GB2546719A

GB2546719A - Modulation of gene expression and screening for deregulated protein expression

Info

Publication number: GB2546719A
Application number: GB1517937.7A
Authority: GB
Inventors: Vorechovsky Igor; Kralovicova Jana
Original assignee: University of Southampton
Current assignee: University of Southampton
Priority date: 2015-10-09
Filing date: 2015-10-09
Publication date: 2017-08-02
Anticipated expiration: 2035-10-09
Also published as: GB2591194A; GB202103433D0; GB2546719B; GB2591194B; GB201517937D0

Abstract

A method of screening a subject for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a nonthymine variant residue rs609261 located at position -3 relative to the 3 splice site of a non-sense mediated RNA decay switch exon NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency. In some embodiments, also included herein are compositions and methods of modulating protein expression that uses an agent that targets a transposed element, methods of treatment and kits for detection of the mutation.

Description

MODULATION OF GENE EXPRESSION AND SCREENING FOR DEREGULATED PROTEIN EXPRESSION

The present invention relates to a screening method of a subject or a population for susceptibility to functional-ATM protein deficiency and associated conditions, methods for selecting subjects for treatment, methods for treatment or prevention of conditions associated with functional-ATM protein deficiency, methods of modifying a cells susceptibility to DNA damaging radio- and chemotherapy, methods for treatment of cancer, and associated compositions and kits.

BACKGROUND

Intervening sequences or introns are removed by a large and highly dynamic RNA-protein complex termed the spliceosome, which orchestrates complex interactions between primary transcripts, small nuclear RNAs (snRNAs) and a large number of proteins. Spliceosomes assemble ad hoc on each intron in an ordered manner, starting with recognition of the 5‘ splice site (5’ss) by U1 snRNA or the 3’ss by the U2 pathway, which involves binding of the U2 auxiliary factor (U2AF) to the 3’ss region to facilitate U2 binding to the branch point sequence (BPS). U2AF is a stable heterodimer composed of a U2AF2-encoded 65-kD subunit (U2AF65), which binds the polypyrimidine tract (PPT), and a U2AF1 -encoded 35-kD subunit (U2AF35), which interacts with highly conserved AG dinucleotides at 3‘ss and stabilizes U2AF65 binding. In addition to the BPS/PPT unit and 3’ss/5’ss, accurate splicing requires auxiliary sequences or structures that activate or repress splice site recognition, known as intronic or exonic splicing enhancers or silencers. These elements allow genuine splice sites to be recognized among a vast excess of cryptic or pseudosites in the genome of higher eukaryotes, which have the same sequences but outnumber authentic sites by an order of magnitude. Although they often have a regulatory function, the exact mechanisms of their repression are poorly understood.

Exome sequencing studies have revealed a highly restricted pattern of somatic mutations in U2AF1/U2AF2 and other genes involved in 3’ss recognition (SF3B1, ZRSR2, SF1, SF3A1, PRPF40B, and SRSF2) in cancer cells, most prominently myelodysplastic syndromes. These genes encode products that often interact during spliceosome assembly, suggesting the existence of shared pathways in oncogenesis, which is further supported by a high degree of mutual exclusivity of cancer-associated mutations. Genome-wide transcriptome profiling in leukemic samples carrying these mutations detected numerous alterations in splicing of mRNA precursors, however, key links between specific RNA processing defects and cancer initiation or progression have remained obscure, despite the great promise of these targets for therapeutic modulation. The interconnections between these RNA-binding proteins and DNA damage response (DDR) pathways remain to be fully characterized.

Mutations in traditional (BPS/PPT/3’ss/5’ss) and auxiliary splicing motifs often cause aberrant splicing, such as exon skipping or cryptic exon or splice-site activation, and contribute significantly to human morbidity and mortality. Both aberrant and alternative splicing patterns can be influenced by natural DNA variants in exons and introns, which play an important role in heritability of both Mendelian and complex traits. However, the molecular mechanisms that translate the allele- or haplotype-specific RNA expression to phenotypic variability as well as interactions between intronic and exonic variant alleles and trans-acting factors are largely obscure.

Antisense technology has now reached important clinical applications. ATM SSOs have been used to repair splicing mutations in ataxia-telangiectasia (A-T) and were successful in normalizing ATM protein levels (Du et al. 2011; Du et al. 2007). A large fraction of both leukaemias and solid tumours show deregulation of ATM expression (for example, Stankovic et al. 1999; Starczynski et al. 2003).

Chemical inhibitors of ATM (wortmannin, CP-466722, KU-55933, KU60019) have not reached clinical trials, largely because of nonspecific effects and/or high toxicity, although KU-559403 has shown good bioavailability and reliably conferred radiosensitivity.

The ability to up or down regulate gene expression in a sequence-specific manner is desirable.

An aim of the invention is to improve treatments and screening for disorders associated with functional-ATM protein deficiencies or ATM deregulation, such as A-T; improve cancer radiotherapy; and provide new methods of modifying gene expression.

SUMMARY

According to a first aspect of the invention, there is provided a method of screening a subject or a population of subjects for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject (or group of subjects) has, or is susceptible to, functional-ATM protein deficiency.

The term “functional ATM-protein deficiency” means the reduction in the presence/expression of ATM protein that is functional in a subject, cell or tissue. Functional ATM-deficiency is the result of a functional variant rs609261 in ATM intron 28 that alters RNA processing of ATM precursor messenger RNA (mRNA). Cytosine allele at rs609261 results in a higher inclusion of a nonsense-mediated RNA decay switch exon (termed here NSE) in ATM mRNA than a thymine allele at this position, limiting the expression of ATM protein more efficiently than the thymine allele. This limitation can be removed or modulated by novel antisense reagents (termed here SSOs for splice-switching oligonucleotides) that block access to NSE or its competitor splicing regulatory motifs in the same intron, leading to derepression or inhibition of ATM protein, respectively.

According to another aspect of the invention, there is provided a method of selecting a subject or a population of subjects for treatment or prophylaxis, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.

According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.

According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with a functional-ATM protein deficiency, comprising the administration of a NSE repressor agent arranged to increase levels of functional ATM protein, wherein the agent is arranged to bind to a NSE in ATM intron 28 of the pre-mRNA transcript to decrease inclusion of the NSE in the mature transcript.

According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with deregulation of ATM expression in a subject comprising the administration of a NSE-activator agent, wherein the NSE-activator agent is arranged to increase NSE inclusion in the ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcript or U2AF65 binding site upstream of the pseudoexon.

According to another aspect of the invention, there is provided a method of treatment or prevention of cancer in a subject comprising the administration of a NSE-activator agent arranged to increase a cancer cell’s susceptibility to DNA damaging agents that induce double strand DNA breaks, such as radiotherapy, wherein the NSE-activator agent is arranged to increase NSE inclusion in the ATM mature RNA by binding motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs include a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcript or U2AF65 binding site upstream of the pseudoexon; and treating the subject with DNA damaging agents that cause double strand breaks, such as radiotherapy or chemotherapy.

According to another aspect of the invention, there is provided a method of increasing a cell’s susceptibility to cytotoxic therapy, such as radiotherapy treatment, comprising the reduction of ATM protein expression by administration of a NSE-activator agent arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs include a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcript or U2AF65 binding site upstream of the pseudoexon.

According to another aspect of the invention, there is provided a method of tailoring functional ATM expression in a subject, cell or tissue, comprising the administration of a NSE-activator agent and/or a NSE-repressor agent described herein.

According to another aspect of the invention, there is provided use of rs609261 genotyping to predict a subject response to therapy for conditions associated with ATM deregulation.

According to another aspect of the invention, there is provided a composition comprising the NSE repressor agent of the invention herein.

According to another aspect of the invention, there is provided a composition comprising the NSE activator agent of the invention herein.

According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue.

According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome with a thymine residue.

According to another aspect of the invention, there is provided a vector comprising the polynucleic acid polymer of the invention.

According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs 4988000of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with adenine.

According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a guanine variant residue at rs4988000 of the human genome with an adenine residue.

According to a first aspect of the invention, there is provided a method of screening a subject or a population of subjects for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a guanine variant residue at rs4988000of the human genome, wherein the presence of a guanine variant residue at rs4988000indicates that the subject(or group of subjects) has, or is susceptible to, functional-ATM protein deficiency.

According to another aspect of the invention, there is provided a method of selecting a subject or a population of subjects for treatment or prophylaxis, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.

According to another aspect of the invention, there is provided a method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.

According to another aspect of the invention, there is provided a method of screening for an agent or a combination of agents capable of modifying regulation of a gene’s expression (Fig. 7) comprising:

Identifying a nonsense-mediated RNA decay switch exon (NSE) that limits functional gene expression; identifying one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudoexons; targeting the one or more splicing regulatory motifs with antisense polynucleic acid that are arranged to hybridize to the splicing regulatory motifs through Watson-Crick base pairing; and determining if there is an increased or decreased inclusion of the NSE in a mature RNA transcript of the gene.

According to another aspect of the invention, there is provided a method of modulating gene’s expression comprising providing an agent arranged to bind to splicing regulatory motifs that compete with a nonsense-mediated RNA decay switch exon (NSE) for spliceosomal components.

According to another aspect of the invention, there is provided an agent arranged to bind to a gene splicing regulatory motif that competes with a nonsense-mediated RNA decay switch exon (NSE) for spliceosomal components, wherein the splicing regulatory motif controls inclusion of the NSE into a mature RNA transcript of the gene.

According to another aspect of the invention, there is provided a method of a treatment or prevention of a disease pathology caused by an NSE inclusion in a pre-mRNA gene transcript comprising providing an agent arranged to bind to a gene splicing regulatory motif that competes with a nonsense-mediated RNA decay switch exon (NSE) for spliceosomal components, wherein the splicing regulatory motif controls inclusion of the NSE into a mature RNA transcript of the gene.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 Identification of a U2AF-repressed cryptic exon in ATM intron 28 (A) Schematics of the cryptic exon (termed here NSE for NMD-switch exon) activation. NSE sequence (upper panel) is boxed, asterisk denotes rs609261, black rectangles show the indicated antisense oligonucleotides. Genome browser views of RNA-Seq data from RNAi- or SSO-mediated depletions of both U2AF35 isoforms (ab-), U2AF35a (a-), U2AF35b (b-) and controls (c) are shown in the lower panel. SSOs targeting 3’ ss of U2AF1 exons Ab and 3 and U2AF35 siRNA were as described [30], Y axis, read densities. NSE inclusion/exclusion is schematically shown by dotted lines at the top. ATM exons (gray boxes) are numbered. The 29-nt NS E introduced a stop codon in the ATM mRNA. (B) Validation of the NSE activation by RT-PCR (upper panel) in inde pendent depletions (lower panel). RT-PCR primers (ATM-F, ATM-R, Figure 16) are denoted by arrows in panel A. Spliced products are shown to the right, the percentage of transcripts with NSE is at the top. Error bars denote SDs of two transfections experiments. ***, p<0.0001, **, p<0.001.(C) NSE inclusion in mature transcripts inversely correlates with residual U2AF. r, Pearson correlation. Estimates of heterodimer levels were as described [30],

Figure 2 NSE activation and ATM expression are modified by rs609261 (A) Allelic frequencies at rs609261 in the indicated populations [112].(B) Minigene schematics. An Xhol/Xbal segment of ATM containing NSE and exon 29 was cloned between U2AF1 exons 2 and 4 (black boxes). RT-PCR primers to amplify exogenous transcripts (PL3 and ATM-R, Figure 16) are denoted by arrows. (C) The rs609261-dependent NSE activation in exogenous pre-mRNAs. HEK293 cells depleted of U2AF35 or U2AF65 were transiently transfected with T (black) and C (grey) minigenes. Final concentration of the E12AF35 and U2AF65 siRNAs was 30 and 60 nM, respectively. (D) Identification of cell lines homozygous at rs609261 (asterisk). NSE is boxed. (E, F) Allele-specific activation of NSE in endogenous transcripts limits ATM expression in a dose-dependent manner. The source of endogenous transcripts is at the bottom, antibodies are to the right. Concentration of siRNAs in cultures was 3, 10 and 30 nM. Cl, C2, control siRNAs. Transfection efficiency was monitored by a GFP-plasmid and fluorescent microscopy. (G) UPF1 depletion increased NSE activation (upper panel) and upregulated isoform U2AFlc (lower panel). The U2AFlc isoform contains both exons Ab and 3 and is repressed by NMD [30, 113], Final concentration of the UPF1 siRNA was 7, 20 and 60 nM. SC, a scrambled control. Error bars are SDs of independent transfections. (H) NSE inclusion levels in cells depleted of U2AF-related proteins and a subset of heterogenous nuclear RNPs. Error bars denote SDs of two transfections. Immunoblots are shown to the right. Final concentration of the U2AF35 siRNA was 25 nM; the remaining siRNAs were at 60 nM. C, controls. (I) Overexpression of PUF60 induced NSE skipping. Immunoblots are shown below, antibodies to the right.

Figure 3 Rescue of U2AF-repressed ATM expression by SSOs targeting NSE (Α,Β) Efficient SSO-mediated NSE inhibition in exogeneous (A) and endogenous (B) ATM transcripts. Mean NSE inclusion levels of two transfection experiments are shown in the right panels. (C) Restoration of ATM protein levels by SSOs that blocks access to NSE. Cells lacking U2AF35 and control cells were transfected with the SSO targeting the NSE 3’ss and a control SSOs (Fig. 1A and Figure 16), as described [35, 106], After 48 hrs, the cells were exposed to ionizing radiation (IR, 10 Gy) and harvested 1 hr later. Cell lysates were separated using a gradient SDS-PAGE. Western blotting was with antibodies shown to the right. (D) Dose-dependent reconstitution of ATM expression SSO-NSE3 in depleted cells.

Figure 4 Identification of intronic cis-elements and SSOs that modulate NSE activation (A) Schematics of two pseudoexons in ATM intron 28. Canonical exons (numbered) are shown as grey boxes, NSE as a white box, and PE as a chequered box. Asterisk indicates location of the IVS28-159A>G substitution, causing A-T [32], In this A-T case, both NSE and PE were included in the ATM mRNA together with the intervening sequence because NSE is separated from PE by less than the minimal size of human intron. Canonical and aberrant transcripts are denoted by dotted lines above and below the pre-mRNA, respectively. Middle panel shows RNA-Seq read densities for NSE in cells depleted of both U2AF35 isoforms (ab-) together with U2AF65 tags/high-confidence binding sites (horizontal lines/rectangles) identified by crosslinking and immunoprecipitation [40], The 100 basewise vertebrate conservation by Phylop (100 VC) is shown at the bottom. Lower panel shows mutations (in red and underlined) introduced in the C-minigene. (B) Splicing pattern of wildtype and mutated C minigenes. Mutations are shown in panel A; RNA products are shown schematically to the right. The largest product produced by clone PE delPPT/AG contains the shortened pseudointron (42 nt). (C) Splicing pattern of C minigenes mutated in NSE (lanes 2, 3, 7 and 8) or PE (lanes 4, 5, 9 and 10) in (mock)depleted HEK293 cells. Mutations are at the bottom and minigene sequences in Figure 17. Spliced products are schematically shown to the right; a hairpin symbol above PE denotes the MIR stem-loop insertion. (D, E) SSO-induced pseudoexon switching. Transfected minigenes are shown at the top, spliced products to the right and SSOs at the bottom. SSO sequences are in Figure 16. Final concentration of SSOs shown in panels D-G was 3, 10 and 30 nM. (F) SSOs targeting PE induced NSE skipping. (G) SSOs targeting a sequence activating NSE upon deletion (PEdelPPT/AG; panel A and B) inhibit PE. (H) NSE activation is haplotype-dependent. Minigene haplotypes at the indicated variants are shown at the bottom. Columns represent mean NSE inclusion, error bars are SDs, asterisks denote statistically significant differences as in Fig. IB.

Figure 5 Exon-centric regulation of ATM signalling

(A) U2AF-regulated gene- and exon-level expression changes in MRN-ATM-CHEK2-CDC25-cdc2/cyclin B pathway (left panel). Log2fold- and q-values [109] are shown in parentheses. Exon usage of CHEK2 and CDC25A genes is shown by RNA-Seq browser shots; PCR validation gels are in the right panels. CHEK2 exon 9 is a NMD switch exon; exon 11 encodes a portion of the kinase domain. Full spectrum of U2AF-mediated expression changes in the ATM signalling pathway is shown in Fig. 9; examples of the U2AF-mediated splicing regulation are in Fig. 10-13. (B) Impaired ATM signalling in U2AF35 depleted cells following IR. HEK293 cells were (mock)depleted of U2AF35 and subjected to IR (10 Gy) 48 hrs later. Expression was examined by immunoblotting at the indicated time points. Antibodies are shown to the right. CHEK2 exon 9 skipping levels are at the bottom; their measurements in control (U2AF35+) and depleted cells (U2AF35-) are in panel (C). (D) CHEK2 exon 9 inclusion in UPF1 depleted cells. Final concentration of the UPF1 siRNA (Figure 16) was 12.5, 25, 50, and 100 nM. (E) Repression of CHEK2 exon 9 by SSO reduced CHEK2 levels and promoted NSE inclusion. Final concentration of SSO targeting CHEK2 exon 9 was 3, 10 and 30 nM. (F) CHEK2 exon 9 inclusion upon transfection of HEK293 cells with the indicated SSOs. (G) A lack of SF3B1 induced CHEK2 exon 9 skipping but did not alter NSE activation. Final concentration of each siRNA targeting SF3B1 was 20 nM.

Figure 6 Rescue of NSE repression by cancer-associ ated mutations in U2AF35

Rescue of U2AF(35)-dependent NSE splicing of the C minigene by zinc finger 1 and 2 substitutions in U2AF35 (upper panel). All substitutions were made in the U2AFla construct (35a) [30], Cancer-associated mutations (bottom) are boxed; splice products are to the right. Immunoblot with U2AF35 and GFP antibodies is shown in the lower panel; ex, exogenous; en, endogenous U2AF35.

Figure 7 SSO-based modulation of gene expression by pseudoexon targeting

Canonical exons are shown as grey boxes, a nonsense-mediated RNA decay (NMD) switch exon as a black box, pseudoexons as white boxes. Canonical splicing is shown by dotted lines. Pseudosplice sites competing with the NMD exon are shown below the RNA precursor. SSO activators/repressors are denoted by horizontal black/grey bars, respectively. Splicing regulatory motifs or secondary structures that compete with NMD switch exons for spliceosome components such as U2AF, heterogeneous nuclear ribonucleoproteins, or serine/arginine-rich proteins, for inclusion to mature transcripts are not shown for simplicity. They can be predicted by computational methods described in details previously (for example, Kralovicova, J. and Vorechovsky, I. (2007) Global control of aberrant splice site activation by auxiliary splicing sequences: evidence for a gradient in exon and intron definition. Nucleic Acids Res., 35, 6399-6413,( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2095810/pdf/gkm680.pdf) and references there in) or determined by experimental methods, including RNA crosslinking and immunoprecipitation, mutagenesis of splicing substrates and RNA folding studies.

Figure 8 SSO-mediated NSE repression enhances ATM expression (A) SSO-NSE3 increased expression of total and activated ATM. HEK293 cells were (mock)-depleted of U2A F35, cotransfected with X press-tagged CHEK2 and SSO NSE3/control (SSO-C), exposed to ionizing radiation (IR) and harvested 30 minutes later. Cell lysates were immunoblotted with the indicated antibodies. Final concentration of siRNA and SSOs was 30 nM. The amount of plasmids expressing CHEK2 was 30, 90 and 270 ng; DNA from the empty vector was added to a final concentration of 270 ng/mL. Ex/enCHEK2, signal from exogenous and endogenous CHEK2, as detected by the D9C6 antibody. (B,C) Increased expression of exogenous CHEK2 by an SSO targeting NMD switch exon 9 (SSO CHEK2). Constant amounts of SSO CHEK2 were cotransfected with increasing amounts of Xpress-CHEK2 and constant amounts of GFP plasmids as transfection and loading control (B) and vice versa (C). Antibodies are to the right.

Figure 9 Map of U2AF-regulated functional ATM interactions U2AF-regulated ATM signalling network is highlighted by red arrows/pink background. Genes up-/down-regulated in cells depleted of U2AF35 are shown in red/dark green, respectively. Genes exhibiting significantly alte red exon usage are shown in yellow. The ATM signalling map shows ATM-interacting proteins (purple)/protein complexes (light green) [18], Arrows correspond to activation, T-shaped edges to inhibition and open circles denote unknown regulations. Containment links are shown as green edges.

Figure 10 Exon usage in CDC25B and CDC25C in cells depleted of U2AF35

Genomic browser views of RNA-Seq data in control (ctr) and depleted (ab-) cells (left panels). PCR primers are shown by arrows, differentially used exons are denoted by black rectangles. RefSeq exon annotation is shown at the bottom. Validation of RNA-Seq data using RT-PCR with RNA extracted from cells depleted of each U2AF subunits and U2AF-related proteins (right panels).

Figure 11 U2AF-regulated exon usage in TTK, PINland CDK1

For legend, see Fig. 10.

Figure 12 RNA processing of RAD50 and EZH2 in depleted cells

For legend, please see Fig. 10.

Figure 13 U2AF(35)-controlled exon usage of the peptidyl-prolyl isomerise ΡΙΝΙ and components of the shelterin complex

Figure 14 U2AF control of RARA fusion partners

Figure 15 NSE activation in normal tissue and leukaemic cells

Figure 16 Synthetic DNA and RNA

Figure 17 Sequences of splicing reporter constructs mutated in NSE and PE

Figure 18 Auxiliary splicing elements in NSE and PE

Figure 19 Summary of U2AF(35)-regulated transcripts involved in NMD

Legend: NSE inclusion levels were measured in 19 human tissues (A) and 17 AML/CMML bone marrow samples (B) using primers ATM-F and ATM-R (Fig. 1, Figure 16). Exon inclusion was quantified as described [19], Means were compared with an unpaired t-test (C). (D,E) Inclusion levels of U2AF-repressed (D) and -activated (E) exons in lymphoblastoid cell lines (top). Cells were exposed to cold and heat shock at the indicated temperatures, as described [19]. ES, exon skipping; El, exon inclusion.

DETAILED DESCRIPTION

According to a first aspect of the invention, there is provided a method of screening a subject for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency.

According to another aspect of the invention, there is provided a method of selecting a subject for treatment, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.

In one embodiment, the method of selecting a subject for treatment or method of screening may further comprise administering the agent for treatment of the selected subject. The agent may comprise a NSE repressor agent.

The determination may use any suitable assay or genetic analysis available to the skilled person. In some instances, detection is done at a nucleic acid level with nucleic acid-based techniques such as in situ hybridization and RT-PCR. Sequencing technologies can include next-generation sequencing technologies such as Helicos True Single Molecule Sequencing (tSMS) (Harris T.D. et al. (2008) Science 320:106-109); 454 sequencing (Roche) (Margulies, M. et al. 2005, Nature, 437, 376-380); SOLiD technology (Applied Biosystems); SOLEXA sequencing (Illumina); single molecule, real-time (SMRT™) technology of Pacific Biosciences; nanopore sequencing (Soni GV and Meller A. (2007) Clin Chem 53: 1996-2001); semiconductor sequencing (Ion Torrent; Personal Genome Machine); DNA nanoball sequencing; sequencing using technology from Dover Systems (Polonator), and technologies that do not require amplification or otherwise transform native DNA prior to sequencing (e.g., Pacific Biosciences and Helicos), such as nanopore-based strategies (e g. Oxford Nanopore, Genia Technologies, and Nabsys). Sequencing technologies can also include Sanger sequencing, Maxam-Gilbert sequencing, Shotgun sequencing, bridge PCR, mass spectrometry based sequencing, microfluidic based Sanger sequencing, microscopy-based sequencing, RNAP sequencing, or hybridization based sequencing.

Sequencing of a gene transcript of interest may also include an amplification step. Exemplary amplification methodologies include, but are not limited to, polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASBA), self-sustained sequence replication (3SR), loop mediated isothermal amplification (LAMP), strand displacement amplification (SDA), whole genome amplification, multiple displacement amplification, strand displacement amplification, helicase dependent amplification, nicking enzyme amplification reaction, recombinant polymerase amplification, reverse transcription PCR, ligation mediated PCR, or methylation specific PCR.

Additional methods that can be used to obtain a nucleic acid sequence include, e.g., whole-genome RNA expression array, enzyme-linked immunosorbent assay (ELISA), genome sequencing, de novo sequencing, Pacific Biosciences SMRT sequencing, immunohistochemistry (IHC), immunoctyochemistry (ICC), mass spectrometry, tandem mass spectrometry, matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS), in-situ hybridization, fluorescent in-situ hybridization (FISH), chromogenic in-situ hybridization (CISH), silver in situ hybridization (SISH), digital PCR (dPCR), reverse transcription PCR, quantitative PCR (Q-PCR), single marker qPCR, real-time PCR, nCounter Analysis (Nanostring technology), Western blotting, Southern blotting, SDS-PAGE, gel electrophoresis, and Northern blotting.

According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with a functional-ATM protein deficiency, comprising the administration of a NSE repressor agent arranged to increase levels of functional ATM protein, wherein the agent is arranged to bind to a NSE in ATM intron 28 of the pre-mRNA transcript to decrease inclusion of the NSE in the mature RNA transcript.

Decreasing inclusion of the NSE in the mature RNA transcript may provide an increase in functional ATM protein expression.

The method of treatment or prevention of functional-ATM protein deficiency in a subject or an at-risk population of subjects may be a method of treatment or prevention of a condition associated with functional-ATM protein deficiency. The condition may be any one of ataxia-telangiectasia; cancer; immune deficiency; cellular radiosensitivity; or chromosomal instability. The cancer may comprise lymphoblastoid leukemias, or lymphomas. In one embodiment, the condition is ataxia-telangiectasia. In another embodiment, the condition is cancer. The cancer may comprise a non-Hodgkin or Hodgkin lymphoma.

In one embodiment, the NSE comprises the sequence TCTACAGGTTGGCTGCATAGAAGAAAAAG. The NSE repressor agent may be arranged to bind to NSE within the sequence agTC T AC AGGTT GGC T GC AT AG A AG A A A A AGgtagag (respective 5’ and 3’ splice sites are underlined). The NSE repressor agent may be arranged to bind to the 5’ or 3’ splice site of the NSE in ATM intron 28. In another embodiment, the NSE repressor agentis arranged to bind to the 3’ splice site of the NSE in ATM intron 28.In another embodiment, the NSE repressor agent may be arranged to bind to NSE within the sequence tcttagTCTACAGGTTGGCTGCATAGAAGAAAAAGgtagag (respective 5’ and 3’ splice sites are underlined).In another embodiment, the NSE repressor agent may be arranged to bind to NSE within the sequence tctcagTCT AC AGGTT GGCTGC AT AG A AG A A A A AGgtagag (respective 5’ and 3’ splice sites are underlined).

According to another aspect of the invention, there is provided a method of treatment or prevention of a condition associated with deregulation of ATM expression in a subject comprising the administration of a NSE-activator agent, wherein the NSE-activator agent is arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcriptor binding to a U2AF65 binding site upstream of the pseudoexon.

Increasing inclusion of the NSE in the mature RNA transcript may provide a decrease in functional ATM protein expression.

According to another aspect of the invention, there is provided a method of treatment or prevention of cancer in a subject comprising the administration of a NSE-activator agent arranged to increase a cancer cell’s susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy, wherein the NSE-activator agent is arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcript or binding to a U2AF65 binding site upstream of the pseudoexon; and treating the subject with the cytotoxic therapy, such as radiotherapy or chemotherapy.

Chemotherapy agents may comprise bleomycin.

The U2AF65 binding sequence may comprise: TTATTTATAATCTTGTAAATCTTGGACTTTGAGTCATCTATTTTCTTTT.

The radiotherapy may be following the administration of the agent. The radiotherapy may one or more days following the administration of the agent. The radiotherapy may be one or more weeks following the administration of the agent.

In one embodiment the pseudoexon comprises the sequence TCATCGAATACTTTTGGAAATAAG.

According to another aspect of the invention, there is provided a method of increasing a cell’s susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy comprising the reduction of ATM protein expression by administration of a NSE-activator agent arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcriptor binding to a U2AF65 binding site upstream of the pseudoexon.

In one embodiment the cell is a cancerous cell. In another embodiment the cell is a pre-cancerous cell.

The NSE repressor agent and NSE activator agent

The NSE repressor agent and/or NSE activator agent may comprise a polynucleic acid polymer. In one embodiment, the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide).

In an embodiment wherein the NSE repressor agent and/or NSE activator agent comprises a polynucleic acid polymer the following statements may apply equally to both the NSE repressor agent and the NSE activator agent unless otherwise indicated. The polynucleic acid polymer may be about 50 nucleotides in length. The polynucleic acid polymer may be about 45 nucleotides in length. The polynucleic acid polymer may be about 40 nucleotides in length. The polynucleic acid polymer may be about 35 nucleotides in length. The polynucleic acid polymer may be about 30 nucleotides in length. The polynucleic acid polymer may be about 24 nucleotides in length. The polynucleic acid polymer may be about 25 nucleotides in length. The polynucleic acid polymer may be about 20 nucleotides in length. The polynucleic acid polymer may be about 19 nucleotides in length. The polynucleic acid polymer may be about 18 nucleotides in length. The polynucleic acid polymer may be about 17 nucleotides in length. The polynucleic acid polymer may be about 16 nucleotides in length. The polynucleic acid polymer may be about 15 nucleotides in length. The polynucleic acid polymer may be about 14 nucleotides in length. The polynucleic acid polymer may be about 13 nucleotides in length. The polynucleic acid polymer may be about 12 nucleotides in length. The polynucleic acid polymer may be about 11 nucleotides in length. The polynucleic acid polymer may be about 10 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 50 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 45 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 40 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 35 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 30 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 25 nucleotides in length. The polynucleic acid polymer may be between about 10 and about 20 nucleotides in length. The polynucleic acid polymer may be between about 15 and about 25 nucleotides in length. The polynucleic acid polymer may be between about 15 and about 30 nucleotides in length. The polynucleic acid polymer may be between about 12 and about 30 nucleotides in length.

The sequence of the polynucleic acid polymer may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to a target sequence of the partially processed mRNA transcript. The sequence of the polynucleic acid polymer may be 100% complementary to a target sequence of the pre-mRNA transcript.

The sequence of the polynucleic acid polymer may have 4 or less mismatches to a target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 3 or less mismatches to a target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 2 or less mismatches to a target sequence of the pre-mRNA transcript. The sequence of the polynucleic acid polymer may have 1 or less mismatches to a target sequence of the pre-mRNA transcript.

The polynucleic acid polymer may specifically hybridize to a target sequence of the pre-mRNA transcript. The specificity may be a 95%, 98%, 99%, 99.5% or 100% sequence complementarity of the polynucleic acid polymer to a target sequence of the pre-mRNA transcript. The hybridization may be under high stringent hybridization conditions.

Where reference is made to a polynucleic acid polymer sequence, the skilled person will understand that one or more substitutions may be tolerated, optionally two substitutions may be tolerated in the sequence, such that it maintains the ability to hybridize to the target sequence, or where the substitution is in a target sequence, the ability to be recognized as the target sequence. References to sequence identity may be determined by BLAST sequence alignment (www.ncbi.nlm.nih.gov/BLAST/) using standard/default parameters. For example, the sequence may have 99% identity and still function according to the invention. In other embodiments, the sequence may have 98% identity and still function according to the invention. In another embodiment, the sequence may have 95% identity and still function according to the invention. A polynucleic acid polymer, such as the SSOs, may comprise RNA or DNA. The polynucleic acid polymer, such as the SSOs, may comprise RNA. The polynucleic acid polymer, such as the SSOs, may comprise natural or synthetic or artificial nucleotide analogues or bases, having equivalent complementation as DNA or RNA. The polynucleic acid polymer, such as the SSOs, may comprise combinations of DNA, RNA and/or nucleotide analogues. Nucleotide analogues may comprise PNA or LNA. In another embodiment, the nucleic acid, such as the SSOs, may comprise or consist of PMO.

In some instances, the synthetic or artificial nucleotide analogues or bases can comprise modifications at one or more of ribose moiety, phosphate moiety, nucleoside moiety, or a combination thereof.

Nucleotide analogues or artificial nucleotide base may comprise a nucleic acid with a modification at a 2’ hydroxyl group of the ribose moiety. The modification can be a 2’-0-methyl modification or a 2’-0-methoxyethyl (2’-0-MOE) modification. The 2’-0-methyl modification can add a methyl group to the 2’ hydroxyl group of the ribose moiety whereas the 2’0-methoxyethyl modification can add a methoxyethyl group to the 2’ hydroxyl group of the ribose moiety. Exemplary chemical structures of a 2’-0-methyl modification of an adenosine molecule and 2’0-methoxyethyl modification of an uridine are illustrated below.

2’-0-methyl-adenosine 2’-0-methoxyethyl uridine

An additional modification at the 2’ hydroxyl group can include a 2’-O-aminopropyl sugar conformation which can involve an extended amine group comprising a propyl linker that binds the amine group to the 2’ oxygen. This modification can neutralize the phosphate derived overall negative charge of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar and can thereby improve cellular uptake properties due to its zwitterionic properties. An exemplar^' chemical structure of a 2’-0-aminopropyl nucleoside phosphoramidite is illustrated below.

2’-0-aminopropyl nucleoside phosphoramidite

Another modification at the 2’ hydroxyl group can include a locked or bridged ribose conformation (e.g., locked nucleic acid or LNA) where the 4’ ribose position can also be involved. In this modification, the oxygen molecule bound at the 2’ carbon can be linked to the 4’ carbon by a methylene group, thus forming a 2'-C,4'-C-oxy-methylene-linked bicyclic ribonucleotide monomer. Exemplary representations of the chemical structure of LNA are illustrated below. The representation shown to the left highlights the chemical connectivities of an LNA monomer. The representation shown to the right highlights the locked 3'-endo ( E) conformation of the furanose ring of an LNA monomer.

LNA (Locked Nucleic Acids) A further modification at the 2’ hydroxyl group may comprise ethylene nucleic acids (ENA) such as for example 2’-4’-ethylene-bridged nucleic acid, which locks the sugar conformation into a C3’-endo sugar puckering conformation. ENA are part of the bridged nucleic acids class of modified nucleic acids that also comprises LNA. Exemplary chemical structures of the ENA and bridged nucleic acids are illustrated below.

Still other modifications at the 2’ hydroxyl group can include 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-O-NMA).

Nucleotide analogues may further comprise Morpholinos, peptide nucleic acids (PNAs), methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’-fluoro N3-P5’-phosphoramidites, Γ, 5’- anhydrohexitol nucleic acids (HNAs), or a combination thereof. Morpholino or phosphorodiamidate morpholino oligo (PMO) comprises synthetic molecules whose structure mimics natural nucleic acid structure by deviates from the normal sugar and phosphate structures. Instead, the five member ribose ring can be substituted with a six member morpholino ring containing four carbons, one nitrogen and one oxygen. The ribose monomers can be linked by a phosphordiamidate group instead of a phosphate group. These backbone alterations can remove all positive and negative charges making morpholinos neutral molecules that can cross cellular membranes without the aid of cellular delivery agents such as those used by charged oligonucleotides.

Morpholine

Peptide nucleic acid (PNA) does not contain sugar ring or phosphate linkage. Instead, the bases can be attached and appropriately spaced by oligoglycine-like molecules, therefore, eliminating a backbone charge.

PNA

Modification of the phosphate backbone may also comprise methyl or thiol modifications such as methylphosphonate nucleotide and. Exemplary thiolphosphonate nucleotide (left) and methylphosphonate nucleotide (right) are illustrated below.

Furthermore, exemplary 2’-fluoro N3-P5’-phosphoramidites is illustrated as:

N3' PS' {^hosphctfeamidate

And exemplary hexitol nucleic acid (or Γ, 5’- anhydrohexitol nucleic acids (HNA)) is illustrated as:

ftexitcsi Nucleic Acid

In addition to modification of the ribose moiety, phosphate backbone and the nucleoside, the nucleotide analogues can also be modified by for example at the 3’ or the 5’ terminus. For example, the 3’ terminus can include a 3' cationic group, or by inverting the nucleoside at the 3'-terminus with a 3'-3' linkage. In another alternative, the 3'-terminus can be blocked with an aminoalkyl group,

e.g., a 3' C5-aminoalkyl dT. The 5' -terminus can be blocked with an aminoalkyl group, e.g., a 5'-0-alkylamino substituent. Other 5' conjugates can inhibit 5'-3' exonucleolytic cleavage. Other 3' conjugates can inhibit 3'-5' exonucleolytic cleavage.

In some cases, one or more of the artificial nucleotide analogues described herein are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribunuclease such as DNase, or exonuclease such as 5’-3’ exonuclease and 3’-5’ exonuclease when compared to natural polynucleic acid polymers. In some instances, artificial nucleotide analogues comprising 2’-0-methyl, 2’-0-methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-O-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2’-fluoro N3-P5’-phosphoramidites, or combinations thereof are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribunuclease such as DNase, or exonuclease such as 5’-3’ exonuclease and 3’-5’ exonuclease. 2’-0-methyl modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). 2’0-methoxyethyl (2’-0-M0E) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). 2’-O-aminopropyl modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). 2'-deoxy modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). T-deoxy-2'-fluoro modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). 2'-0-aminopropyl (2'-0-AP) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). 2'-0-dimethylaminoethyl (2'-0-DMA0E) modified polynucleic acid polymer may be nuclease resistance (e g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). 2'-0-dimethylaminopropyl (2'-0-DMAP) modified polynucleic acid polymer may be nuclease resistance (e g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). T-O-dimethylaminoethyloxyethyl (2'-0-DMAE0E) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). 2'-0-N-methylacetamido (2'-0-NMA) modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). LNA modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). ENA modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). HNA modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). Morpholinos may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). PNA can be resistant to nucleases (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). Methylphosphonate nucleotides modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). Thiolphosphonate nucleotides modified polynucleic acid polymer may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance). Polynucleic acid polymer comprising 2’-fluoro N3-P5’-phosphoramidites may be nuclease resistance (e.g., RNase H, DNase, 5’-3’ exonuclease or 3’-5’ exonuclease resistance).

In some instances, one or more of the artificial nucleotide analogues described herein have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. The one or more of the artificial nucleotide analogues comprising 2’-0-methyl, 2’-0-methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0-dimethylaminopropyl (2'-0- DMAP), T-0- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, or 2’-fluoro N3-P5’-phosphoramidites can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2’-0-methyl modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2’-0-methoxyethyl (2’-0-M0E) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2’-0-aminopropyl modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2'-deoxy modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. T-deoxy-2'-fluoro modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2'-0-aminopropyl (2'-0-AP) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2'-0-dimethylaminoethyl (2'-0-DMAOE) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2'-0-dimethylaminopropyl (2'-0-DMAP) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. T-O-dimethylaminoethyloxyethyl (2'-0-DMAE0E) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. 2'-0-N-methylacetamido (2'-O-NMA) modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. LNA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. ENA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. PNA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. HNA modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Morpholino modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Methylphosphonate nucleotides modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Thiolphosphonate nucleotides modified polynucleic acid polymer can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. Polynucleic acid polymer comprising 2’-fluoro N3-P5’-phosphoramidites can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid polymer. The increased affinity can be illustrated with a lower Kd, a higher melt temperature (Tm), or a combination thereof.

In additional instances, a polynucleic acid polymer described herein may be modified to increase its stability. In an embodiment where the polynucleic acid polymer is RNA, the polynucleic acid polymer may be modified to increase its stability. The polynucleic acid polymer may be modified by one or more of the modifications described above to increase its stability. The polynucleic acid polymer may be modified at the 2’ hydroxyl position, such as by 2’-0-methyl, 2’-0-methoxyethyl (2’-0-M0E), 2’-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMA0E), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAE0E), or 2'-0-N-methylacetamido (2'-0-NMA) modification or by a locked or bridged ribose conformation (e.g., LNA or ENA). The polynucleic acid polymer may be modified by 2’-0-methyl and/or 2’-0-methoxyethyl ribose. The polynucleic acid polymer may also include morpholinos, PNAs, HNA, methylphosphonate nucleotides, thiolphosphonate nucleotides, or 2’-fluoro N3-P5’-phosphoramidites to increase its stability. Suitable modifications to the RNA to increase stability for delivery will be apparent to the skilled person. A polynucleic acid polymer described herein can be constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. For example, a polynucleic acid polymer can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the polynucleic acid polymer and target nucleic acids. Exemplary methods can include those described in: US5,142,047; US5,185,444; W02009099942; or EP1579015. Additional exemplary methods can include those described in: Griffey et al., “2’-0-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides,” J. Med. Chem. 39(26):5100-5109 (1997)); Obika, et al. "Synthesis of 2'-0,4'-C- methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering". Tetrahedron Letters3& (50): 8735(1997); Koizumi, M. "ENA oligonucleotides as therapeutics". Current opinion in molecular therapeutics8 (2): 144-149 (2006); and Abramova et al., “Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical possibilities,” Indian Journal of Chemistry 48B: 1721-1726 (2009). Alternatively, the polynucleic acid polymer can be produced biologically using an expression vector into which a polynucleic acid polymer has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted polynucleic acid polymer will be of an antisense orientation to a target polynucleic acid polymer of interest). A polynucleic acid polymer may be bound to any nucleic acid molecule, such as another antisense molecule, a peptide, or other chemicals to facilitate delivery of the polynucleic acid polymer and/or target the nucleic acid to a specific tissue, cell type, or cell developmental stage. The polynucleic acid polymer may be bound to a protein or RNA. The protein tethered to the polynucleic acid polymer may comprise a splicing factor to enhance, inhibit or modulate splicing and intron removal. RNA tethered to the polynucleic acid polymer may comprise an aptamer or any structure that enhance, inhibit or modulate splicing and intron removal. The polynucleic acid polymer may be isolated nucleic acid. A polynucleic acid polymer may be conjugated to, or bound by, a delivery vehicle suitable for delivering the polynucleic acid polymer to cells. The cells may be a specific cell type, or specific developmental stage. The delivery vehicle may be capable of site specific, tissue specific, cell specific or developmental stage-specific delivery. For example, the delivery vehicle may be a cell specific viral particle, or component thereof, alternatively, the delivery vehicle may be a cell specific antibody particle, or component thereof. The polynucleic acid polymer may be targeted for delivery to beta cells in the pancreas. The polynucleic acid polymer may be targeted for delivery to thymic cells. The polynucleic acid polymer may be targeted for delivery to malignant cells. The polynucleic acid polymer may be targeted for delivery to pre-malignant cells (that are known to develop into overt malignant phenotypes within a foreseeable future, such as pre-leukaemias and myelodysplastic syndromes or histopathologically defined precancerous lesions or conditions.

In one embodiment the polynucleic acid polymer may be bound to a chemical molecule (e g. non-peptide or nucleic acid based molecule), such as a drug. The drug may be a small molecule (e g. having a MW of less than 900Da).

In one embodiment of the invention, the delivery vehicle may comprise a cell penetrating peptide (CPP). For example, the polynucleic acid polymer may be bound or complexed with a CPP. The skilled person will understand that any suitable CPP may be conjugated with the polynucleic acid polymer to aid delivery of the polynucleic acid polymer to and/or into cells. Such CPPs may be any suitable CPP technology described by Boisguerin et al. (2015, Advanced

Drug Delivery Reviews doi: 10.1016/j.addr.2015.02.008), which is herein incorporated by reference. Suitable delivery vehicles for conjugation to the polynucleic acid polymer are also described in Lochmann et al ((.European Journal of Pharmaceutics and Biopharmaceutics 58 (2004) 237-251), which is herein incorporated by reference).

The CPP may be an arginine and/or lysine rich peptide, for example, wherein the majority of residues in the peptide is either lysine or arginine. The CPP may comprise a poly-L-lysine (PLL). Alternatively, the CPP may comprise a polyarginine. Suitable CPPs may be selected from the group comprising Penetratin; R6-Penetratin; Transportan; oligo-arginines; F-3; B-peptide; B-MSP; Pip peptides, such as Pip 1, Pip2a, Pip2b, Pip5e, Pip5f, Pip5h, Pip5j; Pip5k, Pip51, Pip5m, Pip5n, Pip5o, Pip6a, Pip6b, Pip6c, Pip6d, Pip6e, Pip6f, Pip6g, or Pip6h; peptide of sequence PKKKRKV; Penatratin; Lys4; SPACE; Tat; Tat-DRBD (dsRNA-binding domain); (RXR)4; (RFF)3RXB; (KFF)3K; RgF2; T-cell derived CPP; Pep-3; PEGpep-3; MPG-8; MPG-8-Chol; PepFect6; P5RHH; Ri5; and Chol-Rg; or functional variants thereof (e.g. see Boisguerin et al. (2015, Advanced Drug Delivery Reviews doi: 10.1016/j.addr.2015.02.008).

In one embodiment, the CPP comprises or consists of a Pip peptide. The Pip peptide may be selected from the group comprising Pipl, Pip2a, Pip2b, Pip5e, Pip5f, Pip5h, Pip5j; Pip5k, Pip51, Pip5m, Pip5n, Pip5o, Pip6a, Pip6b, Pip6c, Pip6d, Pip6e, Pip6f, Pip6g, and Pip6h.

In one embodiment of the invention, the delivery vehicle may comprise a peptide-based nanoparticle (PBN), wherein a plurality of CPPs (for example one or more suitable CPPs discussed herein) form a complex with the polynucleic acid polymer through charge interactions. Such nanoparticles may be between about 50nm and 250nm in size. In one embodiment the nanoparticles may be about 70-200nm in size. In another embodiment the nanoparticles may be about 70-100nm in size or 125-200nm in size.

In one embodiment, the polynucleic acid polymer may be complexed with a delivery vehicle, for example by ionic bonding. Alternatively, the polynucleic acid polymer may be covalently bound to the delivery vehicle. Conjugation/binding methods are described in Lochmann et al ((European Journal of Pharmaceutics and Biopharmaceutics 58 (2004) 237-251), which is herein incorporated by reference). For example, a conjugation method may comprise introducing a suitable tether containing a reactive group (e.g. -NH2 or -SH2) to the polynucleic acid polymer and to add the delivery vehicle, such as a peptide, post-synthetically as an active intermediate, followed by carrying out the coupling reaction in aqueous medium. An alternative method may comprise carrying out the conjugation in a linear mode on a single solid-phase support.

The delivery vehicle and polynucleic acid polymer may be thiol and/or maleimide linked, such as thiol-maleimide linked. The conjugation of the polynucleic acid polymer and the delivery vehicle may be by click-chemistry, such as reaction of azido or 2’-0-propyargyl functional groups and alkyne groups on the respective molecules to be conjugated. In one embodiment, the delivery vehicle and polynucleic acid polymer may be linked by a thioether bridge. In another embodiment, the delivery vehicle and polynucleic acid polymer may be linked by a disulphide bridge. The skilled person will readily identify suitable linking groups or reactions for conjugation of polynucleic acid polymer and the delivery vehicle, such as a peptide.

In one embodiment the NSE repressor agent may comprise an SSO of the sequence CUUCUAUGCAGCCAACCUGUAGACU (SSO -NSE3), or a nucleic acid analogue thereof. In one embodiment the NSE repressor agent may comprise an SSO of the sequence ACCUUUUUCUUCUAUGCAGCCAAC(SSO -NSE5), or a nucleic acid analogue thereof.

In one embodiment the NSE-activator agent may comprise the SSO PEkr herein described. In one embodiment the NSE-activator agent may comprise an SSO of the sequence CUGUAAAAGAAAAUAGA (PEkr).PEkr may also be referred to as PEdel and it is understood that these terms are interchangeable.

In one embodiment the NSE repressor agent, such as an SSO, may be arranged to bind to guanine variant residue at rs4988000.

Where reference is made to reducing NSE inclusion in the mature RNA, the reduction may be complete, e.g. 100%, or may be partial. The reduction may be clinically significant. The reduction/correction may be relative to the level of NSE inclusion in the subject without treatment, or relative to the amount of NSE inclusion in a population of similar subjects. The reduction/correction may be at least 10% less NSE inclusion relative to the average subject, or the subject prior to treatment. The reduction may be at least 20% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 40% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 50% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 60% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 80% less NSE inclusion relative to an average subject, or the subject prior to treatment. The reduction may be at least 90% less NSE inclusion relative to an average subject, or the subject prior to treatment.

Where reference is made to increasing active-ATM protein levels, the increase may be clinically significant. The increase may be relative to the level of active-ATM protein in the subject without treatment, or relative to the amount of active-ATM protein in a population of similar subjects. The increase may be at least 10% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 20% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 40% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 50% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 80% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 100% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 200% more active-ATM protein relative to the average subject, or the subject prior to treatment. The increase may be at least 500% more active-ATM protein relative to the average subject, or the subject prior to treatment.

The terms active-ATM and functional-ATM may be used interchangeably herein.

The conditions associated with ATM deregulation may comprise A-T or cancer.

In one embodiment, the presence of an rs609261 cytosine residue is associated with a higher NSE activation, less efficient response of ATM to DNA double-strand break signalling, a higher cancer risk and lower survival relative to non-cytosine residue at the same position.

In one embodiment, the composition is a pharmaceutically acceptable formulation.

The composition may comprise at least one other biologically active molecule in addition to the polynucleic acid polymer. The biologically active molecule may be drug or a pro-drug. The biologically active molecule may comprise nucleic acid or amino acid. The biologically active molecule may comprise a small molecule (e.g. a molecule of <900 Daltons).

Pharmaceutical formulations described herein can be administered to a subject by multiple administration routes, including but not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, topical, rectal, or transdermal administration routes. In some instances, the pharmaceutical composition describe herein is formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular) administration. In other instances, the pharmaceutical composition describe herein is formulated for oral administration. In still other instances, the pharmaceutical composition describe herein is formulated for intranasal administration.

Pharmaceutical formulations described herein may include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate and controlled release formulations.

Pharmaceutical formulations may include a carrier or carrier materials which may include any commonly used excipients in pharmaceutics and should be selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. Pharmaceutically compatible carrier materials may include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. See, e.g., Remington: The Science and

Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkinsl999).

In one embodiment, replacing the non-thymine variant residue rs609261 may comprise administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue.

The agent for replacement of the non-thymine residue may be a genomic editing molecule, such as CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs609261.

In one embodiment, replacing the guanine variant residue at rs4988000 may comprise administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with an adenine residue.

The agent for replacement of the guanine residue may be a genomic editing molecule, such as CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs4988000.

The methods of the invention herein may comprise blocking a guanine variant residue at rs4988000, for example using an SSO. PE contains a natural DNA variant rs4988000 (G/A), which also influences NSE recognition (Fig. 4H). Transfections of C and T minigenes systematically mutated at rs4988000 revealed that the rare A allele decreased NSE inclusion on each pre-mRNA, both in U2AF35- and mock-depleted cells. Therefore, replacement of the guanine residue with adenine will decrease NSE inclusion, and increase the level of functional ATM-protein.

The highest NSE inclusion is produced by the haplotype that is most frequent in Caucasians (CG), followed by haplotypes CA>TG>TA (referring tors609261 and rs4988000 respectively). Therefore, the methods and compositions of the invention may be used in combination (concurrently or sequentially) to modify a CG haplotype to CA, TG, or TA. In one embodiment, the methods and compositions of the invention may be used to modify a CG haplotype to TA. In one embodiment, the methods and compositions of the invention may be used to modify a CA haplotype to TG or TA. In one embodiment, the methods and compositions of the invention may be used to modify a CA haplotype to TA. In one embodiment, the methods and compositions of the invention may be used to modify a TG haplotype to TA.

The methods and compositions of the invention may also be used in combination (concurrently or sequentially) to identify a CG haplotype in a subject, and optionally treat or select the patient according to the invention. The methods and compositions of the invention may also be used in combination (concurrently or sequentially) to identify a CA haplotype in a subject, and optionally treat or select the patient according to the invention. The methods and compositions of the invention may also be used in combination (concurrently or sequentially) to identify a TG haplotype in a subject, and optionally treat or select the patient according to the invention.

According to another aspect of the invention, there is provided a method of modifying regulation of NSE inclusion in a mature RNA transcript, the method comprising the insertion or deletion of one or more splicing regulatory motifs upstream or downstream of the NSEs that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudo-exons.

According to another aspect of the invention, there is provided a method of modifying regulation of a functional protein expression, wherein the functional protein expression is regulated by NSE inclusion in a mature RNA transcript of the gene encoding protein, the method comprising the insertion or deletion of one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudo-exons.

In one embodiment, the insertion or deletion of one or more splicing regulatory motifs is in genomic DNA of ATM intron 28.

The insertion of one or more splicing regulatory motifs may cause a reduction in NSE inclusion in the mature RNA transcript. The deletion of one or more splicing regulatory motifs may cause an increase in NSE inclusion in the mature RNA transcript.

The insertion or deletion of one or more splicing regulatory motifs may comprise the use of genome editing technology, such as CRISPR-Cas9. CRISPR-Cas9 may be provided with an appropriate targeting RNA molecule.

The subject or cells that are treated or screened according to the invention may be mammalian. In one embodiment, the subject is a human. In one embodiment, the cells are human.

Kits and articles of manufacture are provided herein for use with one or more methods described herein. The kits can contain one or more of the polynucleic acid polymers described herein.

According to another aspect of the invention, there is provided a kit comprising one or more oligonucleotide probes for identifying rs609261 and/orrs4988000 variants.

The skilled person will be familiar with techniques for probing the presence or absence of genetic sequence features. For example, the oligonucleotide probes may comprise primers for use to PCR amplify regions of nucleic acid comprising rs609261 and/orrs4988000. In another embodiment the oligonucleotide probes may directly bind rs609261 orrs4988000, wherein the binding may be detectable. The binding of the probe may be detectable for example using SERS or SERRS technology.

The kits can also include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements, such as the polynucleic acid polymers and reagents, to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.

The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment. A kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.

The vector may comprise a viral vector. The viral vector may comprise adeno-associated viral vector. The vector may comprise any virus that targets the polynucleic acid polymer to malignant cells or specific cell type.

According to another aspect of the invention, there is provided a method of screening for an agent capable of modifying regulation of a gene’s expression (see Fig. 7) comprising: identifying a nonsense-mediated RNA decay switch exon (NSE) that limits functional gene expression; identifying one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for splisomal components, said regulatory motifs comprising cryptic splice sites or pseudoexons; targeting the one or more splicing regulatory motifs with antisense polynucleic acid arranged to hybridize to the splicing regulatory motifs through Watson-Crick base pairing; and determining if there is an increased or decreased inclusion of the NSE in a mature RNA transcript of the gene.

Nonsense-mediated mRNA decay (NMD) is a surveillance pathway that exists in all eukaryotes. Its main function is to reduce errors in gene expression by eliminating mRNA transcripts that contain premature stop codons. NMD targets transcripts with premature stop codons but also a broad array of mRNA isoforms expressed from many endogenous genes, suggesting that NMD is a master regulator that drives both fine and coarse adjustments in steady-state RNA levels in the cell. A nonsense-mediated RNA decay switch exon (NSE) is an exon or a pseudoexon that activates the NMD pathway if included in a mature RNA transcript. A NSE inclusion in mature transcripts downregulates gene expression

Cryptic (or pseudo- splice sites) have the same splicing recognition sequences as genuine splice sites but are not used in the splicing reactions. They outnumber genuine splice sites in the human genome by an order of a magnitude and are normally repressed by thus far poorly understood molecular mechanisms. Cryptic 5’ splice sites have the consensus NNN/GUNNNN or NNN/GCNNNN where N is any nucleotide and / is the exon-intron boundary.

Cryptic 3’ splice sites have the consensus NAG/N. Their activation is positively influenced by surrounding nucleotides that make them more similar to the optimal consensus of authentic splice sites, namely MAG/GURAGU and YAG/G, respectively, where M is C or A, R is G or A, and Y is C or U.

Cryptic (or pseudo-) exons have the same splicing recognition sequences as genuine exons but are not used in the splicing reactions. They outnumber genuine exons by an order of a magnitude and are normally repressed by thus far poorly understood molecular mechanisms.

Splice sites and their regulatory sequences can be readily identified by a skilled person using suitable algorithms publicly available, listed for example in Kralovicova, J. and Vorechovsky, I. (2007) Global control of aberrant splice site activation by auxiliary splicing sequences: evidence for a gradient in exon and intron definition. Nucleic Acids Res., 35, 6399-6413,( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2095810/pdf/gkm680.pdf)

The cryptic splice sites or splicing regulatory sequences may compete for RNA-binding proteins such as U2AF with a splice site of the NSE. In one embodiment, the agent may bind to the cryptic splice site or splicing regulatory sequences to prevent the binding of RNA-binding proteins and thereby favouring utilization of the NSE splice sites.

In one embodiment, the cryptic splice site may not comprise the 5’ or 3’ splice site of the NSE. The cryptic splice site may be at least 10 nucleotides upstream of the NSE 5’ splice site. The cryptic splice site may be at least 20 nucleotides upstream of the NSE 5’ splice site. The cryptic splice site may be at least 50 nucleotides upstream of the NSE 5’ splice site. The cryptic splice site may be at least 100 nucleotides upstream of the NSE 5’ splice site. The cryptic splice site may be at least 200 nucleotides upstream of the NSE 5’ splice site.

The cryptic splice site may be at least 10 nucleotides downstream of the NSE 3’ splice site. The cryptic splice site may be at least 20 nucleotides downstream of the NSE 3’ splice site. The cryptic splice site may be at least 50 nucleotides downstream of the NSE 3’ splice site. The cryptic splice site may be at least 100 nucleotides downstream of the NSE 3’ splice site. The cryptic splice site may be at least 200 nucleotides downstream of the NSE 3’ splice site.

In some instances, compositions and methods described herein are used to treat a genetic disorder or condition such as a hereditary disease. Compositions and methods described herein can be used to treat a genetic disorder or condition such as a hereditary disease that is characterized by an impaired production of a protein. Compositions and methods described herein can be used to treat a genetic disorder or condition such as a hereditary disease that is characterized by a defective splicing.

Compositions and methods described herein can also be used to treat a genetic disorder or condition such as an autosomal dominant disorder, an autosomal recessive disorder, X-linked dominant disorder, X-linked recessive disorder, Y-linked disorder, mitochondrial disease, or multifactorial or polygenic disorder. Compositions and methods described herein can be used to treat an autosomal dominant disorder, an autosomal recessive disorder, X-linked dominant disorder, X-linked recessive disorder, Y-linked disorder, mitochondrial disease, or multifactorial or polygenic disorder, in which the disorder or condition is characterized by an impaired production of a protein. Compositions and methods described herein can also be used to treat an autosomal dominant disorder, an autosomal recessive disorder, X-linked dominant disorder, X-linked recessive disorder, Y-linked disorder, mitochondrial disease, or multifactorial or polygenic disorder, in which the disorder or condition is characterized by a defective splicing.

The condition associated with deregulated ATM expression may comprise cancer. Compositions and methods described herein can be used to treat cancer.

In one embodiment the cancer comprises breast cancer.Cancer can be a solid tumor or a hematologic malignancy. A solid tumor can be a sarcoma or a carcinoma. Sarcoma can be a cancer of bone, cartilage, fat muscle, vascular or hematopoietic tissues. Exemplary sarcoma can include alveolar rhabdomyosarcoma, alveolar soft part sarcoma, ameloblastoma, angiosarcoma, chondrosarcoma, chordoma, clear cell sarcoma of soft tissue, dedifferentiated liposarcoma, desmoid, desmoplastic small round cell tumor, embryonal rhabdomyosarcoma, epithelioid fibrosarcoma, epithelioid hemangioendothelioma, epithelioid sarcoma, esthesioneuroblastoma, Ewing sarcoma, extrarenal rhabdoid tumor, extraskeletal myxoid chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, giant cell tumor, hemangiopericytoma, infantile fibrosarcoma, inflammatory myofibroblastic tumor, Kaposi sarcoma, leiomyosarcoma of bone, liposarcoma, liposarcoma of bone, malignant fibrous histiocytoma (MFH), malignant fibrous histiocytoma (MFH) of bone, malignant mesenchymoma, malignant peripheral nerve sheath tumor, mesenchymal chondrosarcoma, myxofibrosarcoma, myxoid liposarcoma, myxoinflammatory fibroblastic sarcoma, neoplasms with perivascular epitheioid cell differentiation, osteosarcoma, parosteal osteosarcoma, neoplasm with perivascular epitheioid cell differentiation, periosteal osteosarcoma, pleomorphic liposarcoma, pleomorphic rhabdomyosarcoma, PNET/extraskeletal Ewing tumor, rhabdomyosarcoma, round cell liposarcoma, small cell osteosarcoma, solitary fibrous tumor, synovial sarcoma, telangiectatic osteosarcoma.

Carcinoma can be a cancer developed from epithelial cells. Exemplary carcinoma can include adenocarcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma, large cell carcinoma, small cell carcinoma, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of Unknown Primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastroenterological cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer. Hematologic malignancy is a malignancy of the blood system and can include T-cell based and B-cell based malignancies. Exemplary hematologic malignancy can include myeloid leukaemia, myeloproliferative neoplasias, peripheral T-cell lymphoma not otherwise specified (PTCL-NOS), anaplastic large cell lymphoma, angioimmunoblastic lymphoma, cutaneous T-cell lymphoma, adult T-cell leukemia/lymphoma (ATLL), blastic NK-cell lymphoma, enteropathy-type T-cell lymphoma, hematosplenic gamma-delta T-cell lymphoma, lymphoblastic lymphoma, nasal NK/T-cell lymphomas, treatment-related T-cell lymphomas, chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom’s macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt’s lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis.

According to another aspect of the invention, there is provided a method of a treatment or prevention of a disease pathology caused by an NSE inclusion in a pre-mRNA gene transcript comprising providing an agent arranged to bind to a cryptic splice site of a pseudoexon present on the pre-mRNA gene transcript, wherein the cryptic splice site is capable of regulating inclusion of a nonsense-mediated RNA decay switch exon (NSE)into a mature RNA transcript of the gene.

Wherein the binding of the agent to the cryptic splice site of the pseudoexon present on the pre-mRNA gene transcript reduces the NSE inclusion.

The method may comprise a step of determining if a disease pathology is caused by an NSE inclusion in a gene transcript prior to treatment.

The skilled person will understand that optional features of one embodiment or aspect of the invention may be applicable, where appropriate, to other embodiments or aspects of the invention.

SPECIFIC EXAMPLES

Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying figures. These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.

ABBREVIATIONS NSE nonsense-mediated RNA decay switch exon in ATM intron 28 PE a 24-nt pseudoexon located 3’ of NSE in ATM intron 28 NMD nonsense-mediated RNA decay A-T ataxia-telangiectasia ATM gene deficient in ataxia-telangiectasia SSO splice-switching oligonucleotide DSB double-strand DNA break DDR DNA damage response MIR mammalian-wide interspersed repeat BPS branch point sequence PPT polypyrimidine tract IR ionizing radiation U2AF auxiliary factor of U2 small nuclear ribonucleoprotein U2AF35 a 35-kD subunit of U2AF encoded by U2AF1 U2AF65 a 65-kD subunit of U2AF encoded by U2AF2

snRNA small nuclear RNAs SUMMARY

Phenotypic diversity and susceptibility to genetic disease is influenced by natural intronic variants, but their interactions with RNA-binding proteins are largely unknown. Here we show that a single-nucleotide polymorphism in a detained ATM intron gains functionality in cells lacking the auxiliary factor of U2 small nuclear ribonucloprotein (U2AF). Each U2AF subunit was required for repression of a nonsense-mediated RNA decay switch exon (NSE) in ATM intron 28. NSE was activated to a greater degree in the presence of cytosine than thymine at rs609261 located at position -3 relative to the NSE 3’ splice site. The cytosine allele, which is predominant in Caucasians, resulted in a more efficient NSE-mediated inhibition of ATM expression than thymine, the principal allele in Asian populations. NSE activation was deregulated in leukemic cells and was influenced by the amino acid identity at U2AF35 residue 34. Exploiting competition between NSE and a downstream pseudoexon, we identify splice-switching oligonucleotides (SSOs) that repress or activate NSE to modulate ATM expression. Using RNA-Seq, we also show that U2AF-regulated exon usage in the ATM signalling pathway is centred on the MRN/ATM-CHEK2-CDC25-cdc2/cyclin B axis and that U2AF preferentially controls RNA processing of transcripts involved in cancer-associated fusions and chromosomal translocations. These results reveal important links between 3’ splice-site control and ATM-dependent response to double strand DNA breaks, illustrate functional plasticity of intronic variants in response to RNA-binding factors, demonstrate versatility of SSOs to modify gene expression by targeting pseudo-splice sites in introns and may explain ethnic differences in cancer risk and survival.

INTRODUCTION

Here, we show that U2AF represses a nonsense-mediated decay (NMD) switch exon (NSE) in the ATM gene (ataxia-telangiectasia, A-T, mutated) and identify other proteins involved in 3’ss recognition that regulate NSE inclusion in mature transcripts. The extent to which this event limits ATM expression depends on a common C/T variant rs609261 located in the NSE 3’ss consensus deep in intron 28. Also identified are intronic c/s-elements that control NSE inclusion in mature transcripts and splice-switching oligonucleotides (SSOs) that modulate NSE activation by targeting a competing pseudoexon in the same intron. Elsing RNA-Seq, it was next shown that the E!2AF-mediatedregulation of DNA damage response (DDR) pathway is centered on the ATM-CHEK2-CDC25-cdc2/cyclin B axis, suggesting that it has coevolved with cellular responses to double-strand DNA breaks (DSBs). Finally, a preferential involvement of E!2AF-regulated transcripts is demonstrated in cancer-associated gene fusions and chromosome translocations.

RESULTS

Identification of a U2AF-repressed cryptic exon in ATM

It has been recently shown that depletion of each ET2AF subunit resulted in down- and up-regulation of a large number of exons that were predominantly alternatively spliced. When inspecting global RNA processing changes in cells depleted of U2AF35, we found an unexpectedly strong activation of a cryptic, 29-nt ATM exon that was not annotated by RefSeq (termed NSE, Fig. 1A). The NSE activation was observed also in cells individually depleted of each U2AF35 isoform with isoform-specific small interfering RNAs (siRNAs) and with SSOs targeting 3’ss of alternatively spliced U2AF1 exons Ab and 3, which encode isoform U2AF35b and U2AF35a, respectively (Fig. 1A). Validation of RNA-Seq data using RT-PCR showed that NSE was present in '10-20% of polyadenylated transcripts in untreated HEK293 cells, similar to levels observed in lymphoblastoid cell lines. The NSE inclusion levels increased to 75% in cultures depleted of '90% U2AF35 and to '50% in cells depleted of '75% U2AF65 (Fig. IB), were siRNA dose-dependent and inversely correlated with the amount of available U2AF heterodimers (Fig. 1C), consistent with the requirement of each U2AF subunit for NSE repression. Inspection of RNA-Seq data revealed retention of intronic sequences surrounding NSE (Fig. 1A), suggesting that intron 28 is ‘detained’ and could be spliced post-transcriptionally. Retention levels of intron 28 were affected neither by SSO-nor siRNA-mediated depletion of U2AF35 (Fig. 1A) and no other cryptic exon in this gene was activated to the same extent as NSE. Thus, NSE plays a key role in the exon-centric regulation of ^7Mexpression by U2AF. NSE activation and ATM expression is modified by rs609261

Examination of genomic sequences surrounding NSE revealed that position -3 relative to the NSE 3’ss is polymorphic (rs609261, Fig. 2A) in which thymine (T) is predominant in African and Asian populations and cytosine (C) in Caucasians (Fig. 2A). The base identity at this position is important for universal exon recognition, with a CAG>TAG>AAG>GAG hierarchy of exon inclusion levels both at authentic and U2AF(35)-dependent 3’ss. To confirm that the NSE usage is allele-specific, we examined splicing of two reporter constructs that contained C or T at this position following transient transfections into human embryonic kidney (HEK) 293 cells (Fig. 2B). As expected, the T construct yielded lower NSE inclusion than the C reporter, both in untreated cells and cells individually depleted of each U2AF subunit (Fig. 2C).

To test whether the allele-specific NSE usage results in differential protein expression in cells lacking U2AF35, we first sequenced DNA from available cell lines across rs609261 to obtain transfectable cells homozygous for each allele. We found that HEK293 cells were homozygous for the C allele and HeLa cells were homozygous for the T allele (Fig. 2D). Immunoblots from the U2AF35-depleted cells and untreated controls confirmed efficient depletion in each cell line and a greater U2AF-mediated decline of ATM expression in the presence of the C allele than the T allele (Fig. 2E,F). Depletion of UPF1, a key component of the NMD pathway, revealed a dose-dependent increase of NSE inclusion in ATM mature RNAs (Fig 2G). No signal from a putative truncated ATM was detected on immunoblots from depleted cells.

Because U2AF-repressed and -activated exons show preferential responses to U2AF-related proteins [30], we depleted HEK293 cells of PUF60 and CAPERa, and several heterogeneous nuclear RNPs, including hnRNP Al. PUF60 interacts with uridine-rich motifs at 3’ss [36] and hnRNP Al forms a ternary complex with the U2AF heterodimer on AG-containing U-rich RNAs [37], Depletion of either PUF60 or hnRNP Al increased NSE inclusion (Fig. 2H) while PUF60 overexpression led to NSE skipping (Fig. 21). Thus, the rs609261- and population-dependent NSE activation deep in ATM intron 28 is regulated by U2AF, PUF60 and hnRNP Al, demonstrating how functionality of a common intronic polymorphism varies with cellular levels of RNA-binding proteins that facilitate 3’ss recognition. NSE inhibition by SSOs promotes ATM expression

To test if NSE activation in cells lacking U2AF can be repressed to restore ATM expression, we individually cotransfected the C-allele reporter construct with SSOs targeting each NSE splice site (Fig. 1A). SSOs were modified at each phosphorothioate linkage and 2’-0-methyl ribose and were designed to avoid the PPT of NSE, stable Mfold-predicted stems and rs609261. Each SSO diminished NSE inclusion in a dose-dependent manner both in exogeneous (Fig. 3A) and endogeneous (Fig. 3B) transcripts and the SSO targeting the NSE 3’ss was more efficient than the SSO bridging its 5’ss at the same concentrations.

We next examined if the NSE 3’ss SSO can increase ATM protein expression and activation in cells exposed to ionizing radiation (IR). The low ATM expression in cells lacking U2AF35 was partially rescued by this SSO, both in unexposed and IR-exposed cells (lanes 1 vs 2 and 5 vs 6, Fig. 3C, lanes 5-8 vs 9-12, Fig. 8A) and the increase was dose-dependent (Fig. 4D). Following IR, activated ATM autophosphorylated at SI981 [38] showed reduced signal in depleted cells as compared to untreated cells (lane 6 vs 8, Fig. 3C, and lanes 1-4 vs 5-8, Fig. 8A). Exposure to the NSE 3’ss SSO slightly increased also activated ATM (lanes 5-8 vs 9-12, Fig. 8A, lane 5 vs 6, Fig. 3C). To begin to explore putative effects of SSO-mediated NSE repression on ATM signalling, we also overexpressed wild type CHEK2 in (mock)irradiated cells (mock)depleted of U2AF (Fig. 8A). CHEK2 is a serine/threonine kinase phosphorylated by ATM at T68 in response to DNA double-strand breaks (DSBs) [39], However, cells lacking U2AF had markedly lower levels of endogenous CHEK2 compared to controls, which did not appear to be altered by the NSE 3’ss SSO (lanes 1-4 vs 5-8 vs 9-12) whereas exogeneous CHEK2 was increased in depleted cells both in IR-exposed and -unexposed cells (lanes 1-4 vs 5-8, see also Fig. 5 and Fig. 8B,C further below).

Taken together, NSE activation was efficiently inhibited by SSOs that block access to NSE splice sites and do not support RNase H cleavage. The more efficient SSO partially rescued the NSE-mediated inhibition of ATM.

Activation of a NMD switch exon is influenced by a downstream pseudoexon

To identify intronic regulatory c/s-elements that control NSE inclusion in mature transcripts, we took advantage of a previously reported A-T mutation IVS28-159A>G [32], We noticed that this mutation activated the NSE 3’ss while repressing its 5’ss and promoting a downstream 5’ss instead, introducing a 112-nt cryptic exon in the mRNA [32], We also noticed that within this exon, there is a strong 3’ss consensus preceded by optimal BPS/PPT motifs, which may bind U2AF and activate a smaller, 24-nt pseudoexon (termed PE; Fig. 4A). Examination of published RNA crosslinking/immunoprecipitation data [40] in ATM showed U2AF65 binding upstream and downstream of NSE and upstream of PE, suggesting that NSE activation may be controlled by competition between partially productive spliceosomes assembled at the PE 3’ss and the NSE 3’ss. The two 3’ss are conserved in mammals but are separated by a distance smaller than the minimal size of human introns, sterically preventing simultaneous recognition of NSE and PE (Fig. 4A). In agreement with this hypothesis, deletion of the PE PPT/3’ss introduced in the C minigene, which should alleviate NSE repression through diminished U2AF binding to PE, increased NSE inclusion (Fig. 4B). This deletion also brought about retention of the intron that separates NSE and PE, mimicking the splicing pattern of the A-T mutation IVS28-159A>G. Increasing the intron length from 59 to 79 nt, thereby overcoming a steric hindrance imposed by the insufficient distance between the two pseudo-3’ss, also improved NSE inclusion and diminished the intron retention (Fig. 4B).

To test if NSE inactivation can influence PE inclusion in mRNA, we first eliminated the NSE 3'ss. This mutation activated a cryptic 3’ss 7-nt downstream of the authentic NSE 3’ss (lanes 1, 2 and 6, 7, Fig. 4C, Figure 17). This cryptic 3’ss showed a diminished requirement for U2AF. Because extending the intron length between NSE and PE on this background failed to activate PE (Fig. 4C, lanes 3 and 8) and PE lacks exonic splicing enhancers and has a suboptimal BPS (Figure 18), we inserted a 24-nt stemloop derived from a mammalian-wide interspersed repeat (MIR) in the middle of PE. This MIR hairpin acts as a nearly universal exon definition module through an exposed splicing enhancer in a terminal RNA triloop [41], The enlarged PE was strongly activated in mock-depleted cells, but was outcompeted by NSE in cells lacking U2AF35 (lanes 4 and 9), indicating that NSE inclusion is more dependent on U2AF(35) than PE. The construct containing both the MIR insertion in PE and the extended intron finally generated mRNAs containing both NSE and PE (lanes 5 and 10).

Intronic SSOs targeting competing pseudoexons to modulate gene expression

Next, we employed the MIR reporter to test the impact of NSE and PE SSOs on exon usage and ATM expression. Fig. 4D shows that the NSE 3’ss SSO repressed transcripts containing NSE and upregulated those with PE whereas the opposite effect was found for SSOs targeting the MIR enhancer loop in PE. The same pattern was observed for the reporter in which NSE and PE were separated by a distance insufficient for their simultaneous inclusion in mRNA (Fig. 4E). These results suggested that SSOs targeting PE and/or U2AF65 binding sites upstream of PE may potentially promote NSE inclusion and reduce ATM expression while the NSE SSOs should have the opposite effect. This approach would provide a broad strategy to modulate gene expression in either direction by antisense-based targeting of competing pseudoexons, one of which is critical for gene regulation. To test this concept, we examined SSOs targeting PE 3’ss and 5’ss. Although each PE SSO induced NSE skipping, both on exogeneous and endogeneous transcripts (Fig. 4F), SSOs targeting U2AF65 binding sites just upstream of PE (Fig. 4A), ie. the NSE-repressing sequence (construct delPPT/AG, Fig. 4B), reduced PE inclusion and slightly increased NSE in the MIR reporter (Fig. 4G). In contrast, a longer oligo extended in the 5’ direction (SSO-PEBP, Figure 16) did not show any effect. PE contains a natural DNA variant rs4988000 (G/A), which may also influence NSE recognition (Fig. 4H). Transfections of C and T minigenes systematically mutated at rs4988000 revealed that the rare A allele decreased NSE inclusion on each pre-mRNA, both in U2AF35- and mock-depleted cells. Thus, the highest NSE inclusion was produced by the haplotype that is most frequent in Caucasians (CG), followed by haplotypes CA>TG>TA.

Taken together, the haplotype-dependent activation of the U2AF-repressed NSE can be modified by SSOs that target U2AF65 intronic binding sites upstream of competing pseudo-3’ss, potentially providing a general method to manipulate exon-centric gene expression by antisense-based targeting of NMD switch exons and their regulatory motifs in introns.

Regulation of ATM signalling by U2AF: DSBs at the focal point

Because ATM is a key apical kinase in the DDR pathway and NMD switch exons often regulate genes encoding protein interaction partners, we systematically characterized U2AF(35)-induced RNA processing changes of currently known ATM substrates and other constituents of the ATM signalling network. Interestingly, although genes involved in the DDR and cell cycle control that contained U2AF(35)-dependent exons were only marginally enriched (FDR=0.08), each component in the ATM-CHEK2-CDC25-CDC2/cyclin B axis showed RNA processing alterations (Fig. 5A, Fig. 9). This pathway is critical for ATM signalling of DSBs.

First, reduced ATM expression in cells lacking U2AF (Fig. 8) was associated with decreased CHEK2 mRNA, increased retention of CHEK2 intron 10, and skipping of exons 9 and 11 (Fig. 5A). RNA processing alterations of known CHEK2 substrates were limited to genes regulating the cell cycle (CDC25A, CDC25B, CDC25C and TTK; Fig. 5A, 10A-B, S4A) and were not apparent in genes involved in DNA repair (BRCA1/2, XRCC1, FOXM1, TRIM28) or p53 signalling (TP53, MDM4, CABIN 1, STRAP, AATF). CHEK2 exon 9 skipping, which would be predicted to activate NMD, was only marginally increased 24 hrs after IR and did not contribute to the decline of total CHEK2 observed as early as 30 min after IR (Fig. 5B,C). As CHEK2 exon 9 inclusion was increased only for the highest concentration of UPF1 siRNAs (Fig. 5D), we transfected HEK293 cells with an SSO targeting its 3’ss. This treatment induced exon 9 skipping and reduced expression of the CHEK2 protein, however, it also increased NSE activation (Fig. 5E). In contrast, SSOs targeting NSE or PE did not have any effect on CHEK2 exon 9 inclusion (Fig. 5F). Exon 9 skipping, but not NSE, was also dramatically increased in cells lacking SF3B1 (Fig. 5G). To address why exogenous expression of CHEK2 was increased in cells lacking U2AF35 as compared to controls (Fig. 8A), we cotransfected HEK293 cells with the CHEK2-repressing SSO and a CHEK2-expressing plasmid (Fig. 8B,C). Reduced endogenous CHEK2 was associated with a significant increase of exogenous CHEK2 also in U2AF-proficient cells, pointing to a tight homeostatic regulation of the total CHEK2 protein in the cell.

Second, U2AF was required for full activation of CDC25A exon 6 (Fig. 5A), which encodes a residue (S178) that is phosphorylated by CHEK2 and CHEK1, facilitating binding of 14-3-3 [45], U2AF(35) was also required for inclusion of exon 3 of CDC25B and CDC25C (Fig. 10A,B), confirming previous microarray data [46], CDC25B exon 3 encodes multiple phosphorylated residues, including a B-domain residue SI69, phosphorylated by MAPKAP kinase 2 and pEg3. This isoform localizes to the centrosomes and accumulates during mitosis. CDC25C exon 3 encodes T67 phosphorylated by cdc2/cyclin B as a part of the auto amplification loop. Phosphorylated T67 inCDC25C creates a binding site recognized by the WW domain of ΡΙΝΙ [50], which sustained activation of a U2AF-repressed NMD switch exon (Fig. 11B), possibly modifying catalytic activity of this abundant peptidyl-prolyl isomerase. Finally, cyclin B1 and B2 mRNAs were upregulated in cells lacking U2AF35 as well as cyclin Bl-interacting protein (CCNB1IP1, also known as HEI10), although their RNA processing pattern did not appear to be altered (Fig. 5A). Cyclin B upregulation was associated with a detained CDK1 intron (Fig. 11C), which may be spliced post-transcriptionally. ATM recruitment to DSB is facilitated by the MRN complex, consisting of MRE11, RAD50 and NBN. NBN showed no obvious RNA processing changes in cells lacking U2AF35, but RAD50 mRNA was downregulated, possibly through activation of a NMD switch exon and/or additional splicing alterations (Fig. S5A-C and Fig. 9). The last MRE11A exon was upregulated as a result of a promotion of distal alternative polyadenylation site in depleted cells, which is present in most cell types, but not in B cells. DEXSeq analysis did not detect significant RNA processing changes in transcripts encoding other members of the phosphatidylinositol 3 kinase-like family of serine/threonine protein kinases (.ATR and PRKDC), nor in BRCA1/2, RNF168 and the ATM interactor ATMIN. Additional ATM interacting partners with altered exon or gene expression included RPS6, SRSF1 and other SR proteins, EP300, RPA2, BLM, FANCD2 and FANCI, PPP2R5C and PPP2R5D, and SMC3, a central component of the cohesin complex (Fig. 9).

Depletion of U2AF35 was associated with preferential alterations of genes/exons involved in chromatin modification, which have numerous functional links to ATM signalling (Fig. 9). For example, the INO80 chromatin remodelling complex is phosphorylated by ATM and is functionally linked to checkpoint regulators, including CHEK2. U2AF inhibited INO80C isoforms containing 54-nt exons that encode peptides that are absent in the yeast Ies6 homolog, which is critical to INO80 function in vivo and is likely to alter heterodimer formation with ACTR5 and nucleosome binding. Expression of multiple components of the INO80 complex was altered in depleted cells, including ACTR5, ACTL6A and RUVL2B. Many INO80 subunits localize preferentially in telomeres and their mutations result in telomere elongation. U2AF is required for full inclusion of TERF1 exon 7 in mRNA (Fig. S6A), regulating the abundance of TRF1 (exon 7+)/PIN2 (exon 7-) isoforms, important components of the shelterin complex. Exon 7 encodes multiple phosphorylated serine residues and both isoforms can heterodimerize through the dimerization domain. TRF1 binding to telomeres is promoted by ATM inhibition whereas ATM-mediated phosphorylation impairs TRF1 interaction with telomeric DNA. TRF1 association with telomeres is also negatively regulated by RAD50. TRF1-interacting TIF2 is another shelterin protein localized in nuclear matrix and encoded by TINF2. TIF2 exists in at least two isoforms produced by alternative splicing, termed TIN2S and TIN2Z,. TIN2Z, contains an extra NM binding domain and associates more strongly with the nuclear matrix than TIF2S which is encoded by a transcript with retained 3’ introns that form a long 3’ untranslated region. This mRNA isoform was repressed by U2AF (Fig. S6B).

Collectively, these results show that the MRN/ATM-CHEK2-CDC25-cdc2/cyclin B axis is at the centre of the U2AF(35)-mediated control of DDR, although the U2AF regulation extends into additional ATM substrates involved in chromatin modification and telomere length control. U2AF preferentially controls RNA processing of transcripts involved in leukemia-associated fusions CHEK2 phosphorylates PML (Promyelocytic Leukemia) and appears to require PML for subsequent autophosphorylation. Depletion of U2AF35 promoted the use of proximal alternative polyadenylation site of PML, leading to the upregulation of the shortest PML isoform, which lacks the last exon coding for the nuclear export signal (Fig. 14A). The long and short PML isoforms have distinct functions; for example, nuclear PML isoforms, but not the cytoplasmic isoform, are positive regulators of IFNy signalling. The C-terminus of the longest PML isoform specifically interacts with AML1 to enhance AML1-mediated transcription, suggesting that U2AF deficiency could impair PML-AML1 interactions. PML also binds ΡΙΝΙ and this interaction promotes PML degradation in a phosphorylation-dependent manner. U2AF depletion increased a ΡΙΝΙ NMD exon (Fig. 11 B), potentially limiting expression of this highly abundant peptidyl-prolyl isomerise, which interacts with many phosphoproteins to regulate mitosis, including phosphorylated CDC25.

Apart from PML, U2AF35 depletion upregulated other RARA partners [66], including NPM1 (Fig. 14B). This event was associated with promotion of a proximal polyadenylation site, thus increasing the abundance of shorter, presumably more stable transcripts. An alternatively spliced exon of BCOR, a BCL6 corepressor that forms BCOR-RARA fusions and interacts with several histone deacetylases to increase BCL6 transcriptional repression, was also downregulated (Fig. 14C).

Interestingly, the overlap between U2AF35-sensitive genes/exons and 1,187 genes involved in cancer-associated gene fusions [69] and 300 genes involved in recurrent chromosome translocations was greater than expected, with more significant P values observed for genes with differentially used exons than those implicated by Cufflinks at the transcript level (Table 1). Similarly, sharing of genes frequently mutated in the myelodysplastic syndrome and genes differentially expressed upon U2AF35 depletion was significantly higher than expected (P<0.01, hypergeometric test). Thus, RNA processing of transcripts involved in cancer-associated gene fusions and chromosome translocations is preferentially regulated by U2AF.

To test the function of cancer-associated U2AF1 mutations in NSE splicing, we performed reconstitution experiments with wild-type and mutated U2AF35 constructs that were cotransfected with the C minigene into cells (mock)-depleted of U2AF35 (Fig. 6). NSE activation was repressed by either U2AF35 isoform to a similar extent, as well as U2AF35a containing substitutions of S34 in the zinc finger 1 domain, the most frequently mutated U2AF35 residue in cancer. In contrast, only a partial rescue was achieved by substitutions of Q157 in the second zinc finger domain where these mutations are less frequent. Other S34 mutations failed to fully reconstitute the defect, including S34T and substitutions with small amino acids, although a large residue at this position (S34R) was efficient. Thus, the identity of the residue at position 34 of U2AF35 is important for NSE recognition.

Finally, we detected a low degree of NSE activation in diverse human tissues, both in hexamer-primed samples and polyadenylated transcripts (Fig. 15 A). The proportion of NSE-containing RNAs was on average higher in leukemic cells than in normal cells, with some samples exhibiting very high levels not observed in normal tissues (Fig. 15B,C), potentially contributing to reduced ATM expression previously observed both in leukemias and solid tumors. We also examined NSE inclusion in polyadenylated RNAs extracted from a panel of lymphoblastoid cell lines exposed to cold and heat shock at the indicated temperatures prior to lysis (Fig. 15D,E). Interestingly, NSE appeared to be activated to a minor extent by exposing cells to 42 °C but not at subphysiological temperatures (Fig. 15D), suggesting that markedly higher NSE inclusion levels in malignant cells are unlikely to be explained by a cold shock encountered during storage of patients’ samples. Since proteomic profiling of Jurkat cells exposed to a heat stress at 43 °C revealed diminished expression of several proteins including U2AF35a [73], these results further support U2AF(35) as a specific NSE repressor.

DISCUSSION

Our work significantly expands currently known links between RNA processing and DDR pathways (Fig. 5 and 9). We have identified an alternative splicing-coupled NMD switch exon critical for ATM expression (Figs. 1 and 3) and examined its importance in cancer risk (Fig. 2, Fig. 6 and 15). We have also shown how intronic haplotypes influence inclusion of this exon in mature transcripts and their functional dependence on cellular levels of RNA-binding proteins involved in 3’ss selection (Fig. 2 and 4H). Finally, we have identified SSOs that modulate activation of this exon by targeting its regulatory sequences and propose a novel antisense strategy to modify gene expression U2AF is an important 3’ss recognition complex and a critical regulator of alternative splicing. In addition to expanding protein-protein interactions, alternative splicing has evolved to fine-tune quantitative gene expression through NMD, in agreement with alterations of many NMD exons in cells lacking this factor (Figs. 1, 5 and S6). Peptides encoded by alternatively spliced exons are enriched in disordered regions and post-translation modification (PTM) sites, which are required for dynamic and reversible switching between two or more isoforms. Conversely, PTMs regulate numerous splicing factors, including proteins involved in NSE regulation. This complexity represents a clear challenge ahead and can be exemplified by the observed NSE activation upon targeting of CHEK2 exon 9 (Fig. 5E). Reduced CHEK2 expression may alter interactions with other kinases such as CDK11, which is constitutively phosphorylated at S737 in a CHEK2-dependent manner and interacts with U2AF65 and PUF60 , creating a regulatory loop that controls NSE levels (Fig. 2H,I).

Our results suggest that U2AF is an integral part of the DDR control, contributing to fine-tuning of its PTM network and subject to PTMs itself. U2AF35 was found among proteins that showed increased phosphorylation at S59 upon DNA damage. This serine residue is present only in U2AF35a and is replaced by alanine in U2AF35b. Exogenous expression of U2AF35b was higher than U2AF35a and the relative abundance of U2AF35b increased upon depletion of U2AF65, suggesting that the two U2AF35 isoforms may differentially interact with U2AF65 and may not have equivalent roles in DDR. However, U2AF35- and U2AF65-regulated exons vastly overlap and most, but not all, RNA processing changes found in U2AF35 depleted cells are attributable to the lack of the U2AF heterodimer, including the NSE activation (Fig. 1C). U2AF-repressed exons have a distinct 3’ss organization and response to U2AF-related proteins as compared to U2AF -activated exons, suggesting that the exon repression involves direct RNA binding. This is supported by the observed NSE activation on exogenous transcripts that do not undergo NMD and by the SSO-induced NSE blockage (Figs. 2 and 4). NSE lacks AG dinucleotides between the predicted BPS and 3’ss, its AG exclusion zone is longer than the average and has an unusual stretch of 5 conserved guanines upstream of the BPS, which may contribute to stable secondary structures across 3’ss that might be required for the repression. The adenine-rich 3’ portions of both NSE and PE are more conserved in evolution than their 5’ parts (Fig. 4A), potentially providing important ligand interactions, given the propensity of adenine to occupy unpaired positions in structured RNAs. Interestingly, primate NSEs have uridine at position -3 and longer PPT than lower mammals, which have cytosine at this position. Although direct RNA binding appears to be the simplest explanation for exon repression by U2AF, U2AF35 depletion led to downregulation of several proteins involved in NMD (Figure 19), which may contribute to NSE activation on endogenous transcripts. In addition, physical interactions between U2AF65 and the C-terminus of TRF1 or other components of the ATM signalling network may also participate in NSE regulation.

Apart from U2AF1/U2AF2, additional genes involved in 3’ss selection have been found mutated in cancer. Interestingly, chronic lymphocytic leukemias with SF3B1 mutation were associated with a cryptic 3’ss activation of ATM exon 46, leading to ATM truncation. Recently, splicing of an EZH2 exon as a result of cancer-associated SRSF2 mutation was implicated in impaired hematopoietic differentiation and the same NMD exon was upregulated also upon U2AF35 depletion (Fig. 12D). Whether these exons are targets of a common 3’ss recognition pathway underlying leukemogenesis remains to be established. In contrast, NSE inclusion did not appear altered in cells depleted of SF3B1, which produced almost complete skipping of CHEK2 exon 9 (Fig. 5G).

Because NSE activation may restrict ATM expression both in normal and cancer cells (Figs. 1, 2, and 15) and ATM is a limiting factor in the DDR pathway, cytosine at rs609261 may confer a relative ATM deficiency not only in (pre-)malignant cells but also in the germline. ATM kinase activity appears to be a good predictor of A-T severity, however, the diversity of A-T alleles does not fully account for the spectrum of clinical symptoms. Genes involved in NSE activation (Fig. 1, 2) might contribute to clinical heterogenenity of A-T patients, particularly those with ‘leaky’ mutations. Natural variants modifying NSE inclusion (Figs. 2C-F and 4H) may also contribute to the phenotypic complexity of A-T or even A-T heterozygotes who lack overt clinical features but may display increased radiosensitivity and cancer risk, consistent with the central focus of U2AF-regulated exon usage within the ATM signalling network (Fig. 9).

Our results predict that NSE activation is on average more efficient in Caucasians than in Asian populations as a result of a higher frequency of the C allele at rs609261 in the former (Fig. 2A). Asian Americans have lower mortality rates for common malignancies than Caucasians that persist over a long-period of time. The risk of haematopoietic malignancies also varies greatly by ethnic group and their incidence is the highest in white populations, including non-Hodgkin and Hodgkin lymphomas, which are associated with A-T. This trend also persists in migrants and continues in subsequent generations. Although lymphoblastoid leukemias, lymphomas and other cancer types show distinct incidence rates across Asian and Caucasian populations, no significant ethnic differences in the age-standardized incidence rates were found for myeloid leukemias, which does not appear to be more prevalent in A-T, unlike lymphoid malignancies or other cancers. Asian cancer patients respond more favourably than Caucasian patients to cytotoxic therapy and have on average a longer median survival. Asian cancer patients were also reported to have a lower prevalence of some gene fusions than Caucasians, potentially reflecting their capacity to respond to DSBs. rs609261 showed the lowest p-value of ATM variants in Cochrane-Armitage tests of association with glioma. rs2235006 (ATM allele F582L), which is located only ~35 kb upstream of rs609261 in a region of minimal recombination, was associated with a high risk (OR 11.2) of chronic lymphocytic leukemia. This study genotyped 1467 coding nonsynonymous SNPs in 865 candidate genes and implicated variants in genes encoding the ATM-BRCA2-CHEK2 DDR axis as the most significant risk pathway. Allelic association studies of nonagenarians/centenarians and younger controls also suggested association between ATM and longevity. Finally, ethnic differences were noted also for mutation rates in genes frequently altered in hematological malignancies; for example, SF3B1 mutations in chronic lymphocytic leukemias were less frequent in Chinese than in European populations.

Although these considerations collectively support the importance of rs609261-dependent NSE activation in cancer risk and survival, the U2AF- and hnRNP Al-dependency of NSE inclusion (Fig. 2H, 15B) demonstrates that it is by no means fixed. Variable expression patterns of these proteins from one malignancy to another would imply a ‘capricious functionality’ of this variant. Many more polymorphic sites with this attribute are likely to be established in future, contributing not only to the inter-individual variability of gene expression through restrictive capacity of ‘poison’ cryptic exons, but potentially also to the ‘missing heritability’ of complex traits and failures of genome-wide association studies, particularly in cancer.

Although RNA-Seq is a powerful tool to examine global transcriptome in response to DNA damage, rigorous standards that correctly estimate biological and statistical significance of the observed alterations in RNA processing are yet to be implemented. Given a high stringency of the DEXSeq algorithm, we cannot exclude the existence of additional biologically important RNA processing events responsive to U2AF. For example, upregulation of a proximal polyadenylation site in CHEK1, which was coupled with upregulation of 24-nt and 27-nt exons in CLASP1, would implicate the ATM apoptotic pathway. These events were not detected by DEXSeq but were see genomic browsers and require confirmation. The apoptotic pathways are of particular interest in the myelodysplastic syndrome which shows susceptibility of myeloid progenitors to the programmed cell death and where deregulation of genes involved in ATM signalling was found in more advanced but not initial clinical stages. Interestingly, U2AF1 mutations were also found to be more frequent in advanced stages and were associated with shorter survival. Our study also highlights current limitations of incomplete transcript annotation and the importance of examining cryptic exons in RNA-Seq data. Future RNA-Seq studies should therefore attempt at global detection of NMD events associated with alternative splicing, which has been hindered by the instability of stop codon-containing transcripts.

Finally, our study demonstrates efficient repression of a key NMD switch exon in ATM by SSOs that also increased ATM protein levels (Fig. 3A-D, Fig. 8). It also reveals competing regulatory motifs of NSE in the same intron (Fig. 4A-C, H) that could be exploited as a target for SSO-mediated modulation of gene expression (Fig. 4D-G). This approach can be combined with genome-editing such as CRISPR-Cas9 to delete or introduce splicing regulatory motifs or protein binding sites implicated by minigene studies (Fig. 4C) and should also help us to find efficient intronic SSOs with desired outcomes for RNA processing. The search for such SSOs is more challenging than for those targeting human exons. For example, most SSOs systematically covering SMN2 exon 7 stimulated exon skipping, an event exploited for treatment of spinal muscular atrophy, however, '20% induced exon inclusion. By analogy, the desired stimulation of intron splicing was found only for 10% of SSOs targeting INS intron 1 while the majority failed to show this effect. The proposed strategy takes advantage of a much higher information content of human auxiliary splicing sequences as compared to lower organisms and should be greatly facilitated by future global pre-mRNA folding studies. For example, unlike the SSO that efficiently blocked the NSE 3’ss (SSO-NSE3, Fig. 3A,B), a partially overlapping morpholino extending only 7-nt into NSE failed to repress the same 3’ss to rescue splicing of mutation IVS28-159A>G [107], despite targeting U2AF binding sites (Fig. 4A). This suggests that the morpholino oligo may have blocked access to structures or motifs that are not responsible for exon activation, but exon repression, in agreement with our finding (Fig. 1A-C). Administration of antisense-based RNA processing activators or inhibitors that target or avoid binding sites of splicing factors in introns could be exploited therapeutically to shape beneficial or detrimental consequences of NMD in cancer cells. This approach is supported by a broad recognition that NMD serves primarily a regulatory function across a wide range of transcripts and may also promote translation of NMD substrates that produce truncated polypeptides, which may stimulate anti-tumor immunity. MATERIAL AND METHODS Plasmid constructs ATM minigenes were prepared by cloning '0.9-kb amplicons into XholIXbal sites of the U2AF1 construct described earlier [30], Cloning primers are shown in Figure 16. Full inserts were sequenced to confirm the identity of intended changes and exclude undesired mutations. PUF60 expression vectors were as described [30], The hnRNP A1 construct was a generous gift of Gideon Dreyfuss (University of Pennsylvania).

Cell cultures and transfections

Cell cultures were maintained in standard conditions in DMEM supplemented with 10% (v/v) bovine calf serum (Life Technologies). Depletion of U2AF subunits and U2AF35 isoforms with small interfering RNAs (siRNAs) and splice-switching oligonucleotides (SSOs), were carried out following a time course experiment that established depletion levels of each isoform, as described [30], 01igo(ribo)nucleotides and siRNAs are listed in Figure 16. Transfections were carried out in 6- or 12-well plates using jetPRIME (Polyplus) according to manufacturer’s recommendations, as described in detail [30], The cells were harvested 48 hrs after the second hit, except for those exposed to IR, which received a single hit. For SF3B1 depletion, HEK293 cells were exposed to a siRNAs mixture (S23850, S23852, S223598, Life Technologies) and were harvested 48 hrs later. RNA-Seq

Analysis of differential exon usage was performed using DEXSeq (v. 1.12.1) [102], based on q-values less than 0.05, as described in detail [30], Differential gene and isoform expression between sample sets was analyzed with Cufflinks (v. 2.1.1) [109], which normalizes the reads using a fragments per kilobase of exon model per million reads measure. Selection of significantly differentially expressed genes was made on the basis of FDR-adjusted P-values (q<0.05). NSE expression in human tissues and cell lines

The FirstChoice human total RNA survey panel containing total RNA samples from 19 different tissues was purchased from LifeTechnologies. Each tissue sample contained a pool of RNAs from different donors. Lymphoblastoid cell lines exposed to cold and heat shock were described previously [110], Total RNA samples were reverse transcribed with the Moloney murine leukemia virus reverse transcriptase (Promega) and random hexamer or oligo-d(T) primers. cDNA samples were amplified using primers shown in Figure 16. Total RNA extracted from leukocytes from bone marrow samples of randomly selected patients with acute myeloid leukemia or chronic myelomonocytic leukemia was reverse transcribed with random hexamer primers. The study was approved by the National Research Ethics Service (UK) Committee South West.

Splice-switching oligonucleotides SSOs were designed to maximize interactions with single-stranded regions [41] and avoid secondary structures predicted by mfold [111]. All SSOs were purchased from Eurofins, diluted in water and their aliquots were stored at - 80 °C. All transfections were carried out with jetPRIME (Polyplus) according to manufacturer’s recommendations.

Exposure of cell cultures to ionizing irradiation (Mock)-depleted HEK293 cells were exposed to IR 48 hours after the first hit using a Gulmay Medical (X-Strahl) D3225 Orthovoltage X-ray system at a dose-rate of 0.63 Gy min-1 at room temperature. The actual dose rate was monitored by a constancy meter. Cells were harvested as indicated in figure legends.

Immunoblotting

Antibodies against ATM (D2E2), ATM-pS1981 (D6H9), CHEK2 (D9C6) and CHEK2pThr68 (C13C1) were purchased from the Cell Signaling Technology, Inc. RBM39 antibodies were purchased from Thermo Fisher Scientific (PAS-31103). Antibodies detecting X-press tag, U2AF35, U2AF65, and tubulin were as described previously [30], SF3B1 immunoblotting was performed with mouse monoclonal anti-SAP155 antibody (D138-3, MBL). Preparation of cell lysates and immunoblotting was carried out as described [30],

SUPPORTING INFORMATION Figure 16 Synthetic DNA and RNA

Figure 17 Sequences of splicing reporter constructs mutated in NSE and PE Figure 18 Auxiliary splicing elements in NSE and PE Figure 19 Summary of U2AF(35)-regulated transcripts involved in NMD Figure 8 SSO-mediated NSE repression enhances ATM expression Figure 9 Map of U2AF-regulated ATM interactions

Figure 10 Exon usage in CDC25B and CDC25C in cells depleted of U2AF35

Figure 11 U2AF-regulated exon usage in TTK, PINland CDK1

Figure 12 RNA processing of RAD50 and EZH2 in depleted cells

Figure 13 U2AF(35)-controlled exon usage in genes encoding components of the shelterin complex

Figure 14 U2AF control of RARA fusion partners

Figure 15 NSE activation in normal tissue and in leukemic cells TABLE 1 U2AF35-dependent transcripts are more common than expected among genes involved in cancer-associated gene fusions and recurrent chromosomal translocations

Gene list downloaded on 2 April 2014. Exon- and gene-level analysis of RNA-Seq data was carried out for 23,263 genes using DEX-Seq and Cufflinks, 2 respectively, as described in detail [30], Number of overlapping genes divided by the expected number of overlapping genes drawn from two independent groups. A representation factor >1 indicates a greater overlap than expected of two independent groups, the value <1 indicates less overlap than expected. P-values were derived by hypergeometric tests.

REFERENCES 1. Wahl MC, Will CL, Luhrmann R. The spliceosome: design principles of a dynamic RNP machine. Cell. 2009; 136(4):701-18. Epub 2009/02/26.doi: S0092-8674(09)00146-9 [pii] 10.1016/j.cell.2009.02.009. PubMed PMID: 19239890. 2. Shcherbakova I, Hoskins AA, Friedman LJ, Serebrov V, Correa IR, Jr., Xu MQ, et al. Alternative spliceosome assembly pathways revealed by single

molecule fluorescence microscopy. Cell Rep. 2013;5(1): 151-65. Epub 2013/10/01.doi: S2211-1247(13)00467-1 [pii] 10.1016/j.celrep.2013.08.026. PubMed PMID: 24075986. 3. Ruskin B, Zamore PD, Green MR. A factor, U2AF, is required for U2 snRNP binding and splicing complex assembly. Cell. 1988;52(2):207-19. PubMed PMID: 2963698. 4. Zamore PD, Green MR. Identification, purification, and biochemical characterization of U2 small nuclear ribonucleoprotein auxiliary factor. Proc Natl Acad Sci USA. 1989;86(23):9243-7. PubMed PMID: 2531895. 5. Zorio DA, Blumenthal T. Both subunits of U2AF recognize the 3' splice site in Caenorhabditis elegans. Nature. 1999;402(6763):835-8. PubMed PMID: 10617207. 6. Merendino L, Guth S, Bilbao D, Martinez C, Valcarcel J. Inhibition of msl-2 splicing by Sex-lethal reveals interaction between U2AF35 and the 3' splice site AG. Nature. 1999;402(6763):838-41. PubMed PMID: 10617208. 7. Wu S, Romfo CM, Nilsen TW, Green MR. Functional recognition of the 3' splice site AG by the splicing factor U2AF35.Nature. 1999;402(6763):832-5. PubMed PMID: 10617206. 8. Guth S, Tange TO, Kellenberger E, Valcarcel J. Dual function for U2AF(35) in AG-dependent pre-mRNA splicing. Mol Cell Biol. 2001;21(22):7673-81. PubMed PMID: 11604503. 9. Fairbrother WG, Yeh RF, Sharp PA, Burge CB. Predictive identification of exonic splicing enhancers in human genes.Science. 2002;297(5583): 1007-13. PubMed PMID: 12114529. 10. Wang Z, Rolish ME, Yeo G, Tung V, Mawson M, Burge CB.Systematic identification and analysis of exonic splicing silencers.Cell. 2004; 119(6):831-45. PubMed PMID: 15607979. 11. Warf MB, Berglund JA. Role of RNA structure in regulating pre-mRNA splicing. Trends Biochem Sci. 2010;35(3): 169-78. Epub 2009/12/05.doi: S0968-0004(09)00196-0 [pii] 10.1016/j.tibs.2009.10.004. PubMed PMID: 19959365. 12. Sun H, Chasin LA. Multiple splicing defects in an intronic false exon. Mol Cell Biol. 2000;20(17):6414-25. PubMed PMID: 10938119. 13. Yoshida K, Ogawa S. Splicing factor mutations and cancer. Wiley Interdiscip Rev RNA. 2014;5(4):445-59. doi: 10.1002/wrna.l222. PubMed PMID: 24523246. 14. Wu JY, Maniatis T. Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell. 1993;75(6): 1061-70. Epub 1993/12/17.doi: 0092-8674(93)90316-1 [pii], PubMed PMID: 8261509. 15. Gozani O, Potashkin J, Reed R. A potential role for U2AF-SAP 155 interactions in recruiting U2 snRNP to the branch site. Mol Cell Biol. 1998; 18(8):4752-60. PubMed PMID: 9671485. 16. Hegele A, Kamburov A, Grossmann A, Sourlis C, Wowro S, Weimann M, et al. Dynamic protein-protein interaction wiring of the human spliceosome. Mol Cell. 2012;45(4):567-80. Epub 2012/03/01.doi: S1097-2765(12)00044-5 [pii] 10.1016/j.molcel.2011.12.034. PubMed PMID: 22365833. 17. Yoshida K, Sanada M, Shiraishi Y, Nowak D, Nagata Y, Yamamoto R, et al. Frequent pathway mutations of splicing machinery in myelodysplasia. Nature. 2011;478(7367):64-9. Epub 2011/09/13.doi: naturel0496 [pii] 10.1038/nature 10496. PubMed PMID: 21909114. 18. Papaemmanuil E, Gerstung M, Malcovati L, Tauro S, Gundem G, Van Loo P, et al. Clinical and biological implications of driver mutations in myelodysplastic syndromes. Blood.2013. Epub 2013/09/14.doi: blood-2013-08-518886 [pii] 10.1182/blood-2013-08-518886. PubMed PMID: 24030381. 19. Przychodzen B, Jerez A, Guinta K, Sekeres MA, Padgett R, Maciejewski JP, et al. Patterns of missplicing due to somatic U2AF1 mutations in myeloid neoplasms. Blood. 2013;122:999-1006. Epub 2013/06/19.doi: blood-2013-01-480970 [pii] 10.1182/blood-2013-01-480970. PubMed PMID: 23775717. 20. Brooks AN, Choi PS, de Waal L, Sharifnia T, Imielinski M, Saksena G, et al. A pan-cancer analysis of transcriptome changes associated with somatic mutations in U2AF1 reveals commonly altered splicing events. PLoS One. 2014;9(l):e87361. Epub 2014/02/06.doi: 10.1371/journal.pone.0087361 PONE-D-13-26905 [pii], PubMed PMID: 24498085. 21. Shirai CL, Ley JN, White BS, Kim S, Tibbitts J, Shao J, et al. Mutant U2AF1 Expression Alters Hematopoiesis and Pre-mRNA Splicing In Vivo. Cancer Cell. 2015;27(5):631-43. doi: 10.1016/j.ccell.2015.04.008. PubMed PMID: 25965570; PubMed Central PMCID: PMC4430854. 22. Colla S, Ong DS, Ogoti Y, Marchesini M, Mistry NA, Clise-Dwyer K, et al. Telomere dysfunction drives aberrant hematopoietic differentiation and myelodysplastic syndrome. Cancer Cell. 2015;27(5):644-57. doi: 10.1016/j.ccell.2015.04.007. PubMed PMID: 25965571. 23. Kim E, Ilagan JO, Liang Y, Daubner GM, Lee SC, Ramakrishnan A, et al. SRSF2 Mutations Contribute to Myelodysplasia by Mutant-Specific Effects on Exon Recognition. Cancer Cell. 2015;27(5):617-30. doi: 10.1016/j.ccell. 2015.04.006. PubMed PMID: 25965569; PubMed Central PMCID: PMC4429920. 24. Buratti E, Chivers MC, Hwang G, Vorechovsky I. DBASS3 and DBASS5: databases of aberrant 3' and 5' splice sites in human disease genes. Nucleic Acids Res. 2011;39:D86-91. 25. Coulombe-Huntington J, Lam KC, Dias C, Majewski J. Fine-Scale Variation and Genetic Determinants of Alternative Splicing across Individuals. PLoS Genet. 2009;5(12):el000766. Epub 2009/12/17.doi: 10.1371/journal.pgen. 1000766. PubMed PMID: 20011102. 26. Graveley BR. The haplo-spliceo-transcriptome: common variations in alternative splicing in the human population.Trends Genet. 2008;24(l):5-7. Epub 2007/12/07.doi: S0168-9525(07)00349-6 [pii] 10.1016/j.tig.2007.10.004. PubMed PMID: 18054116. 27. Gibson G. Hints of hidden heritability in GWAS. Nat Genet. 2010;42(7):558-60. Epub 2010/06/29.doi: ng0710-558 [pii] 10.1038/ng0710-558. PubMed PMID: 20581876. 28. Hunt KA, Mistry V, Bockett NA, Ahmad T, Ban M, Barker JN, et al. Negligible impact of rare autoimmune-locus coding-region variants on missing heritability. Nature. 2013;498(7453):232-5. Epub 2013/05/24.doi: naturel2170 [ρϋ] 10.1038/naturel2170. PubMed PMID: 23698362. 29. Oustric V, Manceau H, Ducamp S, Soaid R, Karim Z, Schmitt C, et al. Antisense oligonucleotide-based therapy in human erythropoietic protoporphyria. Am J Hum Genet. 2014;94(4):611-7. doi: 10.1016/j.ajhg.2014.02.010. PubMed PMID: 24680888; PubMed Central PMCID: PMC3980518. 30. Kralovicova J, Knut M, Cross NC, Vorechovsky I. Identification of U2AF(35)-dependent exons by RNA-Seq reveals a link between 3' splice-site organization and activity of U2AF-related proteins. Nucleic Acids Res. 2015. doi: 10.1093/nar/gkvl94. PubMed PMID: 25779042. 31. Shao C, Yang B, Wu T, Huang J, Tang P, Zhou Y, et al. Mechanisms for U2AF to define 3' splice sites and regulate alternative splicing in the human genome. Nat Struct Mol Biol. 2014;doi: 10.1038/nsmb.2906. 32. Coutinho G, Xie J, Du L, Brusco A, Krainer AR, Gatti RA.Functional significance of a deep intronic mutation in the ATM gene and evidence for an alternative exon 28a. Hum Mutat. 2005;25(2): 118-24. Epub 2005/01/12.doi: 10.1002/humu.20170. PubMed PMID: 15643608. 33. Boutz PL, Bhutkar A, Sharp PA. Detained introns are novel, widespread class of post-transcriptionally spliced introns. Genes Dev. 2015;29:63-80. 34. Smith CW, Chu TT, Nadal-Ginard B. Scanning and competition between AGs are involved in 3' splice site selection in mammalian introns. Mol Cell Biol. 1993; 13(8):4939-52. PubMed PMID: 8336728. 35. Kralovicova J, Vorechovsky I. Allele-dependent recognition of the 3' splice site of INS intron 1. Hum Genet. 2010;128:383-400. 36. Page-McCaw PS, Amonlirdviman K, Sharp PA. PUF60: a novel U2AF65-related splicing activity.RNA. 1999;5(12): 1548-60. PubMed PMID: 10606266. 37. Tavanez JP, Madl T, Kooshapur H, Sattler M, Valcarcel J. hnRNP A1 proofreads 3' splice site recognition by U2AF. Mol Cell. 2012;45(3):314-29. Epub 2012/02/14.doi: S1097-2765(12)00032-9 [pii] 10.1016/j.molcel.2011.11.033. PubMed PMID: 22325350. 38. Bakkenist CJ, Kastan MB. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature. 2003;421(6922):499-506. doi: 10.1038/nature01368. PubMed PMID: 12556884. 39. Matsuoka S, Rotman G, Ogawa A, Shiloh Y, Tamai K, Elledge SJ. Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in vitro. Proc Natl Acad Sci USA. 2000;97:10389-94. 40. Zarnack K, Konig J, Tajnik M, Martincorena I, Eustermann S, Stevant I, et al. Direct competition between hnRNP C and U2AF65 protects the transcriptome from the exonization of Alu elements. Cell. 2013;152(3):453-66. Epub 2013/02/05.doi: S0092-8674(12)01545-0 [pii] 10.1016/j.cell.2012.12.023. PubMed PMID: 23374342. 41. Kralovicova J, Patel A, Searle M, Vorechovsky I. The role of short RNA loops in recognition of a single-hairpin exon derived from a mammalian-wide interspersed repeat. RNA Biol. 2015;12(l):54-69. doi: 10.1080/15476286.2015.1017207. PubMed PMID: 25826413. 42. Shiloh Y, Ziv Y.The ATM protein kinase: regulating the cellular response to genotoxic stress, and more. Nat Rev Mol Cell Biol. 2013; 14(4): 197-210. doi: 10.1038/nrm3546. PubMed PMID: 23486281. 43. Matsuoka S, Ballif BA, Smogorzewska A, McDonald ER, 3rd, Hurov KE, Luo J, et al. ATM and ATR substrate analysis reveals extensive protein networks responsive to DNA damage. Science. 2007;316(5828):1160-6. Epub 2007/05/26.doi: 316/5828/1160 [pii] 10.1126/science. 1140321. PubMed PMID: 17525332. 44. Paz A, Brownstein Z, Ber Y, Bialik S, David E, Sagir D, et al. SPIKE: a database of highly curated human signaling pathways. Nucleic Acids Res. 201 l;39(Database issue):D793-9. doi: 10.1093/nar/gkql 167. PubMed PMID: 21097778; PubMed Central PMCID: PMC3014840. 45. Chen MS, Ryan CE, Piwnica-Worms H. Chkl kinase negatively regulates mitotic function of Cdc25A phosphatase through 14-3-3 binding. Mol Cell Biol. 2003;23(21):7488-97. PubMed PMID: 14559997; PubMed Central PMCID: PMC207598. 46. Pacheco TR, Moita LF, Gomes AQ, Hacohen N, Carmo-Fonseca M. RNA interference knockdown of hU2AF35 impairs cell cycle progression and modulates alternative splicing of Cdc25 transcripts. Mol Biol Cell. 2006; 17(10):4187-99. Epub 2006/07/21 .doi: E06-01-0036 [pii] 10.1091/mbc.E06-01-0036. PubMed PMID: 16855028. 47. Lemaire M, Froment C, Boutros R, Mondesert O, Nebreda AR, Monsarrat B, et al. CDC25B phosphorylation by p38 and MK-2. Cell Cycle. 2006;5(15): 1649-53. PubMed PMID: 16861915. 48. Mirey G, Chartrain I, Froment C, Quaranta M, Bouche JP, Monsarrat B, et al. CDC25B phosphorylated by pEg3 localizes to the centrosome and the spindle poles at mitosis. Cell Cycle. 2005;4(6):806-l 1. PubMed PMID: 15908796. 49. Strausfeld U, Fernandez A, Capony JP, Girard F, Lautredou N, Derancourt J, et al. Activation of p34cdc2 protein kinase by microinjection of human cdc25C into mammalian cells. Requirement for prior phosphorylation of cdc25C by p34cdc2 on sites phosphorylated at mitosis. J Biol Chem. 1994;269(8):5989-6000. PubMed PMID: 8119945. 50. Perdiguero E, Nebreda AR. Regulation of Cdc25C activity during the meiotic G2/M transition. Cell Cycle. 2004;3(6):733-7. PubMed PMID: 15136768. 51. Lee JH, Pauli TT. Activation and regulation of ATM kinase activity in response to DNA double-strand breaks.Oncogene. 2007;26(56):7741-8. Epub 2007/12/11.doi: 1210872 [pii] 10.1038/sj.one.1210872. PubMed PMID: 18066086. 52. Lianoglou S, Garg V, Yang JL, Leslie CS, Mayr C. Ubiquitously transcribed genes use alternative polyadenylation to achieve tissue-specific expression. Genes Dev. 2013;27(21):2380-96. Epub 2013/10/23.doi: gad.229328.113 [pii] 10.1101/gad.229328.113. PubMed PMID: 24145798. 53. Morrison AJ, Kim JA, Person MD, Highland J, Xiao J, Wehr TS, et al. Mecl/Tell phosphorylation of the INO80 chromatin remodeling complex influences DNA damage checkpoint responses.Cell. 2007; 130(3):499-511. doi: 10.1016/j.cell.2007.06.010. PubMed PMID: 17693258. 54. Chambers AL, Ormerod G, Durley SC, Sing TL, Brown GW, Kent NA, et al. The INO80 chromatin remodeling complex prevents polyploidy and maintains normal chromatin structure at centromeres. Genes Dev. 2012;26(23):2590-603. Epub 2012/12/05.doi: 26/23/2590 [pii] 10.1101/gad.199976.112. PubMed PMID: 23207916. 55. Yu EY, Steinberg-Neifach O, Dandjinou AT, Kang F, Morrison AJ, Shen X, et al. Regulation of telomere structure and functions by subunits of the INO80 chromatin remodeling complex. Mol Cell Biol. 2007;27(16):5639-49. doi: 10.1128/MCB.00418-07. PubMed PMID: 17562861; PubMed Central PMCID: PMC1952117. 56. Shen M, Haggblom C, Vogt M, Hunter T, Lu KP. Characterization and cell cycle regulation of the related human telomeric proteins Pin2 and TRF1 suggest a role in mitosis. Proc Natl Acad Sci USA. 1997;94(25): 13618-23. PubMed PMID: 9391075, PubMed Central PMCID: PMC28355. 57. Wu Y, Xiao S, Zhu XD. MRE11-RAD50-NBS1 and ATM function as comediators of TRF1 in telomere length control. Nat Struct Mol Biol. 2007;14(9):832-40. doi: 10.1038/nsmbl286. PubMed PMID: 17694070. 58. Kaminker PG, Kim SH, Desprez PY, Campisi J. A novel form of the telomere-associated protein TIN2 localizes to the nuclear matrix. Cell Cycle. 2009;8(6):931-9. PubMed PMID: 19229133; PubMed Central PMCID: PMC2751576. 59. Yang S, Kuo C, Bisi JE, Kim MK. PML-dependent apoptosis after DNA damage is regulated by the checkpoint kinase hCdsl/Chk2. Nat Cell Biol. 2002;4(11):865-70. doi: 10.1038/ncb869. PubMed PMID: 12402044. 60. Yang S, Jeong JH, Brown AL, Lee CH, Pandolfi PP, Chung JH, et al.

Promyelocytic leukemia activates Chk2 by mediating Chk2 autophosphorylation. J Biol Chem. 2006;281(36):26645-54. doi: 10.1074/jbc.M604391200. PubMed PMID: 16835227. 61. Nisole S, Maroui MA, Mascle XH, Aubry M, Chelbi-Alix MK. Differential Roles of PML Isoforms. Front Oncol. 2013;3:125. doi: 10.3389/fonc.2013.00125. PubMed PMID: 23734343; PubMed Central PMCID: PMC3660695. 62. El Bougrini J, Dianoux L, Chelbi-Alix MK. PML positively regulates interferon gamma signaling. Biochimie. 2011;93(3):389-98. doi: 10.1016/j.biochi.2010.11.005. PubMed PMID: 21115099. 63. Nguyen LA, Pandolfi PP, Aikawa Y, Tagata Y, Ohki M, Kitabayashi I. Physical and functional link of the leukemia-associated factors AML1 and PML.Blood. 2005; 105( 1):292-300. doi: 10.1182/blood-2004-03-l 185. PubMed PMID: 15331439. 64. Reineke EL, Lam M, Liu Q, Liu Y, Stanya KJ, Chang KS, et al. Degradation of the tumor suppressor PML by Pinl contributes to the cancer phenotype of breast cancer MDA-MB-231 cells. Mol Cell Biol. 2008;28(3):997-1006. doi: 10.1128/MCB.01848-07. PubMed PMID: 18039859; PubMed Central PMCID: PMC2223389. 65. Litchfield DW, Shilton BH, Brandi CJ, Gyenis L. Pinl: Intimate involvement with the regulatory protein kinase networks in the global phosphorylation landscape. Biochim Biophys Acta. 2015. doi: 10.1016/j.bbagen.2015.02.018. PubMed PMID: 25766872. 66. Corey SJ, Locker J, Oliveri DR, Shekhter-Levin S, Redner RL, Penchansky L, et al. A non-classical translocation involving 17ql2 (retinoic acid receptor alpha) in acute promyelocytic leukemia (APML) with atypical features.Leukemia. 1994;8(8): 1350-3. PubMed PMID: 8057672. 67. Yamamoto Y, Tsuzuki S, Tsuzuki M, Handa K, Inaguma Y, Emi N. BCOR as a novel fusion partner of retinoic acid receptor alpha in a t(X;17)(pl l;ql2) variant of acute promyelocytic leukemia. Blood. 2010; 116(20):4274-83. doi: 10.1182/blood-2010-01-264432. PubMed PMID: 20807888. 68. Huynh KD, Fischle W, Verdin E, Bardwell VJ. BCoR, a novel corepressor involved in BCL-6 repression. Genes Dev. 2000;14(14):1810-23. PubMed PMID: 10898795; PubMed Central PMCID: PMC316791. 69. Kim P, Yoon S, Kim N, Lee S, Ko M, Lee H, et al. ChimerDB 2.0—a knowledgebase for fusion genes updated. Nucleic Acids Res. 2009;38(Database issue):D81-5. Epub 2009/11/13.doi: gkp982 [pii] 10.1093/nar/gkp982. PubMed PMID: 19906715. 70. Mitelman F, Johansson B, Mertens F. The impact of translocations and gene fusions on cancer causation.Nat Rev Cancer. 2007;7(4):233-45. Epub 2007/03/16.doi: nrc2091 [pii] 10.1038/nrc2091. PubMed PMID: 17361217. 71. Stankovic T, Weber P, Stewart G, Bedenham T, Murray J, Byrd PJ, et al. Inactivation of ataxia telangiectasia mutated gene in B-cell chronic lymphocytic leukaemia. Lancet. 1999;353(9146):26-9. doi: 10.1016/S0140-6736(98)10117-4. PubMed PMID: 10023947. 72. Lee J, Sung CO, Lee EJ, Do I-G, Kim H-C, Yoon SH, et al. Metastasis of neuroendocrine tumors are characterized by increased cell proliferation and reduced expression of the ATM gene. PLoS ONE. 2012;7:e34456. 73. Yuan X, Kuramitsu Y, Furumoto H, Zhang X, Hayashi E, Fujimoto M, et al. Nuclear protein profiling of Jurkat cells during heat stress-induced apoptosis by 2-DE and MS/MS. Electrophoresis. 2007;28(12):2018-26. doi: 10.1002/elps.200600821. PubMed PMID: 17523140. 74. Burns CG, Gould KL. Connections between pre-mRNA processing and regulation of the eukaryotic cell cycle. Front Horm Res. 1999;25:59-82. 75. Blencowe BJ. Splicing regulation: the cell cycle connection. Curr Biol. 2003; 13(4):R 149-51. PubMed PMID: 12593819. 76. Montecucco A, Biamonti G. Pre-mRNA processing factors meet the DNA damage response. Front Genet. 2013;4:102. doi: 10.3389/fgene.2013.00102. PubMed PMID: 23761808; PubMed Central PMCID: PMC3674313. 77. Dutertre M, Lambert S, Carreira A, Amor-Gueret M, Vagner S. DNA damage: RNA-binding proteins protect from near and far. Trends Biochem Sci. 2014;39(3): 141-9. Epub 2014/02/19.doi: S0968-0004(14)00015-2 [pii] 10.1016/j.tibs.2014.01.003. PubMed PMID: 24534650. 78. Romero PR, Zaidi S, Fang YY, Uversky VN, Radivojac P, Oldfield CJ, et al. Alternative splicing in concert with protein intrinsic disorder enables increased functional diversity in multicellular organisms. Proc Natl Acad Sci USA. 2006; 103(22):8390-5. Epub 2006/05/24.doi: 0507916103 [pii] 10.1073/pnas.0507916103. PubMed PMID: 16717195. 79. Stamm S. Regulation of alternative splicing by reversible protein phosphorylation. J Biol Chem. 2008;283(3):1223-7. PubMed PMID: 18024427. 80. Choi HH, Choi HK, Jung S-Y, Hyle J, Kim B-J, Yoon K, et al. CHK2 kinase promotes pre-mRNA splicing via phosphorylating CDKllpllO. Oncogene. 2014;33:108-15. 81. Beli P, Lukashchuk N, Wagner SA, Weinert BT, Olsen JV, Baskcomb L, et al. Proteomic investigations reveal a role for RNA processing factor THRAP3 in the DNA damage response. Mol Cell. 2012;46(2):212-25. doi: 10.1016/j.molcel.2012.01.026. PubMed PMID: 22424773; PubMed Central PMCID: PMC3565437. 82. Gutell RR, Cannone JJ, Shang Z, Du Y, Serra MJ. A story: unpaired adenosine bases in ribosomal RNAs. J Mol Biol. 2000;304(3):335-54. Epub 2000/11/25.doi: 10.1006/jmbi.2000.4172 S0022-2836(00)94172-X [pii], PubMed PMID: 11090278. 83. Kim J, Chung IK. The splicing factor U2AF65 stabilizes TRF1 protein by inhibiting its ubiquitin-dependent proteolysis. Biochem Biophys Res Commun. 2014;443(3): 1124-30. doi: 10.1016/j bbrc.2013.12.118. PubMed PMID: 24389012. 84. Ferreira PG, Jares P, Rico D, Gomez-Lopez G, Martinez-Trillos A, Villamor N, et al. Transcriptome characterization by RNA sequencing identifies a major molecular and clinical subdivision in chronic lymphocytic leukemia. Genome Res. 2014;24:212-26. 85. Taylor AM, Lam Z, Last JI, Byrd PJ. Ataxia telangiectasia: more variation at clinical and cellular levels. Clin Genet. 2015;87(3): 199-208. doi: 10.1111/cge. 12453. PubMed PMID: 25040471. 86. Scott SP, Bendix R, Chen P, Dork T, Lavin MF. Missense mutations but not allelic variants alter the function of ATM by dominant interference in patients with breast cancer. Proc Natl Acad Sci USA. 2002;99:925-30. 87. Aizer AA, Wilhite TJ, Chen M-H, Graham PL, Choueiri TK, Hoffman KE, et al. Lack of reduction in racial disparities in cancer-specific mortality over a 20-year period. Cancer. 2014;120:1532-9. 88. Shirley MH, Sayeed S, Barnes I, Finlayson A, Ali R. Incidence of haematological malignancies by ethnic group in England, 2001-7. Br J Haematol. 2013; 163(4):465-77. doi: 10.1111/bjh. 12562. PubMed PMID: 24033296. 89. Taylor AM, Metcalfe JA, Thick J, Mak YF. Leukemia and lymphoma in ataxia telangiectasia.Blood. 1996;87(2):423-38. PubMed PMID: 8555463. 90. Ruchlemer R, Polliack A. Geography, ethnicity and "roots" in chronic lymphocytic leukemia. Leuk Lymphoma. 2013;54(6): 1142-50. doi: 10.3109/10428194.2012.740670. PubMed PMID: 23121522. 91. Kawamata N, Moreilhon C, Saitoh T, Karasawa M, Bernstein BK, Sato-Otsubo A, et al. Genetic differences between Asian and Caucasian chronic lymphocytic leukemia. Int J Oncol. 2013;43(2):561-5. doi: 10.3892/ijo.2013.1966. PubMed PMID: 23708256; PubMed Central PMCID: PMC3775563. 92. Suarez F, Mahlaoui N, Canioni D, Andriamanga C, Dubois d'Enghien C, Brousse N, et al. Incidence, presentation, and prognosis of malignancies in ataxia-telangiectasia: a report from the French national registry of primary immune deficiencies. J Clin Oncol. 2015;33(2):202-8. doi: 10.1200/JCO.2014.56.5101. PubMed PMID: 25488969. 93. Soo RA, Loh M, Mok TS, Ou S-H, Cho B-C, Yeo W-L, et al. Ethnic differences in survival outcome in patients with advanced stage non-small cell lung cancer. J Thorac Oncol. 2011;6:1030-8. 94. Magi-Galuzzi C, Tsusuki T, Elson P, Simmerman K, LaFargue C, Esgueva R, et al. TMPRSS2-ERG gene fusion prevalence and class are significantly difference in prostate cancer of Caucasian, African-American and Japanese patients. The Prostate. 2011;71:489-97. 95. Bethke L, Webb E, Murray A, Schoemaker M, Johansen C, Christensen HC, et al. Comprehensive analysis of the role of DNA repair gene polymorphisms on risk of glioma. Hum Mol Genet. 2008; 17(6):800-5. Epub 2007/12/01.doi: ddm351 [pii] 10.1093/hmg/ddm351. PubMed PMID: 18048407. 96. Bonnen PE, Story MD, Ashorn CL, Buchholz TA, Weil MM, Nelson DL. Haplotypes at ATM identify coding-sequence variation and indicate a region of extensive linkage disequilibrium. Am J Hum Genet. 2000;67(6): 1437-51. Epub 2000/11/15.doi: S0002-9297(07)63213-3 [pii] 10.1086/316908. PubMed PMID: 11078475. 97. Rudd MF, Sellick GS, Webb EL, Catovsky D, Houlston RS. Variants in the ATM-BRCA2-CHEK2 axis predispose to chronic lymphocytic leukemia. Blood. 2006; 108(2):638-44. Epub 2006/04/01.doi: 2005-12-5022 [pii] 10.1182/blood-2005-12-5022. PubMed PMID: 16574953. 98. He Y-H, Lu X, Yang L-Q, Xu L-Y, Kong Q-P. Association of the insulin-like growth factor binding protein 3 (IGFBP-3) polymorphism with longevity in Chinese nonagenarians and centenarians. Aging (Milano). 2014;6:944-56. 99. Chen T, Dong B, Lu Z, Tian B, Zhang J, Zhou J, et al. A functional single nucleotide polymorphism in promoter of ATM is associated with longevity. Mech Ageing Dev. 2010;131:636-40. 100. Piaceri I, Bagnoli S, Tedde A, Sorbi S, Nacmias B. Ataxia-telangiectasia mutated (ATM) genetic variant in Italian centenarians. Neurophysiology. 2013;34:573-5. 101. Xia Y, Fan L, Wang L, Gale RP, Wang M, Tian T, et al. Frequencies of SF3B1, NOTCH 1, MYD88, BIRC3 and IGHV mutations and TP53 disruptions in Chinese with chronic lymphocytic leukemia: disparities with Europeans. Oncotarget. 2015;6(7):5426-34. PubMed PMID: 25605254. 102. Anders S, Reyes A, Huber W. Detecting differential usage of exons from RNA-seq data. Genome Res. 2012;22(10):2008-17. Epub 2012/06/23.doi: gr. 133744.Ill [pii] 10.1101 /gr. 133744.111. PubMed PMID: 22722343. 103. Pellagatti A, Cazzola M, Giagounidis A, Perry J, Malcovati L, Della Porta MG, et al. Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells. Leukemia. 2010;24(4):756-64. doi: 10.1038/leu.2010.31. PubMed PMID: 20220779. 104. Makishima H, Visconte V, Sakaguchi H, Jankowska AM, Abu Kar S, Jerez A, et al. Mutations in the spliceosome machinery, a novel and ubiquitous pathway in leukemogenesis. Blood. 2012; 119(14):3203-10 Epub 2012/02/11. doi: blood-2011-12-399774 [pii] 10.1182/blood-2011-12-399774. PubMed PMID: 22323480. 105. Hua Y, Vickers TA, Baker BF, Bennett CF, Krainer AR. Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon. PLoS Biol. 2007;5(4):e73. Epub 2007/03/16.doi: 06-PLBI-RA-1492R3 [pii] 10.1371/journal.pbio.0050073. PubMed PMID: 17355180. 106. Kralovicova J, Lages A, Patel A, Dhir A, Buratti E, Searle MS, et al. Optimal antisense target reducing INS intron 1 retention is adjacent to a parallel G quadruplex. Nucleic Acids Res. 2014;42:8161-73. 107. Du L, Pollard JM, Gatti RA.Correction of prototypic ATM splicing mutations and aberrant ATM function with antisense morpholino oligonucleotides. Proc Natl Acad Sci USA. 2007; 104(14):6007-12. Epub 2007/03/29.doi: 0608616104 [pii] 10.1073/pnas.0608616104. PubMed PMID: 17389389. 108. Pastor F, Kolonias D, Giangrande PH, Gilboa E. Induction of tumour immunity by targeted inhibition of nonsense-mediated mRNA decay. Nature. 2010;465(7295):227-30. doi: 10.1038/nature08999. PubMed PMID: 20463739; PubMed Central PMCID: PMC3107067. 109. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 2012;7(3):562-78. Epub 2012/03/03.doi: nprot.2012.016 [pii] 10.1038/nprot.2012.016. PubMed PMID: 22383036. 110. Kralovicova J, Houngninou-Molango S, Kramer A, Vorechovsky I. Branch sites haplotypes that control alternative splicing. Hum Mol Genet. 2004;13:3189-202. 111. Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003 ;31 (13):3406-15. Epub 2003/06/26. PubMed PMID: 12824337. 112. Consortium.TGP.An integrated map of genetic variation from 1,092 human genomes.Nature (London). 2012;491:56-65. 113. Pacheco TR, Gomes AQ, Barbosa-Morais NL, Benes V, Ansorge W, Wollerton M, et al. Diversity of vertebrate splicing factor U2AF35: identification of alternatively spliced U2AF1 mRNAS. J Biol Chem. 2004;279(26):27039-49. Epub 2004/04/21 .doi: 10.1074/jbc.M402136200 M402136200 [pii], PubMed PMID: 15096518.

REFERENCES TO SUPPORTING INFORMATION 1. Kralovicova J, Haixin L, Vorechovsky I. Phenotypic consequences of branchpoint substitutions. Hum Mutat. 2006;27(8):803-13. 2. Pacheco TR, Moita LF, Gomes AQ, Hacohen N, Carmo-Fonseca M. RNA interference knockdown of hU2AF35 impairs cell cycle progression and modulates alternative splicing of Cdc25 transcripts. Mol Biol Cell. 2006; 17(10):4187-99. Epub 2006/07/21.doi: E06-01-0036 [pii] 10.1091/mbc.E06-01-0036. PubMed PMID: 16855028. 3. Kralovicova J, Lages A, Patel A, Dhir A, Buratti E, Searle MS, et al. Optimal antisense target reducing INS intron 1 retention is adjacent to a parallel G quadruplex. Nucleic Acids Res. 2014;42:8161-73. 4. Kralovicova J, Patel A, Searle M, Vorechovsky I. The role of short RNA loops in recognition of a single-hairpin exon derived from a mammalian-wide interspersed repeat. RNA Biol. 2015; 12(1):54-69. doi: 10.1080/15476286.2015.1017207. PubMed PMID: 25826413. 5. Pacheco TR, Gomes AQ, Barbosa-Morais NL, Benes V, Ansorge W, Wollerton M, et al. Diversity of vertebrate splicing factor U2AF35: identification of alternatively spliced U2AF1 mRNAS. J Biol Chem. 2004;279(26):27039-49. Epub 2004/04/21.doi: 10.1074/jbc.M402136200 M402136200 [pii], PubMed PMID: 15096518. 6. Hastings ML, Allemand E, Duelli DM, Myers MP, Krainer AR. Control of pre-mRNA splicing by the general splicing factors PUF60 and U2AF. PLoS ONE. 2007;2:e538. PubMed PMID: 17579712. 7. Kralovicova J, Vorechovsky I. Allele-dependent recognition of the 3' splice site of INS intron 1. Hum Genet. 2010;128:383-400. 8. Mendell JT, ap Rhys CM, Dietz HC. Separable roles for rentl/hUpfl in altered splicing and decay of nonsense transcripts. Science. 2002;298(5592):419-22. Epub 2002/09/14.doi: 10.1126/science. 1074428 1074428 [pii], PubMed PMID: 12228722. 9. Consortium.TGP.An integrated map of genetic variation from 1,092 human genomes.Nature (London). 2012;491:56-65. 10. Wang Z, Rolish ME, Yeo G, Tung V, Mawson M, Burge CB.Systematic identification and analysis of exonic splicing silencers.Cell. 2004;119(6):831-45. PubMed PMID: 15607979. 11. Zhang XH, Chasin LA.Computational definition of sequence motifs governing constitutive exon splicing. Genes Dev. 2004;18:1241-50. PubMed PMID: 15145827. 12. Fairbrother WG, Yeh RF, Sharp PA, Burge CB. Predictive identification of exonic splicing enhancers in human genes.Science. 2002;297(5583): 1007-13. PubMed PMID: 12114529. 13. Smith PJ, Zhang C, Wang J, Chew SL, Zhang MQ, Krainer AR. An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum Mol Genet. 2006;15(16):2490-508. PubMed PMID: 16825284. 14. Zhang C, Li WH, Krainer AR, Zhang MQ.RNA landscape of evolution for optimal exon and intron discrimination. Proc Natl Acad Sci USA. 2008; 105(15):5797-802. Epub 2008/04/09.doi: 0801692105 [pii] 10.1073/pnas.0801692105. PubMed PMID: 18391195. 15. Divina P, Kvitkovicova A, Vorechovsky I. Ab initio prediction of cryptic splice-site activation and exon skipping. Eur J Hum Genet. 2009;17:759-65. 16. Corvelo A, Hallegger M, Smith CW, Eyras E. Genome-wide association between branch point properties and alternative splicing. PLoS Comput Biol. 2010;6(1 l):el001016. Epub 2010/12/03.doi: 10.1371/journal.pcbi. 1001016. PubMed PMID: 21124863. 17. Przychodzen B, Jerez A, Guinta K, Sekeres MA, Padgett R, Maciejewski JP, et al. Patterns of missplicing due to somatic U2AF1 mutations in myeloid neoplasms. Blood. 2013;122:999-1006. Epub 2013/06/19.doi: blood-2013-01-480970 [pii] 10.1182/blood-2013-01-480970. PubMed PMID: 23775717. 18. Paz A, Brownstein Z, Ber Y, Bialik S, David E, Sagir D, et al. SPIKE: a database of highly curated human signaling pathways. Nucleic Acids Res. 201 l;39(Database issue):D793-9. doi: 10.1093/nar/gkql 167. PubMed PMID: 21097778; PubMed Central PMCID: PMC3014840. 19. Kralovicova J, Houngninou-Molango S, Kramer A, Vorechovsky I. Branch sites haplotypes that control alternative splicing. Hum Mol Genet. 2004;13:3189-202.

Claims

1. A method of screening a subject for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a nonthymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency.

2. A method of selecting a subject for treatment, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.

3. The method according to claim 2 further comprising administering the agent for treatment of the selected subject.

4. The method according to claim 2 or claim 3, wherein the agent comprises a NSE repressor agent.

5. A method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.

6. A method of treatment or prevention of a condition associated with a functional-ATM protein deficiency, comprising the administration of a NSE repressor agent arranged to increase levels of functional ATM protein, wherein the agent is arranged to bind to a NSE in ATM intron 28 of the pre-mRNA transcript to decrease inclusion of the NSE in the mature RNA transcript.

7. The method according to claim 6, wherein decreasing inclusion of the NSE in the mature RNA transcript provides an increase in functional ATM protein expression.

8. The method according to any of claims 5 to 7, wherein the method of treatment or prevention of functional-ATM protein deficiency in a subject or an at-risk population of subjects is for treatment or prevention of a condition associated with functional-ATM protein deficiency.

9. The method according to claim 8, wherein the condition is ataxia-telangiectasia; cancer; immune deficiency; cellular radiosensitivity; or chromosomal instability.

10. The method according to any preceding claim, wherein the NSE comprises the sequence TCTACAGGTTGGCTGCATAGAAGAAAAAG.

11. The method according to any of clams 4 to 10, wherein the NSE repressor agent is arranged to bind to NSE within the sequence agTCT AC AGGTTGGCTGCATAGAAGA AAAAGgtagag; or tcttagTCT AC AGGTT GGCTGC AT AGAAGA A A A AGgtagag; or tctcaglCT AC AGGTT GGCTGC AT AGAAGA A A A AGgtagag.

12. The method according to any of claims 4 to 10, wherein the NSE repressor agent is arranged to bind to the NSE or its 5’ or 3’ splice site in ATM intron 28.

13. A method of treatment or prevention of a condition associated with deregulation of ATM expression in a subject comprising the administration of a NSE-activator agent, wherein the NSE-activator agent is arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcript or binding to a U2AF65 binding site upstream of the pseudoexon.

14. A method of treatment or prevention of cancer in a subject comprising the administration of a NSE-activator agent arranged to increase a cancer cell’s susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy, wherein the NSE-activator agent is arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcript or binding to a U2AF65 binding site upstream of the pseudoexon; and treating the subject with the cytotoxic therapy, such as radiotherapy or chemotherapy.

15. The method according to claim 13 or claim 14, wherein increasing inclusion of the NSE in the mature RNA transcript provides a decrease in functional ATM protein expression.

16. The method according to any of claims 13 to 15, wherein the pseudoexon comprises the sequence TCATCGAATACTTTTGGAAATAAG.

17. A method of increasing a cell’s susceptibility to cytotoxic therapy with DNA damaging agents such as radiotherapy comprising the reduction of ATM protein expression by administration of a NSE-activator agent arranged to increase NSE inclusion in ATM mature RNA transcript by binding to motifs in ATM intron 28 that compete with NSE for spliceosomal components, wherein such motifs comprise a 24 nucleotide pseudoexon (PE) located 3’ of NSE in ATM intron 28 of the pre-mRNA transcript or binding to a U2AF65 binding site upstream of the pseudoexon.

18. A method of tailoring functional ATM expression in a subject, cell or tissue, comprising the administration of a NSE-activator agent and/or a NSE-repressor agent described herein.

19. The method according to any preceding claim, wherein the NSE repressor agent and/or NSE activator agent comprise a polynucleic acid polymer.

20. The method according to any preceding claim, wherein the NSE repressor agent and/or NSE activator agent is an SSO (Splice Switching Oligonucleotide).

21. The method according to any preceding claim, wherein the NSE repressor agent and/or NSE activator agent is associated with a delivery vehicle suitable for delivering the NSE repressor agent and/or NSE activator agent to cells.

22. The method according to any of claims 4 to 12 or 18 to 21, wherein the NSE repressor agent comprises: an SSO of the sequence CUUCUAUGCAGCCAACCUGUAGACU (SSO -NSE3), or a nucleic acid analogue thereof; or an SSO of the sequence ACCUUUUUCUUCUAUGCAGCCAAC (SSO -NSE5), or a nucleic acid analogue thereof; or the SSO PEkr/PEdel.

23. Use of rs609261 and/or rs4988000 genotyping to predict a subject’s response to therapy for conditions associated with ATM deregulation.

24. A composition comprising the NSE repressor agent and/or the NSE activator agent described herein.

25. The composition according to claim 24, wherein the composition is a pharmaceutically acceptable formulation.

26. A method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome, wherein the presence of a non-thymine variant residue rs609261 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue.

27. A method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a non-thymine variant residue rs609261 located at position -3 relative to the 3’ splice site of NSE (cryptic exon in ATM intron 28) of the human genome with a thymine residue.

28. The method according to claim 26 or claim 27, wherein replacing the nonthymine variant residue rs609261 comprises administration of an agent to the subject, which is arranged to replace the non-thymine variant residue rs609261 with a thymine residue.

29. The method according to any of claims 26 to 28, wherein the agent for replacement of the non-thymine residue is a genomic editing molecule.

30. The method according to any of claims 26 to 29, wherein the agent for replacement of the non-thymine residue is CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs609261.

31. A method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with adenine.

32. A method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising replacing a guanine variant residue at rs4988000 of the human genome with an adenine residue; or blocking the guanine residue by the binding of an SSO.

33. The method according to claim 31 or claim 32, wherein replacing the guanine variant residue at rs4988000 comprises administration of an agent to the subject, which is arranged to replace the guanine variant residue at rs4988000 with an adenine residue.

34. The method according to any of claims 31 to 33, wherein the agent for replacement of the guanine residue is a genomic editing molecule.

35. The method according to any of claims 31 to 34, wherein the agent for replacement of the guanine residue is CRISPR-Cas9, or a functional equivalent thereof, together with an appropriate RNA molecule arranged to target rs4988000.

36. A method of screening a subject or a population of subjects for susceptibility to functional-ATM protein deficiency, wherein the screening comprises determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject (or group of subjects) has, or is susceptible to, functional-ATM protein deficiency.

37. A method of selecting a subject or a population of subjects for treatment or prophylaxis, wherein the subject is susceptible to functional-ATM protein deficiency, the method comprising determining the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and selecting such subject for treatment with an agent arranged to increase functional-ATM levels in the subject.

38. A method of treatment or prevention of functional-ATM protein deficiency in a subject, the method comprising identifying the presence of a guanine variant residue at rs4988000 of the human genome, wherein the presence of a guanine variant residue at rs4988000 indicates that the subject has, or is susceptible to, functional-ATM protein deficiency, and administration of an agent to the subject, which is arranged to increase functional-ATM levels.

39. The method of any one of claims 26-30 and any one of claims 31-38 in combination to modify a CG haplotype to TA.

40. The method of claim 1 and claim 36 in combination to identify a CG haplotype in a subject, and optionally treat or select the patient for treatment according to any preceding claim.

41. A method of modifying regulation of NSE inclusion in a mature RNA transcript, the method comprising the insertion or deletion of one or more splicing regulatory motifs upstream or downstream of the NSEs that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudo-exons.

42. A method of modifying regulation of a functional protein expression, wherein the functional protein expression is regulated by NSE inclusion in a mature RNA transcript of the gene encoding protein, the method comprising the insertion or deletion of one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for spliceosomal components, said regulatory motifs comprising cryptic splice sites or pseudoexons.

43. The method according to claim 41 or 42, wherein the insertion or deletion of one or more splicing regulatory motifs is in genomic DNA of ATM intron 28.

44. The method according to any of claims 41 to 43, wherein insertion of one or more splicing regulatory motifs causes a reduction in NSE inclusion in the mature RNA transcript.

45. The method according to any of claims 41 to 43, wherein the deletion of one or more splicing regulatory motifs causes an increase in NSE inclusion in the mature RNA transcript.

46. The method according to any one of claims 41 to 45, wherein the insertion or deletion of one or more splicing regulatory motifs comprises the use of genome editing technology, such as CRISPR-Cas9.

47. A kit comprising one or more oligonucleotide probes for identifying rs609261 and/orrs4988000 variants.

48. The kit according to claim 47, wherein the oligonucleotide probes are primers for use to PCR amplify regions of nucleic acid comprising rs609261 and/orrs4988000.

49. A vector comprising nucleic acid encoding the NSE activating agent and/or NSE repressor agent.

50. A method of screening for an agent capable of modifying regulation of a gene’s expression comprising: identifying a nonsense-mediated RNA decay switch exon (NSE) that limits functional gene expression; identifying one or more splicing regulatory motifs upstream or downstream of the NSE that compete with the NSE for splisomal components, said regulatory motifs comprising cryptic splice sites or pseudoexons; targeting the one or more splicing regulatory motifs with antisense polynucleic acid arranged to hybridize to the splicing regulatory motifs through Watson-Crick base pairing; and determining if there is an increased or decreased inclusion of the NSE in a mature RNA transcript of the gene.

51. A method of modulating gene’s expression comprising providing an agent arranged to bind to splicing regulatory motifs, such as cryptic splice sites or pseudoexons, that compete with a nonsense-mediated RNA decay switch exon (NSE) for spliceosomal components.

52. An agent arranged to bind to a gene splicing regulatory motif, such as a cryptic splice site or a pseudoexon, that competes with a nonsense-mediated RNA decay switch exon (NSE) for spliceosomal components, wherein the splicing regulatory motif controls inclusion of the NSE into a mature RNA transcript of the gene.

53. A method, use, composition, vector, or agent substantially described herein, optionally with reference to the accompanying figures.