1 of the sequence set forth in SEQ ID NO: 1 (relative to the first nucleotide transcribed from the promoter, also known as +1 nucleotides) Or comprises, for example, In another embodiment, the nucleic acid sequence of the invention comprises a nucleotide sequence of -250 to -1 nucleotides (relative to the first nucleotide transcribed from the promoter, also known as +1 nucleotide) or a functional derivative thereof, of the sequence set forth in SEQ ID NO: 1 , Or this. The nucleotide at position +1 for the 18S ribosomal RNA expressed from the four polI control sequences found in SEQ ID NO: 1 is the nucleotide at position 1809 of SEQ ID NO: In one embodiment, a nucleic acid comprising nucleotides 1 to 469 of SEQ ID NO: 26, a complementary sequence thereof, a reverse complement sequence thereof, or a functional active fragment thereof is provided.

The present invention also provides a functionally active fragment of SEQ ID NO: 1 (a partial sequence of the nucleotide sequence present in the ATCC deposited clone with accession number PTA-7540). Therefore, the present invention also provides polynucleotides in which one or more nucleic acid residues are deleted from the amino terminus of the nucleotide sequence of SEQ ID NO: 1. The N-terminal deletion of SEQ ID NO: 1 can be illustrated by the general formula m-3537 wherein m is an integer from 2 to 3512, m is the nucleotide identified in SEQ ID NO: 1, or a deposited clone No. PTA-7540). ≪ / RTI > The present invention also provides polynucleotides wherein one or more nucleic acid residues are deleted from the carboxy terminus of the nucleotide sequence of SEQ ID NO: 1. The C-terminal deletion of SEQ ID NO: 1 can be illustrated by the general formula 1-n, wherein n is an integer from 2 to 3512, n is the nucleotide identified in SEQ ID NO: 1, or a deposited clone No. PTA-7540). ≪ / RTI >

The present invention also provides a functionally active fragment of SEQ ID NO: 26 (a partial sequence of the nucleotide sequence present in the ATCC deposited clone with accession number PTA-7540). Therefore, the present invention also provides polynucleotides wherein at least one nucleic acid residue is deleted from the amino terminus of the nucleotide sequence of SEQ ID NO: 26. The N-terminal deletion of SEQ ID NO: 26 can be illustrated by the general formula m-469, where m is an integer from 2 to 450 and m corresponds to the position of the nucleic acid residue identified in SEQ ID NO: 26. The present invention also provides polynucleotides wherein one or more nucleic acid residues are deleted from the carboxy terminus of the nucleotide sequence of SEQ ID NO: 26. The C-terminal deletion of SEQ ID NO: 26 can be illustrated by the general formula 1-n, where n is an integer from 2 to 450 and n corresponds to the position of the nucleic acid residue identified in SEQ ID NO: 26.

In certain embodiments, the open polyline control sequences of the invention are capable of hybridizing under stringent hybridization conditions to a nucleic acid comprising a nucleic acid selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 28, operably linked to a control sequence (Or a complementary sequence thereof) that is capable of initiating transcription of the gene in the cell of the subject.

In one embodiment, an open polyl control sequence of the invention comprises a nucleic acid sequence capable of binding to an open polynucleotide polI polypeptide, and in one embodiment, transcription of a gene operably linked to the nucleotide sequence Lt; RTI ID = 0.0 > cells. ≪ / RTI > In one embodiment, the nucleic acid comprises a sequence capable of binding to a eukaryotic pol I polypeptide to initiate transcription (in vitro or in vivo) of influenza vRNA. In certain embodiments, whether a polynucleotide polI polypeptide binds to an open polI regulatory sequence is identified using a nuclease protection assay. In certain embodiments, the binding of the open polI regulatory sequence to the open polyl polypeptide is confirmed using a BIACORE system (Biacore International AG, Uppsala, Sweden) for evaluating protein interactions.

In certain embodiments, the nucleic acid of the invention comprises a sequence that binds to the RNA polI. In certain embodiments, the sequence binds to an RNA polI with greater affinity than an affinity for an RNA polymerase selected from the group consisting of primate RNA polI, human polI and mouse polI. In certain embodiments, the sequence binds to an RNA polI that is more affinity than the affinity of the RNA pol II. In certain embodiments, the sequence binds to an RNA polI that is more affinity than the affinity for the individual RNA polIII. In certain embodiments, whether binding with open polI regulatory sequences is confirmed using a Biacore system (Biacore International AG, Uppsala, Sweden) for assessing protein interactions.

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

[This sequence is a partial sequence of the nucleotide sequence present in the ATCC clone deposited with accession number PTA-7540].

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

In certain embodiments, the two RNA pol I promoters comprise, or consist of,

5.3 Vector and Expression Vector

In another aspect, the invention provides an expression vector useful for recombinantly delivering a vector comprising a nucleic acid of the present invention, for example, from a cell culture broth. In general, expression vectors are useful for the recovery of any viruses known to those skilled in the art that are required to produce RNA with a defined ending during the life cycle of the virus. For example, as described above, the influenza virus genomic RNA must have constant 5 'and 3' ends that are efficiently replicated and packaged within the recombination system. See Neumann et al. (2002), 83: 2635-2662, which is incorporated herein by reference. The following discussion focuses on expression vectors suitable for use with influenza; It should be noted that other viruses may also be alleviated using the vectors of the present invention.

According to the invention, in one embodiment, the eight genomic segments of influenza (these fragments may originate from different influenza viruses, for example from six strains from strain X and from two strains from strain Y) Can be inserted into the recombinant vector for manipulation and production of influenza viruses. Various vectors such as viral vectors, plasmids, cosmids, phage and artificial chromosomes may be used in the present invention. Typically, in order to facilitate manipulation, the cDNA may be used in a plasmid vector, i. E., One or more cloning sources that function in bacterial and eukaryotic cells, and optionally, for screening or screening for cells in which the plasmid sequences are integrated Lt; RTI ID = 0.0 > plasmid < / RTI > See, for example, Neumann et al., 1999, PNAS. USA 96: 9345-9350.

In one embodiment, the vector of the invention is capable of generating (i. E., (+) Chain and (-) chain virus RNA molecules capable of initiating transcription of viral genome segments from cDNA inserted in either direction Lt; / RTI > expression vector. In order to perform bi-directional transcription, each of the viral genome segments may be inserted into an expression vector having two or more independent promoters, in which case the viral genomic RNA transcripts may be inserted into a first RNA polymerase promoter (e. G. Promoter), and the viral mRNA is synthesized from a second RNA polymerase promoter (e.g., an intracellular RNA PolII promoter or other promoter capable of initiating transcription by RNA pol II in a dog cell) . Thus, the two promoters can be aligned in opposite directions while being in contact with one or more cloning sites (i. E., Restriction enzyme recognition sequences), preferably unique cloning sites, suitable for insertion of viral genomic RNA segments. Alternatively, an "ambisense" expression vector in which (+) chain mRNA and (-) chain virus RNA (cRNA) are transcribed from the same chain of a vector may be used. As described above, the polI promoter that transcribes the viral genomic RNA is preferably four pol I promoters.

To ensure the correct 3 ' end of each expressed vRNA or cRNA, each vRNA or cRNA expression vector may be terminated with a suitable terminator sequence downstream of the RNA coding sequence (e. G., Human, mouse, primate or RNA polymerase I termination sequence) or a ribozyme sequence. This may be, for example, a hepatitis delta virus genomic ribozyme sequence or a functional derivative thereof, or a rDNA end sequence of an animal (Genbank accession number M12074). Alternatively, for example, PolI termination sequences can be used [Neumann et al., 1994, Virology 202: 477-479]. RNA expression vectors can be constructed in the same manner as vRNA expression vectors [Pleschka et al., 1996, J. Virol. 70: 4188-4192; Hoffmann and Webster, 2000, J. Gen Virol. 81: 2843-2847; Hoffmann et al., 2002, Vaccine 20: 3165-3170; Fodor et al., 1999, J. Virol. 73: 9679-9682; Neumann et al., 1999, P. N. A. S. USA 96: 9345-9350; And Hoffmann et al., 2000, Virology 267: 310-317; Each of which is incorporated herein by reference in its entirety).

In other systems, the viral sequences transcribed by polI and polII promoters may be transcribed from different expression vectors. In this embodiment, the regulatory sequences of the present invention, for example, a vector ("vRNA expression vector") encoding each of the viral genomic segments under the control of the polI promoter, and one or more viral polypeptides For example, vectors encoding influenza PA, PB1, PB2 and NP polypeptides ("protein expression vectors") can be used.

In either case, with respect to the pol II promoter, the influenza viral genome segment to be expressed may be operably linked to a suitable transcription control sequence (promoter) to induce mRNA synthesis. There are a number of promoters suitable for use in expression vectors to control the transcription of the influenza virus genome segments. In certain embodiments, a cytomegalovirus (CMV) DNA-dependent RNA polymerase II (PolII) promoter is used. If desired, for example, other promoters that induce RNA transcription under certain conditions or within a particular tissue or cell can be used to regulate conditional expression. A number of viruses and mammalian promoters can be used, e. G., Human promoters, or such promoters can be isolated depending on the particular application. For example, alternative promoters derived from the genomes of animal and human viruses include adenovirus (e. G., Adenovirus 2), papilloma virus, hepatitis B virus and polyoma virus ), And various retroviral promoters. Mammalian promoters include actin promoters, immunoglobulin promoters, and heat shock promoters. In certain embodiments, the regulatory sequence comprises an adenovirus 2 major late promoter that is linked to a spliced tertiary leader sequence of human adenovirus 2 [Berg et al., Bio Techniques 14: 972-978]. In addition, a bacteriophage promoter, for example, a T7 promoter, can be used with the parent RNA polymerase.

The expression vector used to express the viral protein, specifically, the viral protein for RNP complexation, may preferably express a viral protein homologous to the desired virus. The expression of the viral protein by such an expression vector can be regulated by any regulatory sequence known to those skilled in the art. Regulatory sequences may be constitutive promoters, inducible promoters or tissue-specific promoters. Other examples of promoters that can be used to control the expression of viral proteins in protein expression vectors include the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290: 304-310), the 3 ' The promoter (Yamamoto et al., 1980, Cell 22: 787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1441-1445), metallothionein Regulatory sequences of genes (Brinster et al., 1982, Nature 296: 39-42); (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), or the tac promoter (DeBoer et al. 1983, Proc Natl Acad Sci USA 80: 21-25 and "Useful proteins from recombinant bacteria", Scientific American, 1980, 242: 74-94); A promoter (Herrera-Estrella et al., Nature 303: 209-213) or a cauliflower mosaic virus 35S RNA promoter (Gardner et al., 1981, Nucl. Acids Res. 9: 2871), and the promoter of the photosynthetic enzyme ribulose bisphosphate carboxylase (Herrera-Estrella et al., 1984, Nature 310: 115-120); Promoter elements derived from yeast or other fungi, such as the Gal4 promoter, the ADC (alcohol dehydrogenase) promoter, the PGK (phosphoglycerol kinase) promoter, the alkaline phosphatase promoter, and the (Swift et al., 1984, Cell 38: 639-646; Omitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50 : 399-409; McDonald, 1987, Hepatology 7: 425-515); (Hanahan, 1985, Nature 315: 115-122) active in pancreatic beta cells, immunoglobulin gene control sites active in lymphocytes (Grosschedl et al., 1984, Cell 38: 647-658; Adames Cells of the mouse breast cancer virus control region active in the testes, breast, lymphoid cells and mast cells (see, for example, Muller et al., 1985, Nature 318: 533-538; Alexander et al., 1987, Mol Cell Biol. 7: 1436-1444) (Pinkert et al., 1987, Genes and Devel. 1: 268-276), liver-activated alpha-fetoprotein gene control (Leder et al., 1986, Cell 45: 485-495) (Krumlauf et al., 1985, Mol. Cell. Biol. 5: 1639-1648; Hammer et al., 1987, Science 235: 53-58); (Kelsey et al., 1987, Genes and Devel. 1: 161-171) active in the liver, beta-globin gene control sites active in bone marrow cells (Mogram et al., 1985, Nature 315 : 338-340; Kollias et al., 1986, Cell 46: 89-94); (Readhead et al., 1987, Cell 48: 703-712) active in the oligodendrocyte cell of the brain (Myriin protein gene control region (Sani, 1985, Nature 314: 283-286), and the hypothalamus active gonadotropin releasing hormone gene control region (Mason et al., 1986, Science 234: 1372-1378).

In certain embodiments, the protein expression vectors of the present invention comprise a promoter operably linked to a nucleic acid sequence, one or more origin of replication, and optionally one or more selectable markers (e.g., an antibiotic resistance gene). In another embodiment, a protein expression vector of the invention capable of producing two cistronic mRNAs can be produced by inserting a two-cystronic mRNA sequence. Any internal ribosome entry site (IRES) sequence may be used. Preferred IRES elements include, but are not limited to, mammalian BiP IRES and hepatitis C virus IRES.

In one embodiment, the nucleic acid of the invention is inserted into the plasmid pAD3000 or a derivative thereof. See, for example, U.S. Patent Application Publication No. 20050266026 and Figure 10. Thus, in certain embodiments, the expression vector is a bi-directional expression vector. In certain embodiments, the expression vector comprises an SV40 polyadenylation signal present in proximity to a segment of the influenza viral genome between the two promoters. In certain embodiments, the expression vector comprises a cytomegalovirus (CMV) DNA-dependent RNA pol II promoter. In one embodiment, the nucleic acid of the invention is inserted into the plasmid pAD4000 or a derivative thereof. In one embodiment, the nucleic acid of the invention comprises or consists of the sequence of pAD4000 set forth in SEQ ID NO: 29.

Gene-inserted expression vectors can be identified, for example, by three general approaches: (a) nucleic acid hybridization; (b) the presence or absence of "marker" gene function; And (c) expressing the inserted sequence (if it is an expression vector). In the first approach, the presence of the inserted viral gene in the vector (s) can be detected by nucleic acid hybridization using a probe comprising a sequence homologous to the inserted gene (s). In a second approach, the recombinant vector / host system is characterized by the presence or absence of the function of any "marker" gene (eg, an antibiotic resistance or transformation phenotype) induced by inserting the gene (s) And the like. In a third approach, an expression vector can be identified by assaying the expressed gene product. Such assays can be based, for example, on the physical or functional properties of viral proteins in an in vitro assay system, for example, the binding properties of antibody and viral proteins.

In certain embodiments, the one or more protein expression vectors encode and express the viral proteins necessary for the formation of the RNP complex. In another embodiment, the one or more protein expression vectors encode and express the viral proteins necessary to form viral particles. In another embodiment, the one or more protein expression vectors encode and express all of the viral proteins of a particular negative strand RNA virus.

Transcription in an expression vector may optionally be enhanced by including an enhancer sequence. Enhancers are typically cis-acting DNA elements that are short in length (for example, 10 to 500 bp) and serve to increase transcription with the promoter. A number of enhancer sequences have been isolated from mammalian genes (hemoglobin, elastase, albumin, alpha-fetoprotein and insulin) and eukaryotic cell viruses. The enhancer can be spliced and cloned at the 5 'or 3' position to the heterologous coding sequence in the vector, but is typically inserted at the 5 'position relative to the promoter. Typically, the promoter, if desired, additional transcription enhancing sequences are selected to optimize expression in the host cell type into which the heterologous DNA is to be introduced (Scharf et al. (1994) Heat stress promoters and transcription factors Results Probl Cell Differ 20: 125-62 ; Kriegler et al. (1990) Assembly of enhancers, promoters and splice signals to control expression of transferred genes Methods in Enzymol 185: 512-27. Optionally, the amplicon may also contain a ribosome binding site or an internal ribosome introduction site (IRES) necessary for translation initiation.

The expression vector of the present invention may also include a transcription termination sequence and an mRNA stabilization sequence, for example, a polyadenylation position or a termination sequence (for example, a human, mouse, primate or RNA polymerase I terminator sequence). Such sequences are generally obtained from the 5 'end of the eukaryotic or viral DNA or cDNA, and optionally from the non-translated site at the 3' end. In some embodiments, the SV40 polyadenylation sequence provides a polyadenylation signal.

In addition, as described above, the vector may contain, in addition to the genes described above, optionally one or more selectable marker genes that provide phenotypic traits for selection of transformed host cells, and may include markers such as dihydrofolate The reductase or neomycin resistance gene is suitable for screening in eukaryotic cell culture fluids.

As described above, an expression vector containing a suitable DNA sequence and a suitable promoter or control sequence can be used to transform a host cell and express the protein. Although the expression vector of the present invention can be replicated in bacterial cells, in general, in order to express the expression vector of the present invention, the vector may be introduced into mammalian cells such as Vero cells, BHK cells, MDCK cells, 293 cells, COS It may be preferable to introduce it into the cell, and more preferably, to introduce it into the MDCK cell.

The expression vector of the present invention may be a genomic vRNA in which one or more mutations (e. G., A mutation that eliminates or inactivates the polyvalent base cleavage site present in the HA gene of H5N1, for example, a particular influenza infectious strain) RTI ID = 0.0 > cRNA < / RTI > These mutations can attenuate the virus. For example, the vRNA segment can be an attenuated base pair substitution present within the pan-handle duplex promoter region, specifically, for example, within the duplex region of the NA-specific vRNA Can be the vRNA segment of influenza A virus with known weak base pair substitutions, such as substitution with A to C and substitution with U to G, occurring at positions 11 to 12 (Fodor et al., 1998, J. Virol. 6923-6290]. By using the method of the present invention for producing the recombinant negative strand RNA virus, a novel weak mutation can be identified.

Also disclosed in U.S. Patent Nos. 6,951,754, 6,887,699, 6,649,372, 6,544,785, 6,001,634, 5,854,037, 5,824,536, 5,840,520, 5,820,871, Any of the expression vectors as disclosed in U.S. Patent Nos. 5,786,199, 5,166,057, and U.S. Patent Application Publications 20060019350, 20050158342, 20050037487, 20050266026, 20050186563, 20050221489, 20050032043, 20040142003, 20030035814, and 20020164770, Can be used. Generally, the vectors disclosed in this document can be used to transform a nucleic acid of the invention (e. G., An open control sequence of the invention, e. G., An open polI promoter sequence) By introducing it into the vector, it can be adapted to be used in accordance with the present invention.

5.3.1 Factors of Addition

Most commonly, the genome segments encoding the influenza virus proteins comprise any additional sequences necessary for expression, e. G. Translation into a functional viral protein. In other cases, viral proteins such as mini genes or other artificial constructs encoding HA or NA proteins can be used. In this case, it may be desirable to include a specific initiation signal which helps the heterologous coding sequence to be efficiently translated. Such signals may include, for example, an ATG start codon and a sequence residing adjacent thereto. To ensure translation of the entire insert, the initiation codon is inserted into the correct decoding frame associated with the viral protein. Exogenous transcription factors and initiation codons can be those derived from a variety of sources (natural and synthetic). Expression efficiency can be enhanced by including an enhancer suitable for use in a cell system.

If desired, polynucleotide sequences encoding additional expression elements, e.g., signal sequences, secretion or localization sequences, are generally in-frame, integrated into the vector along with the desired polynucleotide sequence, For example, polypeptide expression can be targeted to intracellular compartments, membranes, or organs, or cell culture media that are desired. Such sequences are known to those skilled in the art and include, for example, secretory leader peptides, organ targeting sequences (e.g., nuclear localization sequences, ER retention signals, mitochondrial transport sequences) or membrane localization / (E. G., Termination sequences, GPI-fixed sequences), and the like.

5.4 Expression vectors for the production of chimeric viruses

The expression vectors of the invention may also be used to produce chimeric viruses that express heterologous sequences with viral genomes. The expression vector expressing the vRNA or the corresponding cRNA may be introduced into the host cell together with an expression vector expressing the viral protein to produce a new infectious recombinant negative strand RNA virus or chimeric virus. See, for example, U.S. Patent Application Publication No. US20040002061. Heterologous sequences that can be engineered into such viruses include antisense nucleic acids and nucleic acids such as ribozymes. Alternatively, a heterologous sequence expressing a peptide or polypeptide may be engineered into such a virus. A heterologous sequence encoding a peptide or polypeptide such as the following may be engineered into such a virus: 1) an antigen that characterizes the pathogen; 2) an antigen that characterizes an autoimmune disease; 3) allergen-causing antigen; And 4) an antigen that characterizes the tumor. For example, heterologous gene sequences that can be engineered into the chimeric viruses of the invention include epitopes of the human immunodeficiency virus (HIV), such as gp160; Surface antigen (HBsAg) of hepatitis B virus; Glycoproteins of herpes viruses (e. G., GD, gE); VP1 of poliovirus; And non-viral pathogens, including, but not limited to, bacterial and viral antigenic determinants (although in a minority of cases).

Autoimmune diseases such as diabetes mellitus, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, malignant anemia, Addison's disease, scleroderma, autoimmune atrophic gastritis, fulminant diabetes mellitus, Antigens will typically originate from cell surface, cytoplasm, nuclei, mitochondria and other mammalian tissues.

Allergenergic antigens generally include antigens derived from proteins or glycoproteins such as pollen, dust, mold, spores, dandruff, insects and food.

Antigens that characterize tumor antigens will typically originate from the cell surface, cytoplasm, nucleus or organs of tumor tissue, and other cells. Examples include antigens that characterize tumor proteins, for example, proteins encoded by mutated carcinogenic genes; Viral proteins associated with tumors; And glycoproteins. Tumors include tumors derived from a particular type of cancer; The larynx, the nasopharynx, the pharynx and the oral cavity, the esophagus, the stomach, the colon, the rectum, the liver, the gallbladder, the pancreas, the larynx, the lung and the bronchus, the skin melanoma, the breast, the cervix, But are not limited to, a portion of the nervous system, thyroid, prostate, testes, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma and leukemia.

In one embodiment of the invention, the heterologous sequence is derived from the genome of human immunodeficiency virus (HIV), preferably human immunodeficiency virus-1 or human immunodeficiency virus-2. In another embodiment of the invention, the heterologous coding sequence may be inserted into the negative strand RNA virus gene coding sequence so that a chimeric gene product containing a heterologous peptide sequence in the viral protein may be expressed. In such embodiments of the invention, the heterologous sequence may also be derived from the human immunodeficiency virus, preferably the genome of human immunodeficiency virus-1 or human immunodeficiency virus-2.

When the heterologous sequence is an HIV-derived sequence, such a sequence may include a sequence derived from the env gene (i.e., a sequence encoding all or part of gpl60, gpl20, and / or gp41), a pol gene (i.e., a reverse transcriptase, Pg, p55, p17 / 18, p24 / 25, a sequence coding for all or part of an integrase), tat, rev, nef, vif, vpu, vpr, and / or vpx.

One method for constructing such a hybrid molecule is to insert the heterologous coding sequence into the DNA complementary sequence of the negative strand RNA virus gene so that the heterologous sequence contains the viral sequence necessary for viral polymerase activity, And a method of making it face to the polyadenylation position. In an alternative method, the oligonucleotides encoding the < RTI ID = 0.0 > RNA polI < / RTI > promoter, for example, the complementary sequences of both the 3'-terminal or 3'and the 5'terminus of the viral genome segment, It can be ligated. The position of a foreign gene or a segment of a foreign gene in the target sequence is represented by the presence of a suitable restriction enzyme site in the target sequence. Recently, however, methods have been developed in molecular biology to compensate for these problems. Position-directed mutagenesis can be used to easily position the restriction enzyme at any position in the target sequence (see, for example, Kunkel, 1985, Proc. Natl. Acad. : 488). Through a modification of the PCR technique described herein, it is possible to insert the sequence at a specific position (i.e., a restriction enzyme site) and also to easily construct a hybrid molecule. Alternatively, PCR reactions could be used to prepare recombinant templates without the need for cloning. For example, the PCR reaction can be carried out by preparing a hybrid sequence containing a double-stranded DNA molecule containing a DNA-oriented RNA polymerase promoter (for example, bacteriophage T3, T7 or SP6) and a heterologous gene and a single RNA polI promoter . Subsequently, the RNA template could be directly transcribed from such recombinant DNA. In another embodiment, the recombinant vRNA or its corresponding cRNA can be prepared by ligating RNAs that specify a heterologous gene having negative polarity and the RNA polI promoter of a negative polarity using an RNA ligase.

The two cistronic mRNA may be internally initiated to translate the viral sequence and may be constructed to express an exogenous protein coding sequence from a common terminal initiation site. Alternatively, the two cistronic mRNA sequences may be constructed such that the viral sequences are translated from a conventional open reading frame (where the foreign sequence begins at an internal location). Any internal ribosome entry site (IRES) sequence may be used. The selected IRES sequence should be short enough not to interfere with the virus packaging limitation. Therefore, the IRES selected for use in such a two-cistronic method should have a length of no more than 500 nucleotides, preferably less than 250 nucleotides. It is also preferred that the IRES used is not structurally homologous to the picornavirus element. Preferred IRES elements include, but are not limited to, mammalian BiP FRES and hepatitis C virus IRES.

Alternatively, the exogenous protein may be expressed from an internal transcription unit in which the transcription unit has an initiation site and a polyadenylation site. In another embodiment, the foreign gene is inserted into the negative strand RNA virus gene, so that the resulting protein is a fusion protein.

5.5 How to Produce Recombinant Virus

The present invention provides a method for producing an infectious recombinant negative strand RNA virus by introducing a protein expression vector of the present invention and an expression vector expressing vRNA or its corresponding cRNA in the absence of a helper virus into a host cell. Preferably, host cells include dog cells such as MDCK cells. The present invention also provides a method for producing an infectious recombinant negative strand RNA virus by introducing a protein expression vector of the present invention and an expression vector expressing vRNA or its corresponding cRNA in the presence of a helper virus into a host cell. The host cell may be a mammalian cell such as a mouse (e.g., MDCK cell), Vero cell, Per.C6 cell, BHK cell, PCK cell, MDCK cell, MDBK cell, 293 cell .

A protein expression vector and an expression vector that expresses the vRNA or the corresponding cRNA can be introduced into the host cell using any technique known to those skilled in the art. For example, expression vectors of the present invention can be introduced into host cells by electroporation, DEAE-dextran, calcium phosphate precipitation, liposomes, microinjection and microparticle-shock methods (see, for example, Sambrook Et al., Molecular Cloning: A Laboratory Manual, 2 ed., 1989, Cold Spring Harbor Press, Cold Spring Harbor, NY). The expression vector of the present invention may be introduced into the host cell either simultaneously or sequentially.

In one embodiment, the at least one expression vector that expresses the vRNA or its corresponding cRNA is introduced into the host cell prior to introducing the expression vector expressing the viral protein. In other embodiments, one or more expression vectors that express the viral proteins are introduced into the host cell prior to introducing the vRNA or one or more expression vectors that express the corresponding cRNA. According to this embodiment, the expression vector expressing the vRNA or its corresponding cRNA can be introduced separately or separately via different transfection methods. Also, according to this embodiment, the expression vector expressing the viral protein may be introduced separately or separately via a different transfection method.

In another embodiment, one or more expression vectors that express vRNA or its corresponding cRNA, and one or more expression vectors that express the viral protein are simultaneously introduced into the host cell. In certain embodiments, all expression vectors are introduced into host cells using liposomes.

In one embodiment, there is provided a method of producing recombinant influenza virus comprising: (a) introducing into a canine group an expression vector capable of expressing genomic vRNA segments in a cell, wherein the expression vector comprises the nucleotides 1 to 469 of SEQ ID NO: 26, or a functional active fragment thereof; (b) introducing into said cell an expression vector capable of expressing an mRNA encoding at least one polypeptide of said virus; And (c) culturing said cells to produce influenza virus particles. In one embodiment, when the cells were incubated for 48-72 hours to go station of influenza virus-like particles produced is more than 1.0 × 10 ⁴ PFU / ㎖ or more than 1.0 × 10 ⁵ PFU / ㎖.

In one embodiment, there is provided a method of producing recombinant influenza virus comprising: (a) introducing into a canine group an expression vector capable of expressing genomic vRNA segments in a cell, wherein the expression vector comprises the nucleotides 1 to 469 of SEQ ID NO: 26, or a functional active fragment thereof; (b) introducing into said cell an expression vector capable of expressing an mRNA encoding at least one polypeptide of said virus; And (c) culturing said cells to produce influenza virus particles. In one embodiment, when the cells were incubated for 48-72 hours to go station of influenza virus-like particles produced is more than 1.0 × 10 ⁴ PFU / ㎖ or more than 1.0 × 10 ⁵ PFU / ㎖.

The appropriate amount and suitable ratio of the expression vector for carrying out the method of the present invention can be determined through routine experimentation. As is known, in the case of the liposome transfection or calcium precipitation method for introducing the plasmid into the host cell, each plasmid has a final DNA concentration of about 0.1 < RTI ID = 0.0 > Ml, and may be used in a few μg, for example, 1 to 10 μg. It may be desirable to use a vector expressing the NP and / or RNA-dependent RNA polymerase subunit at a higher concentration than the vector expressing the vRNA segment. The skilled artisan will appreciate that the amount and ratio of expression vector can vary depending on the host cell.

In one embodiment, the at least one protein expression vector of the invention is administered to a host cell in an amount of at least 0.5 μg, preferably at least 1 μg, at least 2.5 μg, at least 5 μg, at least 8 μg, at least 10 μg, at least 15 μg, at least 20 μg Ug or more, 25 쨉 g or more, or 50 쨉 g or more is introduced to produce an infectious recombinant negative strand RNA virus. In other embodiments, one or more expression vectors of the invention that express vRNA or cRNA may be present in the host cell in an amount of at least 0.5, preferably at least 1, at least 2.5, at least 5, at least 8, at least 10, at least 15, Ug or more, 20 쨉 g or more, 25 쨉 g or more, or 50 쨉 g or more are introduced to produce an infectious recombinant negative strand RNA virus.

Examples of host cells that can be used to produce the negative strand RNA virus of the present invention include primary cells, cultured cells or secondary cells, and transformed or infinitely proliferating cells (e.g., 293 cells, 293T cells, CHO cells, Vero cells, PK, MDBK, OMK and MDCK cells). The host cell is preferably an animal cell, more preferably a mammalian cell, and most preferably a dog cell. In a preferred embodiment, the infectious recombinant negative strand RNA virus of the present invention is produced in MDCK cells.

The present invention provides a method for producing an infectious recombinant negative strand RNA virus in a host cell strain that is stably transduced. Stably transfected host cell lines of the present invention can be produced by introducing cDNA and selectable markers that are controlled by appropriate expression control elements (e.g., promoters, enhancers, sequences, transcription termination sequences, polyadenylation sites, etc.) Can be produced. After introduction of the foreign DNA, the transfected cells may be grown in an abundance medium for 1-2 days, and then switched on to the selection medium. The selectable markers confer resistance to cells and also allow cells to stably integrate foreign DNA into their chromosomes. The DNA is stably integrated and the transfected host cell can be cloned and propagated into the cell line.

A number of screening systems may be used, such as the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. And adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22: 817) genes can be used in tk-, hgprt- or aprt- cells, respectively. In addition, the metabolic antagonistic resistance can be assessed using dhfr, which confers resistance to methotrexate [Wigler et al., 1980, Natl. Acad. Sci. USA 77: 3567; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1527; Gpt which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072); Neo (Colberre-Garapin et al., 1981, J. Mol. Biol. 150: 1) which confers resistance to aminoglycoside G-418; And Hygro (Santerre et al., 1984, Gene 30: 147) genes that confer resistance to the hygromycin.

The infectious recombinant negative strand RNA viruses (uninfected viruses) produced by the method of the present invention can be attenuated or killed, for example, by conventional methods. For example, the recombinant negative strand RNA virus of the present invention can be killed by treating heat or formalin, and as a result, the virus can not be replicated. The recombinant negative strand RNA viruses of the present invention (non-attenuated viruses) can be attenuated, for example, by subculture through non-natural hosts to produce immunogenic, non-pathogenic offspring viruses.

The viruses produced, attenuated, live, or killed according to the present invention may be incorporated into the vaccine composition in a conventional manner in the future, or may be used, for example, to produce additional viruses in eggs. If such a virus has a chimeric vRNA segment encoding an exogenous antigen, as described above, the virus may be formulated and be vaccinated simultaneously against one or more pathogens. The attenuated recombinant virus having chimeric vRNA fragments produced according to the present invention may also be designed as other therapeutic means, for example as an anti-tumor agent or gene therapy tool, , The virus will be incorporated into a suitable pharmaceutical composition together with a pharmaceutically acceptable carrier or diluent.

Since there is no need to remove the helper virus culture fluid in the screening method, the remedy of the present invention without helper virus is particularly preferable for producing reclassified viruses, particularly reclassified influenza viruses for vaccination.

The methods of the present invention can be modified by incorporating aspects of the methods known to those skilled in the art to improve the efficiency of the remediation of infectious viral particles. For example, the reverse genetics technique involves the use of synthetic recombinant viral RNAs containing non-coding regions of the negative strand viral RNA, essential for the packaging signal required for production of mature virions and for recognition by viral polymerases . Recombinant RNAs are synthesized from recombinant DNA templates and then reconstituted in vitro with the purified viral polymerase complex to form recombinant ribonucleoprotein (RNP) that can be used to transfect the cells. If the viral polymerase protein is present in vitro or in vivo when the synthetic RNA is transcribed, transfection can be made more efficiently. Synthetic recombinant RNPs can be saved as infectious viral particles. The above-mentioned techniques are described in U.S. Patent No. 5,166,057 (November 24, 1992), which is incorporated herein by reference in its entirety; U.S. Patent No. 5,854,037 (December 29, 1998); U.S. Patent No. 5,789,229 (Aug. 4, 1998); European Patent Publication EP 0702085A1 (Feb. 20, 1996); U.S. Patent Application No. 09 / 152,845; International Patent Publication PCR WO 97/12032 (Apr. 3, 1997); WO 96/34625 (7 November 1996); European patent publication EP-A780475; WO 99/02657 (Jan. 21, 1999); WO 98/53078 (November 26, 1998); WO 98/02530 (Jan. 22, 1998); WO 99/15672 (April 1, 1999); WO 98/13501 (2 April 1998); WO 97/06720 (Feb. 20, 1997); And EPO 780 47SA1 (Jan. 25, 1997).

5.5.1 Specific examples of specific segment negative strand RNA viruses

The present invention provides a method for producing an infectious recombinant viral particle of a segment negative strand RNA virus having three or more genomic vRNA segments in a cultured cell, for example, an influenza virus, for example, an influenza A virus, (A) introducing a first set of expression vectors capable of expressing genomic vRNA segments in a cell into a population of cells capable of supporting the growth of said virus to provide complete genomic vRNA segments of said virus step; (b) introducing into the cell a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of the virus; And (c) culturing the cells to produce the virus particles. In certain embodiments, the cell is a dog cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the recombinant virus is an influenza A virus or an influenza B virus. In certain embodiments, a first set of expression vectors is contained in from 1 to 8 plasmids. In certain embodiments, a first set of expression vectors is contained in one plasmid. In certain embodiments, a second set of expression vectors is contained in from 1 to 8 plasmids. In certain embodiments, a second set of expression vectors is contained in one plasmid. In certain embodiments, the first set, the second set, or both the first set and the second set of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encode each vRNA segment of influenza virus. In certain embodiments, the second set of expression vectors encode all or one or more mRNAs of influenza polypeptides. In certain embodiments, the first or second set of expression vectors (or both the first set and the second set) may comprise a nucleic acid of the invention, e. G., An individual RNA pol I regulatory sequence of the invention (e. 0.0 > polI < / RTI > promoter). In certain embodiments, the first or second set of expression vectors (or both the first and second sets) encode the vRNA or mRNA of the second virus. For example, the vector set comprises one or more vectors encoding HA and / or NA mRNA and / or vRNA of the second influenza virus. In one embodiment, a helper virus is used in the method. In one embodiment, the cultured cells used in the method are dog cells.

The present invention provides a method for producing an infectious recombinant viral particle of a segment negative strand RNA virus having three or more genomic vRNA segments in a cultured cell, for example, an influenza virus, for example, an influenza A virus, (A) a set of expression vectors capable of expressing a genomic vRNA segment in a cell to provide complete genomic vRNA segment of said virus and expressing an mRNA encoding at least one polypeptide of said virus; , Into a cell population capable of supporting the growth of the virus; (b) culturing the cells to produce the virus particles. In certain embodiments, the cell is a dog cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the virus is an influenza A virus or an influenza B virus. In certain embodiments, the expression vector set is contained in from 1 to 17 plasmids. In certain embodiments, the expression vector set is contained in from 1 to 8 plasmids. In certain embodiments, a set of expression vectors is contained in one to three plasmids. In certain embodiments, a set of expression vectors is contained in one plasmid. In certain embodiments, the set of expression vectors is introduced by electroporation. In certain embodiments, the set of expression vectors encode each vRNA segment of influenza virus. In certain embodiments, the set of expression vectors encodes the mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors encodes each vRNA segment of influenza virus and mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, e. G., An intracellular polI regulatory sequence of the invention (e. G., A canine polI promoter). In certain embodiments, the set of expression vectors encode the vRNA or mRNA of the second virus. For example, the vector set comprises one or more vectors encoding HA and / or NA mRNA and / or vRNA of the second influenza virus. In certain embodiments, the first or second set of expression vectors (or both the first and second sets) encode the vRNA or mRNA of the second virus. For example, the vector set comprises one or more vectors encoding HA and / or NA mRNA and / or vRNA of the second influenza virus. In one embodiment, a helper virus is used in the method. In one embodiment, the cultured cells used in the method are dog cells.

The present invention provides a method for producing infectious recombinant viral particles of negative strand RNA virus in cultured cells comprising the steps of: (a) expressing an expression vector capable of expressing genomic vRNA in said cell Introducing the first set of viruses into a population of cells capable of supporting the growth of said virus to provide the complete genome vRNA of said virus; (b) introducing into the cell a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of the virus; And (c) culturing the cell to produce the virus particle. In certain embodiments, the cell is a dog cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the virus is an influenza B virus. In certain embodiments, a first set of expression vectors is contained in from 1 to 8 plasmids. In certain embodiments, a first set of expression vectors is contained in one plasmid. In certain embodiments, a second set of expression vectors is contained in from 1 to 8 plasmids. In certain embodiments, a second set of expression vectors is contained in one plasmid. In certain embodiments, the first set, the second set, or both the first and second sets of expression vectors are introduced by electroporation. In certain embodiments, the first set of expression vectors encode each vRNA segment of influenza virus. In certain embodiments, the second set of expression vectors encode the mRNA of one or more influenza polypeptides. In certain embodiments, the first or second set of expression vectors (or both the first set and the second set) may comprise a nucleic acid of the invention, e. G., An individual RNA pol I regulatory sequence of the invention (e. 0.0 > polI < / RTI > promoter). In one embodiment, a helper virus is used in the method. In one embodiment, the cultured cells used in the method are dog cells.

The present invention provides a method for producing infectious viral particles of negative strand RNA viruses in cultured cells comprising the steps of: (a) expressing genomic vRNA in a cell to produce a complete genome of the virus introducing a set of expression vectors capable of providing vRNA and capable of expressing mRNA encoding one or more polypeptides of the virus into a population of cells capable of supporting the growth of the virus; (b) culturing the cells to produce the virus particles. In certain embodiments, the cell is a dog cell. In certain embodiments, the cell is an MDCK cell. In certain embodiments, the virus is an influenza B virus. In certain embodiments, the expression vector set is contained in from 1 to 17 plasmids. In certain embodiments, the expression vector set is contained in from 1 to 8 plasmids. In certain embodiments, a set of expression vectors is contained in one to three plasmids. In certain embodiments, the set of expression vectors is introduced by electroporation. In certain embodiments, the set of expression vectors encode each vRNA segment of influenza virus. In certain embodiments, the set of expression vectors encodes the mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors encodes each vRNA segment of influenza virus and mRNA of one or more influenza polypeptides. In certain embodiments, the set of expression vectors comprises a nucleic acid of the invention, e. G., An intracellular polI regulatory sequence of the invention (e. G., A canine polI promoter). In certain embodiments, the set of expression vectors encode the vRNA or mRNA of the second virus. For example, the vector set comprises one or more vectors encoding HA and / or NA mRNA and / or vRNA of the second influenza virus. In one embodiment, a helper virus is used in the method. In one embodiment, the cultured cells used in the method are dog cells.

The present invention provides a method for producing segmented negative strand RNA viruses having three or more genomic vRNA segments, such as influenza viruses, for example, infectious viral particles of influenza A virus, in cultured canine cells, (A) in the absence of the helper virus, can support the growth of the virus and directly express genomic vRNA segments in the dog cells to produce the complete genomic vRNA segment of the virus or its corresponding cRNA Providing a first population of canine cells into which a first set of expression vectors capable of being provided is introduced to provide an arbitrary RNA segment wherein the nucleoprotein and RNA-dependent RNA polymerase are provided, A dog cell that may form an RNP complex containing genomic vRNA segments may be produced, It can be assembled within the cells; And (b) culturing the canine cell to produce the virus particle. In certain embodiments, the dog cells are MDCK cells.

The present invention also provides a method of producing infectious viral particles of segment negative strand RNA viruses in cultured canine cells, the method comprising the steps of: (i) a) an RNA complex containing the genomic vRNA can be formed that is capable of providing the genome vRNA of the virus in the absence of the helper virus and (b) being modified to provide a nuclear protein and an RNA-dependent RNA polymerase; Providing a first population of canine cells in which the viral particles can be assembled, wherein the genomic vRNA is expressed directly in the cell under control of the RNA pol II regulatory sequences or functional derivatives thereof; And (ii) culturing the canine cell to produce the virus particle.

The present invention also provides a method for producing infectious viral particles of segmented negative strand RNA virus in cultured cells, the method comprising the steps of: (i) ) Helper virus, and (b) is modified to provide a nuclear protein and an RNA-dependent RNA polymerase to form an RNP complex (s) containing the genomic vRNA Wherein the genomic RNA comprises a plurality of RNA polI regulatory sequences or functional derivatives thereof, for example, a polynucleotide encoding a polynucleotide encoding a polynucleotide encoding a polynucleotide of the present invention, Directly expressed in dog cells]; And (ii) culturing the canine cell to produce the virus particle.

In certain embodiments, infectious recombinant negative strand RNA viruses having more than 4, more than 5, more than 6, more than 7, or more than 8 genomic vRNA segments can be used in a host cell Is produced.

In certain embodiments, the invention provides for the production of infectious recombinant influenza viruses in host cells using expression vectors to express vRNA segments or the corresponding cRNA and influenza virus proteins, specifically PB1, PB2, PA and NA. . ≪ / RTI > According to this embodiment, helper virus can be used or can not be used to produce infectious recombinant influenza virus.

The infectious recombinant influenza virus of the present invention may or may not reproduce and produce offspring. Preferably, the infectious recombinant influenza virus of the present invention is attenuated. For attenuated infectious recombinant influenza viruses, for example, mutations may occur in the NS1 gene.

In certain embodiments, an infectious recombinant virus of the invention can be used to produce other viruses useful for producing the vaccine compositions of the present invention. In one embodiment, recombinant or reclassified viruses produced by the methods of the invention are used to produce additional viruses used as vaccines. For example, recombinant or reclassified viral colonies produced by the methods of the present invention incorporate the intracellular polI control sequences of the present invention (e. G., The intracellular polI promoter). As a result, virus clusters are grown in eggs or other culture media, resulting in the production of vaccines or additional viruses for the production of immunogenic compositions.

In certain embodiments, the infectious recombinant influenza viruses of the invention express heterologous (i.e., non-influenza virus) sequences. In another embodiment, an infectious recombinant influenza virus of the invention expresses an influenza virus protein derived from a different influenza strain. In another preferred embodiment, the infectious recombinant influenza virus of the invention expresses a fusion protein.

5.5.2 Introduction of vectors into host cells

Vectors comprising influenza genome segments may be obtained by methods well known in the art as methods for introducing heterologous nucleic acid into eukaryotic cells [see, for example, U.S. Patent Application Publication Nos. US20050266026 and US20050158342], calcium phosphate co- (E. G., Transfected) into host cells according to the methods of transfection, electroporation, microinjection, transfection and transfection using polyamine transfection reagents. For example, a vector can be prepared, for example, using the polyamine transfection reagent trans-ITl (TransIT-LTl; Mirus) according to the manufacturer's instructions, using host cells such as MDCK cells, COS cells, 293T cells , Or a mixture of these cells. About 1 μg of each vector to be introduced into the host cell population can be combined with about 2 μl of trans IT-LT1 diluted in 160 μl of medium (preferably serum-free medium) to a total volume of 200 μl. DNA: The mixture of transfection reagent is incubated for 45 minutes at room temperature, and then 800 μl of medium is added thereto. Then, the transfection mixture is added to the host cells, and the cells are cultured as described above. Therefore, in order to produce recombinant or reclassified viruses in cell culture fluids, a vector having eight genomic segments (PB2, PB1, PA, NP, M, NS, HA and NA) Lt; RTI ID = 0.0 > LT1 < / RTI > and then transfected into host cells. Optionally, prior to transfection, serum-containing medium is exchanged with serum-free medium, for example Opti-MEM I, and incubated again for 4-6 hours.

Alternatively, vectors in which the influenza genome segments are integrated can be introduced into the host cells using electroporation. See, for example, U.S. Patent Application Publication Nos. US20050266026 and US20050158342, which are incorporated herein by reference. For example, a plasmid vector incorporating influenza A virus or influenza B virus is introduced into MDCK cells using electroporation according to the following method. To summarize, for example, 5x10 ⁶ MDCK cells grown in modified Eagle's medium (MEM) supplemented with 10% fetal bovine serum (FBS) are resuspended in 0.3 ml OptiMEM and placed in an electroporation cuvette . 20 μg (total volume 25 μl or less) of DNA is added to the cells in the cuvette, followed by gentle tapping. Electroporation is performed at 300 volts, 950 microfarads, with a time constant of 35 to 45 msec, according to the manufacturer's instructions (for example, BioRad Gene Pulser II, Capacitance Extender Plus ) connect]. After electroporation, the cells are re-mixed by gently patting them for about 1-2 minutes and 0.7 ml of OPTI-MEM is added directly to the cuvette. The cells are then transferred into two wells of a standard 6-well tissue culture dish [containing 2 ml of OPTI-MEM, serum free]. The cuvette is washed to recover residual cells, and the wash suspension is divided into two wells. The final volume should be about 3.5 ml. Thereafter, the cells are incubated under conditions under which the virus can grow, for example, at a temperature of about 33 ° C (cold-adapted strain).

Further descriptions of introducing vectors into host cells can be found in, for example, U.S. Patent Nos. 6,951,754, 6,887,699, 6,649,372, 6,544,785, 6,001,634, 5,854,037, And 5,166,057 and 5,166,057 and U.S. Patent Application Publication Nos. 20060019350, 20050158342, 20050037487, 20050266026, 20050186563, 20050221489, 20050032043, 20040142003, 20030035814, and 20020164770, .

5.6 Cell culture

Typically, propagation of the virus occurs in a medium composition in which the host cells are generally cultured. Suitable host cells for replicating influenza virus include, for example, Vero cells, Per.C6 cells, BHK cells, MDCK cells, 293 cells and COS cells, for example, 293T cells and COS7 cells. MDCK cells are preferred for use in the present invention. The use of non-tumorigenic MDCK cells as host cells also corresponds to embodiments of the present invention. Using a co-culture solution containing, for example, a 1: 1 ratio of any one of 293T cells or COS cells and MDCK cells containing two of these cell lines, the replication efficiency may be improved have. See, for example, 20050158342. Typically, the cells are cultured in standard commercial culture media, such as serum (e.g., 10%), with appropriate control to maintain humidity and CO ₂ concentration at a neutral buffer pH (e.g., pH 7.0-7.2) Fetal bovine serum) supplemented with Dulbecco ' s modified Eagle ' s medium, or serum-free medium. Optionally, the medium can be an antibiotic, such as penicillin, streptomycin and the like, and / or additional nutrients such as L-glutamine, sodium pyruvate, an indispensable amino acid, preferably supplementary ingredients for promoting growth For example, trypsin,? -Mercaptan ethanol and the like.

Methods for maintaining mammalian cells in culture fluids have been extensively reported and are known to those skilled in the art. Common methods are described, for example, in Freshney (1983) Culture of Animal Cells: Manual of Basic Technique, Alan R. Liss, New York; Paul (1975) Cell and Tissue Culture, 5th ed., Livingston, Edinburgh; Adams (1980) Laboratory Techniques in Biochemistry and Molecular Biology-Cell Culture for Biochemists, Work and Burdon (eds.) Elsevier, Amsterdam. Further explanations for tissue culture methods with specific purposes, such as those intended to produce influenza virus in vitro, are described, for example, in Merten et al. (1996) Production of influenza virus in cell cultures for vaccine preparation, Cohen and Shafferman (eds) Novel Strategies in Design and Production of Vaccines. In addition, variations of this method employed in the present invention are readily determined through routine experimentation.

Cells for producing influenza virus can be cultured in serum-containing medium or serum-free medium. In some cases, for example, when preparing a purified virus, it is preferable to grow the host cell under serum-free conditions. The cells may be in the form of micro-sized beads (e.g., DEAE-1) in a small scale, for example, in a culture medium of less than 25 ml, in a culture tube or flask, or in a large flask in which stirring is carried out, in a bottle or flask equipped with a rotor, Dextran microspheres beads such as Dormacell (Pfeifer & Langen), Superbead (Flow Laboratories), styrene copolymer-3 heavy-methylamine beads such as Hillex, ≪ / RTI > SoloHill, Ann Arbor). Microcarrier beads are small spheres (100 to 200 mu m in diameter) and provide a large surface area for the growth of adherent cells per a fixed volume of cell culture fluid. For example, 1 liter of medium may contain 20 million or more fine carrier beads having a growth surface of 8000 cm 2 or more. It may be desirable to cultivate the cells in a bioreactor or fermenter in order to produce the virus commercially (for example, for the production of white acids). There are various types of bioreactors ranging from not less than 1 liter to more than 100 liter. Examples include Cyto3 Bioreactor (Osmonics, Minnetonka, MN); NBS bioreactor (New Brunswick Scientific, Edison, N. J.); There are laboratory and commercial scale bioreactors (B. Braun Biotech International, B. Braun Biotech, Melsungen, Germany).

In the present invention it is important to keep the temperature of the culture below 35 ° C regardless of the volume of the culture medium so that recombinant and / or reclassified influenza viruses, specifically low temperature-adaptive, thermostable and attenuated recombinant and / Or the reclassified influenza virus can be efficiently recovered. For example, the cells are incubated at a temperature of about 32 to 35 째 C, typically about 32 to about 34 째 C, typically about 33 째 C.

Typically, a regulator may be used, such as a thermostat or other device that senses and maintains the temperature of the cell culture system, so that the temperature does not exceed 35 [deg.] C during the viral replication period.

5.7 Recovery of virus

The virus is typically recovered from the culture medium in which the infected (transfected) cells have been grown. Typically, the crude medium is clear before influenza virus is enriched. Commonly used methods include filtration, ultrafiltration, adsorption and elution on barium sulfate, and centrifugation. For example, the crude medium derived from the infected culture medium may initially be subjected to centrifugation at 1000-2000 x g for a time sufficient to remove cell debris and other large particulate matter, for example, for 10-30 minutes To be transparent. Alternatively, the medium is filtered through a 0.8 占 퐉 cellulose acetate filter to remove intact cells and other large particulate matter. Optionally, the clear medium supernatant is centrifuged (e.g., 15,000 x g, about 3 to 5 hours) to make the influenza virus into pellets. After resuspending the virus pellet in a suitable buffer, for example STE (0.01 M Tris-HCl; 0.15 M NaCl; 0.0001 M EDTA) or phosphate buffered saline (PBS, pH 7.4) ) Or potassium tartarate (50 to 10%). Continuous or step-wise gradients For example, a sucrose gradient of 12 to 60% (4 steps of 12%) is appropriate. Centrifuge the gradient at a rate and for a time sufficient to concentrate into a band that can be visually confirmed that the virus has been recovered. Alternatively, and for most large-scale commercial applications, viruses are distributed through a density gradient method using a zonal-centrifuge rotor operating in a continuous manner. Sufficient explanations sufficient to guide the practitioner to produce influenza viruses from tissue culture fluids are described, for example, in Furminger. Vaccine Production, Nicholson et al. (Eds) Textbook of Influenza pp. 324-332; Merten et al. (1996) Production of influenza virus in cell cultures for vaccine preparation, Cohen & Shafferman (eds) Novel Strategies in Design and Production of Vaccines pp. 141-151, and U.S. Patent No. 5,690,937, U.S. Patent Nos. 20040265987, 20050266026, and 20050158342, which are incorporated herein by reference. If desired, the recovered virus may be stored at a temperature of -80 DEG C in the presence of sucrose-phosphate-glutamate (SPG) (stabilizer).

5.8 Influenza virus

The influenza virus genome consists of eight segments of linear (-) chain ribonucleic acid (RNA) encoding immunogenic hemagglutinin (HA) and neuraminidase (NA) proteins and six internal core polypeptides, Capsid nuclear protein (NP); Matrix protein (M); Non-structural proteins (NS); And three RNA polymerase (PA, PB1, PB2) proteins. At the time of replication, genomic viral RNA is transcribed into (+) chain messenger RNA and (-) chain genomic cRNA in the nucleus of the host cell. Each of the eight genome segments is packaged in a ribonucleoprotein complex containing RNA and polymerase complexes (PB1, PB2 and PA) in addition to RNA.

Influenza viruses that can be produced by the method of the present invention in the MDCK cells of the present invention include hemagglutinin and / or neuramidase antigen selected in an approved strain as an attenuated master strain, But are not limited to, recombined viruses. For example, the virus may be a master strain (e.g., A / Ann Arbor / 6/60, or a combination thereof) that is at least one of a temperature-sensitive (ts), a cold- B / L / A / Ar / 1/66, PR8, B / Leningrad / 14/17/55, B / 14/5/1, B / USSR / 60/69, B / Leningrad / B / Leningrad / 14/55, B / England / 2608/76, A / Puerto Rico / 8/34 (ie PR8) or antigenic variants or derivatives thereof) have.

5.9 Influenza Virus Vaccine

Historically, influenza virus vaccines have been produced in hatching eggs using selected virus strains based on predictions through experiments of related strains. More recently, reclassified viruses have produced reclassified viruses incorporating the hemagglutinin and neuraminidase antigens selected in the attenuated temperature-sensitive master strain. After incubating the virus by subculturing several times in an egg, the influenza virus is recovered and the virus is optionally inactivated using, for example, formaldehyde and / or beta -propiolactone. However, there are some drawbacks that should not be overlooked when producing influenza vaccines in this way. In other words, contaminants remaining in eggs are highly antigenic and exothermic, which often causes serious side effects when administered. More importantly, the strains designated for production should be selected and supplied several months prior to the onset of the next influenza (time to produce and inactivate the influenza vaccine). Attempts to produce recombinant and reclassified vaccines in cell culture fluids have been frustrated by the ability of any of the approved strains for vaccine production to fail to grow efficiently under standard cell culture conditions.

The present invention provides a vector system, composition and method for producing recombinant and reclassified viruses in a culture medium so as to rapidly produce a vaccine corresponding to one or more selected antigenic viral strains. Particularly, conditions and strains for efficiently producing viruses from a plurality of plasmid systems in cell culture fluids are provided. Optionally, if desired, the virus may also proliferate in cell culture fluids or eggs that are different from the culture medium used to rescue the virus.

For example, standard cell culture conditions, for example, Influenza B master strain B / Ann Arber / 1/66 can be grown at 37 ° C. In the method of the present invention, a plurality of plasmids in each of which the influenza viral genome segment is incorporated are introduced into appropriate cells and maintained in a culture medium at a temperature of 35 DEG C or lower. Typically, the culture medium is maintained at about 32 to 35 DEG C, preferably about 32 to about 34 DEG C, for example, about 33 DEG C.

Typically, the culture is maintained in a cell culture incubator in which the system, for example, humidity and CO ₂ concentration is controlled and a temperature controller such as a thermostat is installed, do.

Reclassification influenza viruses are readily prepared by introducing a vector encoding a genome segment of the master influenza virus and a vector subset comprising complementary segments derived from the target strain (e. G., An antigenic variant of interest) . Typically, the master strain is selected on the basis of the desired characteristics associated with vaccine administration. For example, in the production of vaccines, for example in the production of live attenuated vaccines, the master donor virus strain may be selected as having an attenuated phenotype, cold-adaptive and / or thermostability. Here, the influenza A strain ca A / Ann Arbor / 6/60; Influenza B strain ca B / Ann Arbor / 1/66; Or other selected strains having desirable phenotypic characteristics (e. G., Toxic, low temperature-adaptive and / or thermostable strains) are selected as master donor strains.

In one embodiment, the plasmids (i.e., PB1, PB2, PA, NP, NB, M1, BM2, NS1 and NS2) comprising cDNA encoding the six internal vRNA segments of the influenza master virus strain Strains are transfected into suitable host cells, for example, with cDNAs encoding hemagglutinin and neuraminidase vRNA segments derived from strains that are expected to induce very local or general influenza infections. For example, at a temperature suitable for efficient recovery, for example, at a temperature below 35 ° C, for example, about 32-35 ° C, for example, about 32 ° C to about 34 ° C, or about 33 ° C, , The reclassified virus is recovered. Optionally, the recovered virus may be inactivated using a denaturant such as formaldehyde or beta -propiolactone.

5.10 Methods for administering vaccines as preventive agents and compositions therefor

The recombinant and reclassified viruses of the present invention may be administered prophylactically with suitable carriers or excipients so as to promote an immune response specific to one or more strains of the influenza virus. Typically, carriers or excipients include pharmaceutically acceptable carriers or excipients such as sterile water, aqueous brine, buffered saline solution, dextrose aqueous solution, glycerol aqueous solution, ethanol, allantoic fluid from infected eggs ) (I. E., Normal urine "NAF") or mixtures thereof. These solutions, which ensure sterility, pH, isotonicity and stability, are prepared according to established methods in the art. In general, the carrier or excipient is selected as being suitable for the route of administration, such as subcutaneous, intramuscular, and intranasal, to minimize allergic and other undesirable effects and to be administered by a particular route of administration.

Generally, the influenza viruses of the present invention are administered in an amount sufficient to promote an immune response specific to one or more strains of the influenza virus. Preferably, when administered with influenza virus, a protective immune response is induced. Dosages and methods for inducing a protective immune response against one or more influenza strains are known to those skilled in the art. For example, inactivated influenza virus is provided as about 1 to 1000 HID ₅₀ (human infectious dose), i.e., about 10 ⁵ to 10 ⁸ pfu per dose (plaque forming units). Alternatively, about 10 to 50 [mu] g of HA, for example, about 15 [mu] g HA is administered without adjuvant, which is administered in smaller amounts when administered with adjuvant. Typically, the dosage will be adjusted to within the above range based on, for example, age, physical condition, body weight, sex, diet, time of administration, and other clinical factors. The prophylactic vaccine formulations are administered systemically by subcutaneous or intramuscular injection using, for example, needles and syringes, or needle-free injection devices. Alternatively, the vaccine formulation may be administered intranasally by spraying, large particle aerosols (greater than about 10 microns), or applied topically. Intracerebral administration, when inducing a protective systemic immune response through any of the pathways, provides the additional advantage of inducing mucosal immunity at the site of influenza virus introduction. For intranasal administration, the attenuated live virus vaccine is often preferably a recombinant or reclassified influenza virus, for example, attenuated, cold-adapted and / or temperature sensitive. While it may be desirable to promote a protective immune response due to a single administration, additional administration may be via the same or different routes and, as a result, the desired prophylactic effect may be obtained.

Alternatively, the immune response may be promoted by in vitro or in vivo targeting of dendritic cells using influenza virus. For example, proliferative dendritic cells are exposed to the virus for sufficient time and for a sufficient time to capture influenza antigens by dendritic cells. The cells are then administered to a subject to be vaccinated by standard intravenous transplantation.

Optionally, preparations of influenza virus or subunits thereof administered at a prophylactic level may also contain one or more adjuvants to enhance the immune response to influenza antigens. Suitable adjuvants include, but are not limited to, saponins, inorganic gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic acid polyols, polyvalent anions, peptides, oils or hydrocarbon emulsions, bacille Calmette- Guerin (BCG)), Corynebacterium parvum , and synthetic adjuvant QS-21 and MF59.

If desired, the vaccine for the prevention of influenza virus may be administered together with one or more immunostimulatory molecules. Examples of immunostimulatory molecules include cytokines, lymphokines and chemokines, such as IL-1, IL-2, IL-2, etc., which have immunostimulatory, 3, IL-4, IL-12 and IL-13); Growth factors (e.g., granulocyte-macrophage (GM) -colonimetric factor (CSF)); And other immunostimulatory molecules such as, for example, macrophage inflammatory factors, Flt3 ligands, B7.1; B7.2 and so on. The immunostimulatory molecule may be administered in the same formulation as the influenza virus, or may be administered separately. The protein or an expression vector encoding the protein may be administered as an immunosuppressive effect.

In another embodiment, a vector of the invention comprising an influenza genome segment comprises a heterologous nucleic acid in a host organism or host cell, e. G., A mammalian cell, e. G., A cell derived from a human subject, with a suitable pharmaceutical carrier or excipient Lt; / RTI > as described above). Typically, the heterologous nucleic acid is inserted into an unnecessary region of the gene or gene segment, e. G., The seventh segment of the M gene. The heterologous polynucleotide sequence may encode a polypeptide or peptide, or RNA, e.g., an antisense RNA or ribozyme. Subsequently, the heterologous nucleic acid is introduced into the host or host cell by producing a recombinant virus in which the heterologous nucleic acid is integrated, and the virus is administered as described above. In one embodiment, the heterologous polynucleotide sequence is not from an influenza virus.

Alternatively, a vector of the present invention comprising a heterologous nucleic acid can be introduced and expressed in a host cell by co-transfecting the vector with cells infected with influenza virus. Optionally, the cells are then resupplied or delivered to the individual, typically the site from which the cells were obtained. In some cases, the cells are implanted into the desired tissue, organ, or system site (as described above) through established cell delivery or transplantation methods. For example, peripheral blood stem cells derived from hematopoietic stem cell lines, for example, bone marrow, umbilical cord blood, or hematopoietic stem cell can be delivered to an individual using standard delivery techniques or injection techniques.

Alternatively, the virus comprising the heterologous nucleic acid may be delivered to the individual cell in vivo. Typically, such methods comprise contacting the vector particles with a target cell population such as blood cells, skin cells, liver cells, nerve cells (including brain cells), kidney cells, uterine cells, muscle cells, small intestine cells, , Prostate cells and the like, and tumor cells derived from a number of cells, tissues and / or organs. Administration can be carried out, for example, by intravenous administration of viral particles or by using a number of methods, for example injection (e.g., using a needle or syringe, or a needleless vaccine delivery device ), By topical administration, or by pumping into tissue, organ or skin area. For example, viral vector particles can be administered by inhalation, orally, intravenously, subcutaneously, subcutaneously, intradermally, intramuscularly, intraperitoneally, intraperitoneally, intravaginally or rectally, For example, by injection into the body cavity or other location in the body at the time of surgery.

The methods described above may be used to transform a vector of the invention comprising heterologous polynucleotides encoding a therapeutically or prophylactically effective polypeptide (or peptide) or RNA (e. G., Antisense RNA or ribozyme) Into a target cell population in vivo, is useful for the therapeutic and / or prophylactic treatment of a disease or disorder. Typically, polynucleotides encoding the polypeptide (or peptide) or RNA of interest are operably linked to appropriate regulatory sequences, as described in the "expression vector" and "additional expression elements" sections. Optionally, the one or more heterologous coding sequences are integrated into a single vector or virus. For example, in addition to a polynucleotide encoding a therapeutically or prophylactically active polypeptide or RNA, the vector may also contain additional therapeutic or prophylactic polypeptides such as, for example, antigens, co-stimulatory molecules, cytokines, And / or markers and the like.

In one embodiment, the invention provides a composition comprising a reclassification and recombinant virus (or a portion thereof) of the invention, which has been treated with a formulation, e. G., Benzinase, to remove potential carcinogens. Therefore, vaccine compositions without oncogenic genes are specifically included in embodiments of the present invention.

The methods and vectors of the present invention are useful for the therapeutic or prophylactic treatment of various diseases, for example genetic and acquired diseases, in the form of vaccines against infectious diseases caused by, for example, viruses and bacteria, Can be used.

5.11 Kit

In order to facilitate the use of the vectors and vector systems of the present invention, any of the vectors, for example, common influenza virus plasmids, mutant influenza polypeptide plasmids, influenza polypeptide library plasmids and the like, as well as for the packaging and infection of experimental or therapeutic influenza viruses Additional useful components can be packaged, for example, in the form of a kit, buffer, cell, culture medium. Typically, the kit contains, in addition to the above components, additional ingredients that may include, for example, instructions for carrying out the methods of the present invention, packaging materials, and containers.

5.12 Manipulation of viral nucleic acids and proteins

Among the contents of the present invention, a nucleic acid, an expression vector, an influenza virus nucleic acid and / or a protein including the intracellular polI control sequence or other nucleic acid of the present invention can be manipulated according to well-known molecular biological techniques. Detailed procedures for such methods, for example, amplification, cloning, mutagenesis, transformation, and the like are described, for example, in Ausubel et al., Current Protocols in Molecular Biology (2000 edition), John Wiley & York ("Ausubel"); Sambrook et al. Molecular Cloning - A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989 ("Sambrook"), and Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152, Academic Press, ("Berger").

In addition to the above references, for example, in vitro amplification techniques useful for amplifying the cDNA probes of the present invention include, for example, polymerase chain reaction (PCR), ligase chain reaction (LCR), Q [ And other RNA polymerase mediated techniques (e.g., NASBA) are described in Mullis et al. (1987) U.S. Patent 4,683,202; PCR Protocols Guide to Methods and Applications (Innis et al. Eds) Academic Press Inc. San Diego, CA (1990) ("Innis"); Arnheim and Levinson (1990) C & EN 36; The Journal of NIH Research (1991) 3:81; Kwoh et al. (1989) Proc Natl Acad Sci USA 86, 1173; Guatelli et al. (1990) Proc Natl Acad Sci USA 87: 1874; Lomell et al. (1989) J Clin Chem 35: 1826; Landegren et al. (1988) Science 241: 1077; Van Brunt (1990) Biotechnology 8: 291; Wu and Wallace (1989) Gene 4: 560; Barringer et al. (1990) Gene 89: 117, and Sooknanan and Malek (1995) Biotechnology 13: 563. In the present invention, additional methods useful for cloning nucleic acids include those disclosed in U.S. Patent No. 5,426,039 (Wallace et al.). An improved method of amplifying large nucleic acids by PCR is summarized in the references cited in Cheng et al. (1994) Nature 369: 684 and references cited therein.

Any of the polynucleotides of the present invention, for example, oligonucleotides can be synthesized using various solid state techniques, such as mononucleotide-based and / or trinucleotide-based phosphoramidite coupling chemistry techniques. For example, the nucleic acid sequence can be synthesized by continuously adding the activated monomer and / or the trimer to the extending polynucleotide chain. See, for example, Caruthers, M. H. et al. (1992) Meth Enzymol 211: 3.

Instead of synthesizing the desired sequences, essentially all of the various sources such as the Midland Certified Reagent Company (mcrc@oligos.com), The Great American Gene Company ; www.genco.com), ExpressGen, Inc. (www.expressgen.com), Operon Technologies, Inc. (www.operon.com), and many others Any nucleic acid can be ordered from the source and purchased.

In addition, substitution of selected amino acid residues in a viral polypeptide can be accomplished, for example, by position-directed mutagenesis. For example, a viral polypeptide in which a desired phenotype, e. G., An attenuated phenotype, a cold-adaptive, temperature-sensitive, functionally correlated amino acid substitution has occurred can be produced by introducing a particular mutation into the viral nucleic acid segment encoding the polypeptide . Position-directed mutagenesis is well known in the art and is disclosed, for example, in Ausubel, Sambrook, and Berger, Sangdong. A variety of kits for performing position-directed mutagenesis are commercially available, such as the Chameleon Site Directed Mutagenesis Kit (Stratagene, La Jolla) For example, one or more amino acid substitutions can be used to introduce influenza A polypeptides or influenza B polypeptides, respectively, into the genomic segment.

5.13 Other viruses

The nucleic acids, vectors and methods of the invention may also be used to express and purify other recombinant viruses. The following discussion is an important guide in adapting vectors used with other viruses.

If the target virus comprises a positive chain, segmented RNA genome, the intracellular polI promoter is preferably present upstream of the cDNA in the internal transcription unit (unidirectional system). In this embodiment, the positive chain RNA is produced directly integrated into the new virus. However, in embodiments in which the target virus comprises a negative strand, segmented RNA genomes produced using the unidirectional system are also included within the scope of the present invention.

If the target virus comprises a negative strand segmented RNA genome, it is preferred that the < RTI ID = 0.0 > RNA polI < / RTI > promoter is downstream of the cDNA in the internal transcription unit (bi-directional system). In this embodiment, the negative strand RNA is directly integrated into the new virus. In embodiments in which the target virus comprises a positive chain, segmented RNA genomes produced using a bi-directional system are also included within the scope of the present invention.

The present invention may also be used to produce viruses comprising infectious or non-infectious non-segmented RNA genomes (single chain or double chain). In general, simply introducing an infectious viral genomic RNA into a host cell is sufficient to initiate a viral life cycle in the cell and ultimately produce a complete virus. For example, simply introducing a picornavirus genomic RNA into a host cell is sufficient to produce a complete picornavirus. Typically, when initiating the life cycle of a virus that contains non-infectious genomic RNA, additional viral proteins that are carried in viral particles with the genome should be introduced. For example, parainfluenza virus III carries an RNA-dependent RNA polymerase, wherein the polymerase is required to initiate viral genomic RNA replication and viral mRNA transcription in newly infected host cells, The Parainfluenza III genomic RNA is also infectious. In an embodiment of the present invention in which a virus comprising an infectious non-segmented genomic RNA is produced, even if simply introducing the double expression plasmid of the present invention, which carries a nucleic acid containing the viral genome, into an appropriate host cell, Lt; / RTI > In embodiments in which a virus comprising non-infectious non-segmented genomic RNA is produced, additional expression plasmids may also be introduced into host cells with dual expression plasmids carrying the viral genome. Additional plasmids should normally express proteins (e. G., RNA-dependent RNA polymerase) required to initiate the life cycle of the virus, which are introduced into the host cell upon infection.

In embodiments in which a picornavirus is produced that contains an infectious, non-segmented RNA genome, a cDNA comprising the complete viral genome is inserted into the dual promoter expression plasmid of the invention. An upstream promoter in an external transcription unit, preferably a pol II promoter, induces the production of a positive chain mRNA comprising a complete viral genome, wherein a polyprotein is translated from the mRNA, and each protein (e. G. Lt; RTI ID = 0.0 > protease < / RTI > in the polyprotein). Since the viral genome contains positive chain RNA, the second upstream promoter in the internal transcription unit (unidirectional system), preferably the canine polI promoter, induces the production of a positive chain copy of the genome. If the viral genome contains negative strand RNA, the second downstream promoter present in the internal transcription unit (the bi-directional system), preferably in the < RTI ID = 0.0 > RNA polI < / RTI > induces production of the negative strand of the genome. Embodiments in which non-segmented RNA viruses that are negative strands are produced using a unidirectional system are included within the scope of the present invention. Similarly, embodiments in which a positive chain non-segmented RNA virus is produced using a bi-directional system are also included within the scope of the present invention.

A virus comprising a non-infectious non-segmented RNA genome, wherein the polyprotein is not produced, can also be produced using the present invention. For example, the system of the present invention can be used to detect viruses such as rhabdoviridae virus or paramyxoviridae virus, preferably parainfluenza virus III, Producing a plurality of one cistron mRNA from genomic negative strand RNA by an enzyme; At this time, each protein is expressed from 1 cistron mRNA. In these embodiments, an exogenous transcriptional unit comprising a promoter, preferably a pol II promoter, induces the production of a multiple cystronic copy of the viral genome (positive chain) in which only the first gene (NP) is translated. In addition, an internal transcription unit comprising a promoter, preferably the pol I promoter, expresses the genomic RNA copy for integration into a new virus. Since the parainfluenza III viral genome contains negative strand RNA, it is preferred that the promoter of the internal transcription unit is located downstream of the cDNA (bi-directional system). If the viral genome comprises positive chain RNA, the promoter of the internal transcription unit is preferably present upstream of the cDNA (unidirectional system). Embodiments in which a virus comprising a positive chain RNA genome is produced using a bi-directional system and embodiments in which a virus comprising a negative strand RNA genome is produced using a unidirectional system are included within the scope of the present invention. Additional viral proteins (except proteins expressed from multiple cystolone mRNAs) are required for viral transcription and replication (L and P), and these proteins are each provided in separate expression plasmids.

The present invention may also include embodiments in which a virus comprising a double-stranded segmental RNA genome is produced. In such embodiments, plasmids containing each gene in the target viral genome can be inserted into the double promoter expression plasmid of the present invention. The plasmid can be an uni-directional plasmid or a bi-directional plasmid. The promoter in the external transcription unit, preferably the pol II promoter, induces the expression of the mRNA transcript of each gene translated into the encoded protein. The promoter in the internal transcription unit, preferably the open polI promoter, induces transcription of either the positive chain (unidirectional system) or the negative strand (bi-directional system). As a result, the first chain produced can serve as a template for production of complementary chains by viral RNA polymerase. The resulting double-stranded RNA product is integrated into a new virus.

6. Specific Examples

1. A separate nucleic acid comprising an RNA polymerase I regulatory sequence.

2. The nucleic acid of embodiment 1, wherein said regulatory sequence is a promoter.

3. The nucleic acid of embodiment 1, wherein said regulatory sequence is an enhancer.

4. The nucleic acid of embodiment 1, wherein said regulatory sequence is an enhancer and a promoter.

5. The nucleic acid according to the embodiment of Claim 1, wherein said RNA polymerase control sequence comprises nucleotides 1 to 1808 of SEQ ID NO: 1, or a functional active fragment thereof.

6. The nucleic acid according to any one of claims 1 to 5, wherein said regulatory sequence is operably linked to a negative strand viral genome RNA or cDNA encoding the corresponding cRNA.

7. The nucleic acid of embodiment 6, wherein said negative strand viral genomic RNA is influenza genomic RNA.

8. The nucleic acid according to any one of claims 6 or 7, wherein the nucleic acid further comprises a transcription termination sequence.

9. An expression vector comprising a nucleic acid according to the embodiment of any one of claims 1 to 8.

10. The expression vector of embodiment 9, wherein said expression vector comprises a bacterial origin of replication.

11. The expression vector of embodiment 9, wherein said expression vector comprises a selectable marker that can be selected within prokaryotic cells.

12. The expression vector of embodiment 9, wherein said expression vector comprises a selectable marker that can be selected within a eukaryotic cell.

13. The expression vector of embodiment 9, wherein said expression vector comprises a multiple cloning site.

14. The method of claim 13, wherein said multiple cloning site is oriented with respect to the < RTI ID = 0.0 > intracellular < / RTI > RNA polymerase I regulatory sequence so that the coding sequence introduced at this multiple cloning site Expression vector.

15. A method for producing an influenza genome RNA, comprising the step of transcribing a nucleic acid according to the embodiment of claim 7 to produce an influenza genome RNA.

16. An expression vector according to any one of claims 9 to 14 and at least one influenza virus selected from the group consisting of PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS2 Culturing a canine cell comprising at least one expression vector expressing an mRNA encoding a polypeptide; And isolating the recombinant influenza virus.

17. The method of embodiment 16 wherein said method uses helper virus.

18. The method of claim 16, wherein the produced influenza virus is infectious.

19. The method of claim 16 to 18 in any of the embodiments of claim, wherein the method is 1 × 10 ³ to produce the PFU / ㎖ or more influenza virus.

20. A cell comprising a nucleic acid according to the embodiment of any one of claims 1 to 8.

21. A cell comprising an expression vector according to any one of claims 9 to 14.

22. The method of claim 20 or 21, wherein the cell is a canine cell.

23. The method of claim 22, wherein the dog cells are kidney cells.

24. The method of claim 23, wherein the kidney cells are MDCK cells.

25. A method for producing a recombinant segment negative strand RNA virus having three or more genomic vRNA segments in cultured dog cells, the method comprising the steps of:

(a) introducing into a population of cell lines a first set of expression vectors capable of expressing genomic vRNA segments within said cells to provide complete genomic vRNA segments of the virus;

(b) introducing into the cell a second set of expression vectors capable of expressing mRNA encoding one or more polypeptides of the virus; And

(c) culturing said cells to produce said virus particles.

26. The method of claim 25, wherein the infectious influenza virus particles are produced by the method.

27. The method of claim 25 or 26, wherein said method uses helper virus.

28. A method for producing an infectious influenza virus particle in cultured dog cells comprising the steps of:

(a) expressing in a dog cell i) an genomic vRNA segment, expressing a complete genomic vRNA segment of an infectious influenza virus, ii) an expression vector set capable of expressing an mRNA encoding one or more polypeptides of the virus Into a canine group; And

(b) culturing the cells to produce the virus particles.

29. A method for producing a polynucleotide molecule comprising the steps of contacting a polynucleotide polynucleotide comprising a nucleic acid selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 28 with a polI polymerase polypeptide, wherein the nucleic acid comprises a cDNA molecule ≪ / RTI > And isolating the transcribed vRNA segment. ≪ Desc / Clms Page number 24 >

30. The method of claim 29, wherein the vRNA is transcribed in a host cell.

31. The method according to any one of claims 16 to 19 and 25 to 28, wherein each expression vector is on a separate plasmid.

32. A composition comprising a plurality of vectors, wherein said plurality of vectors comprises a vector comprising the pol I promoter operably linked to an influenza virus PA cDNA coupled to a transcription termination sequence, A vector comprising the polI promoter operably linked to the influenza virus PB1 cDNA, a vector comprising the polI promoter operably linked to influenza virus PB2 cDNA coupled to the transcription termination sequence, a transcription termination sequence A vector comprising the pol I promoter operably linked to influenza virus HA cDNA coupled to a transcription termination sequence, a vector comprising a pol I promoter operably linked to an influenza virus NP cDNA coupled to a transcription termination sequence, Bound to the termination sequence A vector comprising the pol I promoter operably linked to an influenza virus NA cDNA, a vector comprising the pol I promoter operably linked to an influenza virus M cDNA coupled to a transcription termination sequence, and a transcription termination sequence Lt; RTI ID = 0.0 > polI < / RTI > promoter operably linked to an influenza virus NS cDNA coupled to a polynucleotide encoding an influenza virus NS cDNA.

33. The method of embodiment 32 wherein said composition expresses an mRNA encoding one or more influenza polypeptides selected from the group consisting of PB2, PB1, PA, HA, NP, NA, M1, M2, NS1 and NS2. RTI ID = 0.0 > expression vector. ≪ / RTI >

34. A host cell comprising a composition according to embodiments of claims 32 or 33.

35. A vaccine comprising a virus produced by a method according to any one of claims 16 to 19 and 25 to 28.

36. A vaccine comprising an immunogenic composition made from a virus produced by a method according to any one of the embodiments of any of Claims 16 to 19 and 25 to 28.

37. A composition comprising a vaccine according to any one of claims 35 or 36, wherein each expression vector is on a separate plasmid.

7. Example

The following examples are intended to illustrate the invention and are not intended to limit the invention in any way.

7.1 Example 1: Growth of influenza strains in MDCK cells

This example describes the characteristics of several cell lines for influenza culture. Using several different cell lines and primary cells, for example, MRC-5, WI-38, FRhL2, PerC6, 293, NIH 3T3, CEF, CEK, DF-1, Vero and MDCK, (Wt) and genetic rearrangements, i.e., types A and B derived from cold-adapted (ca) influenza strains. Although many cell types produced only limited cold-adapted influenza strains to a limited extent, MDCK alone produced highly homologous strains of type A and B viruses. For example, PerC6 cells supported replication of any wt and caB type B viruses at similar levels as in MDCK cells but with different growth kinetics (see Figure 1). In contrast, PerC6 failed to support replication of multiple ca A viruses. Figure 2 shows the growth curves for wt and ca A / Sydney / 05/97 and A / Beijing / 262/95 virus. In both cases, the ca strain did not replicate in the PerC6 cells. Similarly, Figure 3 demonstrates that the wt strain and ca A < / RTI > / AN, which do not efficiently replicate within the PerC6 cell and demonstrate that the replication of wt A / Ann Arber / 6/60 is not stable in MDCK cells It represents the growth curve for Arbor / 6/60. Real-time PCR analysis of the replication of influenza virus in PerC6 cells showed that the viral RNA (vRNA) content of both the ca and wt A influenza virus strains was increased during the first 24 hours after infection, but only the viral RNA of the wt strains was maintained for 120 hours And ca strains were not. Conversely, wt and ca vRNA increased in MDCK cells until the passage of 3 days and soon entered a congestion period (see FIG. 4).

The MDCK cells were also tested for their ability to support replication of a potential infectious disease vaccine, ca A / Vietnam / 1203/2004. MDCK cells were infected with a small amount of ca A / Vietnam / 1203/2004, and the virus in the supernatant was quantified at various time points after infection. By 48 h postinfection, the potency of ca A / Vietnam / 1203/2004 reached approximately 8 log ₁₀ TCID ₅₀ / ml, and this condition remained constant for 3 to 4 days thereafter. See FIG.

In this experiment, MDCK cells (accession number; CCL-34) obtained from the ATCC were cultured in a medium containing 10% fetal bovine serum source (US) or a suitable serum-free medium (for example, SFMV 100) Proliferation was performed to make a pre-master cell stock for early characterization studies. Regarding suitable serum-free media, reference may be made to US Provisional Application No. 60 / 638,166, filed December 23, 2004, which is incorporated herein by reference in its entirety; And U.S. Provisional Application Serial No. 60 / 641,139 (filed January 5, 2005); And 11 / 304,589 (filed December 16, 2005). Cells were readily grown in both types of cell stock and in two types of media to support replication of cold-adapted vaccine strains and active strains (see Tables 1 and 5, respectively).

[Table 1]

Comparison of the replication ability of cold-adapted influenza strains in MDCK cells grown in the absence and presence of serum

TCID ₅₀ / Ml (Log ₁₀ ) Virus strain
(6: 2 recycled product) MDCK cells
(Growth in the presence of serum) MDCK cells
(Growth without serum) A / New Caledonia / 20/99
(H1N1) 8.1 7.8 A / Panama / 20/99
(H3N2) 6.8 6.4 A / Sydney / 05/97
(H3N2) 7.0 6.5 B / Brisbane / 32/2002 7.2 7.5 B / Hong Kong / 330/2001 7.2 7.4 B / Victoria / 504/2000 6.9 7.5

Using the eight-plasmid rescue technique to observe the gene segments involved in the limited growth in PerC6 cells, we found that for each gene segment of influenza A / AA / 6/60 strains, 7 : 1 recycled material was produced. See, for example, U.S. Patent No. 6,951,754 (describing an 8-plasmid influenza remedy system). Figure 6 shows a schematic and nomenclature diagram for each of the 7: 1 recondensate. Subsequently, the resulting reassortant was assayed for its ability to replicate in the PerC6 cell. See FIG. Growth restriction phenotype was expressed in the map as PB2 and PB1 gene segments. Detailed maps indicating the exact location associated with these phenotypes can be generated using methods well known in the art. For example, comparing the sequences of wt and ca strains in a particular gene segment may identify specific differences as to whether they can reverse-mutate within the wt or ca strains. This mutant was then analyzed for whether this mutant had the ability to grow in PerC6 cells. Any mutant that inhibits the growth of the wt strain or supports the growth of the ca strain is defined as a mutation involved in the growth restriction phenotype.

7.2 Example 2: Carcinogenicity of MDCK cell line

The possibility of the carcinogenesis of two pre-master MDCK cell stocks (one grown in medium containing serum and the other grown in serum-free medium) was tested for its potential to be used to produce the vaccine after 5 cell subcultures In an athymic nude mouse model. To evaluate carcinogenicity, 10 ⁷ cells were injected subcutaneously into a group of 10 mice, and animals were euthanized at 84 days. It was found that 6 out of 10 animals inoculated with subcultured cells in serum-free medium had formed a neoplastic substance. In contrast, no evidence of neoplastic formation was found in any of the animals inoculated with subcultured cells in a medium supplemented with 10% fetal bovine serum; It was found that fibrosis was slightly formed at the inoculation site, and the subcultured cells in serum did not show any carcinogenicity (see Table 2).

[Table 2]

Carcinogenicity and cytopathological characteristics of subcultured MDCK cells in two different media

Serum free 10% serum inclusion 4th pass subculture 20th passage subculture 4th pass subculture 20th passage subculture Carcinogenicity ND New material formed ND New material
Not formed.
However, fibrosarcoma at the injection site
Formed Forecast TP ₅₀ ^*
(Tumor
Unfulfilled
 Number of animals /
Number of total animals ND About 10 ⁷
(6/10) ND Unpredictable
(> 10 ⁷ )
(0/10) Cell nuclear characteristic
(middle
Chromosome number;
evaluation) 78;
Cell
Chromosome 52 to 82
Evenly distributed in 78;
Cell
Chromosome 52 to 82
Evenly distributed in 78;
In the case of a small number of cells, chromosomes 70 to 82 have an abnormality 78;
In the case of a small number of cells, chromosomes 70 to 82 have an abnormality TP ₅₀ ^* = the number of cells required to induce tumors in 50% of the animals
ND = Do not perform

As shown in Table 2, cell karyotype analysis was performed on two pre-master cell stocks that were passaged four times and 20 times in each medium. The median number of mitotic metaphase chromosomes in non-carcinogenic cells subcultured in 10% FCS was 78, in which case the intracellular distribution of other chromosomes (chromosomes 70-82) was relatively limited. The median number of the mitotic metaphase chromosome in the subcultured cells in the serum-free medium was also 78, however, it was confirmed that a considerable number of cells had an isomeric chromosome (52 to 82 mitotic metaphase chromosome). In both cases, the cell nuclear character was not changed even with subculture.

7.3 Example 3: Adaptation of MDCK cells to allow growth in serum-free medium

MDCK cells obtained from ATCC were subcultured in a medium containing gamma irradiation FBS. The cells are then subcultured a limited number of times in serum-free medium formulations selected to support cell bank production. Serum-free media are disclosed in US Ser. Nos. 60 / 638,166, 60 / 641,139, and 11 / 304,589. Such additional subculture can be performed at 37 [deg.] C or 33 [deg.] C. Thus, through the subculture of MDCK cells performed in three media containing plant-derived supplemental components, but not serum, cells with karyotype similar to the subcultured MDCK cells in the FCS containing medium were obtained (data Is not provided).

7.4 Example 4: Cloning of MDCK cells

To confirm that cell production is determined by a unique genetic order, cells were biologically cloned by limiting dilution. Clones were screened for a variety of phenotypic characteristics, for example, replication time and relative carcinogenicity, and virus replication potential. As initial evidence for abstract experiments, 54 MDCK clones were produced in medium containing FCS. These clones were subcultured, and these clones were infected with small amounts of ca A / New Caledonia / 20/99, respectively. At the end of the infection for several days, the supernatant was removed and the amount of virus in the supernatant was measured by TCID ₅₀ . Few clones produced relatively high titers of virus, and uncloned parental cells produced higher titers of virus. Clones with excellent biological and physiological properties were used to establish a Master Cell Bank (MCB) as described below.

7.5 Example 5: Test and Characterization of Master Cell Banks

MCBs were extensively tested to confirm the absence of contingent agents. For example, several PCR and / or antibody-specific tests were performed more than once on available viral agents (see Table 3 below).

[Table 3]

Test method for MCB

General test asepsis Myco Plasma Zone Occasional In Vitro (multiple cell lines) presence In vivo accidental agent presence PERT Co-culture Observation of cell nuclear characteristics Electron microscope observation Carcinogenic unmodified cells (TP ₅₀ ) Carcinogenicity of cellular DNA Carcinogenicity of cell lysate 9CFR per viral virus 9CFR per pig virus

PCR * / Ab specific test Type 1 and Type 2 AAV HCMV EBV HSV Hepatitis B, C and E viruses HHV 6, 7 and 8 HIV 1 and 2 HPV HTLV I and II Poliomas (BK and JC viruses) Circovirus Parvovirus Distemper Adenovirus SV40

7.6 Example 6: Preclinical characterization of cell culture-derived influenza virus

This example describes the characterization of influenza strains produced from cell culture fluids and eggs and the comparison of viruses produced from this system. In general, influenza viruses are suitable for use as human vaccines and possess biological properties that make the virus suitable for such use. In this example, influenza viruses are characterized by low temperature-adaptive ( ca : ability to efficiently multiply at low temperatures), warmth ( ts : replicate in vitro at limited temperatures) and attenuation ( att : It can not be confirmed that it is replicated), which is referred to herein as ca ts att strain. Comparison items include: biochemical evaluation, antigenicity evaluation and genetic evaluation of virus products (sequencing results); Identification and biochemical characterization of viruses after replication in human cells; Replication in an acceptable animal model; And immunogenicity in acceptable animal models.

7.6.1 Comparison of genetic, biochemical and antigenicity

A / H1N1, A / H5N1, A / H3N2 and type B ca ts att strains were replicated as relatively high titers in MDCK cells. In addition, the genomic sequence was not changed even when the Ca ts att in the MDCK cells was subcultured. Three ca ts att strains, ca A / Sydney / 05/97, ca A / Beijing / 262/95 and ca B / Ann Arber / 1/94 were subcultured once or twice in MDCK cells, The entire coding region of all of the genes was sequenced and compared to the starting material. Nucleotide mutations were not observed, demonstrating that subculture through such substrates did not alter the genetic composition of the strain. Additional sequence characterization work was performed on the different vaccine strains produced in MDCK cells under conditions expected to simulate the production process, including medium composition, moi, incubation temperature, and collection time. Based on the preliminary data, it is expected that the genomic sequence of the MDCK-producing virus will not be mutated.

Since the genome is genetically stable even after subculture in MDCK cells, the biologic characteristics of vaccines produced in eggs or MDCK cells are expected to show no appreciable differences. However, the primary virus product derived from the cell culture shows some minor differences in terms of post-translational modification of viral proteins, HA and NA, and viral membrane lipid composition, in particular compared to products produced in eggs; In both cases, the overall physical properties of virion could potentially be altered. Preliminary preclinical data on antigenicity of cell culture vaccine and egg production vaccine showed that these important parameters showed little difference. Egg stocks of several vaccine strains were subcultured with MDCK cells and the antigenicity of these two products was determined by measuring HAI titers using reference antisera. As shown in Table 4, all of the HAI transcripts showed differences in the range of within 2-fold for each, which means that when the vaccine is replicated in a cell, the vaccine is more antigenic than the egg- It tells you that you have not changed.

[Table 4]

HAI activity of strains produced in eggs and MDCK cells

HAI activity Strain Egg-derived Origin of MDCK A / Panama (Panama) / 20/99  256  256 A / Wuhan (Wuhan) / 359/95 1024 2048 A / Wyoming / 03/2003  512 1024 B / Jilin / 20/2003   64   32 B / Hong Kong / 330/01   64   64 B / Jiangsu / 10/2003  128  128

7.7 Example 7: Infection of human epithelial cells in culture

In one embodiment, in order to assess the biochemical, biological and structural similarity of MDCK and egg-producing vaccines after they have been replicated in cells of human origin, the vaccines are incubated with human cells, Bronchial epithelial cells (NHBE) can be subcultured once. Such subculture can simulate the situation when a human's airway has been infected once and compare the characteristics of the virus, which ultimately leads to an effective immune response. These materials were used to study the hemagglutinin (binding and fusion) of vaccines and the activity of neuraminidase, and other biochemical and structural studies such as electron microscopy, infectivity to whole particles Particle ratio, and viral genome equivalents were also studied. Overall, this study is to compare the efficacy of an effective and safe egg-producing vaccine and a cell-derived vaccine. Analytical results are summarized in Table 5 below.

[Table 5]

Results of preclinical studies to compare cell and egg production vaccines

In vivo (ferret) In vitro * Attenuation / duplication
The degree of reproduction in the prize prayer
Dynamics of replication in upper airways Virus combination
Hemagglutinin titer
Binding of different sialic acids Immunogenicity
Cross reactivity
kinetics Physical Characteristics
Observation of morphology through EM
Infectivity: Total particle (genome) Infectious
Amount required for observable replication
Amount required for antibody reaction Fusion activity
Optimum pH
Optimum temperature Genome sequence New laminase activity * = Comparison of products after one pass subculture in primary and human cells

7.8 Example 8: Preclinical animal model

Ferrot is an animal model that is routinely used to assess the attenuation and immunogenicity of an attenuated influenza vaccine and constitutive vaccine strains. The performance of cell-derived influenza strains produced from MCBs is compared with the same strains produced in eggs. By comparing these materials under controlled study conditions, the comparability of the virus product can be accurately ascertained.

To evaluate the ability of the two vaccines to infect the pellet or to "absorb" into the body of the pellet, the animal was lightly anesthetized and intranasally inoculated with a cell-producing viral or egg-producing viral agent. Nasal washings were collected at some time after inoculation and the amount of virus was assessed by one of a few acceptable methods to assess the degree and kinetics of viral replication within the animal. In this experiment, the relative infectivity of the cell culture broth to the egg - producing strain was generalized by using a trivalent mixture different from a number of strains. The same study was also conducted to assess the immunogenicity of influenza strains and the genetically related characteristics of the virus with the ability to initiate infection. The animals were breeded and nasal washings were collected at various time points (weeks) after viral inoculation; At this time, specimens were used to evaluate nasal IgA response to infection and serum antibody. Using these data, infectivity, serum antibody and mucosal antibody response rates, we will compare and assess the relative infectivity of cell-produced vaccines against egg-producing vaccines. Cell production and egg production vaccine strains are expected to have the greatest likelihood of having similar infectivity and immunogenicity. If the cell-based vaccine is more infectious or immunogenic than the egg-based product, further studies are conducted to assess whether the dose can be lowered.

In order to evaluate the cell culture derived vaccine administered as a single unit to humans, a number of immunogenicity and replication studies were performed in the pereot model. When infected with the ca ts att strain, it generally induces a strong and rapid antibody response in the ferret. In addition, each ca ts att strain is routinely tested, resulting in relatively attenuated transcripts in the nasal pharynx, but attenuated ( att ) phenotypes replicating at an undetectable level in the lungs of this animal Able to know. The influence of the growth of the cell culture on these biological characteristics is also evaluated. However, since the att phenotype is an integral part of the gene composition of this strain, no differences will be noticed. Growth kinetics and cross-reactivity of this strain are evaluated after administration to this animal once by the amount administered to humans. The target sera antibody cross-reacts with a number of strains belonging to the same genetic lineage genetically; The cell-derived vaccine is expected to have the same performance.

Through such an equivalence assessment, the potential biochemical and / or physiological differences of the primary viral products could be observed to a considerable degree and, through this, the ability of ca to be determined by the first passaged virus in human cell or animal studies The effect of subsequent differences on the performance of the ts att strain can be demonstrated. At present, based on the sequence information, it can be seen that when produced in MDCK cells, there is no influence on the immunogenicity of the Ca ts att strain.

Ferrot is a widely-verified animal model for influenza, and is commonly used to evaluate attenuated phenotypes and the immunogenicity of ca ts att strains. In general, animals are evaluated for attenuation using 8-10 week old animals; Typically, the study is designed to use three to five animals per test or control group. Immunogenicity studies are carried out using animals from 8 to 6 months of age, and generally 3 to 5 animals per test or control group are used. These numbers provide sufficient information to obtain statistically valid or comparable outcomes of comparison between groups. In most studies, although influenza-like manifestations may be observed, the likelihood of this is scarce. The pereot does not show signs of appetite or weight loss, intranasal or ocular hemorrhage; Observing signs of influenza-like illness is a necessary process during the course of the research, so intervention, for example, is not done with analgesics. Other signs of discomfort For example, if you have symptoms of hunger or weight loss, you should discuss it with your veterinarian and take appropriate action on the animal.

7.9 Example 9: Development of master virus seed (MVS)

Current influenza vaccine strains are produced by co-infecting avian cells with wild-type virus, type A or type B MDV, and isolating and screening offspring with the desired 6: 2 gene locus. In this method, it is necessary to subculture the virus several times through the avian cell culture solution and / or the SPF egg. Recently, plasmid remediation has been introduced to produce influenza virus preparations. In this method, Vero (African green monkey) cells derived from widely tested and characterized cell banks were transfected into eight DNA plasmids (each plasmid containing one cDNA copy of eight influenza RNA segments) Perforate. Over several days after electroporation, the supernatant of these electroporated cells contains the influenza virus. Subsequently, the supernatant is inoculated into the SPF egg to grow the vaccine strain and then biologically clone it. Through these two methods, vaccine strains producing MVS can be produced inoculated into SPF eggs. Plasmid remediation offers several advantages, for example, reliable timing, more genetically more accurate gene segments than with wild type isolates, and the potential to reduce potential contamination by accidental agents, Each MVS produced by the two methods is indistinguishable from each other and can be used to produce large quantities of vaccines. In this method, since the method and composition of the present invention are used, MDCK cells are used instead of Vero cells in plasmid remediation.

The final amplification step of the vaccine strain is carried out in cells obtained from the MDCK cell bank. Such a final amplification step can be accomplished using a small (less than 20 L) MDCK cell culture. The supernatant from these cells is collected, concentrated and characterized / tested to produce MVS.

7.10 Example 10: Cloning of canine polI regulatory sequences

This example describes the cloning of the open 18S ribosomal RNA gene into the 5 'end nucleic acid sequence of this gene.

First, genomic DNA was isolated from MDCK cells (Accession No. CCL-34, ATCC) using a MasterPure DNA Purification kit (EPICENTRE Biotechnologies; Madison, Wis.). As a result of the sequence alignment, it can be seen that the 18S rRNA gene is about 90% identical to the genes of dogs, humans, mice, rats and chickens. A primer pair for PCR was designed based on the sequence in the conserved region adjacent to the 5 'end of the 18S rRNA gene and used as a probe for detecting the fragment on the membrane having the complementary sequence obtained through Southern hybridization. The probe derived from MDCK genomic DNA The 500 bp region was amplified. One restriction fragment was identified from genomic DNA, which was digested with BamH I (about 2.2 kb) and EcoRI (about 7.4 kb), respectively. These two fragments were cloned into pGEM 7 vector (Promega Corp., Madison, Wis.) And further analyzed. A plasmid containing the EcoR I fragment was deposited on April 19, 2006 in the American Type Culture Collection [ATCC Accession Number: PTA-7540, entrusted date: April 20, 2006].

The two clones obtained by restriction analysis were aligned and the two ends of the two clones were sequenced to confirm the orientation of the two clones. A restriction map of the EcoRI fragment is shown in Fig. The complete nucleic acid sequence of the fragment between the 5 'EcoR I site and the next BamH I site (3' orientation) was then sequenced and assembled into a nucleotide sequence containing about 3536 bases. This sequence is shown in Figures 9a-9c (SEQ ID NO: 1).

Primer extension experiments were then performed to identify the first nucleotide of the transcript expressed from the intracellular RNA pol I regulatory element. In summary, total RNA was isolated from MDCK cells. The labeled oligonucleotide primers were annealed to this RNA and used to primer DNA synthesis towards the 5 ' end of 18S rRNA. To identify the first nucleotide of the transcript, the same primers were used to determine the sequence of the rRNA, using the conventional dideoxynucleotide-based method. By comparing the length of the nucleic acid obtained through the primer amplification process with the length of the various nucleic acids obtained in the sequencing reaction, the first base of 18S rRNA could be identified. The first transcribed nucleotide (+1 position) corresponds to nucleotide 1809 in the nucleotide sequence as shown in Figures 9a-9c.

To confirm whether the upstream sequence of this nucleotide contains sufficient regulatory elements to transduce the downstream gene, a construct comprising the EGFP gene under control of the regulatory sequence was constructed using standard techniques. The EGFP gene used in this construct is described in Hoffmann et al. (2000) "Ambisense" approach for the generation of influenza viruses: vRNA and mRNA synthesis from one template, Virology 15: 267 (2): 310-7 Gt; EGFP < / RTI > This construct was then transfected into MDCK cells using conventional techniques. At 24 hours after transfection, RNA was isolated from transfected cells and Northern blot analysis was performed using the labeled DNA encoding the EGFP gene. By detecting transcripts of appropriate size, it was confirmed that plasmids transfected into MDCK cells contained regulatory sequences that led to transcription of the sequence in the 3 ' terminal direction to the regulatory element.

7.11 Example 11: Identification of the intron RNA polymerase I regulatory element

This example describes the identification and characterization of the intracellular RNA polymerase I promoter, the regulatory element of the intracellular RNA polymerase I.

The RNA pol I promoter and other regulatory regions are identified by observing sequences in the 5 ' -terminal direction for sites that initiate transcription of 18S rRNA to standard promoter sequences. In addition, a simple deletion experiment is performed to identify the sequence necessary for efficiently initiating transcription. In one such deletion experiment, the restriction site is introduced into or identified within the plasmid encoding the nucleotide sequence of Figures 9a-9c by position-directed mutagenesis. The restriction site is introduced at about 50 nucleotide sites from the + 1 nucleotide position as described above to the 3 'terminal direction, that is, the 1809 nucleotide site in the sequence as shown in FIGS. 9A to 9C. With respect to this +1 position, the restriction position in the 5 'terminal direction of the nucleotide sequence of Fig. 9A to Fig. 9C is identified or introduced by the position-orientation mutagenesis method.

The vector containing such restriction sites is then digested with appropriate restriction enzymes and linearized. The linear nucleic acid is then cut with the appropriate nucleases (e. G., Exonuclease I and exonuclease III). By stopping the reaction at different time points, deletion parts of different sizes can be produced in the 5 'direction at the position where transcription is initiated. Then, the linear plasmid is cyclized again, transformed into a suitable host cell, and screened to identify a plasmid containing the desired deletion region. Alternatively, suitable oligonucleotides containing the sequence to be introduced, present in proximity to the deletion region, can be synthesized. These oligonucleotides are then used to generate derivatives containing loop-out deletions with standard techniques. Oligonucleotides may also be used to generate position-orientation substitutions using standard techniques.

The ability of different deletion or substitution mutants to initiate transcription is measured by transfecting the plasmid into MDCK cells and detecting RNA transcribed from the plasmid by Northern blotting as described above. By comparing the sequence of a transposable plasmid with a plasmid sequence that can not be transcribed, the promoter sequence of the RNA polymerase I is identified. The nucleic acid encoding this sequence is then cloned using conventional techniques.

Alternatively, the < RTI ID = 0.0 > RNA polI < / RTI > promoter can be mapped from the nucleic acid shown in SEQ ID NO: 1 through other methods known in the art, e.g., using the mini genome. See, for example, U.S. Patent Application No. 20050266026, which discloses the use of an influenza mini genome reporter (pFlu-CAT) containing the cloned negative sense CAT gene under the control of the pol I promoter. Also, the EGFP mini genome [Hoffmann et al. (2000) "Ambisense" approach for influenza A virus: vRNA and mRNA synthesis from one template, Virology 15: 267 (2): 310-7); And the CAT mini-genome system pPOLI-CAT-RT [Pleschka et al. (1996) J. Virol. 70 (6): 4188-4192].

In order to use a system to identify and characterize the sequences necessary to efficiently initiate transcription, different deletion / substitution mutants or other partial sequences of SEQ ID NO: 1 as described above may be inserted into the selected reporter plasmids (e. G., PFlu- CAT, EGFP mini genome), the transcription of the negative-sense copy of this reporter gene was dependent on the initiation of transcription by deletion or substitution mutants. EGFP-containing constructs as described above can be conveniently used to prepare such deletion or substitution mutants. The viral RNA-dependent RNA polymerase then synthesizes the positive-chain mRNA from the negative strand RNA transcribed from the reporter plasmid. Such positive-chain mRNA can then be translated by cell machinery to detect this reporter protein (EGFP or CAT) activity.

In this assay, a set of expression plasmids containing the cDNAs of PB1, PB2, PA and NP or PB1, PA, NP (-PB2 is a negative control) was transfected with influenza A virus EGFP minigenome or pFlu- CAT reporter MDCK cells were transfected with a plasmid (under control of the putative polI control sequence). The cells were then cultured under conditions to support transcription and translation of reporter sequences.

The activity of the reporter protein was detected using conventional techniques. In the case of EGFP, the transfected cells were observed with an image contrast microscope or fluorescence microscope at 48 hours after transfection. Alternatively, flow cytometry was used to detect the expression of EGFP. In the assay using the mini genome containing the CAT gene, the activity of the polymerase is measured using pFlu-CAT. In such assays, CAT expression can be detected either directly (e. G., By ELISA), by detecting mRNA encoding CAT (e. G., By Northern blotting) For example, by detecting the CAT activity as an indicator for the activity (for example, by detecting the result of transporting the radiolabeled acetyl group to the appropriate substrate).

For example, DNA fragments derived from MDCK clones (see above primer amplification and transcription assays) exhibiting promoter activity are fused to the 5 ' and 3 ' ends of a negative sense EGFP gene, And cloned upstream of the insert containing influenza 5 ' and 3 ' untranslated regions (see Fig. 11). MDCK sequences 1 to 1807 (-1), 1 to 1808 (+1) and 1 to 1809 (+2) of SEQ ID NO: 1 were prepared. Each such construct was separately combined with an expression plasmid (a plasmid for influenza replication proteins PB1, PB2, PA and NP) and introduced into MDCK cells by electroporation. Cells were observed by fluorescence microscopy 24 hours after electroporation. As shown in Fig. 12, the three MDCK fragments -1, +1 and +2 (upper left, middle upper and upper right) showed EGFP fluorescence, whereas structures that did not show promoter activity showed background fluorescence (Lower left). Fluorescence was the highest among the 1 to 1808 (+1) fragments. A plasmid carrying the CMV promoter and expressing EGFP was used as a positive control (lower right).

Influenza replication proteins will only replicate true influenza vRNA ends. The EGFP signal obtained from each plasmid containing the MDCK polI sequence indicates that the canine regulatory sequence fragment exhibited promoter activity that produced RNA with the correct influenza vRNA end that could support influenza replication.

Other assays useful for identifying and characterizing intracellular RNA pol I regulatory sequences include RNA foot-printing experiments. In this method, for example, an RNA molecule comprising the sequence set forth in Figures 9a-9c is brought into contact with one or more subunits of the RNA polymerase I. One or more subunits of RNA polI bind to the appropriate RNA sequence, depending on the specific affinity of the subunit. RNAse I, for example, is then used to degrade RNA not protected by one or more subunits of the RNA polymerase. The RNAase is then inactivated and the protected RNA fragment isolated by protecting one or more subunits of the RNA polymerase I. The isolated fragment contains a sequence joined by one or more subunits of RNA polymerase I and is a good candidate for a sequence having promoter / enhancer activity. In addition, such put-print experiments can be performed when different subunits of the RNA polymerase I are present, so that it is possible to confirm which subunit binds with which RNA sequence. Through such experiments, for example, by comparing sequences of different can polI polymerase subunits with sequences of the RNA polymerase I subunit (including known sequences and having binding specificity) derived from other species, Lt; RTI ID = 0.0 > sequences. ≪ / RTI >

In vitro techniques can also be used to monitor transcription by putative polI control sequences. In this technique, different deletion / substitution mutants as described above or other partial sequences of SEQ ID NO: 1 or SEQ ID NO: 26 are operably linked to the target transcript. The set of the RNA polymerase I protein necessary for transcription is then added to the transcript. By detecting the RNA transcript produced by the intracellular RNA polymerase I protein by, for example, Northern blotting, it can be confirmed that transcription has been effectively performed.

Similar assays can be used to identify other individual RNA polI regulatory elements, such as enhancers, inhibitors, or other factors that affect transcription by RNA polI. Generally, in this assay, the expression levels of the reporter constructs comprising the deletion, substitution or partial sequence of SEQ ID NO: 1 are compared to expression levels by the minimum RNA polI promoter identified as described above. By comparing the expression levels, it can be seen that there are factors associated with the increase or decrease of transcription.

7.12 Example 12: Influenza remission in MDCK cells

This example describes the use of the RNA polI regulatory elements cloned in Example 10 to relieve influenza viruses in MDCK cell culture fluids.

Using conventional molecular biology techniques, eight expression vectors encoding viral genomic RNA under the control of the RNA polI promoter were constructed. Specifically, a human PolI promoter sequence of 213 bp in pAD3000 was replaced with a fragment of 469 bp derived from the MDCK EcoRI-BamHI subclone (nucleotides 1 to 469 of pAD4000) (nucleotides 1808 to 1340 of SEQ ID NO: 1) , the plasmid expression vector pAD4000 (SEQ ID NO: 29, FIG. 13) was constructed from the pAD3000 vector [(Hoffman et al. PNAS (2002), 99 (17): 11411-11416, The 46 bp MDCK fragment contains the functional dog PolI promoter, as well as the 18 bp linker sequence in pAD3000, i.e., AGGAGACGGTACCGTCTC (SEQ ID NO: 30), is shown in SEQ ID NO: with a 24 bp linker sequence in pAD4000, i.e., AGAGTCTTCTCGAGTAGAAGACCG (SEQ ID NO: 31).

Two genomes (NS (SEQ ID NO: 32) and PB1 (SEQ ID NO: 40)) containing 8 silencing mutations (SEQ ID NO: 33 and SEQ ID NO: 41, Lt; RTI ID = 0.0 > pAD4000 < / RTI > expression vector (a vector under the control of the functionalise PolI promoter). Thereafter, MDCK cells in the serum-free Opti-MEM I medium (Invitrogen) were electroporated to introduce 8 expression vectors into the cells, and the supernatant from these cells was inoculated into the eggs. After incubation at 33 [deg.] C for 72 hours, viruses were collected from HA positive eggs. The RNA extracted from the virus was subjected to RT-PCR reaction [primer sequence (SEQ ID NO: 34 to SEQ ID NO: 39) and annealing position (see FIGS. 14 and 15)] to perform nucleotide sequence analysis on the PCR product Respectively. Based on the presence of the PB1 and NS segments containing silent mutations, it was found that the surviving infectious influenza virus was rescued in MDCK cells.

Surprisingly, the reversal of the rescued viruses (both MDV-B and MDV-Bm [MDV-B containing silent mutations]) was high for the supernatant. See Table 6. For example, the virus reversal on day 3 was 4 to 5 log ₁₀ PFU / ml. Typically, the virus recovered using a human polI promoter system based on Vero cells was 100 pfu or less after the second or third day. Therefore, the polI plasmid remedies systems described herein are more efficient than the existing plasmid remediation techniques described in other documents.

[Table 6]

HAI titers (PFU / ml) MDV-B MDV-Bm Day 2 1.48E + 03 2.22E + 02 Day 3 6.60E + 05 9.80E + 04 Day 4 2.28E + 07 5.20E + 06 Day 5 1.90E + 07 1.80E + 07 Day 6 3.60E + 06 3.20E + 06 Day 7 2.62E + 06 2.96E + 06

The stability of the open polI plasmid remediation system was confirmed by the rescue of both strain B and strain A of the ca master donor virus (MDV) and various strains A and B. In the reassembly body, six internal gene segments derived from appropriate MDV (strains A and B) are divided into subtypes A (H1N1, H2N2, H3N2, H5N1) or Yamagata or B / And combined with the HA and NS segments derived from the B-strain derived from the seed heat. Table 7 summarizes the recovered MDV strains and reassortants. These viruses were rescued as described above. The influenza segments encoding the A and B strain genomes were cloned into separate pAD4000 expression vectors (including the functional dog PolI promoter as described above). Thereafter, the eight expression vectors encoding all of the eight influenza segments of the strain to be rescued were transfected into MDCK cells in the serum-free Opti-MEM I medium (Invitrogen), and the supernatant from these cells was inoculated into the egg Respectively. In this experiment, transfection was performed using a non-liposome transfection reagent (PromoFectin Cat. No. PK-CT-2000, PromoKine, Germany) according to the manufacturer's instructions. After incubation at 33 [deg.] C for 72 hours, the virus was recovered from HA positive eggs.

[Table 7]

A strain B strain H1N1
ca A New Caledonia / 20/1999 ca B Malaysia / 2506/2004
ca B Florida / 07/2004
ca B Jiangsu / 10/2003
ca B Hong Kong / 330/2001
MDV B (B / Ann Arbor / 1/1996) H2N2
MDVA (A / Ann Arbor / 6/1960) H3N2
ca A Wisconsin / 67/2005
caa California / 7/2004
ca a Panama / 2007/1999 H5N1
CA A Hong Kong / 213/2003
ca A Hong Kong / 67/1997 (491H5 / 486N1)

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit and scope of the invention as defined by the appended claims. The person skilled in the art will know that it is possible to make a change. For example, all of the above-described techniques and devices may be used in various combinations and combinations. All publications, patents, patent applications or other documents mentioned in this application are herein incorporated by reference for all purposes, and each such publication, patent, patent application, or other document is referred to for all purposes as a reference And is cited as a reference. In addition, PCT patent application PCT / US2006 / 023867 (June 20, 2006); U.S. Patent Application Serial No. 11 / 455,734 (June 20, 2006); 11 / 501,067 (August 9, 2006); U.S. Provisional Application Serial No. 60 / 793,522, filed April 19, 2006; U. S. Patent Application No. 60 / 793,525, filed April 19, 2006; U.S. Patent Application No. 60 / 702,006, filed on July 22, 2005; U. S. Patent Application No. 60 / 699,556, filed July 15, 2005; U. S. Patent Application No. 60 / 699,555, filed July 15, 2005; U.S. Patent Application No. 60 / 692,965 (filed June 21, 2005); And U.S. Patent Application No. 60 / 692,978 (filed on June 21, 2005) are incorporated by reference in their entirety for all purposes.

                         SEQUENCE LISTING <110> MedImmune Vaccines, Inc        Duke, Gregory        Kemble, George        Young, James        Wang, Zhaoti   <120> Methods and Compositions for Expressing Negative-Sense Viral RNA        in Canine Cells <130> FL412PCT2 <150> 11 / 501,067 <151> 2007-08-09 <150> 11 / 455,734 <151> 2006-06-20 <150> 60 / 793,522 <151> 2006-04-19 <150> 60 / 793,525 <151> 2006-04-19 <160> 41 <170> PatentIn version 3.3 <210> 1 <211> 3537 <212> DNA <213> Canis familiaris <400> 1 aattagggag aaacagattg tgttataaga aagaaagaaa gaaagaaaga aagaaagaaa 60 gagaaaatcc ttatgttctt tgagcctccc ctccccccca gaattgagtt cctcttccac 120 gacctcttct cattcaaccc aatagacaag tatttggggg ggggggtcag gtcccagacg 180 ctgagagggt ggaggtgaag gtggtgcggg gggggggggg cacaccgtcc tctccagcgc 240 ctttggttca gacctccttc gtgacctccc tccctccctc cctccctcct ccctcctcct 300 cctcctccct cttcgtctta taaatatata aataaaatcc taaagaaaag aaaaagaaaa 360 aaaaaaaaag gaaggacacg agaaaaaacg gtgcatccgt tgccgtcctg agagtcctcg 420 cctggtttcg gctctacgtt ccctccctga cctcggaaac gtgcctgagt cgtcccggga 480 gccccgcgcg gcgagcgcga ccccctttcg ggcggcagcg ggcccggacg gacggacgga 540 cggacggacg ggttttccaa ggctcccccg ccccgggagg acgggggttc gcggtgcgcg 600 gccgtgtgct ccggggccct ccgccgtccc cgggccgaga ggcgagatcc gaggcgcctg 660 acggcctcgc cgcccggatc tgtcccgctg tcgttcgcgc cggttgtcgg gtgccactgg 720 cggccgcttt tatagagcgt gtccctccgg aggctcggcg gcgacaggca aggaacagct 780 ttggtgtcgg tttcccgggg ccgagttcca ggaggagggc ggctccggcg cgagcgtctg 840 tcgccggggc ctcggcgcga tgcgctcgcc ggagattgga ctccggagct gcgagggagt 900 gtcgccgtcg cccgtgtcgc ccgtgtccgc tccgcctcgc tcccggagga ggccgtgcgg 960 gccgcctggg tgggtcgacc agcaccgccg gtggctcctc ctcgcccgcg cggaccgacc 1020 tgggcgcctc gggggcgggg gacagggtgt gtcccgccgt ccgtcctgtg gctccgggcg 1080 atcttcgggc cttccttccg tgtcactcgg ttgtctcccg tggtcacgcc ctggcgacgg 1140 ggaccggtct gagcctggag gggaagcccg tgggtggcgc gacagacccg gctgcgggca 1200 cgtgtggggg tcccgggcgt cggacgcgat tttctcccct ttttccgagg cccgctgcgg 1260 aggtgggtcc cgggcggtcg gaccgggtgc cacgcggggg tgggcgggcc gtccgttcgg 1320 gcgtccggcc ccggtggcga ttcccggtga ggctgcctct gccgcgcgtg gccctccacc 1380 tcccctggcc cgagccgggg ttggggacgg cggtaggcac ggggcggtcc tgagggccgc 1440 gggggacggc ctccgcacgg tgcctgcctc cggagaactt tgatgatttt tcaaagtctc 1500 ctcccggaga tcactggctt ggcggcgtgg cggcgtggcg gcgtggcggc gtggcggcgt 1560 ggcggcgtgg cgtctccacc gaccgcgtat cgcccctcct cccctccccc cccccccccg 1620 ttccctgggt cgaccagata gccctggggg ctccgtgggg tgggggtggg ggggcgccgt 1680 ggggcaggtt ttggggacag ttggccgtgt cacggtcccg ggaggtcgcg gtgacctgtg 1740 gctggtcccc gccggcaggc gcggttattt tcttgcccga gatgaacatt ttttgttgcc 1800 aggtaggtgc tgacacgttg tgtttcggcg acaggcagac agacgacagg cagacgtaaa 1860 agacagccgg tccgtccgtc gctcgcctta gagatgtggg cctctgggcg cgggtggggt 1920 tccgggcttg accgcgcggc cgagccggtc cctgtcctcg ctcgctggag cctgagccgt 1980 ccgcctgggc ctgcgcgccg gctctcgtgc tggactccag gtggcccggg tcgcggtgtc 2040 gccctccggt ctccggcacc cgagggaggg cggtgtgggc aggtggcggt gggtctttta 2100 cccccgtgcg ctccatgccg tgggcacccg gccgttggcc gtgacaaccc ctgtctcgca 2160 aggctccgtg ccgcgtgtca ggcgtccccc gctgtgtctg gggttgtccg gtcgctcctg 2220 cccccccccc cccgggggtc gaggggcttg ccggtgaggc ggaagcaggt ccccccggtc 2280 gccgtcctcg ctgggctttt gctcctcggg aagccccctc ggggccgcag cttgctgccg 2340 atcgatcgat gtggtgatct cgtgctctcc tgggccgggc ctaagccgcg tcagacgagg 2400 gcgggcgtc cacggcggat gcgaccgctc ttctcgttct gcccgcgggc ccctccctcc 2460 ccggctcctc cgcgcccggc cgtcgtggcg ggtgcgcggg gggcgcgcgc cggggttggg 2520 ggtggtgcgg actccggccc gaccccggcc tcccgccttc ttgcctcgcg gcgctggcgg 2580 gccggggtc ctcggacgcg gcggacactc tcgccggcct ttcccgaagg ccctgggtcc 2640 gtggcgagcg gccctcccct cctccgcggg ggagggccgg cccgacgccg cgctgctcac 2700 cgcccggcct gggcgcgctt gagcgcgttg cgcccggccc tccgtggtgc ccctggagcg 2760 ctccaggtcg cctcaggtgc ctgaggccga gcggtggcgt cgtttccttc cccggcgact 2820 cccctcgggc tgccgccgcc gtcgtcggcg tgtccgagga gcgggtggtg gaagaagtcg 2880 gcaagggagg cgcacccgtg cccctggcgg gggcgcgggc gcctcgtctt ccttcccctc 2940 tcctctcctc ccccctcgcg cgccggcggg gggtgggtgg cgtggggcgg tgtgactcgg 3000 aggacttggc ggggctcgtg aggccgcggc gggccgggcc acgccgcggc gcttgccagc 3060 cgaggggctg cccctctctc cggcacgggt cgtgtccccg tctccgtccc tctctctcgc 3120 gctcgcggga ggcggggagc tctctcctct gggcggtgac gtgaccacgc cgtgcgcggg 3180 cgaggcgggg gtggcgtcct cgagggggca ccggccgcga gcgctcgggg ttgccctgtg 3240 cctgtccctt gccggagatc cgccccccgc cccgcgagcc tgtcggcccc ggagcgccgc 3300 ctggtggggc ccgtttggga ggacgaacgg gtggggcgat gcgccctcgg tgagaaagcc 3360 ttctctagcg atccgagagg gtgccttggg gtaccggagc ccccagccgc tgcccctcct 3420 ctgcgcgtgt agtgtggcca gcgacgcggg gttggactcc cgtcgcgacg tgtttgggca 3480 gagtgccgct ctttgcctac ctacccgcgc tgcgctcccc cctccgagac gggggag 3537 <210> 2 <211> 333 <212> DNA <213> Canis familiaris <400> 2 ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60 cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120 cctccccccc cccccccgtt ccctgggtcg accagatagc cctgggggct ccgtggggtg 180 ggggtggggg ggcgccgtgg ggcaggtttt ggggacagtt ggccgtgtca cggtcccggg 240 aggtcgcggt gacctgtggc tggtccccgc cggcaggcgc ggttattttc ttgcccgaga 300 tgaacatttt ttgttgccag gtaggtgctg aca 333 <210> 3 <211> 168 <212> DNA <213> Canis familiaris <400> 3 gggctccgtg gggtgggggt gggggggcgc cgtggggcag gttttgggga cagttggccg 60 ggcggggtc ttttcttgcc cgagatgaac attttttgtt gccaggtagg tgctgaca 168 <210> 4 <211> 140 <212> DNA <213> Canis familiaris <400> 4 gccgtggggc aggttttggg gacagttggc cgtgtcacgg tcccgggagg tcgcggtgac 60 ctgtggctgg tccccgccgg caggcgcggt tattttcttg cccgagatga acattttttg 120 ttgccaggta ggtgctgaca 140 <210> 5 <211> 114 <212> DNA <213> Canis familiaris <400> 5 tggccgtgtc acggtcccgg gaggtcgcgg tgacctgtgg ctggtccccg ccggcaggcg 60 cggttatttt cttgcccgag atgaacattt tttgttgcca ggtaggtgct gaca 114 <210> 6 <211> 85 <212> DNA <213> Canis familiaris <400> 6 gtgacctgtg gctggtcccc gccggcaggc gcggttattt tcttgcccga gatgaacatt 60 ttttgttgcc aggtaggtgc tgaca 85 <210> 7 <211> 59 <212> DNA <213> Canis familiaris <400> 7 aggcgcggtt attttcttgc ccgagatgaa cattttttgt tgccaggtag gtgctgaca 59 <210> 8 <211> 164 <212> DNA <213> Canis familiaris <400> 8 ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60 cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120 cctccccccc cccccccgtt ccctgggtcg accagatagc cctg 164 <210> 9 <211> 137 <212> DNA <213> Canis familiaris <400> 9 ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60 cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120 cctccccccc ccccccc 137 <210> 10 <211> 109 <212> DNA <213> Canis familiaris <400> 10 ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60 cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatc 109 <210> 11 <211> 55 <212> DNA <213> Canis familiaris <400> 11 ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgt 55 <210> 12 <211> 299 <212> DNA <213> Canis familiaris <400> 12 ttgatgattt ttcaaagtcc tcccggagat cactggcttg gcggcgtggc ggcgtggcgg 60 cgtggcggcg tggcggcgtg gcggcgtggc gtctccaccg acccgtatcg cccctcctcc 120 cctccccccc cccccccgtt ccctgggtcg accagatagc cctgggggct ccgtggggtg 180 ggggtggggg ggcgccgtgg ggcaggtttt ggggacagtt ggccgtgtca cggtcccggg 240 aggtcgcggt gacctgtggc tggtccccgc cggcaggcgc ggttattttc ttgcccgag 299 <210> 13 <211> 244 <212> DNA <213> Canis familiaris <400> 13 ggcggcgtgg cggcgtggcg gcgtggcggc gtggcgtctc caccgacccg tatcgcccct 60 cctcccctcc cccccccccc ccgttccctg ggtcgaccag atagccctgg gggctccgtg 120 gggtgggggt gggggggcgc cgtggggcag gttttgggga cagttggccg tgtcacggtc 180 ccgggaggtc gcggtgacct gtggctggtc cccgccggca ggcgcggtta ttttcttgcc 240 cgag 244 <210> 14 <211> 190 <212> DNA <213> Canis familiaris <400> 14 gcccctcctc ccctcccccc ccccccccgt tccctgggtc gaccagatag ccctgggggc 60 tccgtggggt gggggtgggg gggcgccgtg gggcaggttt tggggacagt tggccgtgtc 120 acggtcccgg gaggtcgcgg tgacctgtgg ctggtccccg ccggcaggcg cggttatttt 180 cttgcccgag 190 <210> 15 <211> 134 <212> DNA <213> Canis familiaris <400> 15 gggctccgtg gggtgggggt gggggggcgc cgtggggcag gttttgggga cagttggccg 60 ggcggggtc ttttcttgcc cgag 134 <210> 16 <211> 106 <212> DNA <213> Canis familiaris <400> 16 gccgtggggc aggttttggg gacagttggc cgtgtcacgg tcccgggagg tcgcggtgac 60 ctgtggctgg tccccgccgg caggcgcggt tattttcttg cccgag 106 <210> 17 <211> 80 <212> DNA <213> Canis familiaris <400> 17 tggccgtgtc acggtcccgg gaggtcgcgg tgacctgtgg ctggtccccg ccggcaggcg 60 cggttatttt cttgcccgag 80 <210> 18 <211> 217 <212> DNA <213> Canis familiaris <400> 18 ggcgtggcgt ctccaccgac ccgtatcgcc cctcctcccc tccccccccc cccccgttcc 60 ctgggtcgac cagatagccc tgggggctcc gtggggtggg ggtggggggg cgccgtgggg 120 caggttttgg ggacagttgg ccgtgtcacg gtcccgggag gtcgcggtga cctgtggctg 180 gtccccgccg gcaggcgcgg ttattttctt gcccgag 217 <210> 19 <211> 56 <212> DNA <213> Canis familiaris <400> 19 tcgcggtgac ctgtggctgg tccccgccgg caggcgcggt tattttcttg cccgag 56 <210> 20 <211> 336 <212> DNA <213> Canis familiaris <400> 20 ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60 ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120 tcccctcccc cccccccccc gttccctggg tcgaccagat agccctgggg gctccgtggg 180 gtgggggtgg gggggcgccg tggggcaggt tttggggaca gttggccgtg tcacggtccc 240 gggaggtcgc ggtgacctgt ggctggtccc cgccggcagg cgcggttatt ttcttgcccg 300 agatgaacat tttttgttgc caggtaggtg ctgaca 336 <210> 21 <211> 167 <212> DNA <213> Canis familiaris <400> 21 ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60 ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120 tcccctcccc cccccccccc gttccctggg tcgaccagat agccctg 167 <210> 22 <211> 140 <212> DNA <213> Canis familiaris <400> 22 ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60 ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120 tcccctcccc cccccccccc 140 <210> 23 <211> 112 <212> DNA <213> Canis familiaris <400> 23 ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60 ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tc 112 <210> 24 <211> 57 <212> DNA <213> Canis familiaris <400> 24 ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgt 57 <210> 25 <211> 302 <212> DNA <213> Canis familiaris <400> 25 ttgatgattt ttcaaagtct cctcccggag atcactggct tggcggcgtg gcggcgtggc 60 ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac cgaccgcgta tcgcccctcc 120 tcccctcccc cccccccccc gttccctggg tcgaccagat agccctgggg gctccgtggg 180 gtgggggtgg gggggcgccg tggggcaggt tttggggaca gttggccgtg tcacggtccc 240 gggaggtcgc ggtgacctgt ggctggtccc cgccggcagg cgcggttatt ttcttgcccg 300 ag 302 <210> 26 <211> 469 <212> DNA <213> Canis familiaris <400> 26 attcccggtg aggctgcctc tgccgcgcgt ggccctccac ctcccctggc ccgagccggg 60 gttggggacg gcggtaggca cggggcggtc ctgagggccg cgggggacgg cctccgcacg 120 gtgcctgcct ccggagaact ttgatgattt ttcaaagtct cctcccggag atcactggct 180 tggcggcgtg gcggcgtggc ggcgtggcgg cgtggcggcg tggcggcgtg gcgtctccac 240 cgaccgcgta tcgcccctcc tcccctcccc cccccccccc gttccctggg tcgaccagat 300 agccctgggg gctccgtggg gtgggggtgg gggggcgccg tggggcaggt tttgggga 360 gttggccgtg tcacggtccc gggaggtcgc ggtgacctgt ggctggtccc cgccggcagg 420 cgcggttatt ttcttgcccg agatgaacat tttttgttgc caggtaggt 469 <210> 27 <211> 245 <212> DNA <213> Canis familiaris <400> 27 ggcggcgtgg cggcgtggcg gcgtggcggc gtggcgtctc caccgaccgc gtatcgcccc 60 tcctcccctc cccccccccc cccgttccct gggtcgacca gatagccctg ggggctccgt 120 ggggtggggg tgggggggcg ccgtggggca ggttttgggg acagttggcc gtgtcacggt 180 cccgggaggt cgcggtgacc tgtggctggt ccccgccggc aggcgcggtt attttcttgc 240 ccgag 245 <210> 28 <211> 218 <212> DNA <213> Canis familiaris <400> 28 cgcccgtc cctgggtcga ccagatagcc ctgggggctc cgtggggtgg gggtgggggg gcgccgtggg 120 gcggttttg gggacagttg gccgtgtcac ggtcccggga ggtcgcggtg acctgtggct 180 ggtccccgcc ggcaggcgcg gttattttct tgcccgag 218 <210> 29 <211> 3100 <212> DNA <213> Artificial <220> <223> plasmid <400> 29 acctacctgg caacaaaaaa tgttcatctc gggcaagaaa ataaccgcgc ctgccggcgg 60 ggaccagcca caggtcaccg cgacctcccg ggaccgtgac acggccaact gtccccaaaa 120 cctgccccac ggcgcccccc cacccccacc ccacggagcc cccagggcta tctggtcgac 180 ccagggaacg gggggggggg gggaggggag gaggggcgat acgcggtcgg tggagacgcc 240 acgccgccac gccgccacgc cgccacgccg ccacgccgcc acgccgccaa gccagtgatc 300 tccgggagga gactttgaaa aatcatcaaa gttctccgga ggcaggcacc gtgcggaggc 360 cgtcccccgc ggccctcagg accgccccgt gcctaccgcc gtccccaacc ccggctcggg 420 ccaggggagg tggagggcca cgcgcggcag aggcagcctc accgggaata tcgggcccgt 480 cacctcagac atgataagat acattgatga gtttggacaa accacaacta gaatgcagtg 540 aaaaaaatgc tttatttgtg aaatttgtga tgctattgct ttatttgtaa ccattataag 600 ctgcaataaa caaggatctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 660 gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 720 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 780 acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 840 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 900 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 960 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 1020 tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt 1080 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 1140 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 1200 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 1260 tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc 1320 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 1380 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 1440 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 1500 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa 1560 aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat 1620 gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct 1680 gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg 1740 caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag 1800 ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta 1860 attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg 1920 ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg 1980 gtcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct 2040 ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta 2100 tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg 2160 gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc 2220 cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg 2280 gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga 2340 tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg 2400 ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat 2460 gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc 2520 tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca 2580 catttccccg aaaagtgcca cctgacgtcg atatgccaag tacgccccct attgacgtca 2640 atgacggtaa atggcccgcc tggcattatg cccagtacat gaccttatgg gactttccta 2700 cttggcagta catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt 2760 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg 2820 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca 2880 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca 2940 gagctctctg gctaactaga gaacccactg cttactggct tatcgaaatt aatacgactc 3000 actataggga gacccaagct gttaacgcta gctagcagtt aaccggagta ctggtcgacc 3060 tccgaagttg ggggggagag tcttctcgag tagaagaccg 3100 <210> 30 <211> 18 <212> DNA <213> Artificial <220> <223> sythetic linker <400> 30 aggagacggt accgtctc 18 <210> 31 <211> 24 <212> DNA <213> Artificial <220> <223> sythetic linker <400> 31 agagtcttct cgagtagaag accg 24 <210> 32 <211> 119 <212> DNA <213> Influenza B virus <400> 32 aaaaattcct caaatagcaa ctgtccaaac tgcaattgga ccgattaccc tccaacacca 60 ggaaagtgcc ttgatgacat agaagaagaa ccggagaatg ttgatgaccc aactgaaat 119 <210> 33 <211> 119 <212> DNA <213> Influenza B virus <400> 33 aaaaattcct caaatagcaa ctgtccaaac tgcaattgga ccgattaccc tccaacgcca 60 ggaaagtgcc ttgatgacat agaagaagaa ccggagaatg ttgatgaccc aactgaaat 119 <210> 34 <211> 20 <212> DNA <213> Artificial <220> <223> sythetic primer <400> 34 ggcactaatg gtcacaactg 20 <210> 35 <211> 22 <212> DNA <213> Artificial <220> <223> sythetic primer <400> 35 atcagagggt ttgtattagt ag 22 <210> 36 <211> 20 <212> DNA <213> Artificial <220> <223> sythetic primer <400> 36 tgggctgtct ctggttattc 20 <210> 37 <211> 20 <212> DNA <213> Artificial <220> <223> sythetic primer <400> 37 tctctttatg aggaaaccct 20 <210> 38 <211> 20 <212> DNA <213> Canis familiaris <400> 38 gtgagcctga aagtaaaagg 20 <210> 39 <211> 20 <212> DNA <213> Artificial <220> <223> sythetic primer <400> 39 gcaacaagtt tagcaacaag 20 <210> 40 <211> 423 <212> DNA <213> Influenza B virus <400> 40 tcattgattc attggacaaa cctgaaatga ctttcttctc ggtaaagaat ataaagaaaa 60 aattgcctgc taaaaacaga aagggtttcc tcataaagag aataccaatg aaggtaaaag 120 acagaataac cagagtggaa tacatcaaaa gagcattatc attaaacaca atgacaaaag 180 atgctgaaag aggcaaacta aaaagaagag caattgccac cgctgggata caaatcagag 240 ggtttgtatt agtagttgaa aacttggcta aaaatatctg tgaaaatcta gaacaaagtg 300 gtttgccagt aggtgggaac gagaagaagg ccaaactgtc aaatgcagtg gccaaaatgc 360 tcagtaactg cccaccagga gggatcagca tgacagtgac aggagacaat actaaatgga 420 atg 423 <210> 41 <211> 423 <212> DNA <213> Influenza B virus <400> 41 tcattgattc attggacaaa cctgaaatga ccttcttctc ggtaaagaat ataaagaaaa 60 aattgcctgc taaaaacaga aagggtttcc tcataaagag aataccaatg aaggtaaaag 120 acagaataac cagagtggaa tacatcaaaa gagcattatc attaaacaca atgacaaaag 180 atgctgaaag aggcaaacta aaaagaagag caattgccac cgctgggata caaatcagag 240 ggtttgtatt agtagttgaa aacttggcta aaaatatctg tgaaaatcta gaacaaagtg 300 gtttgccagt aggtgggaac gagaagaagg ccaaactgtc aaatgcagtg gccaaaatgc 360 tcagtaactg cccaccagga gggatcagca tgacggtgac aggagacaat actaaatgga 420 atg 423

Claims (31)

26. The isolated nucleic acid comprising the RNA polymerase I promoter of SEQ ID NO: 26, or a separate nucleic acid comprising complementary or inverted complement of SEQ ID NO: 26. 2. The isolated nucleic acid of claim 1, wherein said promoter is operably linked to a negative strand viral genomic RNA or cDNA encoding the corresponding cRNA. 3. The isolated nucleic acid according to claim 2, wherein the negative strand viral genome RNA is an influenza genomic RNA. 4. The isolated nucleic acid according to any one of claims 1 to 3, further comprising a transcription termination sequence. A method for producing an influenza genome RNA, comprising the step of transcribing the isolated nucleic acid of claim 3 in a cell to produce an influenza genome RNA. An expression vector comprising the isolated nucleic acid of any one of claims 1 to 3. A method for producing an influenza genome RNA comprising the step of introducing the expression vector of claim 6 into a cell to generate an influenza genome RNA. A separate cell comprising the expression vector of claim 6. 9. The method of claim 8, wherein the dog cells are kidney cells. 10. The method of claim 9, wherein the kidney cells are MDCK cells. The expression vector of claim 6, wherein the polymerase basic protein 2 (PB2), the polymerase basic protein 1 (PB1), the polymerase acidic protein (PA), hemaglutinin (HA) MRNA encoding one or more influenza polypeptides selected from the group consisting of NA (SEQ ID NO: 1), Matrix Protein 1 (M1), Matrix Protein 2 (M2), Non-Structural Protein 1 (NS1) The method comprising: culturing a cell comprising at least one expression vector expressing a cell; And isolating the recombinant influenza virus. 12. The method according to claim 11, wherein the generated influenza virus particles are infectious. The expression vector pAD4000 shown in SEQ ID NO: 29. As a method for producing recombinant influenza virus, a) introducing into the canine group an expression vector capable of expressing genomic vRNA segments in the cells and providing complete genomic vRNA segment of the virus, wherein the expression vector comprises a polynucleotide of SEQ ID NO: 26 step; b) introducing into said cell an expression vector capable of expressing an mRNA encoding at least one polypeptide of said virus; And c) culturing said cells to produce influenza virus particles. 15. The method according to claim 14, wherein the generated influenza virus particles are infectious. 16. The method according to claim 14 or 15, wherein the helper virus is used. As a method for producing recombinant influenza virus, a) an expression vector capable of expressing genomic vRNA segments in i) cells to provide complete genomic vRNA segment of said virus, wherein at least one of said expression vectors comprises a polynucleotide of SEQ ID NO: 26 , And ii) the expression of the polymerase basic protein 2 (PB2), the polymerase basic protein 1 (PB1), the polymerase acid protein (PA), the hemagglutinin (HA) Encoding one or more influenza polypeptides selected from the group consisting of NA1, Matrix Protein 1 (M1), Matrix Protein 2 (M2), Non-Structural Protein 1 (NS1) and Non-Structural Protein 2 (NS2) introducing an expression vector capable of expressing mRNA into the canine group; And b) culturing said cells to produce influenza virus particles. The production method according to claim 14 or 17, wherein the activity of the influenza virus particles produced by culturing the cells for 48 to 72 hours is 1.0 x 10 ⁴ PFU / ml or more. The production method according to claim 14 or 17, wherein the activity of the influenza virus particles produced by culturing the cells for 48 to 72 hours is 1.0 × 10 ⁵ PFU / ml or more. 18. The method of claim 17, wherein the helper virus is used. delete delete delete delete delete delete delete delete delete delete delete

Images