GB2416770A - Synthesis of benzalacetone/raspberry ketone by chalcone synthase - Google Patents

Abstract

A host cell comprising a chalcone synthase (CHS) polypeptide sequence and a 4-coumarate CoA: ligase (4CL) sequence in which one or both are heterologous to the cell. A method of enabling benzalacetone synthase activity of a CHS protein comprising exposing the CHS to a microbial cellular environment, preferably an E. coli cell. The benzalacetone may be reduced by benzalacetone reductase (BAR) in the bacterial cell to make raspberry ketone (pHBD). The host cell may be supplied with a raspberry ketone precursor, preferably benzalacetone or p-coumaric acid. Sequences of raspberry CHS, tobacco 4CL and raspberry BAR genes and polypeptides are described as are vectors comprising CHS and 4CL sequences, preferably in combination with a PAL (phenylalanine ammonia-lyase) gene or a cinnamic acid 4-hydroxylase (C4H) gene. The invention is based on the surprising discovery that chalcone synthase has benzalacetone synthase (BAS) activity.

Description

HOST CELL

FIELD

The present invention relates to the field of flavouring technology.

BACKGROUND

RaspberTy ketone (p-hydroxyphenyl-2-butanone) is a key flavour molecule with typical raspberry flavour characteristics and a low odour threshold. RaspberTy ketone is one of the most expensive flavour components used in the food industry. Up to $20,000/kg may be paid for the natural compound.

RaspberTy ketone can be found in raspberries and other fruits (such as peaches, grapes, apples and various berries), vegetables (e.g. rhubarb) and in the bark of tree (e.g. yew, maple and pine).

RaspberTy ketone can be used in the aroma formulation of, for instance, strawberry, kiwi, cherry and other berries. However none of these fruits are used to obtain the raspberry ketone as the low content of raspberry ketone in these fruits makes the extraction and purification process unprofitable.

RaspberTy ketone can be produced chemically via the condensation of p hydroxybenzaldehyde with acetone.

However, the chemical synthesis of compounds can often result in environmentally unfriendly production processes and in undesirable racemic mixture of the compound of interest (Vandamme and Soetaert 2002; J Chem Techno Biotechnol 77:1323-1332).

Alternatively raspberry ketone can be extracted from raspberries. However, yields are typically very low. For example, only 3.7 mg of ketone can be obtained from 1 kg of bemes (Vandamme and Soetaert 2002; J Chem Techno Biotechnol 77: 1323-1332).

In raspberries, the synthesis of raspberry ketone is one part of the phenylpropanod pathway. This pathway has been described by BorejszaWysocki and Hrazdina (1994). In the first step, coumaryl CoA (which Is present In many plant tissues) is condensed with one malonyl CoA into benzalacetone (p-hydroxyphenylbut 3-enc-2-one). The enzyme catalysing this step is called benzalacetone synthase (BAS). In the second step, the double bond in benzalacetone is reduced, resulting in raspberry ketone (p-hydroxyphenyl-2-butanone). The enzyme catalysing this step is called benzalacetone reductase (BAR), this enzyme requires the presence of NADPH.

Benzalacetone synthase (BAS), EC 2.3.1.-., is a member of the polyketide synthase family. Benzalacetone reductase condenses one acetone unit from malonyl CoA with one p-coumaric acid to form benzalacetone. Chalcone synthase (CHS), EC 2.3.1.74, is another member of the polyketide synthase family, which condenses three acetate units from malonyl CoA with one p-coumaric acid to form chalcone. Stilbene synthase (STS), EC 2.3.1.146, is another member of the polyketide synthase family, which condenses three acetate units from malonyl CoA with one p-coumaric acid to form stilbene (Zheng et al 2001). The polyketide synthase family is described in detail in Schroder 1999 (Comprehensive natural products chemistry vol 1: polyketides and other secondary metabolites includingfatty acids and their derivatives [U. Sankawa Ed] pp 749-771).

CHS is part of another part of the phenylpropanod pathway, which converts phenylalanine into naringenin chalcone and its derivatives (Weisshaar and Jenkins 1998; Hwang et al 2003). This part of the phenylpropanoid pathway involves the following enzymes: phenylalanne ammonia Iyase (PAL), cinnamate-4-hydroxylase (C4H), 4-coumarate:coenzyme A ligase (4CL) and chalcone synthase (CHS). As a first step phenylalanine Is deamnated to yield cinnamic acid by the action of PAL.

Cinnamic acid is hydroxylatcd by C4H to 4-coumaric acid. 4-coumaric acid is activated to 4-coumaryl-coenzymeA (CoA) by the action of 4CL. CHS catalyses the stepwise condensation of three acetate units from malonylCoA with 4-coumaryl CoA to yield nanngenin chalcone (which is a precursor for some flavonoids). Naringenin chalcone is converted to naringenin by chalcone isomerase (CHI) or naringemn chalcone spontaneously converts to naringenn.

Evidence for the relation between BAS and CHS is provided by BorejszaWysocki and Hrazdna (1994 and 1996). Borejsza-Wysocki and Hrazdina (1994) show that the timing of BAS activity parallels CHS activity. In addition, Borejsza-Wysock and Hrazdina (1996) show that CHS and BAS co-purify, and seem to react with the same antisera. However, CHS and BAS activity in the same enzyme preparation showed a different response to treatments with, for instance, 2-mercaptoethanol and ethylene glycol. Also, CHS activity and BAS activity showed different induction patterns upon treatment of raspberry cell cultures with yeast extract, suggesting that these enzymes are not one and the same molecule.

Soluble enzymes catalysing the reduction of a double bond using NADPH, for example benzalacetone reductase (BAR), are classified by the International Union of Biochemistry and Molecular Biology as belonging to enzymatic class EC 1.3.1.X. For instance, an enzyme annotated as EC 1.3.1. 11 from Arthrobacter sp. was reported to remove a double bond from coumarate (Levi and Weinstein, 1964). However, no gene has been identified in connection to this enzymatic activity. Other enzymes In the enzymatic class EC 1.3.1.X are orotate reductase, 2-hexadecenal reductase, cholestenone 5 alpha-reductase etc. for which genes are known. However, none of these enzymes was reported to have benzalacetone reductase (BAR) activity. It is known from literature that 4-hydroxybenzalacetone can be transformed to raspberry ketone by fungi or yeasts such as Pichia, Saccharomyces, Beauveria, Kloeckera, Aureobasidium, Cladosporium Geotrichum, Mucor and Candida spp. (Fuganti and Zucchi, 1998). However, no gene has been identified in connection to this enzymatic activity. Also, to our knowledge, no such activity has been reported for bacteria, neither gram negative nor gram positive.

Attempts to biosynthesise raspberry ketone have been described. Hugueny et al (1995, Boflavour 95 pp 269-273) teach a biotechnological method for producing raspberry ketone. This method comprises culturing a microorganism which has a secondary alcoholdehydrogenase (ADH), such as Candida boidinii, and adding the precursor betulosde to the culture medium. In this cellular environment the secondary ADH dehydrogenatates betuligenol into raspberry ketone.

Various studies have been carried out to determine the role of polyketide synthase genes in the production of flavonoids using E cold transformed with a raspberry CHS gene (see Zheng et al 2001; Kumar and Ellis 2003), a Glycyrrhiza echinata CHS gene (Hwang et al, 2003) or a Arabidopsis thaliana CHS gene (Watts et al 2004). However these studies teach the in vitro or in vivo synthesis of naringenin.

These studies do not teach the in vivo synthesis of benzalacetone or raspberry ketone.

Abe et al (2001) teach the cloning of rhubarb BAS, expression of the gene in E colt, purification of the recombinant BAS protein and the in vitro synthesis of benzalacetone. However this study does not teach the in vivo synthesis of benzalacetone or raspberry ketone.

SUMMARY OF THE INVENTION

According to a first aspect of the present invention, we provide a host cell comprising a chalcone synthase (CHS) polypeptide sequence and a 4coumarate:CoA 1igase (4CL) sequence in which one or both of the CHS polypeptide sequence and the 4CL sequence is heterologous to thc host cell.

Preferably, the CHS polypeptide sequence is derived from one of the following: raspberry, petunia, grape, Medicago sativa, Arabidopsis thaliana, Antirrhinum majus, Zea mais and Petroselinum crispum, preferably a raspberry CHS sequence. Preferably, the CHS sequence is selected from the group consisting of: accession number AF292367, accession number AF400567, accession number X04080, accession number X76892, accession number L02902, accession number AF112086, accession number X0371O, accession number X60204, accession number V01538, a sequence shown in SEQ ID NO: 2, and a sequence having at least 75% sequence homology thereto.

Preferably, the 4CL sequence is a tobacco 4CL sequence. Preferably, the 4CL sequence is a sequence having an accession number U50846 or a sequence shown in SEQ ID NO: 3.

Preferably, the host cell is transformed with an expression vector encoding the chalcone synthase (CHS) polypeptide sequence and an expression vector encoding the 4-coumarate:CoA ligase (4CL) sequence, or an expression vector encoding both sequences.

Preferably, the host cell is a microbial host cell selected from the group consisting of F,scherichia spp, Saccharomyces spp, Pichia spp, Beauveria spp, Candida spp, Aspergillus spp, Bacillus spp, Pseudomonas spp, Hansenula spp, Klayveromyces spp, Schizosaccharomyces spp, Streptomyces spp, Lactococcus spp, Lactobacillus spp, Pediococcus spp, Kloeckera spp, Aureobasidium spp, and Streptococcus spp, preferably an E. colt, preferably strain BL21, or a Saccharomyces cerevisiae, preferably strain YPH 499, or a Bacillus subtilis host cell.

Preferably, a polypeptide expressed from the CHS polypeptide sequence has benzal acetone synthase (B AS) acti vity.

Preferably, the host cell is capable of producing benzalacetone when supplied with a precursor of benzalacetone, preferably p-coumaric acid or a source of p coumarc acid.

Preferably, the host cell has benzalacetone reductase (BAR) activity, preferably inherent benzalacetone reductase (BAR) activity.

Preferably, the host cell further comprises a benzalacetone reductase (BAR) sequence, preferably a heterologous BAR sequence, preferably shown as SEQ ID NO: 5.

Preferably, the host cell is capable of producing raspberry ketone when supplied with a precursor of raspberry ketone, preferably benzalacetone or a source of benzalacetone. Preferably, the host cell is capable of producing raspberry ketone when supplied with a precursor of raspberry ketone, preferably p-coumaric acid or a source of p-coumaric acid.

Preferably, the host cell further comprises a cinnamate-4-hydroxylase (C4H) sequence. Preferably, the host cell Is capable of producing benzalacetone or raspberry ketone, or both, when supplied with cinnamic acid or a source of cinnamic acid.

Preferably, the host cell further comprises a phenylalanine ammonia Iyase (PAL) sequence. Preferably, the host cell is capable of producing benzalacetone or raspberry ketone, or both, when supplied with phenylalanine or a source of phenylalanine.

There is provided, according to a second aspect of the present invention, a method of producing benzalacetone, the method comprising the steps of: (a) providing a host cell as described above; and (b) supplying the host cell with p-coumaric acid or a source of p-coumaric acid.

We provide, according to a third aspect of the present invention, a method of producing raspberry ketone, the method comprising the steps of: (a) providing a host cell as described; and (b) supplying the host cell with p-coumanc acid or a source of p coumanc acid.

Preferably, the host cell is as described, and the source of p-coumaric acid is cinnamic acid. Preferably, the host cell is a host cell as described, and the source of p coumaric acid is phenylalanine.

As a fourth aspect of the present invention, there is provided a method of producing raspberry ketone, the method comprising supplying a bacterium with benzalacetone or a source of benzalacetone.

We provide, according to a fifth aspect of the present invention, a bacterial method of producing raspberry ketone.

Preferably, the method comprises use of a host cell according to the first aspect of the invention.

In a sixth aspect of the present invention, there is provided a method of enabling benzalacetone synthase activity of a CHS polypeptide, the method comprising exposing the CHS polypeptide sequence to a microbial cellular environment.

According to an seventh aspect of the present invention, we provide use of a CHS polypeptide as a benzalacetone synthase, the CHS polypeptide being in a microbial cellular environment.

We provide, according to an eighth aspect of the invention, use of a CHS polypeptide in a method of production of benzalacetone or raspberry ketone, or both, preferably In which the CHS polypeptide is in a microbial cellular environment.

There is provided, in accordance with a ninth aspect of the present invention, a nucleic acid sequence comprising the nucleic acid sequence shown as SEQ ID No 1 or a variant, homologue or derivative thereof having at least 98% homology thereto.

As a tenth aspect of the invention, we provide a polypeptide comprising the amino acid sequence shown as SEQ ID No 2, or a variant, homologue or derivative thereof having at least 99.5% homology thereto.

We provide, according to an eleventh aspect of the invention, a nucleic acid sequence comprising the nucleic acid sequence shown as SEQ ID No 3 or a variant, homologue or derivative thereof having at least 79% homology thereto.

According to a twelfth aspect of the present invention, we provide a polypeptide comprising the amino acid sequence shown as SEQ ID No 4 or a variant, homologue or derivative thereof having at least 99.5% homology thereto.

There is provided, according to a thirteenth aspect of the present invention, a nucleic acid sequence comprising the nucleic acid sequence shown as SEQ ID No 5 or a variant, homologue or derivative thereof having at least 82% homology thereto.

We provide, according to a fourteenth aspect of the present invention, a polypeptide comprising the amino acid sequence shown as SEQ ID No 6 or a variant, homologue or derivative thereof having at least 85% homology thereto.

There is provided, according to a fifteenth aspect of the present invention, an expression vector comprising a nucleic acid sequence according to the ninth aspect of the invention or according to the eleventh aspect of the invention or an expression vector comprising both a nucleic acid sequence according to the ninth and eleventh aspects of the invention.

Preferably, the expression vector further comprises a nucleic acid sequence comprising the nucleic acid sequence according to the thirteenth aspect of the invention.

We provide, according to a sixteenth aspect, an expression vector comprising a nucleic acid sequence according to the thirteenth aspect of the invention.

As an seventeenth aspect of the present invention, we provide an expression vector wherein the expression vector is pAC-4CL-CHS#1.

205 In a eighteenth aspect of the present invention we provide a host cell transformed with one or more expression vectors according to any one of the fifteenth or sixteenth aspects of the Invention.

We provide, according to a nineteenth aspect of the present invention a method of producing benzalacetone, the method comprising the steps of (a) providing a host 210 cell according to the eighteenth aspect of the Invention; and (b) supplying the host cell with p-coumarc acid or a source of p-coumaric acid.

As a twentieth aspect of the present invention, we provide a method of producing raspberry ketone, the method comprising the steps of (a) providing a host cell according to the eighteenth aspect of the invention; and (b) supplying the host cell 215 with p-coumaric acid or a source of p-coumaric acid.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the nucleotide sequence (SE Q ID No 1) of raspberry CHS and the polypeptide sequence (SE Q ID N o 2) encoded by the nucleotide sequence.

Figure 2 shows the nucleotide sequence (SE Q ID No 3) of tobacco 4CL and the 220 polypeptide sequence (SE Q ID N o 4) encoded by the nucleotide sequence.

Figure 3 shows a sequence alignment of the polypeptide sequences of known CHS and BAS proteins.

Figure 4 shows the nucleotde sequence (SE Q ID N o 7) and the polypeptides sequence (SE Q ID No 8) encoded by the nucleotide sequence of CHS*.

225 Figure 5 shows HPLC analysis of naringenin chalcone formation in yeast transformed with 4CL&CHS (CHS) or 4CL&CHS* (CHS*).

Figure 6 shows HPLC analysis of benzalacetone formation in yeast transformed with 4CL&CHS or 4CL&CHS*.

Figure 7 anion-exchange column showmg elusion fractions. The horizontal is 230 fraction number, the vertical is activity in arbitrary units (magenta line), and protein content (A280) in arbitrary units (black/blue line), and the red line is in M NaCL (the maximum is I M) Figure 8 SDS PAGE of a mixture comprising BAR activity. Proteins highlighted with the arrows have been sequenced.

235 Figure 9 shows the nucleotide sequence (SEQ ID No 5) of BAR and the polypeptide sequence (SEQ ID No 6) encoded by the nucleotide sequence.

Figure 10 shows BAR activity in E. cold which have not been transformed with a vector comprising BAR.

DETAII,ED DESCRIPTION

240 The present invention is based on the surprising demonstration that chalcone synthase (CHS) polypeptide sequences have benzalacetone synthase activity in a microbial cellular environment. We therefore provide a host cell comprising a chalcone synthase (CHS) sequence and a 4-coumarate:CoA ligase (4CL) sequence.

As demonstrated in the Examples, such a host cell is capable of producing 245 benzalacetone when supplied with a precursor thereof, for example, pcoumaric acid.

Additionally, we demonstrate the surprising finding that microbial cellular environments, such as the cellular environment of a host cell as described, have benzalacetone reductase (BAR) activity.

Therefore, as further demonstrated in the Examples, a host cell comprising a 250 chalcone synthase (CHS) sequence and a 4-coumarate:CoA ligase (4CL) sequence is capable of producing raspberry ketone when supplied with a precursor thereof, for example, p-coumaric acid.

In other embodiments, the host cell may further express, or be capable of expressing, other enzymatic activities in the raspberry ketone synthesis pathway, in 255 particular, upstream enzymes such as cinnamate-4-hydroxylase (C4H) and/or phenylalanine ammonia Iyase (PAL). This enables the host cell to be supplied with upstream precursors, for example, cinnamate or phenylalanine, as the case may be, for the production of benzalacetone andlor raspberry ketone.

In addition, we provide a number of novel sequences of both CHS and 4CL.

260 One advantage of the methods and compositions described here is that raspberry ketone can be produced in an economical way. Another advantage Is that the method of production of benzalacetone or raspberry ketone or both is not by a chemical process but Is by a cellular process. This is considered more acceptable by consumers, and is therefore "consumer friendly".

265 A further advantage of the methods and compositions described here is that the benzalacetone or raspberry ketone or both produced by the process as described here is suitable for use in aroma formulations in the food market, cosmetics, household products such as air fresheners, and in weight loss products.

The practice of the present invention will employ, unless otherwise indicated, 270 conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the hterature. See, for example, J. Sambrook, E. F. Fntsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, 275 F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide 280 Synthesis: A Practical Approach, Irl Press; D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Using Antibodies: A Laboratory Manual: Portable Protocol NO. I by Edward Harlow, David Lane, Ed Harlow (1999, Cold Spring Harbor Laboratory Press, ISBN 0- 87969-544-7); Antibodies: A 285 Laboratory Manual by Ed Harlow (Editor), David Lane (Editor) (1988, Cold Spring Harbor Laboratory Press, ISBN 0-87969-314-2), 1855, Lars-Inge Larsson "Immunocytochemistry: Theory and Practice", CRC Press inc., Baca Raton, Florida, 1988, ISBN 0-8493-6078-1, John D. Pound (ed); "Immunochemical Protocols, vol 80", in the series: "Methods in Molecular Biology", Humana Press, Totowa, New 290 Jersey, 1998, ISBN 0-89603-493-3, Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B. Fernandes (2001, New York, NY, Marcel Dekker, ISBN 0-8247-0562-9); Lab Ref: A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0- 87969-630-3; and The Merck Manual of 295 Diagnosis and Therapy (17th Edition, Beers, M. H., and Berkow, R. Eds, ISBN: 0911910107, John Wiley & Sons). Each of these general texts is herein incorporated by reference. Each of these general texts is herein incorporated by reference.

CHAECONE SYNTHASE (CHS) POEYPEPTIDE We demonstrate that chalcone synthase (CHS) polypeptide sequences, can, in 300 some circumstances, have benzalacetone synthase (BAS) activity. This is the case when the chalcone synthase (CHS) polypeptide exists in an intracellular environment, for example a microbial cellular environment such as a bacterial intracellular environment.

This may be viewed as the unmasking or activation of a latent benzalacetone 305 synthase activity of a chalcone synthase polypeptide, which otherwise remains hidden.

Thus, in highly preferred embodiments the host cell as described here is one in which the chalcone synthase polypeptide is heterologous to the host cell.

The term "chalcone synthase polypeptide" as it is used in this document, refers to a polypeptide which is a member of the chalcone synthase superfamily (CHS 310 superfamily), as described in, for example, Yamazaki et al, 2001, Planta. 214(1):75-84.

The chalcone synthase polypeptides therefore include stilbene synthase (STS - see below).

Preferably, the chalcone synthase polypeptide has chalcone synthase activity when assayed outside of a microbial cellular environment, e.g., in vitro. For example, 315 in an assay described in the section "Assay to Determine Chalcone Synthase (CHS) Actvity" below. The term "chalcone synthase (CHS) activity" as used herein refers to an enzyme capable of catalysing the following reaction: 3 x malonyl-CoA + 4-coumaroyl-CoA = 4 x CoA + naringenin chalcone + 3 x CO2 320 Chalcone synthase has the IUBMB Enzyme Nomenclature number EC 2.3.1.74. Chalcone synthase may also be referred to as CHS, naringenin- chalcone synthase, flavanone synthase; 6'-deoxychalcone synthase; chalcone synthetase and DOCS.

In preferred embodiments, the chalcone synthase polypeptide may have minor 325 amounts of other enzymatic activities, such as benzalacetone synthase activity,. Thus, although the chalcone synthase polypeptide when assayed in vitro may have other enzymatic activities, its primary activity will be chalcone synthase activity. In other words, the primary product of the chalcone synthase when assayed in vitro is Naringemn-Chalcone or Chalcone (i.e., 4,2',4',6'-tetrahydroxychalcone) 330 In other preferred embodiments, the chalcone synthase polypeptide, or a nucleic acid sequence encoding it, has one or more sequence motifs which are characteristic of chalcone synthase activity. Preferably, such sequence motifs may include motifs conserved In the chalcone synthase family.

Diagnostic domains for chalcone synthase polypeptides are defined by the 335 following PFAM accession numbers: PF00195 (Chalcone and stilbene syntheses, N terninal domain) and PF02797 (Chalcone and stilbene syntheses, C-terminal domain).

These PFAM motifs are described at http://www.sanger.ac.uk/ci bin/Pfam/getacc?PF00195 and http://www.sancer.ac.uklcibin/Pfam/getacc?PF02797 respectively. Preferably, the chalcone synthase polypeptide comprises at least one, 340 preferably both, of these domains.

In highly preferred embodiments, the chalcone synthase polypeptide comprises a conserved cysteine residue, located in the central section of the protein sequence at position 169, which has been shown to be essential for the catalytic activity of the enzyme, and is thought to represent the binding site for the 4-coumaryl-CoA group 345 (Lanz et al, 1991, J. Biol. Chem., Vol. 266, Issue 15, 9971-9976).

Another diagnostic domain of chalcone synthase polypeptides is defined by the PROSITE pattern PS00441 (i.e., R-[LIVMFYS]-x-[LIVM]-x-[QHG]-x-G-C-[FYNA][GA]-G-[GA]-[STAV]-x-[LIVMF]-[RA]). Preferably, the chalcone synthase polypeptide comprises such a motif, as an alternative, or in addition, to the PFAM 350 motifs.

Preferably a chalcone synthase polypeptide sequence as used here is derived from one of the following: raspberry, petunia, grape, Medicago saliva, Arabidopsis thaliana, Antirrhinum majus, Zea mais and Petroselinum crispum. More preferably the chalcone synthase polypeptide as used here is a raspberry chalcone synthase 355 polypeptide.

Examples of chalcone synthase polypeptides which may be used in the methods and compositions described here include, but are not limited to the chalcone synthase polypeptides encoded by the following nucleotide sequences: accession number AF292367, accession number AF400567, accession number X04080, 360 accession number X76892, accession number L02902, accession number AF112086, accession number X03710, accession number X60204, accession number V01538, a sequence shown in SEQ ID NO: 2. Preferably the polypeptide comprising SEQ ID No 2 is encoded by a nucleotide sequence comprising the sequence shown as SEQ ID No 1.

365 Specifically, the chalcone synthase polypeptide may comprise accession number L02902 from Medicago saliva, accession number AF112086 from Arabidopsis thaliana, accession number X03710 from Antirrhinum majus (Snapdragon), accession number X60204 from Zea mats (corn) or accession number V01538 from Petroselinum crispum (parsley). Other examples of chalcone synthase 370 polypeptides are set out below, in particular at Example 3.7. Variants, homologues, derivatives and fragments of any of these sequences may also be employed.

In another embodiment, the term "chalcone synthase polypeptide" includes polypeptides which have stilbene synthase activity in vitro. Stilbene syntheses catalyse a condensation reaction of p-coumaroyl-CoA and three C(2)-units from malonyl-CoA 375 to produce resveratrol (Yamaguchi et al, 1999, FEBS Lett 460(3):457- 61). For example, stilbene synthase from Vitis vinifera (grape, accession number X76892) has benzalacetone synthase activity in vivo in a microbial cellular environment. Thus, host cells expressing stilbene synthase from grape, together with 4-CL may be used for the production of benzalacetone and/or raspberry ketone as described in this document.

380 For the avoidance of doubt, the term "chalcone synthase polypeptide" specifically does not include benzalacetone synthase polypeptides, for example, those descrbed in Abe et al, 2003, J Biol Chem. 2003 Jul 4; 278(27):25218-26; Kumar and Ellis, 2003, Phytochemistry 62(3):513-26; Abe et al, 2002, Org Lett;4(21):3623-6; BoreJsza-Wysocki et al, 1996, Plant Physiol, 110(3):791-799 and Abe et al, 2001, Eur 385 J Biochem 268(11):3354-9.

BENZAEACETONE SYNTHASE (BAS) ACTIVITY According to the methods and compositions described here, a chalcone synthase polypeptide can, in certain circumstances, e.g., when expressed in viva, preferably in a microbial cellular environment, have benzalacetone synthase (BAS) 390 activity.

By benzalacetone synthase activity, we mean the ability of a polypeptide (enzyme) to catalyse a one-step decarboxylative condensation of 4coumaryl-CoA with malonyl-CoA to produce benzalacetone. Benzalacetone synthase (BAS) has the IUBMB Enzyme Nomenclature number EC 2.3.1.-.

395 In some embodiments, the chalcone synthase polypeptide when expressedin microbial cellular environment has an increased benzalacetone synthase activity when compared to an in vitro environment. In preferred embodiments, the chalcone synthase polypeptide when expressed in a microbial cellular environment acquires a benzalacetone synthase activity which was not previously detectable in an in vitro 400 environment.

Preferably, a host cell expressing the chalcone synthase polypeptide (whether or not it expresses any other enzymes) is capable of converting at least some coumaryl-CoA and malonyl CoA to benzalacetone. Alternatively, or in addition, such a host cell which further expresses 4coumarate:CoA ligase (4-CL) is capable of 405 converting at least some p-coumaric acid to benzalacetone.

Thus, a host cell such as E cold BL21 which expresses 4-coumarate:CoA ligase (4-CL), as described In the Examples, together with a chalcone synthase polypeptide, is capable of producing at least O. l lug of benzalacetone per 50ml culture when cultured m the conditions described in Example 1.7 below, the sample being made 410 from 10 ml of culture with an optical density at 600 nm of 0.4 resuspended in SO ml of LB supplied with 20 g/ml chloramphenicol and 1 mM IPTG and 3 mM p-coumaric acid and grown overnight at 28 C and 250 rpm.

The chalcone synthase polypeptide, when expressed In such a host cell, may retain some of its chalcone synthase activity. That is to say, the chalcone synthase 415 polypeptide may have both chalcone synthase activity, as well as benzalacetone synthase activity in the microbial cellular environment, i. e., it may be capable of producing both naringenin-chalconc, as well as benzalacetone as end products from 4 coumaryl-CoA and malonyl-CoA. What is important, however, is that the benzalacetone synthase activity of the chalcone synthase polypeptide is higher in the 420 microbial cellular environment than outside it, e.g., in its native environment, or in vitro.

In preferred embodiments, the enzyme produces more benzalacetone than naringenin-chalcone mass for mass, or in terms of molar equivalents. In highly preferred embodiments, the majority of the product, preferably 90% or above by mass 425 or molar equivalents, is benzalacetone.

4-CoUMARATE:CoA LIGATE (4CL) The host cell comprises a 4-coumarate:CoA ligase (4-CL) sequence, in addition to the chalcone synthase polypeptide sequence. In highly preferred embodiments the host cell as described here is one in which the 4-coumarate:CoA ligase (4-CL) is 430 heterologous to the host cell.

As used herein the term "4-coumarate:CoA ligase (4CL)" refers to a polypeptide capable of catalysing the following reaction: ATP + 4coumarate + CoA = AMP + diphosphate + 4-coumaroyl-CoA 4-coumarate:CoA ligase has the IUBMB Enzyme Nomenclature number EC 435 6.2.1.12. An assay for detcrminng 4-coumarate:CoA ligase is set out below at the section "Assay to Determine 4-Coumarate:Coa Ligase (4cl) Activity".

4-coumarate:CoA ligase may also be referred to as 4CL, 4-coumaroyl-CoA synthetase; p-coumaroyl CoA ligase; p-coumaryl coenzyme A synthetase; pcoumaryl CoA synthetase; p-coumaryl-CoA ligase; feruloyl CoA ligase; hydroxycinnamoyl CoA 440 synthetase; 4-coumarate:coenzyme A ligase; caffoolyl coenzyme A synthetase; p hydroxycinnamoyl coenzyme A synthetase; feruloyl coenzyme A synthetase; sinapoyl coenzyme A synthetase; 4-coumaryl-CoA synthetase; hydroxycinnamate:CoA ligase; p-coumaryl-CoA ligase; andp-hydroxycinnamic acid:CoA ligase.

4-coumarate:CoA ligase (4-CL) sequences suitable for use in the methods and 445 compositions described here may be derived from Streptomyces coelicolor, Larix larcina, Arabidopsis thaliana, Petroselinum crispum, Oryza sativa and Rhodobacter sphaeroides. Preferably the 4-CL sequence is selected from the group comprising: accession number U50846, accession number NP_628552, accession number AAQ05337, accession number P14913, accession number NP_849844, acession 450 number Pl4913, accession number JU0311 and accession number 054075. In highly preferred embodiments, the 4-coumarate:CoA ligase (4-CL) sequence is a tobacco 4CL sequence, preferably a sequence having an accession number U50846. The 4-CL sequence can have a sequence as shown in SEQ ID NO: 3.

Variants, homologues, derivatives and fragments of any of these sequences 455 may also be employed.

HOST CEEE

We describe a host cell comprising a chalcone synthase (CHS) polypeptide sequence and a 4-coumarate:CoA ligase (4CL) sequence. The host cell may be used to produce benzalacetone and raspberry ketone. In addition, we describe the use of a CHS 460 polypeptide as a benzalacetone synthase (BAS) in a microbial cellular environment.

Furthermore, we describe the use of a CHS polypeptide In a method of production of benzalacetone or raspberry ketone or both.

In a preferred embodiment, the host cell as described here is one in which one or both of the CHS sequence and the 4CL sequence is heterologous to the host cell.

465 The term "heterologous to the host cell" as used herein refers to a sequence which is derived from a separate genetic source, preferably a different individual, strain or species, to that of the host cell.

Chalcone Synthase Sequence A host cell which is useful in the methods and compositions described here 470 comprises a chalcone synthase sequence and/or is capable of expressing a chalcone synthase polypeptide.

Preferably the CHS sequence as used here is derived from one of the following: raspberry, petunia, grape, Medicago saliva, Arabidopsis thaliana, Antirrhinum majus, Zea mais and Petroselinum crispum. More preferably the CHS sequence as used here 475 is a raspberry CHS sequence.

In another embodiment, preferably the CHS sequence used here is selected from the group consisting of: accession number AF292367, accession number AF400567, accession number X04080, accession number X76892, accession number L02902, accession number AF112086, accession number X03710, accession number 480 X60204, accession number V01538, a sequence shown in SEQ ID NO: 1, and a sequence having at least 75% sequence homology thereto.

4-coumarate:CoA ligase (4-CL) A host cell which is useful in the methods and compositions described here further comprises a 4-coumarate:CoA ligase (4-CL) sequence and/or is capable of 485 expressing a 4-coumarate:CoA ligase (4-CL) polypeptide.

Preferably, as used here, the 4CL sequence is a tobacco 4CL sequence. The term "the 4CL is a tobacco sequence" as used herein refers to the 4CL sequence bemg derived from tobacco (Nicotiana spp, preferably Nicotiana tabacum (cv. Samsung)).

Preferably the 4CL sequence as used here is a sequence having an accession 490 number U50846 or a sequence shown in SEQ ID NO: 3.

The host cell comprises the sequences in such a way that it expresses either or preferably both the chalcone synthase polypeptide and the 4-coumarate:CoA ligase (4- CL) polypeptide. This may be achieved by any means known in the art, for example, by transformation of the host cell with an expression vector comprising the chalcone 495 synthase (CHS) sequence and an expression vector comprising the 4- coumarate:CoA ligase (4CL) sequence. For convenience, an expression vector capable of expressing both polypeptides may be used to transform the host cell. Expression of the two polypeptides in such an expression vector may be driven from separate promoters, or by a common promoter (optionally through the use of an internal ribosome entry site 500 (lRES)).

Benzalacetone reductase (BAR) The term "benzalacetone reductase (BAR) activity" as used here refers to a sequence which catalyses the formation of raspberry ketone from benzalacetone.

Preferably, therefore, the host cell is one in which the host cell has benzalacetone 505 reductase (BAR) activity. An assay to determine BAR actvity is described below.

As demonstrated in the Examples, host cells such as microbial, preferably bacterial, host cells, comprise inherent BAR activity. In a preferred embodiment, therefore, the host cell comprises a BAR activity which is inherent benzalacetone reductase (BAR) activity. The term "inherent" as used here refers to the host cell 510 having benzalacetone reductase activty without the need, for example, for the host cell to be transformed with a benzalacetone reductase sequence.

In certain embodiments, however, it may be preferable to provide benzalacetone reductase activity to the host cell, for example, where the endogenous activity is weak or absent. In such a case, the host cell is one in which the host cell 515 further comprises a benzalacetone reductase (BAR) sequence. More preferably the BAR sequence is a heterologous BAR sequence. Preferably the heterologous BAR sequence is a raspberry BAR sequence. Even more preferably the BAR sequence comprises a sequence shown as SEQ ID NO: 5.

As used here the term "benzalacetone reductase (BAR) sequence" refers to a 520 sequence having benzalacetone reductase activity. As used here the term "heterologous BAR sequence" refers to a sequence having BAR activity which is derived from a separate genetic source or species to that of the host cell.

BAR activity can be determined for a sequence using the assay detailed below.

Preferably the BAR sequence as used here is derived from one of the 525 following: raspberry, strawberry, birch, Arabidopsis, corn, bacteria and fungi. More preferably the BAR sequence as used here is derived from raspberry.

Nature of Host Cell In one embodiment, preferably the host cell is a microbial host cell.

In a preferred embodiment the host cell is one in which the host cell is a 530 microbial host cell selected from the group consisting of Escherichia spp, Saccharomyces spp, Pichia spp, Beauveria spp, Candida spp, Aspergillus spp, Bacillus spp, Pseudomonas spp, Hansenula spp, Klayveromyces spp, Schizosaccharomyces spp, Streptomyces spp, Lactococcus spp, Lactobacillus spp, Pediococcus spp, Kloeckera spp, Aureobasidium spp, and Streptococcus spp.

535 Preferably the microbial host cell used here is an E. cold host cell. Preferably the E. cold host strain provides a source of T7 polymerase. Preferably, this is as a result of the host cell comprising a vector or plasmid which comprises a T7 polymerase sequence. More preferably the microbial host cell used here is an E. cold strain BL21.

Alternatively, preferably the microbial host cell used here is a Saccharomyces 540 cerevisiae host cell. Preferably the S. cerevisue host strain is deficient in Trp synthesis, preferably by having a TRP deletion or non- functional Trp mutation in its genome.

More preferably the microbial host cell used here is Saccharomyces cerevisiae strain YPH 499.

Alternatively, preferably the microbial host cell used here Is a Bacillus subtilis 545 host cell.

OPTIONAE ENZYMATIC ACTIVITIES OF HOST CEEE

As described below, in further embodiments, the host cell may be capable of expressing one or both of phenylalanine ammonia-lyase (PAL) and cinnamic acid 4- hydroxylase (C4H), for example, by being transformed with one or more expression 550 vectors capable of expressing such polypeptides.

Preferably the C4H sequence is derived from one of the following: Vigna radiate, Helianthu.s tuberosus, Arabidopsis thaliana, Catharanthus roseus and Citrus sinesis. Preferably the C4H sequence Is selected from the group consisting of: P37155, Q04468, P92994, S68204 and AAF66066.

SSS The term "PAL" as used here refers to phenylalanine amrnonia-lyase. This enzyme catalyses the reaction: L-phenylalanine = trans-cinnamate + NH3 PAL is also referred to as tyrase; phenylalanine deaminase; tyrosine ammonia lyase; and L-tyrosine ammonia-lyase. PAL has the IUBMB Enzyme Nomenclature number EC 4.3. l.S. This enzyme may also act on L-tyrosine to form p-coumaric acid 560 (Hwang et al, 2003), and the PAL enzyme may be referred to in some contexts as tyrosne ammonia Iyase (TAL). Thus, host cells which express PAL, in addition to chalcone synthase and 4-coumarate:CoA ligase (4-CL) may be used to produce benzalacetone and/or raspberry ketone when provided with tyrosine, or a source thereof. This is described m further detail below.

565 The term "C4H" as used here refers to cinnamic acid 4-hydroxylase. This enzyme catalyses the reaction: trans-cinnamate + NADPH + H+ + O2 = 4 hydroxycinnamate + NADP+ + H2O C4H has the IUBMB Enzyme Nomenclature number EC 1.14. 13.11. C4H is also referred to as trans-cinnamate 4monooxygenase; oxygenase, cinnamate 4-mono-; 570 CA4H; cytochrome P450 cinnamate 4-hydroxylase; cinnamate 4- hydroxylase; cinnamate 4-monooxygenase; cinnamate hydroxylase; cinnamic 4- hydroxylase; cinnamic acid 4-monooxygenase; cinnamic acid p-hydroxylase; hydroxylase, cinnamate 4-; t-cinnamic acid hydroxylase; trans-cinnamate 4- hydroxylase; and trans cinnamic acid 4-hydroxylase.

575 Host cells which express C4H, in addition to chalcone synthase and 4 coumarate:CoA ligase (4-CL) may be used to produce benzalacetone and/or raspberry ketone when provided with cinnamic acid, or a source thereof. This is described in further detail below.

PRODUCTION OFBENZALACETONE AND RASPBERRY KETONE FROM P-COUMARIC

580 ACID We describe a method of producing benzalacetone, the method comprsing the steps of: (a) providing a host cell comprising a chalcone synthase polypeptide (CHS) and a 4-coumarate:CoA ligase (4-CL) described n this document; and (b) supplying the host cell with p-coumaric acid or a source of p-coumarc acid.

585 The term "supplying the host cell with p-coumaric acid or a source of p coumaric acid" as used here refers to the supply, by any means, of pcoumaric acid or a source of p-coumaric acid to the host cell. One example of a supply of p-coumaric acid is to culture the host cell In a medium comprising p-coumaric acid.

Another example of a supply of a source of p-coumaric acid is to supply the 590 host cell with a source of p-coumaric acid in a culture medium. A source of p- coumaric acid in a culture medium is the supply of one or more precursors of p- coumaric acid to the culture medium.

In one embodiment, the host cell may be supplied with a source of pcoumaric acid comprising tyrosine. Tyrosine can be enzymatically converted in the host cell into 595 p-coumaric acid by the enzyme phenylalanine ammonia Iyase (PAL; Hwang et al, 2003, Appl. Environ. Mcrobiol. 69 (5): 2699-2706). In such an embodiment, the host cell further comprises phenylalanine ammonia Iyase (PAL) activity, whether endogenous, or as a result of it being transformed with an exogenous expression vector capable of expressing phenylalanine ammonia Iyase (PAL).

600 In another embodiment, the host cell may be supplied with a source of p coumaric acid comprising cinnamic acid. Cinnamic acid can be enzymatically converted in the host cell into p-coumaric acid by the enzyme cinnamate-4 hydroxylase (C4H). Accordingly, the host cell comprises further cinnamate-4 hydroxylase (C4H) activity, whether endogenous, or as a result of it being transformed 605 with an exogenous expression vector capable of expressing cinnamate-4- hydroxylase (C4H).

In yet another embodiment, the host cell may be supplied with a source of p coumaric acid comprising phenylalanine. Phenylalanine can be enzymatically converted in the host cell into cinnamic acid by the enzyme phenylalanine ammonia 610 Iyase (PAL); in turn cinnamic acid can be enzymatically converted into p-coumaric acid by the enzyme cinnamate-4-hydroxylase (C4H). Accordingly, the host cell further comprises and cinnamate-4-hydroxylase (C4H) activity, whether endogenous, or as a result of it being transformed with one or more exogenous expression vectors capable of expressing cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia Iyase 615 (PAL).

As shown below, we demonstrate that microbial cellular environments, such as the cellular environment of a host cell as described, have benzalacetone reductase (BAR) activity. Benzalacetone reductase is capable of converting benzalacetone to raspberry ketone. Accordingly, each of the above embodiments is also capable of 620 producing raspberry ketone.

PRODUCTION OF RASPBERRY KETONE FROM BENZAEACETONE

It is furthermore evident that host cells as described here can be used to produce raspberry ketone, provided that they are supplied with benzalacetone or a source of benzalacetone. This arises as a result of our demonstration that microbial 625 cellular environments, such as the cellular environment of a host cell as described, have benzalacetone reductase (BAR) activity.

The term "supplying a microbial organism with benzalacetone or a source of benzalacetone" as used here refers to the supply, by any means, of benzalacetone or source of benzalacetone to a microbial organism. One example of a supply of 630 benzalacetone is to culture the microbial organism in a medium comprising benzalacetone. An example of a supply of a source of benzalacetone Is the supply of one or more precursors of benzalacetone to a culture medium comprising the microbial organism.

In one embodiment, the host cell may be supplied with a source of pcoumaric 635 acid comprising tyrosine. Tyrosine can be enzymatically converted in the host cell into p-coumaric acid by the enzyme phenylalanine ammonia Iyase (PAL; Hwang et al, 2003, Appl. Environ. Microbiol. 69 (5): 2699-2706). In such an embodiment, the host cell further comprises phenylalanine ammonia Iyase (PAL) activity, whether endogenous, or as a result of it being transformed with an exogenous expression vector 640 capable of expressing phenylalamne ammonia Iyase (PAL).

In such a host cell, tyrosine is enzymatically converted into p-coumaric acid by the enzyme phenylalanine ammonia Iyase (PAL); p-coumaric acid in turn is enzymatically converted into p-coumaryl CoA by the enzyme 4coumarate:CoA lease (4CL); p-coumaryl CoA in turn is enzymatically converted into benzalacetone by the 645 enzyme CHS. Raspberry ketone is accordingly produced.

In another embodiment, the host cell may be supplied with a source of pcoumanc acid comprising cinnamic acid. Cinnamic acid can be enzymatically converted in the host cell into p-coumaric acid by the enzyme cinnamate-4hydroxylase (C4H). Accordingly, the host cell comprises further cinnamate4 650 hydroxylase (C4H) activity, whether endogenous, or as a result of it being transformed with an exogenous expression vector capable of expressing cinnamate-4-hydroxylase (C4H).

In such a host cell, cinnamic acid is enzymatically converted into pcoumaric acid by the enzyme cinnamate-4-hydroxylase (C4H); p-coumaric acid in turn is 655 enzymatically converted into p-coumaryl CoA by the enzyme cinnamate-4- hydroxylase (4CL); p-coumaryl CoA in turn is enzymatically converted into benzalacetone by the enzyme CHS. Raspberry ketone is accordingly produced.

In yet another embodiment, the host cell may be supplied with a source of p- coumaric acid comprising phenylalanine. Phenylalanine can be enzymatically 660 converted in the host cell into cinnamic acid by the enzyme phenylalanine ammonia Iyase (PAL); in tunn cinnamic acid can be enzymatically converted into p-coumaric acid by the enzyme cinnamate-4hydroxylase (C4H). Accordingly, the host cell further comprises and cinnamate-4-hydroxylase (C4H) activity, whether endogenous, or as a result of it being transformed with one or more exogenous expression vectors capable 665 of expressing cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia lyase (PAL).

In such a host cell, phenylalanine is enzymatically converted in the microbial orgamsm into cinnamic acid by the enzyme phenylalanine ammonia Iyase (PAL); cinnamic acid can be enzymatically converted into p-coumaric acid by the enzyme 670 cnnamate-4-hydroxylase (C4H); p-coumaric acid in turn Is enzymatically converted into p-coumaryl CoA by the enzyme cinnamate-4- hydroxylase (4CL); p-coumaryl CoA in turn is enzymatically converted into benzalacetone by the enzyme CHS.

Raspberry ketone is accordingly produced.

The phrase "microbial cellular environment" refers to in an in viva 675 environment wherein the in viva environment is a microbial cell. The microbial cell may be a yeast or a bacterium.

ASSAYS TO DETERMINE CHAECONE SYNTHASE (CHS) ACTVITY A quantitative assay of CHS activity in an extract can be performed as described in BorejszaWysocki & Hrazdina 1994, and Kumar & Ellis 2003. These 680 assays lead to activities of CHS enzyme expressed as nmol incorporated malonyl CoA per milligram protein per minute.

ASSAYS TO DETERMINE 4 COUMARATE:COA LIGASE (4CE) ACTIVITY A quantitative assay for 4-CL activity is described by Lee & Douglas (1996) and Knobloch KH & Hahlbrock K. (1977; 4-Coumarate:CoA ligase from cell 685 suspension cultures of Petroselinum hortense Hoffm. Partial purification, substrate specificity, and further properties. Arch Biochem Biophys. 184(1):237-48). These assays lead to activities of 4-CL activity expressed as millimole product (coumaroyl CoA) formed per kg protein per second (mkat Ego) ASSAYS TO DETERMINE BENZAEACETONE SYNTHASE (BAS) ACTIVITY 690 A quantitative assay for BAS is described by Abe et al., 2001. BAS activity is expressed as mole malonyl CoA incorporated in benzalacetone per mole protein per minute.

ASSAY TO DETERMINE BENZALACETONE REDUCTASE (BAR) ACTIVITY Samples can be analysed for the presence of BAR activity by the standard BAR 695 assay (such as BoreJsza & Hrazdina 1994). This assay can be used to determine if a cell or a sequence is capable of converting benzalacetone into raspberry ketone by determining the amount of raspberry ketone in samples which have been, for example, cultured in a medium supplemented with benzalacetone or cultured in a medium which has not been supplemented with benzalacetone.

700 Of each sample, 200 Al is mixed with 20 pi of substrate solution (containing 0.8 mg/ml p-hydroxyphenylbutenone) and 10,ul NADPH solution (containing 10 mg/ml NADPH), and incubated at 30 C for 45 minutes under gentle shaking.

Subsequently, the reaction mixture is added to l ml ethylacetate containing 1 log /ml 4 (4-methoxyphenyl)-2-butanone (Aldrich) as an internal standard. The mixture is 705 vortexed for 5 seconds, and centrifuged for 5 minutes at 1200xg. The ethylacetate phase is recovered, filtered over solid sodium sulphate to remove residual water. Of the samples, 2,uL is analysed by GC-MS using a gas chromatograph (5890 series II, Hewlett-Packard) equipped with a 30-m x 0.25-mm i.d., 0.25-m film thickness column (5MS, Hewlett-Packard) and a mass-selective detector (model 5972A, 710 Hewlett-Packard). The GC is programmed at an initial temperature of 45 C for 1 min. with a ramp of 10 C per min to 220 C and final time of 5 min. The injection port (splitless mode), interface, and MS source temperatures is 250 C, 290 C, and 180 C, respectively, and the He inlet pressure is controlled with an electronic pressure control to achieve a constant column flow of 1.0 mL per min. The ionisaton potential is set at 715 70 eV. Compounds are detected in the selected-ion-monitoring mode: m/z 107, 121 and 164.

Masses at m/z 107 and 164 are typical for raspberry ketone, while mass 121 is typical for the internal standard. The peak surface at m/z 107, elating around 15 minutes, is used as a measure for the amount of raspberry ketone formed, and 720 consequently for the BAR activity in the sample. The concentration of protein in a sample is determined using a Biorad Protein Assay, according to the instructions of the manufacturer.

To exclude errors caused by evaporation of the solvent during or after extraction, values are divided by the peak surface of the internal standard, measured at 725 m/z 121. The relative peak surface at ion 107 is compared to that of a standard of known quantity of raspberry ketone. The BAR activity is then expressed as nmol raspberry ketone formed per milligram protein per minute.

ASSAYS TO DETERMINE CINNAMATE-4-HYDROXYEASE ACTIVITY Activity of cinnamate-4-hydroxylase (C4H) is determined according to Urban 730 P. Mignotte C, Kazmaier M, Delorme F. Pompon D. (1997; Cloning, yeast expression, and characterization of the coupling of two distantly related Arabidopsis thaliana NADPH-cytochrome P450 reductases with P450 CYP73AS. J Biol Chem. 272(31):19176-86). Activity of C4H is expressed as moles cinnamate converted per mole protein per minute.

735 ASSAYS TO DETERMINE PHENYEAEANINE AMMONIA LYASE (PAL) ACTIVITY Activity of PAL is assayed according to descriptions in Nita-Lazar M, Chevolot L, Iwahara S. Takegawa K, Furmanek A, Lienart Y (2002; High performance liquid chromatography and photodiode array detection of ferulic acid in Rubus protoplasts elicited by O-glycans from Fusarium sp. M7-1. Acta Biochim. Poll 740 49 (4): 1019-27). Activity of PAL is expressed as ukat / kg protein, corresponding to umol product (cinnamic acid) product formed per kg protein per second.

SEQUENCE

We further disclose sequences encoding enzymes having the specfic properties as defined herein.

745 In particular, we disclose novel BAS sequences SEQ ID NO: 5 and 6, novel 4 CL sequences SEQ ID NO: 3 and 4 and novel BAR sequences SEQ ID NO: 7 and 8.

The term "sequence" as used herem refers to a nucleic acid sequence, an ohgonucleotide sequence, a nucleotide sequence or polynucleotide sequence, and variant, homologues, fragments and derivatives thereof (such as portions thereof). The 750 sequence may be of genomic or synthetic or recombinant origin, which may be double-stranded or single-stranded whether representing the sense or ant-sense strand.

The term "sequence" includes genomic DNA, cDNA, synthetic DNA, and RNA.

Preferably it means DNA, more preferably cDNA sequence coding for the enzymes described herein.

755 In a preferred embodiment, the sequence does not include the native sequence when in its natural environment and when it is linked to its naturally associated sequence(s) that is/are also in its/their natural environment. For ease of reference, we shall call this preferred embodiment the "non-native nucleotide sequence". In this regard, the term "native nucleotide sequence" means an entire nucleotide sequence that 760 is in its native environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter is also in its native environment. In one embodiment however, the amino acid sequence may be expressed by a nucleotide sequence in its native organism but wherein the nucleotde sequence is not under the control of the promoter with which it is naturally associated within that organism.

765 As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and/or the term "protein". In some instances, the term "amino acid sequence" is synonymous with the term "peptide". In some instances, the term "amino acid sequence" is synonymous with the term "enzyme".

VARIANTS/HOMOEOGUES/DERIVATIVES 770 The methods and compositions described here may be performed by variants, homologues and derivatives of any amino acid sequence of an enzyme or of any nucleotide sequence encoding such an enzyme.

Specifically, the methods and compositions described here may be performed by any combination of the following: a sequence having at least 99 or 99.5% 775 homology to SEQ ID No 1, a sequence having at least 80, 85, 90, 95, 96, 97, 98, 99 or 99.5% homology to SEQ ID No 3.

Preferably the variant, homologue or derivative thereof has at least 85, 90, 95, 96, 97, 98, 99 or 99.5% homology to SEQ ID No 5, and a sequence having at least 90, 95, 96, 97, 98, 99 or 99.5% homology to SEQ ID No 6.

780 Here, the term "homologue" means an entity having a certain homology with the amino acid sequences and the nucleotide sequences. Here, the term "homology" can be equated with "identity".

In the present context, a homologous amino acid sequence is taken to include an amino acid sequence which may be at least 75, 80, 85 or 90% identical, preferably 785 at least 95, 96, 97, 98, 99 or 99.5% identical to the sequence. Typically, the homologues will comprise the same active sites etc. - e.g. as the subject amino acid sequence. Although homologycan also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), it is preferred to express homology in terms of sequence identity.

790 In the present context, an homologous nucleotide sequence Is taken to include a nucleotide sequence which may be at least 75, 80, 85 or 90% identical, preferably at least 95, 96, 97, 98, 99 or 99.5% identical to a nucleotide sequence encoding an enzyme of as described here, e.g., chalcone synthase or 4-coumarate:CoA ligase (4 CL) (the subject sequence). Typically, the homologues will comprise the same 795 sequences that code for the active sites etc. as the subject sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), it is preferred to express homology in terms of sequence identity.

For the amino acid sequences and the nucleotide sequences, homology 800 comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.

% homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly 805 compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "uncapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.

Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one 810 insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved 815 by inserting "gaps" in the sequence alignment to try to maximise local homology.

However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible reflecting higher relatedness | between the two compared sequences - will achieve a higher score than one with many 820 gaps. "Affme gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when 825 using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum To homology therefore firstly requires the production of an optimal alignment, taking Into consideration gap penalties. A suitable computer 830 program for carrying out such an alignment is the GCG Wisconsin Bestfit package (Devereux et al 1984 Nuc. Acids Research 12 p387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 Short Protocols in Molecular Biology, 4th Ed Chapter 18), PASTA (Altschul et al., 1990 J. Mol. Biol. 403-410) and the GENEWORKS suite of 835 comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60).

However, for some applications, it is preferred to use the GCG Bestfit program.

A new tool, called BLAST 2 Sequences is also available for comparing protein and 840 nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nlm.nih.gov).

Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison.

Instead, a scaled similarity score matrix Is generally used that assigns scores to each 845 pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it Is preferred to use the public 850 default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

Altennatively, percentage homologies may be calculated using the multiple alignment feature in DNASIS_ (Hitachi Software), based on an algorithm, analogous to CLUSTAL (Higgins DO & Sharp PM (1988), Gene 73(1), 237-244).

855 Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

The sequences may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent 860 substance. Deliberate amino acid substitutions may be made on the basis of similarity in amino acid properties (such as polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues) and it is therefore useful to group amino acids together In functional groups. Amino acids can be grouped together based on the properties of their side chain alone. However it is more useful to 865 include mutation data as well. The sets of amino acids thus derived are likely to be conserved for structural reasons. These sets can be described in the form of a Venn diagram (Livingstone C.D. and Barton G.J. (1993) "Protein sequence alignments: a strategy for the hierarchical analysis of residue conservation" Comput.Appl Biosci. 9: 745-756)(Taylor W.R. (1986) "The classification of amino acid conservation" 870 J.Theor.Biol. 119; 205-218). Conservative substitutions may be made, for example according to the table below which describes a generally accepted Venn diagram grouping of amino acids.

Set Sub-set Hydrophobic F W Y H K M I L V A G C Aromatic F W Y H Aliphatic I L V | Polar WYHKREDCSTNQ Charged HKRED Positively H K R. charged, Negatively E D charged Small VCAGSPTND Tiny AGS

_

Polypeptides having homologous substitutions may also be used. Substitution and replacement are both used herein to mean the interchange of an existing amino 875 acid residue, with an alternative residue. Such substitutions may be like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Non- homologous substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as 880 B), norleucine ornithine (hereinafter referred to as O), pyrylalanine, thienylalanine, naphthylalanine and phenylglycine.

Replacements may also be made by unnatural amino acids.

Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups 885 such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or p-alanine residues. A further form of variation, involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art. For the avoidance of doubt, "the peptoid form" is used to refer to variant amino acid residues wherein the oc-carbon substituent group is on the residue's 890 nitrogen atom rather than the x-carbon. Processes for preparing peptides in the peptoid form are known in the art, for example Simon RJ et al., PEAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.

The nucleotide sequences suitable for use in the methods and compositions described here may include within them synthetic or modified nucleotides. A number 895 of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. It is to be understood that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance 900 the in viva activity or life span of nucleotide sequences described here.

We further describe the use of nucleotide sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof. If the sequence is complementary to a fragment thereof then that sequence can be used as a probe to identify similar coding sequences in other organisms etc. 905 Polynucleotides which are not 100% homologous to the sequences specifically described here, but are still suitable for use in the methods and compositions described here, can be obtained in a number of ways. Other variants of the sequences described herein may be obtained for example by probing DNA libraries made from a range of individuals, for example individuals from different populations. In addition, other 910 homologues may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein. Such sequences may be obtained by probing cDNA libraries made from or genomic DNA libraries from other species, and probing such libraries with probes comprising all or part of any one of the sequences in the attached sequence listings under 915 conditions of medium to high stringency. Similar considerations apply to obtaining species homologues and allelic variants of the polypeptide or nucleotide sequences specifically described.

Variants and strain/species homologues may also be obtained using degenerate PCR which will use primers designed to target sequences within the variants and 920 homologues encoding conserved amino acid sequences within the relevant sequences.

Conserved sequences can be predicted, for example, by aligning the amino acid sequences from several variants/homologues. Sequence alignments can be performed using computer software known in the art. For example the GCG Wisconsin PileUp program is widely used.

925 The primers used in degenerate PCR will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with single sequence primers against known sequences.

Alternatively, such polynucleotides may be obtained by site directed mutagenesis of characterised sequences. This may be useful where for example silent codon sequence 930 changes are required to optimise codon preferences for a particular host cell in which the polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.

Polynucleotides (nucleotide sequences) described here may be used to produce a 935 primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. Iabelled with a revealing label by conventional means using radioactive or non radioactive labels, or the polynucleotides may be cloned into vectors. Such primers, probes and other fragments will be at least 15, preferably at least 2O, for example at least 25, 30 or 40 nucleotides in length, and are also encompassed by the term polynucleotides 940 as used herein.

Polynucleotides such as DNA polynucleotides and probes may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques.

In general, primers will be produced by synthetic means, involving a stepwise 945 manufacture of the desired nucleic acid sequence one nucleotde at a time. Techniques for accomplishing this using automated techniques are readily available in the art.

Longer polynucleotides will generally be produced using recombinant means, for example using a PCR (polymerase chain reaction) cloning techniques. The primers may be designed to contain suitable restriction enzyme recognition sites so that the 950 amphfied DNA can be cloned into a suitable cloning vector.

EXPRESSION VECTOR

The methods and compositions described here preferably make use of expression vectors. Specifically, the following expression vectors are useful: An expression vector comprising a nucleic acid sequence encoding a chalcone 955 synthase (CHS) polypeptide and a nucleic acid sequence encoding a 4- coumarate:CoA ligase (4CL). Preferably, either or both of these sequences are heterologous to the host cell. The expression vector may optionally comprise a BAR sequence. Examples of each of these sequences are set out elsewhere in this document.

The expression vector may in particular comprise a nucleic acid sequence comprising 960 the sequence shown as SEQ ID No 1 or a variant, homologue or derivative thereof having at least 98o homology thereto. Alternatively, or in addition, it may comprise a nucleic acid sequence comprising the sequence shown as SEQ ID No 3 or a variant, homologue or derivative thereof having at least 79% homology thereto. Alternatively, or further in addition, the expression vector may comprise a nucleic acid sequence 965 comprising the sequence shown as SEQ ID No 5 or a variant, homologue or derivative thereof having at least 82% homology thereto.

Such expression vectors may be usefully transformed into a host cell to provide the beneficial benefits described in this document. In preferred embodiments, the expression vector is pAC-4CL-CHS#1, whose structure and construction is described

970 in the Examples.

To provide further advantages, the host cell may be further transformed with an expression vector encoding a PAL sequence. It may further be transformed with another expression vector eroding a C4H sequence. Of course, a single expression vector comprising both the PAL sequence and the C4H sequence may be employed.

975 This enables the use of upstream precursors as described elsewhere in this document.

The term "expression vector" means a construct capable of in vivo or in vitro expression.

In one embodiment, the expression vector is incorporated into the genome of a suitable host organism. The term "incorporated" preferably covers stable incorporation 980 into the genome.

A nucleotide sequence suitable for use in the methods and compositions described here may be present in a vector in which the nucleotide sequence is operably linked to regulatory sequences capable of providing for the expression of the nucleotide sequence by a suitable host organism.

985 The vectors for use may be transformed into a suitable host cell as described herein to provide for expression of a polypeptide as described.

The choice of vector e.g. a plasmid, cosmic, or phage vector will often depend on the host cell into which it is to be introduced.

The vectors suitable for use may contain one or more selectable marker genes 990 such as a gene, which confers antibiotic resistance e.g. ampicillin, kanamycin, chloramphenicol or tetracyclin resistance. Alternatively, the selection may be accomplished by co-transformation (as described in WO91/17243).

The vector may further comprise a nucleotide sequence enabling the vector to replicate in the host cell in question. Examples of such sequences are the origins of 995 replication of plasmids pUC19, pACYC177, pUB1 IO, pE194, pAMB1 and pIJ702.

REGULATORY SEQUENCES

In some applications, sequences suitable for use in the methods and compositions described here are operably linked to a regulatory sequence which is capable of providing for the expression of the nucleotide sequence, such as by the 1000 chosen host cell.

The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with 1005 the control sequences.

The term "regulatory sequences" includes promoters and enhancers and other expression regulation signals.

The term "promoter" is used in the normal sense of the art, e.g. an RNA polymerase binding site.

1010 Enhanced expression of the sequence encoding the enzyme may also be achieved by the selection of heterologous regulatory regions, e.g. promoter, secretion leader and terminator regions.

Examples of suitable promoters for directing the transcription of the nucleotide sequence in a bacterial, fungal or yeast host are well known in the art.

1015 TRANSFORMATION OF HOST CELLS As indicated earlier, the host organism can be a prokaryotic or a eukaryotic organism. An example of a suitable prokaryotic hosts is E. coli. An example of a suitable eukaryotic organism is S. cerevisiae.

Teachings on the transformation of prokaryotc hosts is well documented in the 1020 art, for example see Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press). If a prokaryotic host is used then the nucleotide sequence may need to be suitably modified before transformation - such as by removal of introns.

Filamentous fungi cells may be transformed using various methods known in 1025 the art - such as a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known. The use of Aspergillus as a host microorganism is described in EP 0 238 023.

Teachings on transforming filamentous fungi are reviewed in US-A-5741665 which states that standard techniques for transformation of filamentous fungi and 1030 culturing the fungi are well known in the art. An extensive review of techniques as applied to N. crassa is found, for example in Davis and de Serres, Methods Enzymol (1971) 17A: 79-143.

Further teachings on transforming filamentous fungi are reviewed in US-A5674707.

1035 A review of the principles of heterologous gene expression in yeast are provided in, for example, Methods Mol Biol (1995), 49:341-54, and Curr Opin Biotechnol (1997) Oct;8(5):554-60 In this regard, yeast - such as the species Saccharomyces cerevisiae or Pichia pastoris (see FEMS Microbol Rev (2000 24(1):45-66), may be used as a vehicle for 1040 heterologous gene expression.

A review of the principles of heterologous gene expression in Saccharomyces cerevisiae and secretion of gene products is given by E Hinchcliffe E Kenny (1993, "Yeast as a vehicle for the expression of heterologous genes", Yeasts, Vol 5, Anthony H Rose and J Stuart Harrison, eds, 2nd edition, Academic Press Ltd.).

1045 For the transformation of yeast, several transformation protocols have been developed. For example, a transgenic Saccharomyces can be prepared by following the teachings of Hinnen et al., (1978, Proceedings of the NationalAcademy of Sciences ofthe USA 75, 1929); Beggs, J D (1978, Nature, London, 275, 104); and Ito, H et al (1983, J Bacteriology 153, 163-168).

1050 CULTURING A culture may be prepared by techniques well known in the art such as those disclosed in US 4,621,058.

The medium used to cultivate the host cells as described here may be any conventional medium for growing the host cell. Suitable media are available from 1055 commercial suppliers or may be prepared according to published recipes (e.g. as described in the catalogues if the American Type Culture Collection.

The culture medium can be supplemented with, for instance, one or more of the following: phenylalanine, a precursor of phenylalanine, cinnamic acid, a precursor of cinnamic acid, tyrosine, a precursor of tyrosine, pcoumaric acid, a p-coumaric acid 1060 precursor, 4-coumaryl CoA, a precursor of coumaryl CoA, benzalacetone and a precursor of benzalacetone.

EXAMPLES

Example 0. General Materials and Methods In the methods described below, the following oligonucleotides are used: 1065 PolyT 5' TTTTTTTTTTTTTTT W RubCHSs 5' CTTTCTCCACAGACTCGAGATGGTGACCGTCGATGAAGTC RubCHSa 5' CAAGTGAACCCAGCCATGGTCAAGTTGAAGCTGCCACACTG CHSintern 5' CTCCGTGAAGCGCCTCATG SP6 5' ATTTAGGTGACACTATA 1070 T7 5' AATACGACTCACTATAG PRSETrev 5' TAGTTATTGCTCAGCGGTGG CHSmutS 5' GCCAAGCCATACTCGGTGACGGTGCTGC CHSmutA 5' CGTCACCGAGTATGGCTTGGCCCACAAG JulR3 5' TTYCCIWSIGARTTYGGIAAYGAYGTIGAYMG 1075 JulR6 5' GGIGTIACIHTIHTITAYGGIGAYHTITAYGGICA JulR7R 5' GTRTAIGTICCIADRTCYTCYTCYTTRTTRAAIADIGC BARFWDl 5' GTGAAGGCGATCAAACAGGTCGATG BARFWD2 5' GTAACATGCAGCTAGCCGATCAAACC BARREVl 5' ATAGCCTGCAAAGCAATTGCTGGAG 1080 BARREV2 5' CAAAGCAATTGCTGGAGACATAAGTGTAG Barstart 5' CTCGGATCCATGGCTCATCAGAAAAGCAAGG Barend 5' CACGAATTCTTAAACAAACTGGTCGAGGTACTCC NUP 5' AAGCAGTGGTATCAACGCAGAGT SmartIIA 5' AAGCAGTGGTATCAACGCAGAGTACGCggg 1085 UPM Long 5' CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT UPM Short 5' CTAATACGACTCACTATAGGGC 3'CDS 5' AAGCAGTGGTATCAACGCAGAGTAC(T)30VN 4CLDUETS 5' TATATCCATGGAGAAAGATACAAAACAGG 4CLINPLUS 5' AGGGACTTGTGACAAGCGTC 1090 4CLINMIN 5' CACGTCCTCGCTATGGATATAC 4CLANTIS 5' GCGGCCGCTTAATTTGGAAGCCCAGCAG CHSDUETS 5' TATATAGATCTTGTGACCGTCGATGAAG CHSDUETA 5' TATATGGTACCTCAAGTTGAAGCTGCCAC Wherein: 1095 V = (A, C or G) Y = (C or T) R = (A or G) H = (A, C or T) W = (A or T) 1100 M = (A or C) D = (A, G or T) S = (C or G) I = inosine g = ribonucleotide G 1105 The following Examples 1.1 to 1.16 describe the use of the chalcone synthase (CHS) gene from raspberry for the production of benzalacetone and raspberry ketone Example 1.1 Isolating RNA from raspberry Total RNA is isolated from ripe raspberries from the cultivar Tulameen. For 1110 this purpose, 5 grams of raspberries is frozen in liquid nitrogen and ground to powder using a coffee-grinder which is pre-cooled with liquid nitrogen. The powder is immediately transferred to a 250 ml centrifuge tube containing 50 ml extraction buffer (2 % CTAB, 100 mM Tris pH8.2, 1.4 M NaCI, 20 mM EDTA) pre-warmed to 65 C, then 50 pl 2-mercaptoethanol is added. The tube is incubated at 65 C for an hour and 11lS is agitated every 10 minutes. The tube is transferred to room temperature and left to stand until the tube is no longer warm. Then 50 ml chloroforrn/isoamylalcohol (24: l) is added, the mixture is vigorously agitated for 5 seconds and centrifuged at 12,000xg for 15 minutes at room temperature. The aqueous phase is transferred into another tube, to which 50 ml of chloroform/isoamylalcohol (24: 1) is added. The mixture is 1120 vigorously agitated for 5 seconds and centrifuged at 12,000xg for 15 minutes at room temperature. The watery phase is transferred into another tube, to which 33 ml of 10 M LOCI is added. After careful mixing, the tube is put at 4 C and left overnight. The next day, the tube is centrifuged at 20,000xg for 20 minutes at 4 C, and the supernatant is completely removed. The pellet is dissolved in 1 ml sterile TE buffer, and extracted 1125 with 1 ml phenol, phenol/chloroform/isoamylalcohol (24:24: 1) and chloroform/isoamylalcohol (24: 1). To the final waterphase, 0.11 volume of 3M sodium acetate and 3 volumes of 100 % ethanol are added, and the mixture is incubated overnight at -70 C. The next day the tube is centrifuged for 15 minutes at 14,000xg at 4 C. The supernatant is removed, the pellet washed with 70% ethanol and ar-dried for 1130 5 minutes. The pellet is dissolved in 20 pI water, and the concentration of RNA is measured by diluting this solution in water, and measuring the absorpton at 260 nm and 280 nm.

* Example 1.2 cDNA synthesis 1 fig of raspberry RNA is taken in a volume of 3 Ill, and mixed with 1 Al polyT 1135 primer (PolyT 5' mTTTVV) (10,uM). The mixture is incubated at 70 C for 2 minutes, and then immediately put on ice for 2 minutes. Then 2 pI Sxls' strand buffer (Invitrogen), 1 Al lOO mM DTT, 1 pi 10 mM dNTP, 1 pI Rnasin (Invitrogen) and 1 PI SST Reverse Transcriptase (Invitrogen) are added and the mixture incubated at 42 C for 90 minutes. After this, the mixture is inactivated for 7 1140 minutes at 70 C, and stored on ice.

Example 1.3 Amplifying a CHS gene from raspberry cDNA Primers RubCHSa and RubCHSs are designed to amplify the full protein coding region of an aromatic polyketide synthase from raspberry deposited in Genbank under number AF292367 and described by Zheng et al., 2001.

1145 RubCHSs 5' CTTTCTCCACAGACTCGAGATGGTGACCGTCGATGAAGTC RubCHSa 5' CAAGTGAACCCAGCCATGGTCAAGTTGAAGCTGCCACACTG The primers RubCHSa and RubCHSs are such that an XhoI - Ncol restriction digestion product can be ligated into vector pRSETA (Invitrogen), and results in an in- frame fusion gene with the His-tag encoded by this plasmid. The gene is amplified in a 1150 25 Ill mixture containing I pI raspberry cDNA (see section 1.2), 2.5 Ill 10xPfu buffer, 0.25 mM dNTP, 2 units of Pfu polymerase and 0.15 pM of oligonucleotides RubCHSa and RubCHSs. The mixture is heated to 95 C for 5 minutes, and then 25 cycles of 30 seconds at 92 C, 30 seconds at 63 C and 90 seconds at 72 C are performed on a thermocycler. After heating the mixture to 72 C for 5 minutes, the mixture is purified 1155 using Qiaquick PCR purification kit (Qiagen). Analysis on a 1 % agarose gel shows that a DNA fragment of 1136 bp is amplified, corresponding to the expected size of the coding region of the aromatic polyketide synthase gene.

Example 1.4 Cloning CHS into pRSETA About 1 lug of the fragment is cleaved with Ncol and XhoI in buffer React 3 1160 (Invitrogen), in parallel with 1 lag of p]asmid pRSETA. Both digestions are loaded on a 1 % agarose gel. After electrophoresis, fragments of the expected size (about 1100 bp for the PCR fragment and about 2900 Up for the vector DNA) are observed, and isolated from the gel using Qiaex II DNA isolation kit (Qiagen). Fragments are brought into 30 pI EB buffer (50 mM Tris pH = 8.5). To clone the aromatic polyketide 1165 synthase gene from raspberry into pRSETA, 1 pi of XhoI-NcoI cleaved pRSETA and soul of purified and cleaved PCR product are mixed with 3 1 5xligase buffer (Invitrogen) and 1 pi of T4 ligate (Invitrogen). The ligation mixture is incubated for 3 hours at 16 C and 10 pi of it is used for transfomnation of competent E. cold XL-1 Blue by standard procedures. The transfommation mixture is plated on 25 ml petri dishes 1170 containing LB medium, 1.5% technical agar and 100 g/ml ampicillin. After overnight incubation at 37 C, colonies are picked into 3 ml liquid LB medium with 100 1lg/ml ampicillin and grown overnight at 37 C shaking at 250 rpm. Plasmid is isolated from 1.5 ml of these cultures using the Qiagen plasmid isolation kit, and clones containing plasmids with inserts are identified by restriction digestion with Xhol and NcoI.

1175 Plasmid pRSETA-CHS#1 is identified in this way. The sequence of the inserted aromatic polyketide synthase gene is analysed using oligonucleotide T7 (5 AATACGACTCACTATAG), pRSETrev (5' TAGTTATTGCTCAGCGGTGG) and CHSintem (5' CTCCGTGAAGCGCCTCATG) using the dRhod Temminato RR mix of Applied Biosystcms and the recommended themmocycling program. The DNA 1180 sequence (SEQ ID No 1) and the translated protein (SEQ ID No 2) of the CHS are depicted in Fig. 1. In the translated protein, the polyketide synthase part of the fusion protein starts at residue 40 (basepair 118 in the DNA sequence): the preceding part comes from the pRSET vector and contains a Hiss tag and an express eptope. The protein is 98% identical to the aromatic polyketide synthaseprotein encoded by the 1185 gene that is used to design the primers, with 7 residues out of 391 differing. It is even more identical (99%, 3 out of 391 residues differ) to a protein called chalcone synthase 6 from Rubus idaeus with accession number AF400567, described by Kumar and Ellis (2003).

The obtained plasmid DNA Is used as template to amplify the CHS gene using 1190 oligonucleotides CHSDUETS and CHSDUETA. The isolated plasmid is diluted 1:200, and 1 Al of the dilution is used In an amplification reaction mix. The mix further contains 0.5 mM dNTP, 2.5 pi fox BD Advantage 2 PCR buffer (BD Bioscience), 0.5 pi 50x Advantage 2 polymerase mix (BD Bioscience) and 0.4 EM of oligonucleotides.

The amplification reaction mix Is incubated for 5 minutes at 94 C, and subsequently 1195 subjected to 10 cycles of 30 seconds at 94 C, 30 seconds at 55 C and 3 minutes at 72 C, and 20 cycles of 30 seconds at 94 C, 30 seconds at 55 C and 3 minutes at 72 C.

After these cycles, the mixture Is incubated at 72 C for 5 minutes, after which it is cooled to 10 C. The amplified product is purified using the Qiaquick PCR purification kit (Qiagen). The purified fragment (which is 950 bp, as analysed on a 1% agarose gel) 1200 are ligated into the pGEM-T easy vector, using the pGEM-T Easy Vector System I (Promega), and subsequently brought into E. cold XL-1 Blue cells by transformation according to standard procedures. Transformed cells are plated on LB-agar plates with 1lg/ml ampicillin. Of the resulting colonies after overnight incubation at 37 C, a few are grown in liquid culture. Clones containing plasmids with inserts are identified 1205 by restriction digestion with EcoRI. Plasmid pGEMT-CHS#1 is identified in this way.

The insert of this plasmid is sequenced using oligonucleotides T7, SP6 and CHSintern.

The sequence appears to be identical to the pRSETA CHS sequence, except for the restriction sites designed in the oligonucleotides.

Example 1.5 Amplifying a 4-CL-2 gene from tobacco leaf cDNA 1210 Isolating RNA from tobacco A young leaf is detached from a Nicotiana tabacum (cv. Samsung) plant and wounded by cutting it with a knife in small strips. Strips are incubated floating on water at room temperature for 2 hours, after which they are frozen in liquid nitrogen.

Frozen material is ground to powder with a mortar and pestle. 50 mg powdems used 1215 for total RNA isolation using the SV Total RNA Isolation System (Promega) according to the description supplied by the manufacturer. The total RNA is obtained in 50,ul water, and quantified by gel electrophoresis.

cDNA synthesis 1 log of tobacco RNA is taken In a volume of 3 pi, and mixed with 1 Al polyT 1220 primer (10,uM). The mixture is incubated at 70 C for 2 minutes, and immediately put on ice for 2 minutes. Then 2 soul 5xlst strand buffer (Invitrogen), 1 Al 100 mM DTT, 1 1 10 mM dNTP, I Al Rnasin (Invitrogen) and 1 pI SST Reverse Transcriptase (Invitrogen) are added and the mixture incubated at 42 C for 90 minutes. After this, the mixture is inactivated for 7 minutes at 70 C, and stored on ice.

1225 Amplifying a 4CL gene from tobacco cDNA The oligonucleotides 4CLDUETS, 4CLINMIN, 4CLINPLUS and 4CLANTIS are designed to amplify the full protein coding region of the 4CL-2 gene from tobacco as deposited in Genbank under number U50846 and described by Lee and Douglas, 1996. The primers 4CLDUETS and 4CLINM1N are used to amplify a +550 bp cDNA 1230 fragment, encoding the 5' region of the 4CL2 cDNA. The oligonucleotides 4CLINPLUS and 4CLANTIS are used to amplify a +900 bp cDNA fragment, encoding the 3'region of the 4CL-2 gene. Both amplifications are carried out as follows: a 25 pI mixture is made containing I HI tobacco cDNA (see sections 1.1 and 1.2 for details on how to obtain RNA from a sample and how to make cDNA), 2.5 1 1235 lOxPfu buffer, 0.25 mM dNTP, 2 units of Pfu polymerase and 0.15 pM of both oligonucleotides. The mixture is heated to 95 C for 5 minutes, and then 25 cycles of 30 seconds at 92 C, 30 seconds at 63 C and 90 seconds at 72 C are performed on a therrnocycler. After heating the mixture to 72 C for 5 minutes, the mixture is purified using Qiaquick PCR purification kit (Qiagen). Analysis on a 1 % agarose gel showed 1240 that DNA fragments of the expected size are amplified. Both fragments are cloned into pGEMT-easy (Promega) as described by the manufacturer, and are sequenced using oligonucleotides T7 and SP6. The clone containing the 5' fragment of the 4CL gene is termed pGEMT-4CL5, the clone containing the 3' fragment of the 4CL gene is termed pGEMT-4CL3. The fragments partially overlap, and, when connected at the SalI 1245 restriction sites, make a full-length sequence (SEQ ID No 3) as shown in Fig. 2. The cDNA encodes a protein (SEQ ID No 4) that Is 99% identical (539 out of 542 residues) to the 4CL-2 protein described by Lee and Douglas (1996).

Example 1.6 Cloning CHS and 4CL-2 into pAC-DUET Of the pGEMT-CHS#1 plasmid, described in section 1.4, 5 ill is restriction 1250 digested with Bgl II restriction enzyme in buffer React 2 (Invitrogen) for 2 hours, then purified using Qiaquick PCR purification kit, then digested with restriction enzyme Kpn I in buffer React 4 (Invitrogen). The digest is separated on a 1% agarose gel, and the + 1100 bp restriction fragment is isolated from gel. In parallel, the vector pACYC DUET (Novagen) is digested with the same enzymes using the same procedure. The 1255 CHS fragment is ligated into the pACYC-DUET according to standard procedures, and then transformed into competent XL-1 blue cells and selected overnight on chloramphenicol (30 microgram per ml) containing LB- agar plates. Colonies are inoculated into liquid LB medium, grown overnight at 37 C while shaking, and plasmid is isolated from the culture. The presence of the CHS gene in the pACYC 1260 DUET vector is verified by digestion with restriction enzymes Bgl II and Xho I, in buffer React 3 (Invitrogen). A positive plasmid is termed pAC-CHS#1.

Plasmid pAC-CHS#l is digested with restriction enzymes NcoI and NotI using React 3 buffer. The resulting vector DNA is isolated from a 1% agarose gel. At the same time the plasmid pGEMT-4CL5 is digested with restriction enzymes SalI and 1265 NcoI, and the plasmid pGEMT-4CL3 is digested with restriction enzymes SalI and NotI. Fragments of +550 bp (pGEMT-4CL5) and of +900 bp are isolated from a 1% agarose gel. The isolated fragments are mixed, and added to the digested pAC-CHS#1 vector, in the presence of ligase and ligase buffer. The ligation mix, after incubation on 16 C for 3 hours, is transformed to competent E. cold XL-1 blue, and transformants are 1270 selected on LB agar with chloramphenicol. The resulting colonies are inoculated into liquid medium, and, after ON growth, plasmid is isolated, and verified for the presence so of the entire 4CL2 gene by digestion with restriction enzymes Neol and Notl. A positive plasmd its termed pAC- 4CI,-CHS#l.

Example 1.7 Expression of (gHS and 4CL-2 in E. cold 1275 The pACYCDUET plasmid encodes both the 4CI, and the CHS protein behind the T7 promoter. This promoter is not recognsed by the bacterium, unless a gene encoding T7 polymerase Is introduced. In the case of stram E. cold BL21-CodonPlus RIL, the '1'7 polymerase is encoded on the chromosome oJ the bacterium, under control of the lee-promoter. Thus, the expression of proteins is not possible In normal cold 198() strains, while In [if. colt BL21 CodonPlus-RIL, the expression of fusion protein can be repressed by glucose, and Educed by IPTG. To improve this control, we provided In cold BL21 CodonPlus-RIL with plasmid pREP4 (Qiagen), which provides additional lee-repressor to the E. cold strain, and encodes a low level of kanamyen resistance.

1285 E. cold BL21 CodonPlus-RIL-pREP4 is made competent by growing the ceils overnight at 37"C and 250 rpm in LB with 1% glucose and 20,ug/ml kanamyein. The next day, the overnight culture Is diluted 100-fold m fresh LB medium with logo glucose until an optical density at 600 nm of 0. 4 is reached. 10 ml of culture Is centrifuged for 5 mmutes at 400xg. Supernatant Is discarded and replaced by 10 ml of 1290 an ce-cold solution of 10 mM CaCI2 and I mM Ttis-HCI pH = 7.5. Cells are resuspended and immediately centrii'ugecl again at 4()0xg t'or 5 minutes. After discarding the supernatant, ceils are resuspended In 2 ml of an ce-cold solution of 75 mM CaC12 and I mM Tis-HCl pH: = 7.5. After Incubation on Ice for at least 30 minutes, ceils can be used for plasmd transformation by standard procedures.

1295 Plasmids pAC-4CL-CHS#1 and pACYCDU-LT are used to transform these cells, and transt'onned colomes are selected on LB-agar plates supplied with 1% glucose, 20 g/ml kanamycin and 30 g/ml ehlorampheneol. Colonies are transferred to I ml liquid LB supplied with 1% glucose, 20,ug/ml kanamyen and 30 g/ml chloramphemcol and grown ovemgilt at 37"C and 250 rpm.

1300 The next day, a 75 mM solution of p-coumaric acid (Sigma) Is prepared In 0.1 N NaOI 1. After dissolving the coumarc acid, the solution Is neutralized to pH = 8 by adding 1 N HCI. The overn ght culture Is diluted 100-f'okt in 10 ml fresh LB medium with 1% glucose and 15 g/ml chlora',nphenicol until an optical density at 600 rim of' 0.4 IS reached. 10 ml of culture is centrifuged for 5 minutes at 400xg. Supernatant Is 1305 discarded and cells are resuspended m 5() ml of LB supplhed with 20 g/ml chloramphen',col and I mM IPTG and 3 mM p-coumar,c acid. Then the cultures are grown overnight at 28 C and 250 rpm.

The next day, the cultures are transferred to separation funnels, and 20 ml ethyl acetate Is added under vigorous mixing. The funnels are left to separate the phases for 1310 5 minutes, after which the lower phases are discarded. The upper phases are collected m centrifuge tubes, sonlcated for 10 minutes m a bath and centrifuged for 5 minutes at 1200xg. The clear ethyl acetate phases are transferred to fresh tubes. The ethyl acetate Is aspired under a nitrogen flow.

Example 1.8 Analysis of benzalacetone formation 1315 For analysis on HPLC, residuals of dried samples are resuspended n1 150 Al 100% methanol. Samples are Injected in the following order: pACYC-DUET culture extract; pAC-4CL-CHS#1 culture extract; benzalacetone standard; naringenln standard. 20 p1 of these samples is injected Into an HPLC system using a Luna 3u C18(2) 150x4.6 mm colu',nn (Phenomenex). The HPLC set-up is composed of a 1320 Waters 600 controller and a Waters 996 Photo Diode Array detector. 'l'he column Is used at 40 C, flow rate 1 ml / mln.'l'he products are eluted with a gradient, made t'rom but'fer A (0.1% formic acid in water) and buffer B (100 % acetonitril).

The gradient Is defined as follows: t=0 A=95% B=5/o 1325 t=30 A=75% B=25 70 t=3S A=70% B=30% t=37 A=50% R=50%o t=40 A=50'31o B=50'Y, t=42 A=95'7O B=5'%o 1330 t=47 A=95% B=5%o The benzalacetone standard elutes at 27 minutes, and maximal absorption of this compound Is observed at 320 nm. The naringemn standard elutes after 41 minutes, having maximal absorption at 288 nm. The extract of pAC-4C[,-CElS#1 gives a peak at 27 minutes, In the region where benzalacotone clutes. This peak has an 1335 absorption spectrum exactly matching that of benzalacetone. Mass spectrometry confirms the presence of a compound with mass 163 ([Mel, corresponding to the mass of benz.alacetone). Another clear peak is observed at 41 minutes, having the same absorption spectrum as narmgenm. Both peaks are absent from the sample of the pACYC-DUET culture extract.

134() This shows that the raspberry CHS, when expressed In combination with the 4CL-9 gene, Is active m E. coli, and converts coumaric acid into both benzalacetone and narngemn. Therefore it Is apphcable as a tool to produce raspberry ketone m a microbial cellular environment.

Example 1.9 Sequence alignment 1345 Figure 3 shows a sequence ahgnment of the ammo acid sequences of known CHS and BAS proteins using CLUSTAL W (1.) multiple sequence ahgnment program. CHS Rubus Is part of SEQ ID No 2 as described here. CHSMedicago Is accession number AAA02824.1 and rlleum BAS Is AAK82894.1.

Example 1.10 Mutagenesis of CHS 1350 Mutagenesis of the 214 I.eu and 215 Phe ol'SFTQ H) No 2 into Be and Leu residues respectively Is earned out using standard techniques In the art.

To change the DNA of pRSETA-CHS#1 In SUCtl a way that it encodes tie and Leu at positions 214 and 215 ot'CI IS, instead ol' Leu and Phe, the sequence CTTGTGGGCCAAGCCTTGTTCGGTGACGGTGCTCCAG starting at position 747 1355 of the gene In figure I Is changed mto CTTGTGGGCCAAGCCaTacTCGGTGACG(iTGCTGCAG. (see Figure 4) Plasmd preparation of pRSETA-CHS#I are diluted 100 fold m water. Two PCR reactions are performed in parallel, using ().5 pi of the diluted plasmid as a template.

In one reaction, to the template Is added 2.5 1 1()xPfu buffer, ().25 mM dNTP, 2 units 1360 of Putt polymerase and 0.15 pM of oligonucleotides CE-ISmutA and RubCHSs to a final volume of 25 1.

In a second reaction, to the template Is added 2.5 1 l()xPfu buffer, 0.25 mM dNTP, 2 units of Pfu polymerase and 0.15 pM of olgonucleotides RubCHSa and Cl lSmutS to a Emil volume ol'25 1.

1365 The mixtures are heated to 95 C for 5 minutes, and then 25 cycles of 30 seconds 92 C, seconds 55 C and 90 seconds 72 C are performed on a themocycler.

The resulting products of reaction s #5 and #3 are analysed on a 1% agarose gel, and fragments of the predicted size (about 700 Up for the first reaction and about 600 bp for the second reaction) Identified.

1370 These fragments are punl'ied from gel with tl1e Q'aex 11 DNA punt'caton system mto HI EB buffer. 1()0 rig of the products ot'the first and second reactions are used as a template t'or fusion PCR, which consists of a total 25 Al IT1 which Is added to the templates 2.5 1 10xPfu buffer, ().25 rnM dNTP, 2 units of Pfu polymerase and 0.15 pM of olgonuclectdcs RubCHSa and KubCE1Ss. The mixture Is heated to 95 C for 5 1375 minutes, and then 25 cycles of 3() seconds 92 C, 30 seconds 55 C and 90 seconds 72 C arc performed on a thermocycler. The rcsultng products of the fusion PCR reaction arc analysed on a 1, agarosc gel, and a fragment of the predicted size (about 1300 bp) dentl'ed. This fragment Is purified using the Q'aquck PCR purification kit mto 40 1, of which 20 HI was cleaved with XhoI and Ncol restriction enzymes m 138() huft'cr React3 for 3 hrs at 37 C. After this, the DNA is pumiced using the Q'aquick PCR purification kit mto 40 Al EB buffer. 10 Al of the purified and digested PCR product Is ligated with 1 pI pRSE'l'A cleaved with NcoT and Xhol In 25 HI total volume with T4 ligase buffer (Invitrogcn) en T4 ligase (Invitrogen) for 2 hours at 1 6 C.

1385 The hgation-mx Is used for transt'ormation of competent XL- 1 Blue cells by standard procedures, and plated on LB-agar plates with 100 g/ml ampicillin. Of the resulting colonies after overnight mcubaton at 37 C, a few are grown In liquid culture. Clones containing plasmid.s with inserts are Identified by restriction digestion with Xhol and Ncol.

1390 The sequence of the inserted aromatic polyketide synthase gene in pRSETCHSMUT#1 (or pRSETCHS*) is analysed using olgonucleotide T7, pRSETrev and CHS'ntern.

Further the presence of' the changes as planned arc detected, while no other differences between pRSETCHS#1 and pRSETCHSmut#1 are observed.

I'he resultant mutated Cl IS, shown as SEQ ID Nos 7 and 8 (see f'igurc 4), Is 1395 herein referred to as CHS*.

Example 1.11 Cloning CIIS* and 4CI, into pAC-DUET The mutant CHS* gene and p4CL are cloned Into pAC-DUET vector In a manner analogous to that dcscrbcd m section 1.6.

Example 1.12 Expression of CHS* and 4CL in E. cold 1400 In addition k:. colt are transformed with the vector of 1.11 in a manner analogous to that clcscubed In sccton 1.7.

Mutant CHS* shows if vitro BAS activity and produced benzalacetone instead of naringenm chalcone.

Example 1.13 Expression of C118&4CL and (:HS*&4CI, in yeast 1405 For expression in yeast, the 4CL gene the mutant CTIS* gene and the 4CL gene & the mutant Cl lS k gene are introduced into the yeast expression vector pESC-Trp, which allows expression of both genes Educed by galactose. Competent cells for the yeast strain YPH499 are prepared according to the manual accompanying the Stratagene pESC Yeast Eptope Tagging Vectors (Stratagene, LaJolla, CA).

14]0 The 4CL-CHS expression vector is introduced in the yeast SaccI'aromyce.Y cerevi.siae strain YPII 499. In addition the 4CL-CHS expression vector is introduced in the yeast Saccharonyces cerevisiae strain YPH 499 The transformed cells are maintained by selection against Trp auxotrophy.

Cultures (10 ml) are grown m the presence of galaetose to induce recombinant gene 1415 expression, and p-eoumane acid (3 mM) Is added, after which the cultures are grown overnight at 30 C.

The cultures are extracted with ethyl acetate, and extracts are analysed on HPLC (see figures 5 and 6). 'I'he strain in which only vector pESC-Tp is introduced produces neither naringenn ehaleone nor benzalaeetone, as expected.

1420 The 4CL - CLIS stram shows production ol narngenm ehalcone, demonstrating that eoumarie acid enters the yeast cells, and Is used by the 4C1, enzyme to make eoumaryl CoA which can be used as a substrate by the CHS enzyme.

Suprtsmgly, the 4CL - CHS strain Is found to produce benzalacetone, In addition to narngemn ehaleone. Benzalaeetone Is compared to a standard, and showed an 1425 clentcal retention time and absorption spectrum (\max = 320 nary).

In the 4CL - ClIS* mutant we are not able to detect naringcmn chalcone.

Further, only a low amount calf benzalacetone Is observed as a small peak.

SG

QTOF-MS confirmed that benzalaeetone (CO) Is observed.

Example 1.1412xpression of CIIS&4CI, and CHS k&4CI in yeast and E. cold 1430 Table I shows the amounts ot'benzalacetone, r aspberry ketone, nanngenn and narngenin chalcone (narchalcone) produced by Fit cold and S. cerevi.siae transi'ormed with (I) the expression vector, (ii) the expression vector comprising CHS & 4CL and (us) the expression vector comprising CHS* & 4CL.

Table l: Products formed by micro-organsms ted with 3 mM p-eoumare acid Benzalacetone Raspberry ketone Narngenin Narichalcone (pg /50 ml) (119/50 ml) (g/50 ml) (9/50 ml) Bacteria Vector 0.07 0.05 0. 0 0.0 CHS* mutant 0.1 0.3 0.0 0.0 Yeast 5.4 14.2 22.0 0.0 Vector 0.0 n.d. 0.0 0.0 CHS* mutant 0.2 n.d. 0.0 0.0 CHS 3.0 n.d. 14.8 4.3 1435 (25 mg/50 ml).

In yeast raspberry ketone overlaps with a large peak from yeast which hampers proper detection by GC-MS analysis.

Example 1.15 Use of the chalcone synthase (CHS) gene from petunia for the production of raspberry ketone 1440As an example, the ehaleone synthase gene (aeeesson number X04080) from Petr.,ic'lybrila can be used in a bacterial environment to produce raspberry ketone.

For this purpose, RNA Is Isolated from flowers from Petunia using a procedure as described by Koes et aI. (198G). From this RNA, cDNA Is generated as described In section 1.2. From this cDNA the petunia CHS gene is amphfed using 1445 ohgonucleotdes PetFw and PetRev PetFw 5' TATATGGATCCAACAA't, GOTGACAGTCGAGGAG PctI:ev 5' ATATAC'FCGACT'TAAGTAGCAACACTGTGCACCAC For amplification a 95 Al mixture containing I Ill petunia cDNA contammg 1 log of cDNA 2.5 Al lOx BD Advantage 2 PCR buffer (BD Bioscience) 0.5 Ill 50x 1450 Advantage 2 polymerase mix (BD Bioscience) 0.25 mM dNTP and O.lS pM of oligonucleotdes PetFw and PetRev. The amplification reaction mix Is incubated for 5 minutes at 94"C and subsequently subjected to to cycles of 30 seconds at 94 C 30 seconds at 52 C and 3 mmutes at 72 C and 20 cycles of 30 seconds at 94"C 30 seconds at 55 C and 3 minutes at 72"C. After these cycles the mixture Is Incubated at 1455 72 C l'or 5 minutes after which it Is cooled to lO"C. The amphl''ed product should be purified using the Qiaquck PCR purification kit (Qiagen) . Analysts on a I 70 agarose gel shows that a DNA fragment of about l 190 bp is amplified corresponding to the expected size of the coding region -,f'the petunia chalcone synthase gene.

When 1 log of' the purified fragment Is obtained by pooling PCR reactions the 1460 purified fragment Is ligated Into the pGEM-T easy vector using the pGEM-T Easy Vector System I (Promega) and subsequently brought Into E. r. oli XL-1 Blue ceils by transformation according to standard procedures. Transformed cells are plated on LB agar plates with lot) g/ml ampelln. Of the resulting prolongs after overnight Incubation at 37 C a few are grown in liquid culture. Clones eontamng plasmds with 1465 Inserts are Identified by pleased isolation and restriction digestion with EeoRI.

Plasmas pGEMT-CHSPet Is obtained In this way. The Insert of this plasmid should be sequenced using olgonueleotdes T7 and SP6. The sequence should appear to be identical or within 95'7, Identity (homology) to the sequence of accession number X04()cS0 except for the restreton sites designed In the oligonueleotides.

1470 Of the pGEMT-CHSPet plasmid l log Is digested with BamBI and Salt restriction enzymes In buffer React 3 (Invtrogen) for 2 hours. The oldest Is separated on a limo agarose gel and the + 1190 bp restncton fragment Is Isolated from gel. In hi& parallel, the vector pAC-Dt ET-4CL-CHS (Novagen) is digested with the same enzymes using the same procedure, and a 5561 bp fragment is isolated from gel This 1475 fragment is referred to as pAC-4CL. The CHS fragment is ligated into the pAC-4CL fragment according to standard procedures, and then transformed mto competent Xl,-l blue cells and selected overnight on chloramphencol (30 microgram per ml) containing LB-agar plates. Colomes are inoculated into hood LB medium with chloramphemcol, grown overnight at 37"C while shaking, and plasmd Is isolated from 1480 the culture. The presence of the appropriate petuma Cl-IS gene in the pAC-4CL vector Is verified by digestion with restncton enzymes Bgl II and Xho 1, m buffer React 2 (Invitrogen), and by sequencing using oligonucleotde Duetsens2 (5' TTGTACACGGCCGCATAATC). A positive plasmid Is termed pAC-4CL-CHSPet Tests for the usefulness of the phased pAC-4CL-CHSPet Is performed as 1485 described in sections 1.7, 1.8 and 2.12. The person marrying out the experimentation Will observe Ionnation of benzalacetone and raspberry ketone depending on the presence of this plasmd.

Example 1.16 Production of raspberry ketone and benzalacetone by host cells The production of raspberry ketone, benzalacetone and nanngenn upon 1490 feeding of 4 mM p-coumanc acid to a 50 ml culture and growing overnight at 28"C is compared for cold BL 21 transformed with the following vectors using standard transformation techniques as described in section 1.7.

pAC-DUET- the empty vector pAC-4CL-CE IS Rub - CHS from raspberry 1495 pAC-4CL-CI-1SPet - CHS from petunia pAC-4CL-BASRab - ClIS fron1 rhubarb pAC-4CL-CHSRuh from raspberry Is prepared as described In 1.6. (in section 1.6 pAC-4CL-CElSRuh Is referred to as pAC-4CL-CHS).

pAC-4CL-CHSPet from petunia Is prepared as described In 1 15.

15()0 The culture medium Is 2xTY with 30pg/ml chlorampllencol and SmM p coumarc acid and lmM 1PTG.

the results are summarsed In Table 2.

I Raspberry ketone Benzalacetone nari ngeni n (microgram per 50 (microgram per 50 (microgram per 5() ml) ml) ml) pAC- DUET 0.07 0 0 pAC-4CL-CHSRub 10.0 4.3 16.2 p \C4LL UHSt'ct 3.7 1.1 2 Clo'icg a/ tic Be,zalaceco,e Reducttc.se (BAR) genie 1505 The BAR protein Is poorly charged which makes the purification procedure do FFicult.

Example 2.1 Crude purification As a first step, about 20g of'ripe raspberry fruits from variety Tulameen are frozen m liquid nitrogen, and ground to powder In a cooled coffee mill. The powder, 151() still frozen, Is mixed with 65 ml buffer R (0.2 M KPO pH = 8.0, 2mM DT'1'), 8 mg sucrose, 2 g polymeised polyvnylpyroldon and half a tablet of Protease mbibtors Complete (Roche) The mixture Is stifled on Ice for 1() minutes. The solid matter Is

GO

rcmoved'uy filtering through cheesecloth and centrifuged for 20 minutes at 20,()00xg and 4'-'C. The supcrnatant Is recovereci, its volume measured, and 0.516 g (NH)'SO 15I 5 per ml Is slowly acided during 2() minutes, under continuous stir mg In 4"C. Storing Is continued overnight at 4 C. The next day the mixture Is centrifuged In 4 tubes for 20 minutes at 2(),000xg and 4"C. 'I'hc supernatant is removed carefully, and the pellet Is resuspended In total 8 ml bui for R (4 C). Every 2 ml Is filtered through glass wool, and loaded on a PDIO column (Pharmacist), which had been previously equilibrated with 152() 30 ml 1uf'fer A (2() mM Tns llCI pi-1 = 8.5 + 5 mM 2- mercaptoethanol), by gravity.

I'he column is washed with 0.5 ml buffer A, and subsequently protein Is eluted with 3.5 ml buffer A (4 C). 'I'he cluted protein from 4 PDIO columns is pooled and stored on Cc as Crude Enzyme F,xample 2.21Lnzyme assay 1525 Fractions from the Anion exchange column (see section 2.3) and the butyl FF column (see section 2.3) are analysed for presence of BAR activity. Of each fraction, pi Is mixed with 20 1 of substrate solution (containing 0.8 mg/ml p hydroxyphenylbutenone) and 10 pI NADPH solution (containing 10 mg/ml NADPH), and incubated at 30 C for 45 minutes under gentle shaking. Subsequently, the reaction 1530 mixture is added to 1 ml eLhylacetate containing 1 log /ml 4-(4- methoxyphenyl)-2 butanone (Alclnch) as an internal standard. The mixture Is vortexed for 5 seconds, and centrifuged lair 5 minutes at 1200xg. The ethylacetate phase is recovered, filtered over solid sodium sulphate to remove residual water. Of the samples, 2,uL Is analysed by GC-MS using a gas chromatograph (589() series IT, Hewlett-Packard) equipped with a 1535 30-m x 0.25-mm,.d., 0.25-,um told thickness column (5MS, Hewlett- Packard) and a mass-selective detector (model 5972A, Hewlett-Packard). The GC Is programmed at an Initial temperature of'450C for 1 man, with a ramp of lO"C per mm to 220 C and final time of 5 man. The Election port (splitless mode), Interface, and MS source temperatures are 250 C, 290 C, and 18()"C, respectively, and the He Inlet pressure Is 1540 controlled with an electronic pressure control to achieve a constant column flow of 1.0 mL per man. The onsaton potential Is set at 70 eV. Compounds are detected in the selectcd-on-mcnitoring mode: m/z 107, 121 and 164. Masses at m/z 107 and 164 are typical for raspberry ketone, whale mass 121 Is typical for the Internal standard. The peak surface at m/z. 107, fluting around 15 minutes, Is used as a measure for the 1545 amount cl'raspben-y ketone formed, and consequently for the BAR activity In the sample. To exclude enors caused by evaporation of the solvent during or after extraction, values are divided by the peak surface of the Internal standard, measured at m/z. 121.

Example 2.3 anion exchange 1550 For anion exchange, 12 ml Crude Enzyme Is slowly (0.5 ml/minute) pumped over a I-liTrap Q FPLC column (1 ml, Pharmacia), which had been previously calibrated In buffer A (4"C) Subsequently the column is washed with 15 ml of buffer A (4 C). Then the column Is attached to an FPLC set up, In which Buffer A (20 mM Tns lIC1 pH = 8.5 + 5 mM 2-mercapLoethanol) and huft'er B (20 mM Tris HC1 pH = 1555 8.5 + 1 M NaCI + 5 mM 2-mercaptoethanol) are held on ice. The FPLC is programmed to run the following gradient: Pump speed I ml/min,.

T=0 to t=2 man 100% A T=2 to t=4 man 5 %O B 1560 T=4 to t=7 man 7.5% B T=7 to t=1() man 10 ., B 1'=10 to t=13 min 12.5% B T=13 toT=15 man 157o B From T=15 to T = 3() mmuLes, a gradient from limo B to 100 % B. 1565 Fractions are collected every mnutc.

The majority of BAR activity appeared to be bound to the anon-exchange column, and to elute In fractions 4 to 7, at 5-7.5 mM NaCI. A second (small and more broad) peak elutes In tractions 9 to 13 (Figure 7).

Example 2.4 hydrophobic interaction 157() From the 1 ml Anon-exchange fractions 3 to 7, 70() Ill are pooled and added together Lo 20 ml IM (NH)2SO4. This mixture Is loaded on a 1 ml HTrap Butyl FF column (Pharmacy) at +4'C, and the column Is washed with ce-cold buffer C (20 mM Trots HCI pH = 8.5 + I M (NH4)2SO4 + 5 mM 2- mercaptoethanol).Subsequently, the column is connected to an FP[,C setup, from which I ml tractions are eluted every 1575 minute during a 30 minute gradient from 100% buffer C to 100 'To Buffer A. Fractions are analysed for BAR activity according to 2.2.

Almost all activity Is retained by the Butyl FF column. Most BAR activity is eluted in fractions 24 to 30, although a large portion (about 50%) of activity Is not r ccovered.

1580 Example 2.5 proteins in active fractions Protein concentration Is determined In the active fractions of 2.3 and 2.4, using the Burred Protein Assay. From each relevant fraction, 25 1 Is loaded on an analytical 15Xo SDS PAGE gel, and stained by silver staining according to Rablloud et al. (1988). Active fractions front the butyl FF column appeared to contain 5 dominant 1585 protein hands, which are called BAR1, BAR2, BARS, BAR4 and BARS (Figure 8).

400 1 of each of fractions 25, 26, 27, 28 and 29 are added to 200 1 40% trichloracetc acid and 500 1 acetone. The mixtures are left on Ice for 1 hour and centrifuged at 4 C 13,000xg for 15 minutes. SupernatanL Is removed, and 500 Ill ice-cold acetone Is used to wash each pellet. Pellets are pooled and totally clssolved m 25 Al buffer containing 1590 2() mM Tns pH=6.8, Do Glycerol, I SDS and 2() mM DTT, boiled for 5 minutes and loaded on a 157%o SDS PAGE gel After running the gel, it is stamed with Coomasse BB The hands corresponding to BARl to BARS are excised from the gel. Gel shoes are excised, driecl, and protein is digested m gel with trypsm, according to Sevchenko e! al. ( 1996).

1595 Example 2.6 Qtof MS/MS analysis of peptides Protein is extracted from the gel slices, and loaded onto a C 18 PepMap column (15 cm x 75 cm). Peptdes are eluted by a 30 man. gradient from O.5o formic acid in water to 0.5% formic acid in 50 % acetontrl at a speed ol'0.2 l/min. The C 18 column is connected to the electro-electro-spray of a Q-'l'of-2 Mass spectrometer 16()() (M'cromass) by a PcoTp (New Objective). The Qtof mass spectrometer Is Instructed to determine charge of the elutmg peptizes, and, if appropriate (.e. 2+ or 3+), the QtotMS switched to the MS/MS mode applying collision-induced dissociation (C[D).

I'he resulting CID spectrum contains the sequence information for a single peptde.

The Mass-Lynx package V4.0 (McroMass) and Protein Lynx Global Server 1605 V2.0 are used to processing and deconvolutng MS data, and to search the NCBI non redundant database. Spectra matching database entries are selected for further analysis.

Relevant peptdes found In the automated search are shown In table 3.

- = h - o o boom =

- - -

s o by s >7 a > O L s s s 2 _ 1 D ha a. s U] C As

_ 6(,

1610 "bitts" are found relevant when a protein with a molecular weight of similar size as observed for the sequenced BAR protein is identified. Among the Live TcientTfTed proteins, the hit of BARS with Tsoflvone recluctase 1lomologue fiord Betula pendula was found most mteT-estTng, and relevant for BAR activity. The enzymatic class of isollavone reductase TS EC 1.3.1.45 and the BAR enzyme should also be 1615 classified as belonging Lo enzymatic class EC 1.3.1, composing outdo reductase enzymes acting OTT CH=CH groups using NADH or NADPH as a cofactor.

To further confirm the identity of the BARS protein, the BToLynx PepSeq module is used to interpret MS/MS spectra and to generate peptTde sequences f rom the spectra manually. We looked in particular for peptTdes potentially matching the 1620 Tsoflavone reductase homologue from Betula pendula (gil473 1 376|gb|AAC05 1 16.21).

The following peptTdes in Cable 4 are deduced from the spectra.

> b == t == of o l JO 53 En c _ Lie it,

-