GB2519828A - Formulation with immuno-stimulant/adjuvant activity - Google Patents

Abstract

A formulation with immune-stimulant/adjuvant activity comprising (-)-alpinone, dimethyl sulfoxide (DMSO) and saline solution. The formulation may be used as a vaccine for vertebrates, such as those of a salmonid species. The (-)-alpinone active may be obtained from the resinous exudates from the plant species Heliotropium huascoense and can induce maturation in dendritic cells, corresponding to the first stages of induction of the immune system in higher vertebrates.

Description

Intellectual Property Office Application No. GB1410879.9 RTN4 Date:24 February 2015 The following terms are registered trade marks and should be read as such wherever they occur in this document: SYBR (registered) Tween (registered) Span (registered) Maxisorp (registered) Intellectual Property Office is an operating name of the Patent Office www.gov.uk/ipo

I

FORMULATION WITH I MMUNO-STIMULANT/ADJUVANT ACTIVITY

SPECIFICATION

FIELD OF THE INVENTION

The purpose of the present invention is to provide a formulation containing an active principle with immuno-stimulant/adjuvant activities obtained from the resinous exudate from the plant species Heliotropium huascoense, and being useful in salmonid species in order to increase the immunogenicity of an antigen and/or the components from a vaccine.

BACKGROUND OF THE INVENTION

Industry of salmon and health challenges: During the last years, Chile has developed a very important industry of aquaculture of salmon. In 1994, the exports of salmon products went up to US$ 349 millions. After a decade, this figure was seven times higher, and in 2007, reached up to US$ 2.207 billions. Today, salmon is one of the most important export industries in Chile, with a quota of 10.8% on exports. This industry constitutes a crucial element for the diversification of national economy, and is one of the pillars of the strategy to make of Chile a powerful food producer (SalmonChile, 2010).

In general, fish farming is constantly exposed to attacks from several infectious diseases due to the extreme production conditions, causing the growth of microorganisms to easily spread and to represent a difficult problem to control. There is a variety of infectious diseases affecting fish farming and representing the main cause of death. Diseases can be caused by viruses, bacteria, parasites, and fungi, and cause important production losses every year. Decrease in salmon exports in 2009 was caused by an outbreak of viral diseases. According to the Monthly Report on Foreign Trade (Informe Mensual de Comercio Exterior) produced by the National Customs Service (Servicio Nacional de Aduanas), the shipments amounting for the 55% of the fishing and aquaculture, decreased 17% in 2009 (SalmonChile, 2010).

Globalization of world markets has meant for Chile, a country free of many diseases affecting animal production for many years, not to have this advantage anymore, and to have its ability to attain high competitiveness jeopardized.

The many diseases set and spread on cultured salmon in the South of Chile, which in some cases have become endemic pathologies, include Bacterial Kidney Disease (BKD), Salmonid Rickettsial Syndrome (SRS), and Enteric Red Mouth Disease (ERM). Those pathologies are likely to have arrived to this country through ova import, from which Chile was dependent in an almost exclusive way in the past, when requirements for admission were not as hard (Pinto, 2003). During the last years, other diseases caused mainly by bacteria such as Vibriosis, Estreptocosis, and atypical Furunculosis, and by parasites such as Diphyllobothrium sp., causing amoebic gill disease (Torres, 2000) and Caligus, a parasite causing wounds and stress to fish, weakening their defenses, and leaving them susceptible to the attack of other pathogen microorganisms such as bacteria and viruses, have appeared. Among the viral infectious agents affecting salmonids are the infectious pancreatic necrosis virus (IPNV), which is a birnavirus (family Birnaviridae) (Dobos et al., 1979), and the virus of most incidence around the world (Wolf, 1988). This virus has been detected in the majority of the salmon production centers around the world, including Chile (Wolf, 1988;. Hill, and Way, 1995). IPNV affects mainly young fish (babies and fry), causing a great deal of mortality (Wolf, 1988, lmajoh et al., 2005), although it also infects more developed fish. The outbreak of infectious diseases in salmon is one of the main problems of fish farming centers since they do not have closed, controlled spaces allowing to prevent pathogens from easily spreading in lakes and the sea.

Due to its environmental and commercial importance, much effort has been put in studies associated with the infectious pancreatic necrosis virus (IPNV), and the search for antiviral compounds (Saint-Jean et al., 2003). Now there are vaccines that help to prevent being infected by the IPN virus (Christie, 2004; Salgado Miranda, 2006), but the inoculation of fry fails to produce the expected responses as their immune system is immature. On the other hand, there are some antiviral compounds that inhibit the replication of cell cultures, for example, ribavirin and 5-ethynyl-143-D-ribofuransulimidazole-4-carboxamide (EICAR) (Migus and Dobos, 1980; Jashes et al., 1996; Jashes et al., 2000). Ribavirin, however, has not had good results in essays carried out in vivo (Somogyi and Dobos, 1980), and the mortality of fish is decreased by EICAR, but it is not stable in water (Moya et al., 2000).

Another infectious disease significantly affecting salmon farms is caused by the infectious salmon anemia virus (ISA virus), discovered in Norway in 1984 (Thorud and Djupvik, 1988). This agent has been a problem for salmon aquaculture in the North hemisphere, including Norway, Canada, Scotland, Faroe Islands, and The United States, and the high mortality rates got to include almost all the production in the case of Norway (Mjaaland et al., 1997). In Chile, ISA virus was registered for the first time in 2001, but unlike the case of the North hemisphere countries, was not associated to high mortality and losses at the moment (Kibenge et al., 2001). In 2007, however, the ISA virus started to devastate the Chilean salmon up to a loss of 40% of the national production.

Nowadays, diseases affecting salmon are prevented mainly through health management practices, the use of authorized vaccines and/or the selection of healthy breeding fish. Treatments used must be prescribed by a veterinarian, and only the drugs registered for their use in aquatic species can be used (Sandoval, 2004). The great losses caused by this type of infectious diseases lead to searching for solutions that should control somehow their progress. On the other hand, a prophylactic treatment with antibiotics aimed at preventing bacterial infections in highly susceptible fish is used. Treatment with antibiotics in salmon aquaculture is carried out through immersion with drugs and medicated food. In both cases, the possibility exists for the antibiotics to pass to the environment and cause effects in the wild life. There are multiple concerns regarding the excessive use of antibiotics in salmon aquaculture, among which is the growth of antibiotic-resistant bacteria in the flora and the normal pathogens of pools, the effects caused by the persistence of these drugs, and the antibiotic residues found in sediments and in the water column.

These antibiotics promote the growth of free antibiotic-resistant bacteria, process that alters the composition of normal bacterial flora in fresh and salt water. Data indicate that those antibiotic-resistant organisms in marine environment will transfer in turn their antibiotic-resistant genes to other bacteria, including human and animal pathogens. Antibiotics can also affect the composition of the phytoplankton community, the zooplankton community, even the diversity of bigger animal populations. Thus, the possible alterations in the marine microbiota diversity caused by the antibiotics could modify the homeostasis of marine environments, and affect complex life forms, including fish, mollusks, marine mammals, and human beings.

For example, in the case of oxitetracyclyne, it has proven low absorption in the fish's intestinal tract, therefore, much of the drug is excreted with no alterations to the aquatic environment, where it is distributed between the sediment and the water column, or is consumed by the marine wild life (Paone, 2001). In summary, treatments used now for the control of infectious diseases in salmonids are based in the use of chemicals and vaccines not having a good percentage of efficiency. On the other hand, many of those chemicals are causing side effects or are forbidden substances in other countries.

In addition, the life cycle of salmon is also affected by several factors induced by human intervention, such as fishing pressure, contamination, geographic barriers, and aquaculture farms. Those factors have great impact in their survival, especially in their ability to endure stress, such as being subjected to a caged culture system. This has generated a significant decrease in their defense system that could be exploited by the infectious microorganisms that cause disease and death of salmon populations, or asymptomatic infections leading to the onset of asymptomatic carriers capable of transferring microorganisms for long periods of time and long distances. Adverse scenarios in culture, and mostly the exposure to pathogen microorganisms, require a good immunological condition from the salmon in order for it to face its life cycle in a healthy way.

The immune system of teleosts, such as salmon, holds similarities with that of higher vertebrates. It is known that mammals and teleosts have well-defined lymphoid tissues, such as thymus, spleen, kidney, and tissues associated to skin and gills (Press, Evensen et al. Fish, however, have no bone marrow, lymphatic system, or Peyer's patches as mammals do (Rombout, Huttenhuis et al. 2005). The immune system of salmon is characteristic of teleosts (Penagos et al., 2008) being identified (i) the innate response immune system, corresponding to the phylogenetic or ancestral mechanism capable of removing any foreign object, mainly by activation of a set of receptors for pathogen-associated molecular pattern (RAMP) reconnaissance, and (ii) the adaptive immune response that, depending on the lymphocytes, is capable of recognizing and eliminating external aggressors. Despite this classification, the mechanisms of innate and adaptive immunity interact and operate jointly against an external aggression. Leukocytes involved in fish immunity are B lymphocytes (IgMi-and lgT-'-cells) and T lymphocytes. The existence of T helper lymphocytes (CD4+ T cells) has been proved indirectly in fish, including salmon and trout, due to the presence of genes homologous to CD4, TCR and CD3e, among others (Suetake, Araki et al 2004; Laing, Zou et al 2006; Nakanishi et al., 2011), and recently, by means of immune-magnetic isolation and characterization of CD4 + cells (lmarai et al., unpublished). Additionally, cytotoxic I lymphocytes (CD8+ T) have been isolated, and their function in vitro has been demonstrated (Fischer, Utke et al 2006; Sato and Okamoto 2008; Utke, Kock et al 2008). Similarly, the antigen onset seems to occur as in mammals due to the presence of MHC Class I, TAP, and LMP genes. Antigen-presenting cells, such as macrophages, are abundant in fish, and cells similar to dendritic cells have been recently identified in fish (Ohta, Landis et al. 2004; Yoder and Litman, 2000). Jointly, evidence supports the existence of an adaptive immune response in teleosts, including salmonids.

The immune response is influenced by multiple factors dependent on the host, including age, physiological condition or stress, characteristics of the aquatic environment, such as water temperatures or the presence of toxins therein, and thirdly on the organism involved (Penagos et al., 2009). The high mortality caused by infectious diseases observed now in the industry of salmon indicates that developing new pharmacological tools to stimulate the protective immune response in salmonids is urgent.

Genus Heliotropium: The interest of the researchers in medicinal plants, as natural source of many active components has increased outstandingly in the last two decades. In this sense, for far too long secondary metabolites obtained from the resinous exudates of plants of genus Heliotropium (family Heliotropiaceae) growing in the North of Chile have been isolated and characterized. The species Heliotropium grows in arid regions under extreme environmental conditions, and are characterized by producing a resinous exudate through glandular trichomes covering their foliar surface and stem. Phytochemical researches revealed that the resine consists mainly of flavonoids and aromatic geranilated derivatives, in smaller amount (Torres et al., 1994, 1996; Urzüa et al., 1993, 1998, 2000, 2001; Modak et al., 2003, 2007, 2009).

Searching for an explanation for the role of resinous exudates, it has been proposed that they can constitute the first barrier of protection against predators. This protection may be due to a mechanical effect associated to its sticky character that makes predators to get stuck (Eigenbrode et al., 1996), as well as a chemical protection due to the presence of secondary metabolites with antimicrobial, antioxidant, and cytotoxic properties (Hoffman et al., 1983). Furthermore, the predominant presence of resinous exudate in plants growing in arid and semi-arid zones has been explained in terms of the extreme environmental conditions (Downum et al., 1988), and in particular, the increased oxidative stress to which they are exposed (Gonzalez -Coloma et al., 1987). It has been also proposed that the presence of antioxidant flavonoids in the exudates can prevent oxidative degradation of the resin's other components, which can lead to the loss of its chemo-physical properties (UrzUa y Mendoza, 1993).

There are studies on the composition of resin from different species of genus Heliotropium, as well as certain biological and chemical activities of such exudates and their components (Modak et al., 2004 and 2010). In particular, pinocembrine, 3-0-metilgalangine, 3,7-0-dimetilgalangine, alpinone, and carrizaloic acid have been isolated from Heliotropium huascoense (UrzUa et al., 2000;.Villarroel et al., 2001). In general, studies carried out with flavonoids isolated from the species of Heliotropium reveal that they present mainly antioxidant activity (Lissi et al., 1999; Modak et al., 2003; Modak et al., 2007, Modak et al., 2009; Choudhary et al., 2008).

Vaccines for fish: Under natural conditions, disease is a phenomenon inherent to any living being, and is potentiated when the individual is subjected to stressful conditions, including caged culture. The intensive animal production enables the conditions for altering the environment-pathogen-host balance, leading to disease and mortality.

Therefore, the invention being filed solves this technical problem in a very different way from what is disclosed in the state of the art.

In order to prevent infectious diseases, vaccination is one of the most valuable tools in aquaculture ensuring a clean product that does not alter the environment. Despite some authors think that in aquaculture only one vaccination is enough to induce protection until fish are collected (Heppell and Davis, 2000; Bowden etal., 2003), and this can have validity after the immunizations via intraperitoneal, vaccination of populations of hundreds of thousand of individual requires massive methods of immunization (immersion and oral), which require, in most cases, revaccination (Romalde et al., 2004; Vandenberg, 2004). In some fish, suitable levels of protection are reached only when modified live vaccines are used, being the case of the vaccine against Edwardsiella ictaluri in catfish aquacultures in the United States. Despite the apparent security of bacterines, fish vaccination received an alert in 2001, when in a rainbow trout (Onchorhynkus mykiss) farm in Israel, the appearance of an isotype of higher virulence, with modifications in the membrane proteins, and capable of infecting and killing vaccinated fish, was induced by the use of a bacterine against streptococcosis (Bachrach et al., 2001).

Additionally, some extracellular products (ECP5) from bacteria have been tested with dubious results in the vaccination of fish against Streptococcus. Klesius et al.,2000, and Evans et al., 2004 compared in tilapias (Oreochromisniloticus) the protective effect of conventional bacterines and bacterines added with ECPs against Streptococcus iniae and Streptococcus agalactiae, and suitable protection levels were found only when concentrated ECPs were added to the vaccines. DNA vaccines, in turn, are considered the most efficient in inducing protection and response from the immune system of the fish by triggering innate and adaptive immune mechanisms ensuring effective responses humoral and cellular as well (Heppell and Davis, 2000). On the other hand, to date there is no inactivated vaccine available that is highly effective against the IPNV virus (Salgado-Miranda, 2006). The virus treatment with formalin or 3-propiolactone for use in vaccines inactivated the virus completely, but reduced the antigenicity up to 50% (Dixon, 1983). An active vaccine that included a non-pathogenic strain of the IPNV virus, sensitive to normal trout serum, also failed to confer protection to the experimental challenge (Dorson, 1977). Inactivated and recombinant vaccines are also used. Therefore, the recombinant vaccine, the first with license for being administered to fish, contains the structural protein VP2 produced in Escherichia coli, and induces the production of specific antibodies against the IPNV virus (Christie, 2004).

Veterinarian-grade adiuvants: Conventional veterinarian vaccines consist mainly of attenuated live pathogens, inactivated organisms, or inactivated bacterial toxins (Chang et al., 1998).

Although attenuated forms of pathogens are used as veterinarian vaccines, there is concern in this respect, since occasionally it turns back to the virulent form or adverse effects are observed in immunodepressed animals. The use of dead organisms or parts thereof is an alternative, although the lower efficiency is evident.

As a result of these limitations, new types of vaccines have been developed with significant advantages over the previous ones. Those include subunits of recombinant proteins and DNA (Rankin et al., 2002). Although these new alternatives may be beneficial, a usual problem is that, in veterinary, they are frequently immunogenically poor (Bahenmann et al., 1987; Loehr et al., 2001).

Traditional vaccines frequently contain components that can help in the maturation of T cells and function as adjuvants, for example, the bacterial DNA, or [PS. Those components, however, have been eliminated from the new vaccine generations, therefore the need for identifying adjuvants that should potentiate and drive the required immune response arises.

The immune adjuvants were originally described by Ramon (1924) as "substances used in combination with a specific antigen that produces a more robust immune response than the antigen alone." This definition includes a wide range of materials. An extensive assessment of adjuvants used by the Food and Drug Administration in humans, however, limited the use of aluminum salts. These salts show a good record of security, but comparative studies in animals, show that it is a good adjuvant for inducing antibodies in vaccines of recombinant proteins, and induces a type-Th2 response, more than the sought type-Thi response (Gupta, 1998), which is more effective in protecting against intracellular pathogens.

Additionally, a key in the study of adjuvants is toxicity. Thus, during the first 50 years, allowed adjuvants referred to the aluminum salts.

For prophylactic immunization in animals, only adjuvants producing minimal adverse effects, local and systemic, can be accepted. Important issues in the development of adjuvants are the reaction in the injection site, the elimination or biodegradation of the adjuvant, and the duration and retention in the injection site.

The types of adjuvants used in animals are summarized below (Singh and O'Hagan, 2003): * Mineral salts: Aluminum hydroxide, aluminum phosphate.

* Immunostimulant adjuvants: Cytokines, saponines, bacterial DNA, LPS (lipopolysaccharide), lipopeptides.

* Lipid particles: Emulsions of Freud, ISA 25, 51, 206, SAF, MF59, liposome.

* Adjuvant mucus: Mutant toxins, including LTK63 and LTR72, microparticles, polymerized liposomes, chitosan.

Mineral salts, in particular those of aluminum, stimulate the production of antibodies by a Th2 response. They, however, have the disadvantage of producing a low impact in inducing a cellular immune response. These adjuvants are also known for inducing immunity in short term, implying the use of multiple boost injections.

Additionally, it is not uncommon to observe granulosis in the injection site (Nicklas, 1992).

The Freud adjuvant has been used during more than 50 years, especially when limited quantities of antigen are available. Its toxicity, however, has been recognized for long time, and with the growing interest in experimental animals' wellbeing, considerable pressure to limit their use exists (Morris et al., 1999). In the veterinary field, the more broadly used adjuvants in veterinary vaccines are mineral oil emulsions (oil-in-water or water-in-oil), such as ISA 25,51, 206, MF59. MF59 is the oil-in-water emulsion that has been the most assessed regarding its use as adjuvant. It is a microfluidized emulsion containing a terpenic derivative, squalene, together with two surfactants: Tween 80, and Span-85, in sodium citrate buffer.

Squalene is a natural compound obtained from vegetables and animals. It is not an adjuvant in itself, but the squalene emulsions with surfactants improve the immune response of human beings and animals. An example is MF59 (US Patent 6.299.884 B) which is an adjuvant manufactured by the Novartis Lab, and is added to the influenza vaccine.

Saponins are another type of adjuvant used. These derive from the Chilean tree Quillaja saponaria Molina, and consist of terpenoidal derivatives, which have been used in human beings and animals. The crude extract from this tree is called saponin. Quil A, and spikoside are partially-purified mixtures, and QS21 is a fraction. Quil A is widely used in veterinary medicine, and has been used in livestock, pig, horse, dog, and cat vaccination, including FeLV vaccine for the equine influenza virus, parvovirus. QS21 is used in the FeLV vaccines, and the canine vaccine for Lyme disease (Kim et al., 2006).

DETAILED DESCRIPTION OF THE INVENTION

The purpose of the present invention is to provide a formulation containing an active principle with immuno-stimulant/adjuvant activities obtained from the resinous exudate from the plant species Heliotropium huascoense, and being useful in salmonid species in order to increase the immunogenicity of an antigen and/or the components from a vaccine.

The present invention provides a formulation with immuno-stimulant/adjuvant activity, wherein it comprises: a) (-)-alpinone, of which the structural formula is: R2 OH 0 wherein R1 is OH, and R2 is OCH3, with an optic activity of [a]25°D= -28,1 (c.0.215,CHCI3), and an S configuration of carbons 2 and 3; b) dimethyl sulfoxide; and c) saline solution.

Preferably, the formulation comprises: a) (-1-alpinone: 0,05% w/v to 0,5% w/v b) DM50: 0,8 to 8,0 % wlv, and c) Saline solution: Necessary amount to complete 100% volume.

The present invention further provides the use of a formulation with immuno-stimulant/adjuvant activity, wherein it is useful for preparing vertebrate vaccines.

Preferably, the vertebrates are of a salmonid species.

The formulation active principle is the flavonoid (-)-alpinone, and it shows no toxicity in treated subjects, to the contrary, produces an improvement of the general look, probably due to its antioxidant and stress-controlling properties in subjects under treatment.

This active principle has the property of inducing maturation in dendritic cells, corresponding to the first stages of induction of the immune response in higher vertebrates.

The active principle in the formulation of the present invention is the flavonoid 3, 5-dihydroxy-7-O-methoxyflavanone (Alpinone). The formulation of the present invention differentiates from others previously patented in that it is a formulation of which the active agent is a natural flavonoid obtained from vegetable species, and therefore is biodegradable, as it does not affect the environment. In the present invention, a formulation has been developed according to which certain amounts of an active agent, that is a phenolic compound (flavonoid), are available, in which positions 3 and 5 are hydroxylated, position 7 is methoxylated, and in position 4 there is a carbonyl. It has two stereogenic centers, where the configuration of carbons 2 and 3 must be "S." In the formulation of the present application, the flavonoid is in the melding with pharmacologically accepted diluents, including, but not limited to, dimethylsulphoxide, and saline solution.

Preferably, the formulation of the present immuno-stimulant/adjuvant invention for fish consists of: DMSO: 8% wlv (-)-alpinone: 0.5% wlv (alpinone must present an S' configuration in its stereogenic centers).

Saline solution: 91.5% w/v The formulation has as an active ingredient the flavonoid of general formula:

L OH 0

Wherein R1 must be OH, and R2 must be OCH3. Additionally, it must have an optic activity of [a]25°D= -28.1 (c.O.215,CHCI3), and an "S' configuration of carbons 2 and 3.

The present invention provides an immuno-stimulant formulation that is not specifically directed against a selected pathogen, or a grouping of selected pathogen agents.

The purpose of the present invention is providing an immuno-stimulant/adjuvant formulation administrable via intramuscular for triggering the immune response in salmonid species and/or improving the response of the existing vaccines.

The present invention has the advantage over other market-grade adjuvants, including, but not limited to, Montanide, wherein the formulation active principle is used in low doses, and in the zone where is being injected no necrosis or damage around the tissue is observed. Instead, the market-grade adjuvant Montanide generates granulomes in the injection site (Mutoloki et al., 2004).

Furthermore, the injectable solution of the present invention requires a smaller amount of active principle, unlike the market-grade adjuvants.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Analysis of the expression of MHCII in mouse dendritic cells by flow cytometry.

Figure 2. Levels of cytokine mRNA in SHK-1 cells stimulated with potential immuno-stimulant compounds.

Figure 3. Levels of cytokine transcripts in the kidney of fish treated with immuno-stimulant compounds.

Figure 4. Analysis of humoral response in fish immunized with ovalbumin.

Figure 5. Detection of viral RNA by RT-PCR.

Examples

Example 1: Effect of the active principle in the maturation of mouse dendritic cells The immuno-stimulant capacity of the formulation active principle from the present invention in the primary culture of mouse dendritic cells (DC) was tested. For this essay, dendritic cells obtained from the bone marrow of the mouse were cultured for 6 days in a RPMI-1 640 medium supplemented with 10% fetal calf serum (SFB), 4 mM L-Glutamine (Hyclone), penicillin/streptomycin (Hyclone), and 10 ng/mL GM-CSF. After this time, the cells were incubated with 5 ug formulation active principle for 6 h at 37°C. The cell triggering condition was evaluated by the expression of class II MHC on the surface of mouse DC using a specific antibody (FITC-antimouse lAd, BD, USA) for detecting that molecule by flow cytometry. The observed results in this essay (Figure 1) indicate that the active principle increases the expression of class II MHC molecule in dendritic cells. This indicates that the compound induces maturation of the dendritic cells, which is a characteristic of compounds used as immuno-stimulants or adjuvants. In conclusion, the formulation active principle has immuno-stimulant activity, in particular, producing mouse dendritic cell triggering.

Example 2: Effect of the active principle on cytokine expression in the SHK-1 cell line The evaluation of the immuno-stimulant capacity was carried out as well in the SHK-1 cell line that corresponds to cells derived from an enriched culture of macrophages obtained from the Atlantic salmon's anterior kidney. How the immuno-stimulants should trigger the expression of cytokines crucial for the onset of the immune response in the individual, and this occurs by activation of the gene transcription; the increase in the expression of pro-inflammatory cytokine genes, including IL-i, IL-B, IL-b, 1L12, and TNFa; anti-inflammatory cytokines, including TGFI31; and the antiviral cytokine IFNa was quantified. Cells were made grow in 6-well plates during 3 days until a confluence of about 90% was reached; then, they were incubated with 5 ug formulation active principle for 24 h at 15°C in a L-1 5 medium supplemented with 10% SFB, 4mM L-Glutamine,40 uM 2-mercaptoethanol, uglmL Gentamicin. In order to obtain RNA, cells were loosened by mechanical action of the wells, concentrated by centrifugation, and homogenized in 1 mL Trisure (Bioline, USA). Then, 200 uL chloroform was added to each sample, and they were mixed in a vortex for 1 mm. The suspension was centrifuged at 13,200 x g for 15 mm at 4°C. The aqueous phase was retrieved and transferred to another tube containing 500 uL cold isopropanol (Merck). The mixture was incubated for 20 mm at -20°C, and was centrifuged again at 13,200 x g for 10 mm at 4°C; the supernatant was removed, and 1 mL 75% cold ethanol was added to each tube. Tubes were centrifuged at 6,000 x g for 5 mm at 4°C, the supernatant was discarded, and the RNA pellet was dissolved in 20 uL nuclease-free water (Invitrogen). RNA was incubated at 65°C for 10 mm, and was stored at -20°C. The contaminant DNA digestion in the sample was carried out by a treatment with DNAsa RQ1 (Promega).

2 ug RNA were treated according to the conditions set forth by the manufacturer.

cDNA synthesis was carried out using 200 U/uL reverse transcriptase enzyme M-MLV (Promega), 500 ng/uL oligo dT (Promega), 1mM dNTP5 (Bioline), and enzyme 5X (Promega) buffer in a final volume of 25 uL. The mixture was incubated for 60 mm at 42°C, and then, at 70°C for 15 mi cDNA generated was stored at -20°C.

The reaction in quantitative real time (qRT-PCR) was carried out in 96-well plates (AXIGEN) covered with optic lids on the equipment STRATAGENE 7300.

Every reaction was carried out in a final volume of 25 uL, using 12.5 uL Quantace SYBR Green/ROX qPCR master mix (2X) (Bioline), 1.25 uL sense starter (10 uM), 1.25 uL anti-sense starter (10 uM), 8 uL ultra-pure distilled water (Invitrogen), 2 uL cDNA 1:2 dilution. In all reactions, controls without quenching were carried out. The results show that the formulation active principle induces an increase in the expression of pro-inflammatory cytokines, including IL-i, IL-8, TNF-cx; the antiviral cytokine IFNa, as well as cytokines important in this T helper 1 (Thi) type of response, such as IL-b 2 (Fig. 2). The R compound used as positive control increases the expression of cytokines, mainly of the pro-inflammatory type, including IL-i, IL-B, and IL-12 (Figure 2). These results show that the formulation active principle is capable of inducing high levels of pro-inflammatory, antiviral, and Thi-response-inducing cytokines in the SHK-1 cell line of salmon.

In conclusion, it has been determined that the formulation active principle can be used as an immuno-stimulant/adjuvant in order to trigger an early antiviral response and a type-Thi response.

Example 3: Effect of the active principle as an immuno-stimulant in Atlantic salmon For the analysis in vivo, 15 Atlantic salmon of 40-50 g were used, which were injected via intramuscular (IM) with doses of 100 ug formulation active principle in a final volume of 100 uL. As controls, fish were injected with 8% DMSO (formulation component) dissolved in 100 uL saline solution, and with 5 mg control compound Ribomunyl dissolved in 100 uL saline solution. As control, a group of fish was only injected with 100 uL saline solution, while the other was not injected. After 48 h, fish were sacrificed with a benzocaine overdose, and their kidney and spleen were extracted for their subsequent analysis. In order to obtain RNA, organs were disintegrated in 1 mL Trisure using a tissue homogenizer. Next, the same protocol used in the RNA obtaining essay from SHK-1 cells was carried out. As a result, it was observed that in the kidney, the formulation active principle increases the levels of expression of pro-inflammatory cytokines IL-i and IL-8, and of IL-12 (type-Thi cytokine). Additionally, it increases the levels of anti-inflammatory cytokine TGF-131 and of antiviral cytokine lENa (Figure 3). The compound Ribomunyl, used as control for its known effects on activating mouse cells (Spisek et al., 2004), increased the expression of IL-i, TNF-a, IL-i2, and lENa (Fig. 3). Furthermore, the kidney from the control, DMSO, saline solution, and no-treatment fish present no modifications in the expression of such cytokines.

In conclusion, the formulation active principle of the present application presents immuno-stimulant properties in salmonid fish.

Example 4: Effect of the active principle as adiuvant on vaccines for salmonid In order to evaluate the adjuvant capability of the formulation active principle from the present invention, an antigen-dependent lymphocytic proliferation essay was carried out using ovalbumin as an immunogen. That essay is carried out in lymphocyte cultures that proliferate clonally when stimulated with the antigen. This only occurs when a previous immunization with the antigen has taken place. A protein such as ovalbumin requires an adjuvant compound in order for the immunization to take place. Thus, groups of 3 50 g-fish (rainbow trout) received two doses of the formulation combined with the protein ovalbumin (Sigma). Groups in experimentation received the injectable solution (formulation of the present application) consisting of lOOug combined compound with bug protein ovalbumin dissolved in 100 uL saline solution (0,9% NaCI). A positive control, Montanide ISA 763 a VG (Seppic, Francia), an oily adjuvant used in veterinary vaccines, was used, and it was mixed with 10 ug ovalbumin. The preparation of Montanide was carried out according to the manufacturer's recommendations. On the other hand, two control groups were used, which were split into fish that received 10 ug protein ovalbumin dissolved in saline solution, and fish that were injected with 100 uL saline solution. The dose of ovalbumin was determined in a previous essay according to a protocol carried out by Joosten et al., 1997. Fish were kept in aquariums with 30 L fresh water, and a continuous supply of oxygen to a biomass of 10-12 Kg/m3 at 15°C.

For feeding, a market-grade pellet was used, and was administered in the aquariums once a day. Temperature, pH, oxygen, and ammonium levels were monitored on a daily basis in order to maintain the parameters within optimal ranges. Additionally, the aquariums' water was replaced daily.

After 5 days, the spleens of treated fish were disintegrated in 100-mesh nets with RPMI-1640 (Gibco) medium supplemented with 10% fetal calf serum, 4 mM L-Glutamine (Hyclone), 40 uM 2-Mercaptoethanol (Gibco), and 50 ug/mL Gentamicin (USB Biological). The cell suspension was centrifuged at 2.600 x g for 5 mm at 4°C. The cell pellets were resuspended in supplemented RPMI medium, and the number of cells was determined in a hemocytometer, and the viability by Trypan blue staining on a phase-contrast inverted microscope. For the in vitro stimulation, lxi 06 cells were seeded in 96-well plates with 100 uL RPMI/s medium plus 50 ug ovalbumin (OVA). After 3 days, 18 h before the completion of the experiment, 1 uL tritiated thymidine (3H-Thymidine) was added, 5 pCiImL (PerkinElmer) in each well.

Then, cells were resuspended in 1 mL ultra-pure water, and the suspension was transferred to fiberglass filters that were vacuum-dried. The filters were deposited in scintillation liquid, and radioactivity was quantified in a scintillation counter (Tri-Carb 2100 TR; Packard). Experimental data was expressed in counts per minute (CPM).

As a result, it is observed that the cultures from fish immunized with ovalbumin and Montanide (OVA+Montanide) presented higher levels of incorporated thymidine than those from the cells of control fish injected with ovalbumin only (OVA) (Table 1), verifying the control compound's adjuvant effect. Furthermore, an increase of the thymidine incorporation when the formulation is used is also observed (Table 1).

Example 5: Analysis of specific antibodies Immunization with ovalbumin in a formula containing the active principle as an adjuvant also induces a better humoral response. Specific 1gM was quantified for OVA by ELISA in serum after the immunization. In this analysis, sera from fish treated with the formulation was used (100 pg active principle, 8% DMSO, and 100 pL saline solution). In the essay, Maxisorp (Nunc) 96-well plates activated with 10 pg of the ovalbumin protein were used at 37°C all night. The next day, 200 pL blocking solution (1% BSA, 5% sucrose in saline phosphate buffer) was added to each well, and the plates were incubated for 30 mm at 37°C. Then, the blocking solution was removed, and 100 uL serum from each treated fish was added to each well in triplicate, and the plates were incubated for 1 h at 25°C. After this time, the wells were washed with 0,05% Tween 20 in PBS. Subsequently, 100 uL trout anti-lgM antibody were added to the wells, and then the plates were incubated for 1 h at 25°C.

Again, the wells were washed and incubated for 30 mm with 100 uL mouse anti-immunoglobulin antibody conjugated to alkaline phosphatase (Sigma) diluted in 1:1000. Finally, the wells were washed, and 100 uL developer solution (50 mM Na2CO3, 2 mM MgCI2, and 14 mg p-nitrophenylphosphate) was added to each well.

The plates were incubated for 15 mm at 37°C, and analyzed in an ELISA reader at 405 nm.

As a result, it was noted that there is a higher amount of specific antibodies against OVA in the group of fish treated with the adjuvant Montanide (Figure 4) over the rest of the control groups and fish treated with the formulation of the present invention, and that the formulation of the present application also presents a slight increase in the levels of specific antibodies against OVA over the controls that is statistically significant (Figure 4).

Example 6: Antiviral effect of the formulation active principle The increase of the transcribed lFNcx levels in SHK-1 cells treated with the active principle suggests that IFNa can also be secreted to the culture medium. In this case, the supernatant of the treated cells must show an antiviral effect as well. In order to verify this hypothesis, the supernatant effect on the ISA virus proliferation in ASK cell monolayers was evaluated.

In order to obtain conditioned supernatants, SHK-1 cells were cultured in 6-well plates at 15°C in Leibovitz L-15 medium supplemented with 10% SFB, 4 mM L-Glutamine, 40 uM 2-Mercaptoethanol, and 50 ug/m[ Gentamicin until a 90%-i 00% confluence was reached, and they were stimulated by adding 5 ug formulation active principle or 20 ug/mL Poly l:C (Sigma) in each well, used as a control. The plates were incubated for 24 h, and medium from each well was collected afterwards, and was centrifuged at 3.000 rpm for 5 mm at 4°C. The supernatants were stored at - 80°C. Furthermore, the ISA virus spread in monolayers of SHK-1 cells with a 60% confluence, which were inoculated with the virus in an infection medium (MOl 0,1)( [eibovitz [-15 medium without SF3, 4mM [-Glutamine, 40 uM 2-Mercaptoethanol, 50 ug/mL Gentamicin). The protocol described by Jensen et al., 2002, was followed.

For the antiviral activity essay, ASK cells were used. (Rivas-Aravena et al., 2011). Cells were spread in 48-well plates until a 90%-i 00% confluence was reached, then incubated for 48 h with 1:100 dilutions of each supernatant from both stimulated and non-stimulated SHK-i cells. Then] cells were infected with ISAV at a dilution of 1/40 in [-15 medium. On post-infection (P1) days 2, 4, and 7, the supernatant was collected, and viral RNA was extracted using a Kit according to the manufacturer's protocol (Omega Biotek, E.N.Z.A).

The inhibition of the viral replication was determined by RT-PCR, this method being more specific, sensitive, and fast for detecting, and identifying the virus. For this, specific starters aimed at the fragment 8 of the ISA virus were used.

uL of the RNA obtained from the extraction were incubated with 1 uL sense starter (10 uM), 1 uL anti-sense starter (10 uM) (see Table 1), 5 uL master mix (Kit one step Syber Green), and 3 uL ultra-pure water (Invitrogen). cDNA was synthesized, and the PCR was carried out in the Stratagene 7300 equipment.

Table I: Sequence of starters used in detecting the ISA virus present in ASK cell cultures.

Gene Sequence Tm Size (Fw/Rv) (5' -3') (°C) (pb) Segment GAAGAGTCAGGATGCCAAGAC 59 200 8ISAV G 59

GAAGTCGATGATCTG CAGCGA

As a result, we noted that the supernatant from SHK-1 cells, stimulated with the formulation active principle, delays the viral replication until day 4 (Figure 6), unlike the supernatant obtained by stimulation with Poly l:C. Results indicate that there is a compound with antiviral activity induced by the active principle of the present invention in the supernatant from stimulated cells, which probably corresponds to a type-I IFN. Therefore, the formulation active principle would be useful in triggering an early antiviral response.

Figure 1 shows the Mean Fluorescence Intensity (MFI) of the expression of MHCII in untreated control DC, and DC treated with 0,5 or 5 ug formulation active principle. R is a compound used as positive control. As negative control, untreated DC, as well as DC treated with DMSO (0,02%) corresponding to the carrier used in order to dissolve the studied compound, were used. The results were analyzed with One-way ANOVA together with the Bonferroni Multiple Comparison Post-Test (*p<QQ5) Figure 2 shows the levels of cytokine mRNA in SHK-1 cells stimulated with potential immuno-stimulant compounds. For that, SHK-1 cells were incubated with the control compound Ribomunil and with the formulation active principle, as well as DMSO solvent for 24 h at 15°C in supplemented L-1 5 medium. The expression of cytokine transcripts was evaluated by qRT-PCR. The graph shows the normalized and relative expression. Normalization was carried out in relation to the untreated cultures and the constitutively expressed gene 1 8s. Statistical differences were determined by the non-parametric t-test (Mann-Whitney) among the untreated groups and the experimental groups (* PcO,05).

Figure 3 shows the levels of cytokine transcripts in the kidney of fish treated with immuno-stimulant compounds. Groups of fish (Salmo salar) were injected IM with 100 ug active principle in 100 uL saline solution, with the control compound Ribomunil, 8% DMSO, or with saline solution. The expression of cytokine transcripts was evaluated by qRT-PCR. The graph shows the normalized and relative expression (NRE). Normalization was carried out in relation to the levels of expression in untreated fish and in relation to the constitutive expression of gene 18s.

Statistically significant differences were determined by the non-parametric t-test (Mann-Whitney) among untreated fish and experimental fish (* P<0,05).

Figure 4 shows the analysis of humoral response in fish immunized with ovalbumin. ELISA plates were activated with 10 ug ovalbumin all night in phosphate buffer. 100 uL of the sera from fish treated with the formulation plus OVA, 1SA763 plus OVA, OVA only, and untreated were added to the plates, and incubated for 1 h at room temperature. 100 uL trout anti-lgM antibody were added to each well, and finally, the plates were incubated with an lgG anti-mouse antibody. The results were analyzed in a BIORAD plate reader.

Figure 5 shows the viral RNA detection by RT-PCR. ASK cell monolayers were infected with a 1:40 dilution of the ISA virus. On days 2, 4, and 7, the supernatant was collected, and the viral RNA extraction was carried out. Samples were analyzed by RT-PCR. Ct indicates the number of cycles where the amplification starts. (The higher the Ct, the lower the viral RNA present in the sample).

Table 2. Proliferation of antigen specific to the rainbow trout splenocytes immunized with ovalbumin (OVA).

Treatment Average CPM (counts per minute) ± standard deviation Untreated (u/t) 5.212 cpm ± 0,023 Ovalbumin (OVA) 6.099 cpm ± 0,025 OVA + Montanide 9.853 cpm ± 0,167 OVA + Formulation 7.440 cpm ± 0,035 The ovalbumin (10 ug) was injected pure, with ISA 763 (Montanide + OVA), and jointly with the formulation. After extracting the splenocytes from the spleens, they were cultured for 3 days with 50 ug ovalbumin. After that period of time, tritiated thymidine was added, and the addition of thymidine was quantified 18 h later in a scintillation counter. Each value represents the average of 1 essay in triplicate with 3 fish in each experimental group. Statistically significant differences were determined by One-way ANOVA together with a non-parametric t-test (Mann-Whitney) (* Pc0,05).

Table Ill: Comparative chart between the proposed invention and the competition (market-grade adjuvant Montanide).

INVENTION

ADVANTAGES DISADVANTAGES

No toxic effects for individuals Not observed No tissue damage (non-oily compound) Potentiates antiviral response or against intracellular pathogens (IPN). Type-Thi immune response.

Ease of recombination for new formulations

STATE OF ART

In association with vaccines against Promotes lesions in the injection site.

furunculosis and vibriosis, results in a durable induction and protected immunity.

Intra-abdominal lesions, granulomes, and tissue adherence.

REFERENCES

1. Bachrach G, Zlotkin A, Hurvitz A, Evans D, Eldar A. (2001). Recovery of Streptococcus iniae from Diseased Fish Previously Vaccinated with a Streptococcus Vaccine. AppI Envir Microbiol. 67,3756-3758.

2. Bahenmann. G, Mesquita. J (1987). Oil adjuvant vaccine against foot-and-mouth disease. Biol. Centr. Panam. Fiebre, 53, 25-30 3. Bogdan,C, Rollinghoff. M, Diefenbach. A. (2000), Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Curr Opin Immunol, 12, 64-76.

Bowden T, Bricknell I, Ellis A. (2003). Fish Vaccination, an overview. Industry report IntraFish. 5-20.

4. Chang. J, Diveley. J, Savary. J, Jensen. F (1998). Adjuvant activity of incomplete Freund's adjuvant. Ad. Drug Del. Rev., 32 173-186.

5. Choudhary. M, Hareem. S, Siddiqui. H, Anjum. S, Ali. S, Atta-ur-Rahman, Zaidi. M (2008). A benzil and isoflavone from Iris tenuifolia. Phytochemistry., 69,1880-1885.

6. Christie. K, (2004). Immunization with viral antigens: infectious pancreatic necrosis. J. Virol. 24, 13829-1 3838.

7. Dixon. F, Hill. B (1983). Inactivation of infectious pancreatic necrosis virus for vaccine use. Journal of Fish Diseases,6-399-409.

8. Dobos. P, Hill. B, Hallett. R, Kells. 0, Becht. H, Teninges. D. (1979).

Biophysical and biochemical characterization of five animal viruses with bisegmented double-stranded RNA genomes. J Virol., 32, 593-605.

9. Dorson M. (1977). Vaccination trials of rainbow trout fry against infectious pancreatic necrosis. Bull Off Int Epizoot. 87-405-406.

10. Downum. K, Dole. J, Rodriguez. E (1998) Nordihydroguaiaretic acid: inter-and intra population variation in the Sonoran Desert Creasote bush (Larrea tridentate, Zygophyllaceae). Biochem. Syst. Ecol., 15, 551-555.

11. Droge. W. (2002), Free radicals in the physiological control of cell function.

Physiol Rev., 82, 47-95.

12. Eingenbrode. S, Trumble. J, White. K (1996). Trichome exudates and resistance to beet armyworm (Lepidoptera: Noctuidade) in Lycopersicum hirsutum f.

typicum accessions. Environ. Entomol., 25, 90-95.

13. Evans. J, Klesius. P, Shoemaker. C (2004). Efficacy of Streptococcus agalactiae (group B) vaccine in tilapia (Oreochromis niloticus) by intraperitoneal and bath immersion administration. Vaccine,22, 3769-3773.

14. Fischer U, Utke K, Somamoto I, Koliner B, Ototake M, Nakanishi T. (2006).

Cytotoxic activities of fish leucocytes". Fish Shellfish Immunol. 20,209-26.

15. González-Coloma. A, Wisdom. C, Rundel. P (1987). Ozone impact on the antioxidant nordihydroguairetic acid content in the external leaf resin of Larrea tridentate. Biochem. Syst. Ecol., 16, 59-64.

16. Gupta. R (1998). Aluminum compounds as vaccine adjuvants. Adv. Drug Deliv. Rev., 32,155-1 72 17. Heppell J, Davis HI. (2000), Application of DNA vaccine technology to aquaculture. Adv Drug Deliv Rev. ,43,29-43.

18. Hill, B. J. and Way, K (1995) Serological classification of infectius pancreatic necrosis (IPN) virus and other birnaviruses. Annu. Rev. Fish. 5, 55-77.

19. Hoffman. J, Kingsolver. B, McLaughlin. S, Timmermann. B, (1983).

"Production of resins by arid adapted Astereae" in Recent Advances in Photochemistry Phytochemical Adaptations to stress. Edited by B. Timmermann, C. Steelink and F. Loewus. Plenum Press, USA.

20. Hsu. H.Y, Wen. M.H. (2002), Lipopolysaccharide-mediated reactive oxygen species and signal transduction in the regulation of interleukin-1 gene expression. J Biol Chem., 277, 22131 -22139.

21. lmajoh M, Hiraya T, Oshima 5 (2005). Frequent occurrence of apoptosis is not associated with pathogenic infectius pancreatic necrosis virus (IPNV) during persistent infection. Fish Shellfish Immunol. 18, 163-1 77.

22. Jashes. M, Gonzalez. M, López-Lastra. M, De Clerq. E, Sandino. A. (1996).

Inhibitors of infectious pancreatic necrosis virus replication. Antiviral Res., 29, 309-312.

23. Jashes. M, Mlynarz. G, De Clerq. E, Sandino. A. (2000). Inhibitory effects of EICAR on infectious pancreatic necrosis virus replication. Antiviral Res., 45, 9-17.

24. Kibenge, F. S., Garate, 0. N., Jonson, G., Arriagada, R., Kibenge, M. J., Wadowska, D. (2001) Isolation and identification of infectius salmon anemia virus (ISAV) from Coho salmon in Chile. Dis. Aquat. Organ. 45, 9-18.

25. Kim. Y., Wang. P., Navarro-Villalobos. M., Rohde. B., Derrybery. J., Gin. D. (2006). Synthetic studies of complex immunostimulants from Quillaja saponaria: synthesis of the potent clinical immonoadjuvant Qs-2lAapi. J. Am. Chem. Soc., 128,11906-11915.

26. Klesius. P, Shoemaker. C, Evans. J (2000). Efficacy of single and combined Streptococcus iniae isolate vaccine administered by intraperitoneal and intramuscular routes in tilapia /Oreochromis niloticus!. Aquaculture 188, 237-246.

27. Laing KJ, Zou JJ, Purcell MK, Phillips R, Secombes CJ, Hansen JD. (2006).

Evolution of the CD4 family: teleost fish possess two divergent forms of CD4 in addition to lymphocyte activation gene-3". J Immunol. 177, 3939-51.

28. Lakhanpal. P, Rai. D., Internet Journal of Medical Update 2007 Jul-Dec;2(2): www.geocities.comm/agnihotrimed/paperO5 jul-dec2007.htm, 2007.

29. Liu. T, Castro. 5, Brasier. A. R, Jamaluddin. M, Garofalo. R. P, Casola, A., (2004). Reactive oxygen species mediate virus-induced STAT activation: role of tyrosine phosphatases. J Biol Chem., 279, 2461 -2469.

30. Loehr. B, Rankin. R, Pontarollo. P, King. 1, Wilson. L, Babiuk. L, Van-Drunnen.

H (2001). Suppository-mediated DNA immunization induces mucosal immunity against bovine herpes virus-i in cattle. Virology, 289, 327-333.

31. Lissi. E, Modak. B, Torres. R, Escobar. J, UrzUa, A. (1999). Total antioxidant potential of resinous exudates from Heliotropium species and a comparison of the ABTS and DPPH methods. FreeRad. Res., 30, 47i-477.

32. Londono. J, Sierra. J.(2007). Efecto de Ia hesperidina sobre Ia captaciOn de Hdl en células Hepáticas y evaluación de hesperidina liposomal sobre Ia oxidacián de [dl. Scientia et teccnica, 33, 63-66.

33. Middleton E Jr. (1998). Effect of plant flavonoids on immune and inflammatory cell function. Adv Exp Med Biol. 1998;439:i75-82.

34. Mjaaland, S., Rimstad, E., Falk, K., Dannevig, B. H. (i997). Genomic characterization of the virus causing infectius salmon anemia in Atlantic salmon (Salmo solar L): an orthomyxo-like virus in a teleost. J. Virol. 71, 7681-7686.

35. Migus. D, Dobos. P. (1980). Effect of ribavirin on the replication of infectious pancreatic necrosis virus in fish cell cultures. J. Gen. Virol., 47, 47-57.

36. Modak. B, Torres. R, Lissi. E, Delle Monache F. (2003) Antioxidant capacity of flavonoids and a new arylphenol of the resinous exudate from Heliotropium sinuatum.

Nat. Prod. Res., i7, 403-407.

37. Modak. B, Torres. R, Wilkens. M, UrzUa. A (2004) Antibacterial activity of compounds isolated of the resinous exudates from Heliotropium sinuatum on phytopathogenic bacteria. J. Chil. Chem. Soc., 49, 1-3.

38. Modak. B, Galeno. H, Torres. R (2004) Antiviral activity on Hantavirus and apoptosis of Vero cells of natural and semi-synthetic compounds from Heliotropium filifolium resin. J. Chil. Chem. Soc., 49,143-i 45.

39. Modak. B, Rojas. M, Torres. R, Rodilla. J, Luebert. F. (2007). Antioxidant activity of a new aromatic geranyl derivative of the resinous exudates from Heliotropium glutinosum Phil. Molecules, 12, 1057-i 063.

40. Modak. B, Rojas. M, Torres. R. (2009). Chemical analysis of the resinous exudate isolated from Heliotropium taltalense and evaluation of the antioxidant activity of the phenolics components and the resin in homogeneous and heterogeneous systems. Molecules, 14, 1980-1 989.

41. Modak. B, Salinas. M, Rodilla. J, Torres. R (2009) Study of the chemical composition of the resinous exudates isolated from Heliotropium sclerocarpum and evaluation of the antioxidant properties of the phenolic compounds and the resin.

Molecules, 14, 4625-4633.

42. Modak. B, Sandino. A, Torres. R. (2009). Gomposician veterinaria que comprende un ester senecionilico derivado de un alcohol espiránico aromético geranilado; y su uso para inhibir el desarrollo de los virus de Ia necrosis pancreática infecciosa y de Ia anemia infecciosa. Invention patent. Request number 200900714.

Oficina de Patentes Chilena, INAPI (CLPTO, Chilean Patent Office).

43. Modak. B, Sandino. A, Arata. L, Cárdenas-Jiran. G, Torres. R (2010).

Inhibitory effect of aromatic geranyl derivatives isolated from heliotropium filifolium on infectious pancreatic necrosis virus replication. Vet. Mic., 12, 53-58.

44. Moon, Y. J.; Wang, X.; Morris, M. E.(2006). Dietary flavonoids: Effects on xenobiotic and carcinogen metabolism. Toxicology in Vitro, 20, 187-210 45. Morris. J, MartInez, C, Abdala. R, Campos. D, (1999). Adyuvantes lnmunolágicos. Rev Cubana Invest Biomed. 18, 130-7.

46. Moya. J, Pizarro. H, Jashes. M, De Clerq. E, Sandino. A. (2000). In vivo effect of E ICAR (5-ethylnyl-1 -13-D-ribofuranosylim idazole-carboxam ide) on experimental infected rainbow trout (Oncorhynchus mykiss) and coho salmon (Oncorhynchus kisutch) fry with infectious necrosis virus. Antiviral Res., 48, 125-1 30.

47. Nakanishi, T., Toda, H., Shibasaki, Y. y Somamoto, 1., (2011). CytotoxicT cells in teleost fish. Dev. Comp. Immunol. 35, 1317-1323.

48. Nicklas, W. (1992). Aluminium salts. Research in Immunology. 143, 489.

49. Nijveldt RJ, van Nood E, van Hoorn DE, Boelens PG, van Norren K, van Leeuwen PA. (2001). Flavonoids: a review of probable mechanisms of action and potential applications. Am J Clin Nutr. 74,418-25.

50. Ohta Y, Landis E, Boulay T, Phillips RB, Collet B, Secombes CJ, (2004).

"Homologs of CD83 from elasmobranch and teleost fish". J Immunol. 173, 4553-60.

51. Paone S. (2001). Farmed and Dangerous. Human Health Risks Associated with Salmon Farming. Friends of Clayoquot Sound, Tofino, British Columbia.

52. Penagos. 0, Barato. F, lregui. C (2009) Sistema immune y vacunaciOn de peces. Acta Biol. Colomb., 14, 3-24.

53. Pinto. J. (2003). Proyecto ElF 2001 -2008 "Riesgos de introducción de enfermedades infectocontagiosas en salmonidos". Informe de Resultados.

54. Press CM, Evensen 0, Reitan U, Landsverkl. (1996). Retention of furunculosis vaccine components in Atlantic salmon, Salmo salar U, following different routes of vaccine administration". Journal of Fish Diseases. 19, 215-24.

55. Ramon. G. (1924). Sur Ia toxine et surranatoxine diphtheriques. Ann. Inst.

Pasteur, 38, 1.

56. Rankin. R, Pontarollo. R, Gomis. 5, Karvonen. B, Willson. P, Loehr. B, Godson. D, Babiuk. L, Hecker. R, Van Drunen Littel-van den Hurk. (2002). CpG-containing oligodeoxynucleotides augment and switch the immune responses of cattle to bovine herpesvirus-1 glycoprotein D. Vaccine, 20 3014-3022.

57. Romalde J, Luzardo-Alvárez A, Ravelo C, Toranzo A, Blancoméndez J. (2004). Oral immunization using alginate microparticles as a useful strategy for booster vaccination against fish lactoccocosis. Aquaculture. 236:119-129.

58. Rombout JH, Huttenhuis HB, Picchietti 5, Scapigliati G. (2005)." Phylogeny and ontogeny of fish leucocytes". Fish Shellfish Immunol. 19, 441-55.

59. Sadasaiv, E. (1995) Immunological and pathological responses of salmonids to infectius pancreatic necrosis virus (IPNV). Annu.Rev. Fish Dis. 5, 209-223 60. Saint-Jean. 5, Borrego. J, Pérez-Prieto, S. (2003) Infectious pancreatic necrosis virus biology, phatogenesis and diagnostic methods. Adv. Virus Res. 62, 113-165.

61. Salgado-Miranda. C. (2006). Infectious pancreatic necrosis: an emerging disease in the Mexican trout culture. Vet. Mex. 37, 467-477.

62. Salmon Chile (2010) www.salmonchile.cl 63. Sandoval. F. (2004). "Estatus ambiental y sanitario de Ia acuicultura chilena".

Presentation of the Undersecretary of Fishing, Chile. Aquavision, Noruega.

64. Sato A, Okamoto N. (2008). "Characterization of the cell-mediated cytotoxic responses of isogeneic ginbuna crucian carp induced by oral immunisation with hapten-modified cellular antigens". Fish Shellfish Immunol. 24, 684-92.

65. Singh. M, OHagan. 1(2003). Vaccines in the 21st Century: Expanding the Boundaries of Human and Veterinary Medicine. International Journal for Parasitology.

33, 469-478 66. Somogyi. P, Dobos. P (1980). Virus-specific RNA synthesis in cells infected by infectious pancreatic necrosis virus. J. Virol., 33, 129-1 39.

67. Suetake H, Araki K, Suzuki Y. (2004). "Cloning, expression, and characterization of fugu CD4, the first ectothermic animal CD4". Immunogenetics.

56,368-74.

68. Thorud, K. and Djupvik H. (1988). Infectius anemia in Atlantic salmon (salmo solar L).. Bull. Eur. Assoc. Fish Pathol. 8, 109-111.

69. Torres. R, Villarroel. L, UrzUa. A, Delle Monache. F, Delle Monache. G, Gacs-baitz. E., (1994), Filifolinol a rearranged geranyl aromatic derivative from the resinous exudates of Heliotropium filifolium. Phytochem., 36, 249-256.

70. Torres. R, Modak. B, Urzüa. A, Villarroel. L, Delle Monache. F, Sanchez-Ferrando. F. (1996), Flavonoides del exudado resinoso de Heliotropium sinuatum.

Bol. Soc. Chil. Quim., 41, 195-197.

71. Torre. R, Galeno. H, Modak. B. (2007). Effect on Hantavirus replication of resins from Heliotropium species and other selected compounds. Natural Product Communications, 3, 525-525.

72. Torres. F, Aedo. E, Figueroa. L, Siegmund. I, Silva. R, Navarrete. N, Puga. 5, Mann. F y Aedo. E (2000). "lnfecciOn por helmintos parásitos en salmon coho, Oncorhynchus kisutch, durante su retorno al rio Simpson, Chile". Bol. Chil. Parasitol., 55, N° 1-2.

73. UrzUa. A, Mendoza. L (1993), ComposiciOn qulmica del exudado resinoso de Haplopappus velutinus. Bol. Soc. Chil. Quim., 38, 89-93.

74. UrzUa. A, Villarroel. L, Torres. R, Teillier. S. (1993), Flavonoids of the resinous exudate of chilean Heliotropium species from Cochranea section. Bioch. Sist. Ecol., 21, 744-749.

75. Urzüa. A, Modak. B, Villarroel. L Torres. R, Andrade. L (1998), Comparative flavanoid composition of the resinous exudates from Heliotropium chenopodiaceum var. chenopodiaceum and H. chenopodiaceum var. ericoideum. Bioch. Sist. Ecol. ,26, 127-1 30.

76. UrzUa. A, Modak. B, Villarroel. L, Torres. R, Andrade. L, Mendza. L, Wilkens.

M (2000), External flavonoids from Heliotropium megalanthum and H. Huascoense (Boraginaceae). Chemotaxonomic considerations. Bol. Soc. Chil. Quim., 45, 23-29.

77. tirzüa. A, Modak. B, Torres. R (2001). Identification of a new aromatic geranyl derivative in the resinous exudates of Heliotropium filifolium (Boraginaceae). Bol.

Soc. Chil. Quim., 46, 175-1 78.

78. Utke K, Kock H, Schuetze H, Bergmann SM, Lorenzen N, Einer-Jensen K. (2008). "Cell-mediated immune responses in rainbow trout after DNA immunization against the viral hemorrhagic septicemia virus". Dev Comp Immunol. 32,239-52.

79. Vandenberg. G (2004). Oral vaccine for finfish: academic theory or commercial reality?. Anim Health Res Rev. 5,301 -304.

80. Villarroel. L, Torres. R, UrzUa. A, Reina. M, Cabrera. R, González-Coloma. A (2001). Heliotropium huascoense resin exudate: Chemical Constituents and Defensive Properties, 64, 1123-1126.

81. Wolf, K. (1988) Infectius pancreatic necrosis. En Comstock Publishing Associate (ed) Fish Viruses and Fish Diseases, Cornell University Press. 115-157.

82. Yoder, J, Litman G. (2000). The zebrafish fthl, slc3a2, meni, pc, fgf3, andcycdl genes define two regions of conserved synteny between linkage group 7 and human chromosome 11q13. Gene, 261,235-242.

83. Yoshida. Y, Maruyama. M, Fujita. T, Arai. N, Hayashi. R, Araya. J, Matsui. S, Yamashita. N, Sugiyama. E, Kobayashi. M. (1999). Reactive oxygen intermediates stimulate interleukin-6 production in human bronchial epithelial cells. Am J Physiol., 276, L900-908.

84. Zhang. B, Hirahashi. J, Cullere. X, Mayadas. T. (2003). Elucidation of molecular events leading to neutrophil apoptosis following phagocytosis: cross-talk between caspase 8, reactive oxygen species, and MAPKIERK activation. J Biol Chem., 278, 28443-28454.

Claims (4)

1. Claims 1. A formulation with immuno-stimulant/adjuvant activity, comprising: a) (-)-alpinone, of which the structural formula is: R2 OH 0 wherein R1 is OH, and R2 is OCH3, with an optical activity of [ct]25°D= -28.1 (c.0.215,CHCI3), and an S configuration at carbons 2 and 3; b) dimethyl sulfoxide; and c) saline solution.
2. 2. A formulation according to claim 1, comprising: a) (-)-alpinone: 0.05% w/v to 0.5% w/v b) DM50: 0.8 to 8.0 % w/v, and c) Saline solution: Necessary amount to complete 100% volume.
3. 3. A formulation with immuno-stimulant/adjuvant activity, for use as a vaccine for vertebrates.
4. 4. A formulation according to claim 3, wherein said vertebrates are of a salmonid species.