GB2416769A - Biosynthesis of raspberry ketone - Google Patents

Abstract

A host cell comprising a benzalacetone synthase (BAS) polypeptide sequence and a 4-coumarate:CoA ligase (4CL) sequence in which one or both of the BAS polypeptide sequence and the 4CL sequence is heterologous to the host cell. Such a host cell is useful in the production of benzalacetone and/or raspberry ketone from precursors such as p-coumaric acid. Also claimed is a method of producing raspberry ketone comprising supplying a bacteria with benzalacetone.

Description

HOST CELL Fit

The present invention relates to the field of flavouring technology.

BACKGROUND

s Raspberry ketone (p-hydroxyphenyl-2-butanone) is a key flavour molecule with typical raspberry flavour characteristics and a low odour threshold. Raspberry ketone is one of the most expensive flavour components used in the food industry. Up to $2O,000/kg may be paid for the natural compound.

Raspberry ketone can be found in raspberries and other fruits (such as peaches, lo grapes, apples and various berries), vegetables (e.g. rhubarb) and in the bark of tree (e.g. yew, maple and pine).

Raspberry ketone can be used in the aroma formulation of, for instance, strawberry, kiwi, cherry and other berries. However none of these fruits are used to obtain the raspberry ketone as the low content of raspberry ketone in these fruits makes the extraction and purification process unprofitable.

Raspberry ketone can be produced chemically via the condensation of p hydroxybenzaldehyde with acetone.

However, the chemical synthesis of compounds can often result in environmentally unfriendly production processes and in undesirable racemic mixture of the compound of interest (Vandamme and Soetaert 2002; J Chem Techno Biotechnol 77:1323-1332).

Alternatively raspberry ketone can be extracted from raspberries. However, yields are typically very low. For example, only 3.7 mg of ketone can be obtained from I kg of berries (Vandamme and Soetaert 2002; J Chem Techno Biotechnol 77: 1323- 1332).

In raspberries, the synthesis of raspberry ketone is a two-enzyme part of the phenylpropanoid pathway. This pathway has been described by BorejszaWysocki and Hrazdina (1994). In the first step, coumaryl CoA (which is present in many plant tissues) is condensed with one malonyl CoA into benzalacetone (p-hydroxyphenylbut 3-ene-2-one). The enzyme catalysing this step is called benzalacetone synthase (BAS). In the second step, the double bond in benzalacetone is reduced, resulting in raspberry ketone (p-hydroxyphenyl-2-butanone). The enzyme catalysing this step is called benzalacetone reductase (BAR), this enzyme requires the presence of NADPH.

Benzalacetone synthase (BAS), EC 2.3.1.-., is a member of the polyketide 3s synthase family. Benzalacetone reductase condenses one acetone unit from malonyl CoA with one p-coumanc acid to form benzalacetone. The polyketide synthase family is described in detail in Schroder 1999 (Comprehensive natural products chemistry vol 1: polyketides and other secondary metabolites including fatty acids and their derivatives [U. Sankawa Ed] pp 749-771). Abe et al (2001) teach the cloning of a BAS gene from rhubarb.

Soluble enzymes catalysing the reduction of a double bond using NADPH, for example benzalacetone reductase (BAR), are classified by the International Union of Biochemistry and Molecular Biology as belonging to enzymatic class EC 1.3. l.X. For instance, an enzyme annotated as EC 1.3. 1. l l from Arthrobacter sp. was reported to 4s remove a double bond from coumarate (Levi and Weinstein, 1964). However, no gene has been identified in connection to this enzymatic activity. Other enzymes in the enzymatic class EC 1.3. l.X are orotate reductase, 2-hexadecenal reductase, cholestenone 5 alpha-reductase etc. for which genes are known. However, none of these enzymes was reported to have benzalacetone reductase (BAR) activity. It is so known from literature that 4-hydroxybenzalacetone can be transformed to raspberry ketone by fungi or yeasts like Pichia, Saccharomyces, Beauveria, Kloeckera, Aureaba.sidiurn, Cladosporium Geotrichum, Mucor and Candida spp. (Fuganti and Zucchi, 1998). However, no gene has been identified in connection to this enzymatic activity. A1SO7 to our knowledge, no such activity has been reported for bacteria, neither gram negative nor gram positive.

Attempts to biosynthesise raspberry ketone have been described. Hugueny et al ( 1995, Boflavour 95 pp 269-273) teach a biotechnological method for producing raspberry ketone. This method comprises culturing a microorganism which has a secondary alcoholdehydrogenase (ADH), such as Candida boidinii, and adding the precursor betuloside to the culture medium. In this cellular environment the secondary ADH dehydrogenatates betuligenol into raspberry ketone.

Abe et al (2001) teach the cloning of rhubarb BAS, expression of the gene in E colt, purification of the recombinant BAS protein and the in vitro synthesis of benzalacetone. However this study does not teach the in vivo synthesis of benzalacetone or raspberry ketone.

SUMMARY OF THE INVENTION

According to a first aspect of the present invention, we provide a host cell comprising a benzalacetone synthase (BAS) polypeptide sequence and a 4- coumarate:CoA ligase (4CL) sequence in which one or both of the BAS polypeptide sequence and the 4CL sequence is heterologous to the host cell.

Preferably, the BAS polypeptide sequence is derived from rhubarb or raspberry, preferably from rhubarb. Preferably, the BAS polypeptide sequence is accession number AF326911 or a sequence having at least 75% sequence homology thereto. Preferably, the 4CL sequence is a tobacco 4CL sequence. Preferably, the 4CL 7s sequence is a sequence having an accession number U50846 or a sequence shown in SEQID NO: 2.

Preferably, the host cell is transformed with an expression vector encoding the benzalacetone synthase (BAS) polypeptde sequence and an expression vector encoding the 4-coumarate:CoA ligase (4CL) sequence, or an expression vector encoding both sequences.

Preferably, the host cell is a microbial host cell selected from the group consisting of Escherichia spp, Saccharomyces spp, Pichia spp, Beauveria spp, Candida spp, Bacillis spp, Pseudomonas spp, Hansenula spp, Kluyveromyces spp, Schizosaccharomyces spp, Streptomyces spp, Lactococcus spp, Lactobacillus spp, Pediococcus spp, Kloeckera spp, Aureobasidium spp, and Streptococcus spp, preferably an E. colt, preferably strain BL21, or a Saccharomyces cerevisiae preferably YPH 499 host cell.

Preferably, the host cell is capable of producing benzalacetone when supplied with a precursor of benzalacetone, preferably p-coumaric acid or a source of p- go coumaric acid.

Preferably, the host cell has benzalacetone reductase (BAR) activity, preferably inherent benzalacetone reductase (BAR) activity.

Preferably, the host cell further comprises a benzalacetone reductase (BAR) sequence, preferably a heterologous BAR sequence, preferably shown as SEQ ID NO: 4.

Preferably, the host cell is capable of producing raspberry ketone when supplied with a precursor of raspberry ketone, preferably benzalacetone or a source of benzalacetone.

Preferably, the host cell is capable of producing raspberry ketone when oo supplied with a precursor of raspberry ketone, preferably p-coumaric acid or a source of p-coumaric acid.

Preferably, the host cell further comprises a cinnamate-4-hydroxylase (C4H) sequence.

Preferably, the host cell Is capable of producing benzalacetone or raspberry oS ketone, or both, when supplied with cinnamic acid or a source of cinnamic acid.

Preferably, the host cell further comprises a phenylalanine ammonia Iyase (PAL) sequence.

Preferably, the host cell is capable of producing benzalacetone or raspberry ketone, or both, when supplied with phenylalanine or a source of phenylalanine.

l lo There Is provided, according to a second aspect of the present invention, a method of producing benzalacetone, the method comprising the steps of: (a) providing a host cell as set out above; and (b) supplying the host cell with p-coumaric acid or a source of p-coumaric acid.

We provide, according to a third aspect of the present invention, a method of is producing raspberry ketone, the method comprising the steps of: (a) providing a host cell as set out above; and (b) supplying the host cell with p-coumaric acid or a source of p-coumaric acid.

Preferably, the source of p-coumaric acid is cinnamic acid. Preferably, the source of p-coumaric acid is phenylalanine.

As a fourth aspect of the present invention, there is provided a method of producing raspberry ketone, the method comprising supplying a bacterium with benzalacetone or a source of benzalacetone.

Preferably, the bacterium is an E cold or a Bacillus, more preferably an E. cold strain BL21.

We provide, according to a fifth aspect of the present invention, a bacterial method of producing raspberry ketone.

Preferably, the method comprises use of a host cell as set out above.

The present invention, in a sixth aspect, provides use of a BAS polypeptide in a bacterial method of production of benzalacetone or raspberry ketone, or both.

In a seventh aspect of the present invention, there is provided an expression vector comprising a nucleic acid sequence encoding a benzalacetone synthase (BAS) polypeptide and a nucleic acid sequence encoding a 4-coumarate:CoA ligase (4CL), optionally together with a BAR sequence.

According to an eighth aspect of the present invention, we provide an expression vector comprising any one or more of the following: a nucleic acid sequence shown as SEQ ID NO: 5, a nucleic acid sequence shown as SEQ ID NO: 1 and a nucleic acid sequence shown as SEQ ID NO: 3.

We provide, according to a ninth aspect of the invention, an expression vector wherein the expression vector is pAC-4CL-BASrheum.

Preferably, the expression vector further comprises a PAL sequence or a C4H sequence, or both.

There is provided, in accordance with a tenth aspect of the present invention, a host cell transformed with an expression vector as described.

As an eleventh aspect of the invention, we provide a method of producing benzalacetone, the method comprising the steps of (a) providing a host cell as described; and (b) supplying the host cell with p-coumaric acid or a source of p coumaric acid.

We provide, according to a twelfth aspect of the invention, method of producing raspberry ketone, the method comprising the steps of (a) providing a host cell as described; and (b) supplying the host cell with p-coumaric acid or a source of p- coumanc acid.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the nucleotide sequence (SE Q ID N o 7) of raspberry CHS and the polypeptide sequence (SE Q ID No 8) encoded by the nucleotide sequence.

Figure 2 shows the nucleotide sequence (SE Q ID N o 1) of tobacco 4CL and the polypeptide sequence (SEQ ID N o 2) encoded by the nucleotide sequence.

Figure 3 shows the nucleotide sequence (SEQ ID No 5) of rhubarb BAS and the polypeptide sequence (SE Q ID N o 6) encoded by the nucleotide sequence.

Figure 4 anion-exchange column showing elusion fractions.

Figure 5 S D S PAGE of a mixture comprising BAR activity. Proteins highlighted with the arrows have been sequenced.

Figure 6 shows the nucleotide sequence (SE Q ID N o 3) of BAR and the polypeptide sequence (SE Q ID No 4) encoded by the nucleotide sequence.

Figure 7 shows BAR activity in E. cold which have not been transformed with a vector comprising BAR.

DETAILED DESCRIPTION

The present invention is based on the surprising finding that microbial cellular environments, such as the cellular environment of a host cell as described, have benzalacetone reductase (BAR) activity.

Therefore, a host cell comprising a benzalacetone synthase (BAS) sequence and a 4-coumarate:CoA ligase (4CL) sequence is capable of producing raspberry ketone when supplied with a precursor thereof, for example, pcoumaric acid. This is demonstrated m the Examples.

Furthermore, such a host cell is also capable of producing benzalacetone when fed with such a precursor, as also demonstrated in the Examples.

In other embodiments, the host cell may further express, or be capable of expressing, other enzymatic activities in the raspberry ketone synthesis pathway, In particular, upstream enzymes such as cinnamate-4-hydroxylase (C4H) andlor phenylalanine ammonia lyase (PAL). This enables the host cell to be supplied with upstream precursors, for example, cinnamate or phenylalanine, as the case may be, for the production of benzalacetone andlor raspberry ketone.

One advantage of the methods and compositions described here is that raspberry ketone can be produced in an economical way. Another advantage is that the method of production of benzalacetone or raspberry ketone or both is not by a chemical process but is by a cellular process. This is considered more acceptable by consumers, and is therefore "consumer friendly".

A further advantage of the methods and compositions described here is that the benzalacetone or raspberry ketone or both produced by the process as described here is suitable for use in aroma formulations in the food market, cosmetics and household products such as air fresheners, and in weight loss products.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the aft. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Frtsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, r F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Using Antibodies: A Laboratory 20s Manual: Portable Protocol NO. I by Edward Harlow, David Lane, Ed Harlow (1999, Cold Spring Harbor Laboratory Press, ISBN 0-87969-544-7); Antibodies: A Laboratory Manual by Ed Harlow (Editor), David Lane (Editor) (1988, Cold Spring Harbor Laboratory Press, ISBN 0-87969-314-2), 1855, Lars-Inge Larsson "Immunocytochemistry: Theory and Practice", CRC Press inc., Baca Raton, Florida, 210 1988, ISBN 0-8493-6078-1, John D. Pound (ed); "Immunochemical Protocols, vol 80", in the series: "Methods in Molecular Biology", Humana Press, Totowa, New Jersey, 1998, ISBN 0-89603-493-3, Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B. Fernandes (2001, New York, NY, Marcel Dekker, ISBN 0-8247-0562-9); Lab Ref: A Handbook of Recipes, Reagents, and Other 215 Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969-630-3; and The Merck Manual of Diagnosis and Therapy (17th Edition, Beers, M. H., and Berkow, R. Eds, ISBN: 0911910107, John Wiley & Sons). Each of these general texts is herein incorporated by reference. Each of these general texts is herein incorporated by reference.

220 BENZAEACETONE SYNTHASE (BAS) The methods and compositions described here make use of a host cell which is capable of expressing benzalacetone synthase (BAS) activity. Typically, such a host cell is capable of expressing a benzalacetone synthase enzyme by, for example, beng transformed with an expression vector encoding such an enzyme.

22s By benzalacetone synthase activity, we mean the ability of a polypeptide (enzyme) to catalyse a one-step decarboxylative condensation of 4- coumaryl-CoA with malonyl-CoA to produce benzalacetone. A benzalacetone synthase (BAS) polypeptide is one which has at least some benzalacetone synthase activity.

Benzalacetone synthase (BAS) has the IUBMB Enzyme Nomenclature number EC 230 2.3. 1.-.

Preferably, a host cell expressing the benzalacetone synthase (BAS) (whether or not it expresses any other enzymes) is capable of converting at least some coumaryl-CoA and malonyl CoA to benzalacetone. Alternatively, or in addition, such a host cell which further expresses 4coumarate:CoA ligase (4-CL) is capable of 23s converting at least some p-coumaric acid to benzalacetone.

Thus, a host cell such as E cold BL21 which expresses 4-coumarate:CoA ligase (4-CL), as described in the Examples, together with a benzalacetone synthase (BAS), is capable of producing at least 0.1 lug of benzalacetone per 50ml culture when cultured in the conditions described in Example 1.7 below, the sample being made 240 from 10 ml of culture with an optical density at 600 nm of 0.4 resuspended in 50 ml of LB supplied with 20 g/ml chloramphenicol and 1 mM IPTG and 3 mM p-coumaric acid and grown overnight at 28 C and 250 rpm.

Suitable benzalacetone synthase (BAS) sequences for use in the methods and compositions described here include the sequence described by Abe et al (2001).

245 Further benzalacetone synthase (BAS) sequences may be identified from other individuals or species by homology searching, or by screening using probes derived from the benzalacetone synthase (BAS) sequence of suitable cDNA or genomic libraries.

4-CoUMARATE:CoA LIGATE (4CL) 250 The host cell comprises a 4-coumarate:CoA ligase (4-CL) sequence, in addition to the benzalacetone synthase (BAS) sequence. Thus, a host cell which is useful in the methods and compositions described here further comprises a 4-coumarate:CoA ligase (4-CL) sequence and/or Is capable of expressing a 4-coumarate:CoA ligase (4-CL) polypeptide. In highly preferred embodiments the host cell as described here is one in 2s5 which the 4-coumarate:CoA ligase (4-CL) is heterologous to the host cell.

As used herein the term "4-coumarate:CoA ligase (4CL)" refers to a polypeptide capable of catalysing the following reaction: ATP + 4coumarate + CoA = AMP + diphosphate + 4-coumaroyl-CoA 4-coumarate:CoA ligase has the IUBMB Enzyme Nomenclature number EC 260 6.2.1.12. An assay for determining 4-coumarate:CoA ligase is set out below at the section "Assay to Determine 4-Coumarate:Coa Ligase (4cl) Activity".

4-coumarate:CoA ligase may also be referred to as 4CL, 4-coumaroyl-CoA synthetase; p-coumaroyl CoA ligase; p-coumaryl coenzyme A synthetase; pcoumaryl CoA synthetase; p-coumaryl-CoA ligase; feruloyl CoA ligase; hydroxycinnamoyl CoA 265 synthetase; 4-coumarate:coenzyme A ligase; caffeolyl coenzyme A synthetase; p hydroxycinnamoyl coenzyme A synthetase; feruloyl coenzyme A synthetase; sinapoyl coenzyme A synthetase; 4-coumaryl-CoA synthetase; hydroxycinnamate:CoA ligase; p-coumaryl-CoA ligase; and p-hydroxycinnamic acid:CoA ligase.

4-coumarate:CoA ligase (4-CL) sequences suitable for use in the methods and 270 compositions described here may be derived from Streptomyces coelicolor, Larix larcina, Arabidopsis thaliana, Petroselinum crispum, Oryza sativa and Rhodobacter sphaeroides. Preferably the 4-CL sequence is selected from the group comprising: accesson number U50846, accession number NP_628552, accession number AAQ05337, accession number P14913, accession number NP_849844, acession 275 number Pl4913, accession number JU0311 and accession number 054075. In highly preferred embodiments, the 4-coumarate:CoA lgase (4-CL) sequence is a tobacco 4CL sequence, preferably a sequence having an accession number U50846. The 4-CL sequence can have a sequence as shown in SEQ ID NO: 2.

Variants, homologues, derivatives and fragments of any of these sequences 280 may also be employed.

Preferably, as used here, the 4CL sequence is a tobacco 4CL sequence. The term "the 4CL Is a tobacco sequence" as used herein refers to the 4CL sequence being derived from tobacco (Nicotiana spp, preferably Nicotiana tabacum (cv. Samsung)).

Preferably the 4CL sequence as used here is a sequence having an accession 285 number U50846 or a sequence shown in SEQ ID NO: 2.

The host cell comprises the sequences in such a way that it expresses either or preferably both the benzalacetone synthase (BAS) and the 4-coumarate:CoA ligase (4- CL) polypeptide. This may be achieved by any means known in the art, for example, by transformation of the host cell with an expression vector comprising the 290 benzalacetone synthase (BAS) and an expression vector comprising the 4- coumarate:CoA ligase (4CL) sequence. For convenience, an expression vector capable of expressing both polypeptides may be used to transform the host cell. Expression of the two polypeptides in such an expression vector may be driven from separate promoters, or by a common promoter (optionally through the use of an internal 29s ribosome entry site (IRES)).

BENZAEACETONEREDUCTASE(BAR) The term "benzalacetone reductase (BAR) activity" as used here refers to a sequence which catalyses the formation of raspberry ketone from benzalacetone.

Preferably, therefore, the host cell is one in which the host cell has benzalacetone 300 reductase (BAR) activity. An assay to determine BAR activity is described below.

As demonstrated in the Examples, host cells such as microbial, preferably bacterial, host cells, comprise inherent BAR activity. In a preferred embodiment, therefore, the host cell comprises a BAR activity which is inherent benzalacetone reductase (BAR) activity. The term "inherent" as used here refers to the host cell 30s having benzalacetone reductase activity without the need, for example, for the host cell to be transformed with a benzalacetone reductase sequence.

In certain embodiments, however, it may be preferable to provide benzalacetone reductase activity to the host cell, for example, where the endogenous activity is weak or absent. In such a case, the host cell is one in which the host cell 310 further comprises a benzalacetone reductase (BAR) sequence. More preferably the BAR sequence is a heterologous BAR sequence. Preferably the heterologous BAR sequence is a raspberry BAR sequence. Even more preferably the BAR sequence comprises a sequence shown as SEQ ID NO: 4.

As used here the term "benzalacetone reductase (BAR) sequence" refers to a 315 sequence having benzalacetone reductase activity. As used here the term "heterologous BAR sequence" refers to a sequence having BAR activity which is derived from a separate genetic source or species to that of the host cell.

BAR activity can be determined for a sequence using the assay detailed below.

Preferably the BAR sequence as used here is derived from one of the 320 following: raspberry, strawberry, birch, Arabidopsis, corn, bacteria and fungi. More preferably the BAR sequence as used here is derived from raspberry.

HOST CEEE

We describe a host cell comprising a benzalacetone synthase (BAS) sequence and a 4-coumarate:CoA ligase (4CL) sequence. The host cell may be used to produce 32s benzalacetone and raspberry ketone. Furthermore, we describe the use of a benzalacetone synthase (BAS) polypeptde in a bacterial method of production of benzalacetone or raspberry ketone or both.

In a preferred embodiment, the host cell as described here is one in which one or both of the BAS sequence and the 4CL sequence is heterologous to the host cell.

330 The term "heterologous to the host cell" as used herein refers to a sequence which is derived from a separate genetic source, preferably a different individual, strain or species, to that of the host cell.

In one embodiment, preferably the host cell is a microbial host cell.

In a preferred embodiment the host cell is one In which the host cell is a 335 microbial host cell selected from the group consisting of Escherichia spp, Saccharomyce.s spp, Pichia spp, Beauveria spp, Candida spp, Aspergillus spp, Bacillus SE)P, Pseudomonas spp, Hansenula spp, Kluyveromyces spp, Schizosaccharomyces spp, Streptomyces spp, Lactococcus spp, I,actobacillus spp, Pediococcus spp, Kloeckera spp, Aureobasidium spp, and Streptococcus spp.

340 Preferably the microbial host cell used here is an E. cold host cell. Preferably the E. cold host strain provides a source of T7 polymerase. Preferably, this is as a result of the host cell comprising a vector or plasmid which comprises a T7 polymerase sequence. More preferably the microbial host cell used here is an E. cold strain BL21.

Alternatively, preferably the microbial host cell used here is a Saccharomyces 34s cerevisiae host cell. Preferably the S. cerevisae host strain is deficient in Trp synthesis, preferably by having a TRP deletion or non- functional Trp mutation in its genome.

More preferably the microbial host cell used here is Saccharomyces cerevisiae strain YPH 499.

Alternatively, preferably the microbial host cell used here is a Bacillus subtilis 3so host cell.

OPTIONAL ENZYMATIC ACTIVITIES OF HOST CEDE

As described below, In further embodiments, the host cell may be capable of expressing one or both of phenylalanine ammonia-lyase (PAL) and cinnamic acid 4 hydroxylase (C4H), for example, by being transformed with one or more expression 35s vectors capable of expressing such polypeptides.

Preferably the C4H sequence is derived from one of the following: Vigna radiata, Helianthus tuberosus, Arabidopsis thaliana, Catharanthus roseus and Citrus sinesis. Preferably the C4H sequence is selected from the group consisting of: P37155, Q04468, P92994, S68204 and AAF66066.

360 The term "PAL" as used here refers to phenylalanine ammonia-lyase. This enzyme catalyses the reaction: L-phenylalanine = trans-cinnamate + NH3 PAL is also referred to as tyrase; phenylalanine deaminase; tyrosine ammonia lyase; and L-tyrosine ammonia-lyase. PAL has the IUBMB Enzyme Nomenclature number EC 4.3.1.5. This enzyme may also act on L-tyrosine to form p-coumaric acid 36s (Hwang et al' 2003), and the PAL enzyme may be referred to in some contexts as tyrosine ammonia Iyase (TAL). Thus, host cells which express PAL, in addition to benzalacetone synthase (BAS) and 4-coumarate:CoA ligase (4-CL) may be used to produce benzalacetone and/or raspberry ketone when provided with tyrosine, or a source thereof. This is described in further detail below.

370 The term "C4H" as used here refers to cinnamic acid 4-hydroxylase. This enzyme catalyses the reaction: trans-cinnamate + NADPH + H+ + O2 = 4 hydroxycinnamate + NADP + H2O C4H has the IUBMB Enzyme Nomenclature number EC 1.14.13.11. C4H is also referred to as trans-cinnamate 4monooxygenase; oxygenase, cinnamate 4-mono-; 37s CA4H; cytochrome P450 cinnamate 4-hydroxylase; cinnamate 4- hydroxylase; cinnamate 4-monooxygenase; cinnamate hydroxylase; cinnamic 4- hydroxylase; cinnamic acd 4-monooxygenase; cinnamic acid p-hydroxylase; hydroxylase, cinnamate 4-; t-cinnamic acid hydroxylase; trans-cinnamate 4- hydroxylase; and trans cinnamic acid 4-hydroxylase.

380 Host cells which express C4H, in addition to benzalacetone synthase (BAS) and 4-coumarate:CoA ligase (4-CL) may be used to produce benzalacetone and/or raspberry ketone when provided with cinnamic acid, or a source thereof. This is described m further detail below.

PRODUCTION OF BENZALACETONE AND RASPBERRY KETONE FROM P-COUMARIC

38s ACID We describe a method of producing benzalacetone, the method comprising the steps of: (a) providing a host cell comprising a benzalacetone synthase (BAS) and a 4- coumarate:CoA ligase (4-CL) described in this document; and (b) supplying the host cell with p-coumaric acid or a source of p-coumaric acid.

390 The term "supplying the host cell with p-coumaric acid or a source of p coumaric acid" as used here refers to the supply, by any means, of pcoumaric acid or a source of p-coumaric acid to the host cell. One example of a supply of p-coumaric acid is to culture the host cell in a medium comprising p-coumaric acid.

Another example of a supply of a source of p-coumaric acid is to supply the 395 host cell with a source of p-coumaric acid in a culture medium. A source of p- coumaric acid in a culture medium is the supply of one or more precursors of p- coumaric acid to the culture medium.

In one embodiment, the host cell may be supplied with a source of p-coumaric acid comprising tyrosine. Tyrosine can be enzymatically converted in the host cell into 400 p-coumaric acid by the enzyme phenylalanine ammonia Iyase (PAL; Hwang et al, 2003, Appl. Environ. Microbial. 69(5):2699-2706). In such an embodiment, the host cell further comprises phenylalanine ammonia Iyase (PAL) activity, whether endogenous, or as a result of it being transformed with an exogenous expression vector capable of expressing phenylalanine ammonia Iyase (PAL).

40s In another embodiment, the host cell may be supplied with a source of p coumaric acid comprising cinnamic acid. Cinnamic acid can be enzymatically converted m the host ccl1 into p-coumaric acid by the enzyme cinnamate-4 hydroxylase (C4H). Accordingly, the host cell comprises further cnnamate-4 hydroxylase (C4H) activity, whether endogenous, or as a result of it being transformed 410 with an exogenous expression vector capable of expressing cinnamate-4- hydroxylase (C4H).

In yet another embodiment, the host cell may be supplied with a source of p coumaric acid comprising phenylalanine. Phenylalanine can be enzymatically converted in the host cell into cinnamic acid by the enzyme phenylalanine ammonia 415 Iyase (PAL); in turn cinnamic acid can be enzymatcally converted into p-coumaric acid by the enzyme cinnamate-4-hydroxylase (C4H). Accordingly, the host cell further comprises and cinnamate-4-hydroxylase (C4H) activity, whether endogenous, or as a result of it being transformed with one or more exogenous expression vectors capable of expressing cinnamate- 4-hydroxylase (C4H) and phenylalanine ammonia Iyase 420 (PAL).

As shown below, we demonstrate that microbial cellular environments, such as the cellular environment of a host cell as described, have benzalacetone reductase (BAR) activity. Benzalacetone reductase is capable of converting benzalacetone to raspberry ketone. Accordingly, each of the above embodiments is also capable of 42s producing raspberry ketone.

PRODUCTION OF RASPBERRY KETONE FROM BENZAEACETONE

It is furthermore evident that host cells as described here can be used to produce raspberry ketone, provided that they are supplied with benzalacetone or a source of benzalacetone. This arises as a result of our demonstration that microbial 430 cellular environments, such as the cellular environment of a host cell as described, have benzalacetone reductase (BAR) activity.

The term "supplying a microbial organism with benzalacetone or a source of benzalacetone" as used here refers to the supply, by any means, of benzalacetone or source of benzalacetone to a microbial organism. One example of a supply of 435 benzalacetone is to culture the microbial organism in a medium comprising benzalacetone. An example of a supply of a source of benzalacetone is the supply of one or more precursors of benzalacetone to a culture medium comprising the microbial organism.

In one embodiment, the host cell may be supplied with a source of pcoumaric 440 acid comprising tyrosine. Tyrosine can be enzymatically converted in the host cell into p-coumarc acid by the enzyme phenylalamne ammonia Iyase (PAL; Hwang et al, 2003, Appl. Environ. Microbiol. 69 (5): 2699-2706). In such an embodiment, the host cell further comprises phenylalanine ammonia Iyase (PAL) activity, whether endogenous, or as a result of it being transformed with an exogenous expression vector 44s capable of expressing phenylalanine ammonia Iyase (PAL).

In such a host cell, tyrosine is enzymatically converted into p-coumaric acid by the enzyme phenylalanine ammonia lyase (PAL); p-coumaric acid in turn is enzymatically converted into p-coumaryl CoA by the enzyme 4coumarate:CoA ligase (4CL); p-coumaryl CoA in turn is enzymatically converted into benzalacetone by the 450 enzyme benzalacetone synthase (BAS). Raspberry ketone is accordingly produced.

In another embodiment, the host cell may be supplied with a source of pcoumaric acid comprising cinnamic acid. Cinnamic acid can be enzymatically converted in the host cell into p-coumaric acid by the enzyme cinnamate-4hydroxylase (C4H). Accordingly, the host cell comprises further cinnamate4 455 hydroxylase (C4H) activity, whether endogenous, or as a result of it being transformed with an exogenous expression vector capable of expressing cinnamate-4-hydroxylase (C4H).

In such a host cell, cinnamic acid is enzymatically converted into pcoumaric acid by the enzyme cinnamate-4-hydroxylase (C4H); p-coumaric acid in turn is 460 enzymatically converted Into p-coumaryl CoA by the enzyme cinnamate-4- hydroxylase (4CL); p-coumaryl CoA m turn Is enzymatically converted into benzalacetone by the enzyme benzalacetone synthase (BAS). Raspberry ketone is accordingly produced.

In yet another embodiment, the host cell may be supplied with a source of p 465 coumaric acid comprising phenylalanine. Phenylalanine can be enzymatically converted in the host cell Into cinnamic acid by the enzyme phenylalanine ammonia Iyase (PAL); in turn cinnamic acid can be enzymatically converted into p-coumaric acid by the enzyme cinnamate-4hydroxylase (C4H). Accordingly, the host cell further comprises and cinnamate-4-hydroxylase (C4H) activity, whether endogenous, or as a 470 result of it being transformed with one or more exogenous expression vectors capable of expressing cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia Iyase (PAL).

In such a host cell, phenylalanine is enzymatically converted in the microbial organism into cinnamc acid by the enzyme phenylalanine ammonia Iyase (PAL); 47s cinnamic acid can be enzymatically converted into p-coumaric acid by the enzyme cinnamate-4-hydroxylase (C4H); p-coumaric acid in turn is enzymatically converted into p-coumaryl CoA by the enzyme cinnamate-4- hydroxylase (4CL); p-coumaryl CoA In turn is enzymatically converted into benzalacetone by the enzyme benzalacetone synthase (BAS). Raspberry ketone is accordingly produced.

480 The phrase "microbial cellular environment" refers to in an in viva environment wherein the in viva environment is a microbial cell. The microbial cell may be a yeast or a bacterium.

ASSAYS TO DETERMINE 4-COUMARATE:COA LIGASE (4CE) ACTIVITY A quantitative assay for 4-CL activity is described by Lee & Douglas (1996) 485 and Knobloch KH & Hahlbrock K. (1977; 4-Coumarate:CoA ligase from cell suspension cultures of Petroselinum hortense Hoffm. Partial purification, substrate specificity, and further properties. Arch Biochem Biophys. 184(1):237-48). These assays lead to activities of 4-CL activity expressed as millimole product (coumaroyl CoA) formed per kg protein per second (mkat Ego) 490 ASSAYS TO DETERMINE BENZALACETONE SYNTHASE (BAS) ACTIVITY A quantitative assay for BAS is described by Abe et al., 2001. BAS activity is expressed as mole malonyl CoA incorporated in benzalacetone per mole protein per minute.

ASSAY TO DETERMINE BENZALACETONE REDUCTASE (BAR) ACTIVITY 49s Samples can be analysed for the presence of BAR activity by the standard BAR assay (such as Borejsza & Hrazdina 1994). This assay can be used to determine if a cell or a sequence is capable of converting benzalacetone into raspberry ketone by determining the amount of raspberry ketone in samples which have been, for example, cultured in a medium supplemented with benzalacetone or cultured in a medium which see has not been supplemented with benzalacetone.

Of each sample, 200 Al is mixed with 20 Al of substrate solution (containing 0.8 mg/ml p-hydroxyphenylbutenone) and 10 Al NADPH solution (containing 10 mg/ml NADPH), and incubated at 30 C for 45 minutes under gentle shaking.

Subsequently, the reaction mixture is added to I ml ethylacetate containing 1 lug /ml 4 sos (4-methoxyphenyl)-2-butanone (Aldrich) as an internal standard. The mixture is vortexed for 5 seconds, and centrifuged for 5 minutes at 1200xg. The ethylacetate phase is recovered, filtered over solid sodium sulphate to remove residual water. Of the samples, 2 AL Is analysed by GC-MS using a gas chromatograph (5890 series II, HcwlettPackard) equipped with a 30-m x 0.25-mm Ed., 0.25-pm film thickness 51o column (SMS, Hewlett-Packard) and a mass-selective detector (model 5972A, Hewlett-Packard). The GC is programmed at an initial temperature of 45 C for 1 min. with a ramp of 10 C per min to 220 C and final time of 5 min. The injection port (splitters mode), interface, and MS source temperatures is 250 C, 290 C, and 180 C, respectively, and the He inlet pressure is controlled with an electronic pressure control SlS to achieve a constant column flow of 1.0 mL per min. The ionization potential is set at eV. Compounds are detected in the selected-ion-monitorng mode: m/z 107, 121 and 164.

Masses at m/z 107 and 164 are typical for raspberry ketone, while mass 121 is typical for the internal standard. The peak surface at m/z 107, elating around 15 s20 minutes, is used as a measure for the amount of raspberry ketone formed, and consequently for the BAR activity in the sample. The concentration of protein in a sample is determined using a Biorad Protein Assay, according to the instructions of the manufacturer.

To exclude errors caused by evaporation of the solvent during or after s25 extraction, values are divided by the peak surface of the internal standard, measured at m/z 121. The relative peak surface at ion 107 is compared to that of a standard of known quantity of raspberry ketone. The BAR activity is then expressed as nmol raspberry ketone formed per milligram protein per minute.

ASSAYS TO DETERMINE CINNAMATE 4 HYDROXYEASE ACTIVITY s30 Activity of cinnamate-4-hydroxylase (C4H) is determined according to Urban P. Mignotte C, Kazmaier M, Delorme F. Pompon D. (1997; Cloning, yeast expression, and characterization of the coupling of two distantly related Arabidopsis thalana NADPH-cytochrome P450 reductases with P450 CYP73A5. J Biol Chem. 272(31):19176-86). Activity of C4H is expressed as moles cinnamate converted per s3s mole protein per minute.

ASSAYS TO DETERMINE PHENYEAEANINE AMMONIA LYASE (PAE) ACTIVITY Activity of PAL is assayed according to descriptions in Nita-Lazar M, Chcvolot L, Iwahara S. Takegawa K, Furrnanek A, Lienart Y (2002; High performance liquid chromatography and photodode array detection of ferulic acd in 540 Rubus protoplasts elicited by O-glycans from Fusarium sp. M7-1. Acta Biochim. Poll 49 (4): 1019-27). Activity of PAL is expressed as Mat / kg protein, corresponding to Wool product (cinnamc acid) product formed per kg protein per second.

SEQUENCE

We further disclose sequences encoding enzymes having the specific properties 54s as defined herein.

In particular, we disclose novel BAS sequences SEQ ID NO: 5 and 6, novel 4- CL sequences SEQ ID NO: 1 and 2 and novel BAR sequences SEQ ID NO: 3 and 4.

The term "sequence" as used herein refers to a nucleic acid sequence, an oligonucleotide sequence, a nucleotide sequence or polynucleotide sequence, and 550 variant, homologues, fragments and derivatives thereof (such as portions thereof). The sequence may be of genomic or synthetic or recombinant origin, which may be double-stranded or single-stranded whether representing the sense or anti-sense strand.

The term "sequence" includes genomic DNA, cDNA, synthetic DNA, and RNA.

Preferably it means DNA, more preferably cDNA sequence coding for the enzymes 555 described herein.

In a preferred embodiment, the sequence does not include the native sequence when in its natural environment and when it is linked to its naturally associated sequence(s) that is/are also In its/their natural environment. For ease of reference, we shall call this preferred embodiment the "non-native nucleotide sequence". In this 560 regard, the term "native nucleotide sequence" means an entire nucleotide sequence that is in its native environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter Is also in its native environment. In one embodiment however, the amino acid sequence may be expressed by a nucleotide sequence In its native organism but wherein the nucleotide sequence is not under the 565 control of the promoter with which it is naturally associated within that organism.

As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and/or the term "protein". In some instances, the term "amino acid sequence" is synonymous with the term "peptide". In some instances, the term "amino acid sequence" is synonymous with the term "enzyme".

s70 VARIANTS/HOMOEOGUES/DERIVATIVES The methods and compositions described here may be performed by variants, homologues and derivatives of any amino acid sequence of an enzyme or of any nucleotidc sequence encoding such an enzyme.

Specifically, the methods and compositions described here may be performed 57s by any combination of the following: a sequence having at least 80, 85, 90, 95, 96, 97, 98, 99 or 99.5% homology to SEQ ID No 1; a sequence having at least 99 or 99.5% homology to SEQ ID No 2.

Preferably the variant, homologue or derivative thereof has at least 85, 90, 95, 96, 97, 98, 99 or 99.5% homology to SEQ ID No 3, and a sequence having at least 90, 580 95, 96, 97, 98, 99 or 99.5% homology to SEQ ID No 4.

Here, the term "homologue" means an entity having a certain homology with the amino acid sequences and the nucleotide sequences. Here, the term "homology" can be equated with "identity".

In the present context, a homologous amino acid sequence is taken to include 585 an amino acid sequence which may be at least 75, 80, 85 or 90% identical, preferably at least 95, 96, 97, 98, 99 or 99.5% identical to the sequence. Typically, the homologues will comprise the same active sites etc. - e.g. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), it is preferred to express 590 homology in terms of sequence identity.

In the present context, an homologous nucleotide sequence is taken to include a nucleotde sequence which may be at least 75, 80, 85 or 90% identical, preferably at least 95, 96, 97, 98, 99 or 99.5o identical to a nucleotide sequence encoding an enzyme of as described here, e.g., benzalacetone synthase (BAS) or 4-coumarate:CoA 595 ligase (4-CL) (the subject sequence). Typically, the homologues will comprise the same sequences that code for the active sites etc. as the subject sequence. Although homology can also be considered in terms of similarity (net amino acid residues having similar chemical properties/functions), it is preferred to express homology in terms of sequence identity.

600 For the amino acid sequences and the nucleotide sequences, homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.

% homology may be calculated over contiguous sequences, i.e. one sequence is 605 aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.

Although this is a very simple and consistent method, it fails to take into 610 consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions 615 and deletions without penalising unduly the overall homology score. This is achieved by Inserting "gaps" in the sequence alignment to try to maximise local homology.

However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible reflecting higher relatedness 620 between the two compared sequences will achieve a higher score than one with many gaps. "Affine gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with tcwer gaps. Most alignment programs allow the 625 gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum % homology therefore firstly requires the production 630 of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (Devereux et al 1984 Nuc. Acids Research 12 p387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 Short Protocols in Molecular Biology, 4th Ed Chapter 18), 635 PASTA (Altschul et al., 1990 J. Mol. Biol. 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999, Short Protocols in Molecular Biology, pages 7-58 to 7-60).

However, for some applications, it is preferred to use the GCG Bestfit program.

640 A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 24750; FEMS Microbiol Lett 1999177(1): 187-8 and tatiana@ncbi.nlm.nih.gov).

Although the final % homology can be measured In terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison.

645 Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used Is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see 6s0 user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

Alternatively, percentage homologies may be calculated using the multiple alignment feature in DNASISrM (Hitachi Software), based on an algorithm, analogous 65s to CLUSTAL (Higgins DO & Sharp PM (1988), Gene 73(1), 237-244).

Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

The sequences may also have deletions, insertions or substitutions of amino 660 acid residues which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in amino acid properties (such as polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues) and it is therefore useful to group amino acids together in functional groups. Amino acids can be grouped 66s together based on the properties of their side chain alone. However it is more useful to include mutation data as well. The sets of amino acids thus derived are likely to be conserved for structural reasons. These sets can be described in the form of a Venn diagram (Livingstone C. D. and Barton G.J. (1993) "Protein sequence alignments: a strategy for the hierarchical analysis of residue conservation" Comput.Appl Biosci. 9: 670 745-756)(Taylor W.R. (1986) "The classification of amino acid conservation" J.Theor.Biol. 119; 205-218). Conservative substitutions may be made, for example according to the table below which describes a generally accepted Venn diagram grouping of amino acids.

Set Sub-set Hydrophobic F W Y H K M I L V A G C Aromatic F W Y H. Aliphatic I L V Polar WYHKREDCSTNQ Charged HKRED Positively H K R charged Negatively E D charged Small VC AGSPTND Tiny AGS Polypeptides having homologous substitutions may also be used. Substitution 675 and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue. Such substitutions may be like-for-lke substitution such as basic for basic, acidic for acidic, polar for polar etc. Non- homologous substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine 680 (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.

Replacements may also be made by unnatural amino acids.

Variant amino acid sequences may include suitable spacer groups that may be 685 inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or,B-alanine residues. A further form of variation, involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art. For the avoidance of doubt, "the peptoid form" is used to refer to 690 variant amino acid residues wherein the X-carbon substituent group is on the residue's nitrogen atom rather than the a-carbon. Processes for preparing peptides in the peptoid form are known m the art, for example Simon RJ et al., PANS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.

The nucleotide sequences suitable for use in the methods and compositions 695 described here may include withm them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothoate backbones and/or the addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. It is to be understood that the nucleotide sequences described herein may be modified by any 700 method available in the art. Such modifications may be carried out in order to enhance the in viva activity or life span of nucleotide sequences described here.

We further describe the use of nucleotide sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof. If the sequence is complementary to a fragment thereof then that sequence can be used as 705 a probe to identify similar coding sequences in other organisms etc. Polynucleotides which are not 100% homologous to the sequences specifically described here, but are still suitable for use in the methods and compositions described here, can be obtained in a number of ways. Other variants of the sequences described herein may be obtained for example by probing DNA libraries made from a range of 710 individuals, for example individuals from different populations. In addition, other homologues may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein. Such sequences may be obtained by probing cDNA libraries made from or genomic DNA libraries from other species, and probing such libraries with probes 715 comprising all or part of any one of the sequences in the attached sequence listings under conditions of medium to high stringency. Similar considerations apply to obtaining species homologues and allelic variants of the polypeptide or nucleotide sequences specifically described.

Variants and strain/species homologues may also be obtained using degenerate 720 PCR which will use primers designed to target sequences within the variants and homologues encoding conserved amino acid sequences within the relevant sequences.

Conserved sequences can be predicted, for example, by aligning the amino acid sequences from several variants/homologues. Sequence alignments can be performed using computer software known in the art. For example the GCG Wisconsin PileUp 725 program is widely used.

The primers used in degenerate PCR will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with single sequence primers against known sequences.

Alternatively, such polynucleotides may be obtained by site directed mutagenesis 730 of characterized sequences. This may be useful where for example silent codon sequence changes are required to optimise codon preferences for a particular host cell in which the polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.

73s Polynucleotides (nucleotide sequences) described here may be used to produce a primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. Iabelled with a revealing label by conventional means using radioactive or non radioactive labels, or the polynucleotides may be cloned into vectors. Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 740 25, 30 or 40 nucleotidcs in length, and are also encompassed by the term polynucleotides as used herein.

Polynucleotides such as DNA polynuclcotides and probes may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques.

745 In general, primers will be produced by synthetic means, involving a stepwise manufacture of the desired nucleic acid sequence one nucleotde at a time. Techniques for accomplishing this using automated techniques are readily available in the art.

Longer polynucleotides will generally be produced using recombinant means, for example using a PCR (polymerase chain reaction) cloning techniques. The primers 750 may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.

EXPRESSION VECTOR

The methods and compositions described here preferably make use of expression vectors. Specifically, the following expression vectors are useful: 75s An expression vector comprising a nucleic acid sequence encoding a benzalacetone synthase (BAS)polypeptide and a nucleic acid sequence encoding a 4 coumarate:CoA ligase (4CL). Preferably, either or both of these sequences are heterologous to the host cell. The expression vector may optionally comprise a BAR sequence. Examples of each of these sequences are set out elsewhere in this document.

760 The expression vector may in particular comprise a nucleic acid sequence comprising the sequence shown as SEQ ID No 5 or a variant, homologue or derivative thereof having at least 75% homology thereto. Alternatively, or in addition, it may comprise a nucleic acid sequence comprising the sequence shown as SEQ ID No 1 or a variant, homologue or derivative thereof having at least 79% homology thereto.

765 Alternatively, or further in addition, the expression vector may comprise a nucleic acid sequence comprising the sequence shown as SEQ ID No 3 or a variant, homologue or derivative thereof having at least 82% homology thereto.

Such expression vectors may be usefully transformed into a host cell to provide the beneficial benefits described in this document. In preferred embodiments, the 770 expression vector is pAC-4CL-BASrheum, whose structure and construction is described in the Examples. To provide further advantages, the host cell may be further transformed

with an expression vector encoding a PAL sequence. It may further be transformed with another expression vector eroding a C4H sequence. Of course, a single expression 77s vector comprising both the PAL sequence and the C4H sequence may be employed.

This enables the use of upstream precursors as described elsewhere in this document.

The term "expression vector" means a construct capable of in viva or in vitro expression.

In one embodiment, the expression vector is incorporated into the genome of a 780 suitable host organism. The term "incorporated" preferably covers stable incorporation into the genome.

A nucleotide sequence suitable for use in the methods and compositions described here may be present in a vector in which the nucleotide sequence is operably linked to regulatory sequences capable of providing for the expression of the 785 nucleotide sequence by a suitable host organism.

The vectors for use may be transformed into a suitable host cell as described herein to provide for expression of a polypeptide as described.

The choice of vector e.g. a plasmid, cosmic, or phage vector will often depend on the host cell into which it is to be introduced.

790 The vectors suitable for use may contain one or more selectable marker genes such as a gene, which confers antibiotic resistance e.g. ampicillin, kanamycin, chloramphenicol or tetracyclin resistance. Alternatively, the selection may be accomplished by co-transformation (as described in WO91/17243).

The vector may further comprise a nucleotide sequence enabling the vector to 795 replicate in the host cell In question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.

REGULATORY SEQUENCES

In some applications, sequences suitable for use in the methods and compositions described here are operably linked to a regulatory sequence which is 800 capable of providing for the expression of the nucleotide sequence, such as by the chosen host cell.

The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is ligated in such a way 805 that expression of the coding sequence is achieved under condition compatible with the control sequences.

The term "regulatory sequences" includes promoters and enhancers and other expression regulation signals.

The term "promoter" is used in the normal sense of the art, e.g. an RNA 810 polymerase binding site.

Enhanced expression of the sequence encoding the enzyme may also be achieved by the selection of heterologous regulatory regions, e.g. promoter, secretion leader and terminator regions.

Examples of suitable promoters for directing the transcription of the nucleotide 815 sequence in a bacterial, fungal or yeast host are well known in the art.

TRANSFORMATION OF HOST CELLS

As indicated earlier, the host organism can be a prokaryotic or a eukaryotic organism. An example of a suitable prokaryotic hosts is E. colt. An example of a suitable eukaryotic organism is S. cerevisiae.

820 Teachings on the transformation of prokaryotic hosts is well documented in the art, for example see Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press). If a prokaryotic host is used then the nucleotide sequence may need to be suitably modified before transformation such as by removal of introns.

82s Filamentous fungi cells may be transformed using various methods known in the art - such as a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known. The use of Aspergillus as a host microorganism is described in EP 0 238 023.

Teachings on transforming filamentous fungi are reviewed in US-A-5741665 830 which states that standard techniques for transformation of filamentous fungi and culturing the fungi are well known in the art. An extensive review of techniques as applied to N. crassa is found, for example in Davis and de Serres, Methods Enzymol (1971) 17A: 79-143.

Further teachings on transforming filamentous fungi are reviewed in US-A 83s 5674707.

A review of the principles of heterologous gene expression in yeast are provided in, for example, Methods Mol Biol ( 1995), 49:341-54, and Curr Opin Biotechnol (1997) Oct;8(5):554-60 In this regard, yeast - such as the species Saccharomyces cerevisiae or Pichia 840 pastoris (see FEMS Microbiol Rev (2000 24(1):45-66), may be used as a vehicle for heterologous gene expression.

A review of the principles of heterologous gene expression in Saccharomyces cerevisiae and secretion of gene products is given by E Hinchcliffe E Kenny ( l 993, "Yeast as a vehicle for the expression of hetcrologous genes", Yeasts, Vol 5, Anthony H 84s Rose and J Stuart Harrison, eds, 2nd edition, Academic Press Ltd.).

For the transformation of yeast, several transformation protocols have been developed. For example, a transgenic Saccharomyces can be prepared by following the teachings of Hinnen et al., (1978, Proceedings of the National Academy of Sciences of the USA 75, 1929); Beggs, J D (1978, Nature, London, 275, 104); and Ito, H et al (1983, J 8s0 Bacteriology 153, 163-168).

CULTURING

A culture may be prepared by techniques well known in the art such as those disclosed in US 4,621,058.

The medium used to cultivate the host cells as described here may be any 85s conventional medium for growing the host cell. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. as described in the catalogues if the American Type Culture Collection.

The culture medium can be supplemented with, for instance, one or more of the following: phenylalanine, a precursor of phenylalanine, cinnamic acid, a precursor of 860 cinnamc acid, tyrosine, a precursor of tyrosine, p-coumaric acid, a p- coumaric acid precursor, 4-coumaryl CoA, a precursor of coumaryl CoA, benzalacetone and a precursor of benzalacetone.

EXAMPLES

Example 0. General Materials and Methods 865 In the methods descrbed below, the following oligonucleotides are used: PolyT 5' TTTTTTTTTTTTTTT W RubCHSs 5' CTTTCTCCACAGACTCGAGATGGTGACCGTCGATGAAGTC RubCHSa 5' CAAGTGAACCCAGCCATGGTCAAGTTGAAGCTGCCACACTG CHSintern 5' CTCCGTGAAGCGCCTCATG 870 SP6 5' ATTTAGGTGACACTATA T7 5' AATACGACTCACTATAG PRSETrev 5' TAGTTATTGCTCAGCGGTGG CHSmutS 5' GCCAAGCCATACTCGGTGACGGTGCTGC CHSmutA 5' CGTCACCGAGTATGGCTTGGCCCACAAG 875 JulR3 5' TTYCCIWSIGARTTYGGIAAYGAYGTIGAYMG JulR6 5' GGIGTIACIHTIHTITAYGGIGAYHTITAYGGICA JulR7R 5' GTRTAIGTICCIADRTCYTCYTCYTTRTTRAAIADIGC BARFWD1 5' GTGAAGGCGATCAAACAGGTCGATG BARFWD2 5' GTAACATGCAGCTAGCCGATCAAACC 880 BARREV1 5' ATAGCCTGCAAAGCAATTGCTGGAG BARREV2 5' CAAAGCAATTGCTGGAGACATAAGTGTAG Barstart 5' CTCGGATCCATGGCTCATCAGAAAAGCAAGG Barend 5' CACGAATTCTTAAACAAACTGGTCGAGGTACTCC NUP 5' AAGCAGTGGTATCAACGCAGAGT 885 SmartIIA 5' AAGCAGTGGTATCAACGCAGAGTACGCggg UPM Long 5' CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT UPM Short 5' CTAATACGACTCACTATAGGGC 3'CDS5' AAGCAGTGGTATCAACGCAGAGTAC(T)30VN 4CLDUETS 5' TATATCCATGGAGAAAGATACAAAACAGG 890 4CLINPLUS 5' AGGGACTTGTGACAAGCGTC 4CLINMIN 5' CACGTCCTCGCTATGGATATAC 4CLANTIS 5' GCGGCCGCTTAATTTGGAAGCCCAGCAG CHSDUETS 5' TATATAGATCTTGTGACCGTCGATGAAG CHSDUETA 5' TATATGGTACCTCAAGTTGAAGCTGCCAC 895 Wherein: V = (A, C or G) Y = (C or T) R = (A or G) H = (A, C or T) 900 W = (A or T) M = (A or C) D = (A, G or T) S = (C or G) I = inosine 905 g = ribonucleotide G 1.1 Preparation of the pAC-DUET-4CL-CHS vector Example 1.1 Isolating RNA from raspberry Total RNA is isolated from ripe raspberries from the cultivar Tulameen. For 910 this purpose, 5 grams of raspberries is frozen in liquid nitrogen and ground to powder using a coffee-grinder which is pre-cooled with liquid nitrogen. The powder is immediately transferred to a 250 ml centrifuge tube containing 50 ml extraction buffer (2 % CTAB, 100 mM Tris pH8.2, 1.4 M NaCI, 20 mM EDTA) pre-warmed to 65 C, then 50 pi 2-mercaptoethanol is added. The tube is incubated at 65 C for an hour and 915 is agitated every 10 minutes. The tube Is transferred to room temperature and left to stand until the tube is no longer warm. Then 50 ml chloroforrn/isoamylalcohol (24: 1) is added, the mixture is vigorously agitated for 5 seconds and centrifuged at 12,000xg for 15 minutes at room temperature. The aqueous phase is transferred into another tube, to which 50 ml of chloroform/isoamylalcohol (24:1) is added. The mixture is 920 vigorously agitated for 5 seconds and centrifuged at 12,000xg for 15 minutes at room temperature. The watery phase is transferred into another tube, to which 33 ml of 10 M LiCI is added. After careful mixing, the tube is put at 4 C and left overnight. The next day, the tube is centrifuged at 20,000xg for 20 minutes at 4 C, and the supernatant is completely removed. The pellet is dissolved in 1 ml sterile TE buffer, and extracted 92s with 1 ml phenol, phenol/chloroform/isoamylalcohol (24:24: 1) and chloroform/isoamylalcohol (24: 1). To the final waterphase, 0.11 volume of 3M sodium acetate and 3 volumes of 100 % ethanol are added, and the mixture is incubated overnight at -70 C. The next day the tube is centrifuged for 15 minutes at 14,000xg at 4 C. The supernatant is removed, the pellet washed with 70% ethanol and air-dried for 930 5 minutes. The pellet is dissolved in 20 Al water, and the concentration of RNA is measured by diluting this solution in water, and measuring the absorption at 260 nm and 280 nm.

Example 1.2 cDNA synthesis I fig of raspberry RNA is taken in a volume of 3 Al, and mixed with 1 Al polyT 93s primer (PolyT 5' flTlTrrTTTTTTTVV) (10 M). The mixture is incubated at 70 C for 2 minutes, and then immediately put on ice for 2 minutes. Then 2 Ill Sxlst strand buffer (Invitrogen), 1 pi 100 mM DTT, 1 Al 10 mM dNTP, 1 Ill Rnasin (Invitrogen) and 1 ill SST Reverse Transcriptase (Invitrogen) are added and the mixture incubated at 42 C for 90 minutes. After this, the mixture is inactivated for 7 940 minutes at 70 C, and stored on ice.

Example 1.3 Amplifying a CHS gene from raspberry cDNA Primers RubCHSa and RubCHSs are designed to amplify the full protein coding region of an aromatic polyketide synthase from raspberry deposited in Genbank under number AF292367 and described by Zheng et al., 2001.

945 RubCHSs 5' CTTTCTCCACAGACTCGAGATGGTGACCGTCGATGAAGTC RubCHSa 5' CAAGTGAACCCAGCCATGGTCAAGTTGAAGCTGCCACACTG The primers RubCHSa and RubCHSs are such that an Xhol - NcoI restriction digestion product can be ligated into vector pRSETA (Invitrogen), and results in an in frame fusion gene with the His-tag encoded by this plasmid. The gene is amplified in a 95o 25 Ill mixture containing 1 Al raspberry cDNA (see section 1.2), 2.5 1 lOxPfu buffer, 0.25 mM dNTP, 2 units of Pfu polymerase and 0.15 pM of oligonucleotides RubCHSa and RubCHSs. The mixture is heated to 95 C for 5 minutes, and then 25 cycles of 30 seconds at 92 C, 30 seconds at 63 C and 90 seconds at 72 C are performed on a thermocycler. After heating the mixture to 72 C for 5 minutes, the mixture is purified 955 using Qiaquick PCR purification kit (Qiagen). Analysis on a 1 % agarose gel shows that a DNA fragment of 1136 bp is amplified, corresponding to the expected size of the coding region of the aromatic polyketide synthase gene.

Example 1.4 Cloning CHS into pRSETA About 1 log of the fragment is cleaved with NcoI and XhoI m buffer React 3 960 (Invtrogen), in parallel with 1 lug of plasmid pRSETA. Both digestions are loaded on a I % agarose gel. After electrophoresis, fragments of the expected size (about 1100 bp for the PCR fragment and about 2900 bp for the vector DNA) are observed, and isolated from the gel using Qiaex II DNA isolation kit (Qiagen). Fragments are brought into 30 HI EB buffer (50 mM Tris pH = 8.5). To clone the aromatic polyketide 965 synthase gene from raspberry into pRSETA, 1 1 of XhoI-NcoI cleaved pRSETA and Al of purified and cleaved PCR product are mixed with 3 Al Sxligase buffer (Invitrogen) and 1 Al of T4 ligase (Invitrogen). The ligation mixture is incubated for 3 hours at 16 C and to Al of it is used for transformation of competent E. cold XL-1 Blue by standard procedures. The transformation mixture is plated on 25 ml petri dishes 970 containing LB medium, 1.5% technical agar and 100,ug/ml ampicillin. After overnight incubation at 37 C, colonies are picked into 3 ml liquid LB medium with 100,ug/ml ampicillin and grown overnight at 37 C shaking at 250 rpm. Plasmid is isolated from 1.5 ml of these cultures using the Qiagen plasmid isolation kit, and clones containing plasmids with inserts are identified by restriction digestion with XhoI and NcoI.

975 Plasmid pRSETA-CHS#1 is identified in this way. The sequence of the inserted aromatic polyketide synthase gene is analysed using oligonucleotide T7 (5 AATACGACTCACTATAG), pRSETrev (5 TAGTTATTGCTCAGCGGTGG) and CHSintern (5 CTCCGTGAAGCGCCTCATG) using the dRhod Terminato RR mix of Applied Biosystems and the recommended thermocycling program. The DNA 980 sequence (SEQ ID No 7) and the translated protein (SEQ ID No 8) of the CHS are depicted In Fig. 1. In the translated protein, the polyketide synthase part of the fusion protein starts at residue 40 (basepair 118 in the DNA sequence): the preceding part comes from the pRSET vector and contains a Hiss tag and an express epitope. The protein is 98% identical to the aromatic polyketide synthase protein encoded by the 985 gene that is used to design the primers, with 7 residues out of 391 differing. It is even more identical (99%, 3 out of 391 residues differ) to a protein called chalcone synthase 6 from Rubus idaeus with accession number AF400567, described by Kumar and Ellis (2003).

The obtained plasmid DNA is used as template to amplify the CHS gene using 990 oligonucleotides CHSDUETS (5' TATATAGATCTTGTGACCGTCGATGAAG) and CHSDUETA (5' TATATGGTACCTCAAGTTGAAGCTGCCAC) and CHSDUETA.

The isolated plasmid is diluted 1:200, and 1 ill of the dilution is used in an amplification reaction mix. The mix further contains 0.5 mM dNTP, 2. 5 1 10x BD Advantage 2 PCR buffer (BD Bioscience), 0.5 Al 50x Advantage 2 polymerase mix 99s (BD Bioscience) and 0.4 EM of oligonucleotdes. The amplification reaction mix is incubated for 5 minutes at 94 C, and subsequently subjected to 10 cycles of 30 seconds at 94 C, 30 seconds at 55 C and 3 minutes at 72 C, and 20 cycles of 30 seconds at 94 C, 30 seconds at 55 C and 3 minutes at 72 C. After these cycles, the mixture is incubated at 72 C for 5 minutes, after which it is cooled to 10 C. The amplified loon product is purified using the Qiaquick PCR purification kit (Qiagen). The purified fragment (which is 950 bp, as analysed on a 1% agarose gel) are ligated into the pGEM-T easy vector, using the pGEM-T Easy Vector System I (Promega), and subsequently brought into E. cold XL-1 Blue cells by transformation according to standard procedures. Transformed cells are plated on LB-agar plates with 100,ug/ml ampicillin. Of the resulting colonies after overnight incubation at 37 C, a few are grown in liquid culture. Clones containing plasmids with inserts are identified by restriction digestion with EcoRI. Plasmid pGEMT- CHS#1 is identified in this way.

The msert of this plasmid is sequenced using oligonucleotides T7 (T7 5' AATACGACTCACTATAG), SP6 (SP6 5' ATTTAGGTGACACTATA) and lolo CHSintern (CHSintern 5' CTCCGTGAAGCGCCTCATG). The sequence appears to be identical to the pRSETA CHS sequence, except for the restriction sites designed in the oligonucleotides.

Example 1.5 Amplifying a 4-CL-2 gene from tobacco leaf cDNA Isolating RNA from tobacco A young leaf is detached from a Nicotiana tabacum (cv. Samsung) plant and wounded by cutting it with a knife in small strips. Strips are incubated floating on water at room temperature for 2 hours, after which they are frozen in liquid nitrogen.

Frozen material Is ground to powder with a mortar and pestle. 50 mg powder is used for total RNA isolation using the SV Total RNA Isolation System (Promega) according to the description supplied by the manufacturer. The total RNA is obtained in 50 all water, and quantified by gel electrophoresis.

cDNA synthesis 1 log of tobacco RNA is taken in a volume of 3 Al, and mixed with 1 Al polyT primer (to M). The mixture is incubated at 70 C for 2 minutes, and immediately put on ice for 2 minutes. Then 2 Ill 5xls' strand buffer (Invitrogen), 1 Al lOO mM DTT, 1 Ill 10 mM dNTP, 1 HI Rnasin (Tnvitrogen) and 1 pI SST Reverse Transcriptase (Invitrogen) are added and the mixture incubated at 42 C for 90 minutes. After this, the mixture is inactivated for 7 minutes at 70 C, and stored on ice.

Amplifying a 4CL gene from tobacco cDNA The oligonucleotides: 4CLDUETS (5' TATATCCATGGAGAAAGATACAAAACAGG), 4CLTNMIN (5' CACGTCCTCGCTATGGATATAC), 4CLINPLUS (5' AGGGACTTGTGACAAGCGTC) and 4CLANTIS (5' GCGGCCGCTTAA1-1-1GGAAGCCCAGCAG) are designed to amplify the full protein coding region of the 4CL-2 gene from tobacco as deposited in Genbank under number U50846 and described by Lee and Douglas, 1996. The primers 4CLDUETS and 4CLINMIN are used to amplify a +550 bp cDNA fragment, encoding the 5' region of the 4CL2 cDNA. The oligonucleotides 4CLINPLUS and 4CLANTIS are used to amplify a +900 bp cDNA fragment, encoding the 3'region of the 4CL-2 gene. Both amplifications are carried out as follows: a 25 Al mixture is made containing 1 Al tobacco cDNA (see sections 1. I and 1.2 for details on how to obtain RNA from a sample and how to make cDNA obtaining cDNA from tobacco is carried out in a similar manner), 2.5 Al lOxPfu buffer, 0.25 mM dNTP, 2 units of Pfu polymerase and 0.15 pM of both 1045 olgonucleotides. The mixture is heated to 95 C for 5 minutes, and then 25 cycles of 30 seconds at 92 C, 30 seconds at 63 C and 90 seconds at 72 C are performed on a thermocycler. After heating the mixture to 72 C for 5 minutes, the mixture is purified using Qiaquick PCR purification kit (Qiagen). Analysis on a 1 % agarose gel showed that DNA fragments of the expected size are amplified. Both fragments are cloned into pGEMT-easy (Promega) as described by the manufacturer, and are sequenced using oligonucleotides T7 and SP6. The clone containing the 5' fragment of the 4CL gene is termed pGEMT-4CL5, the clone containing the 3' fragment of the 4CL gene is termed pGEMT-4CL3. The fragments partially overlap, and, when connected at the SalI restriction sites, make a full- length sequence (SEQ ID No 1) as shown in Fig. 2. The cDNA encodes a protein (SEQ ID No 2) that is 99% identical (539 out of 542 residues) to the 4CL-2 protein described by Lee and Douglas (1996).

Example 1.6 Cloning CHS and 4CL-2 into pAC-DUET Of the pGEMT-CHS#1 plasmid, described in section 1.4, 5 Al Is restriction digested with Bgl II restriction enzyme m buffer React 2 (Invitrogen) for 2 hours, then purified using Qiaquick PCR purification kit, then digested with restriction enzyme Kpn I in buffer React 4 (Invitrogen). The digest is separated on a 1% agarose gel, and the + 1100 bp restriction fragment is isolated from gel. In parallel, the vector pACYC DUET (Novagen) is digested with the same enzymes using the same procedure. The CHS fragment is ligated into the pACYC-DUET according to standard procedures, and then transformed into competent XL-l blue cells and selected overnight on chloramphenicol (30 microgram per ml) containing LB-agar plates. Colonies are inoculated into liquid LB medium, grown overnight at 37 C while shaking, and plasmid is isolated from the culture. The presence of the CHS gene in the pACYC DUET vector is verified by digestion with restriction enzymes Bgl II and Xho I, in 1070 buffer React 3 (Invtrogen). A positive plasmid Is termed pAC-CHS#l.

Plasmid pAC-CHS#1 is digested with restriction enzymes NcoI and Notl using React 3 buffer. The resulting vector DNA is isolated from a 1% agarose gel. At the same time the plasmid pGEMT-4CL5 is digested with restriction enzymes SalI and NcoI, and the plasmid pGEMT-4CL3 is digested with restriction enzymes SalI and Notl. Fragments of +550 bp (pGEMT-4CL5) and of +900 bp are isolated from a 1% agarose gel. The isolated fragments are mixed, and added to the digested pAC-CHS#l vector, in the presence of ligase and ligase buffer. The ligation mix, after incubation on 16 C for 3 hours, is transformed to competent E. cold XL-1 blue, and transformants are selected on LB agar with chloramphenicol. The resulting colonies are inoculated into liquid medium, and, after ON growth, plasmid is isolated, and verified for the presence of the entire 4CL2 gene by digestion with restriction enzymes NcoI and NotI. A positive plasmid is termed pAC-4CL-CHS#1.

Example 1.7 Use of the benzalacetone synthase (BAS) gene from rhubarb for the production of raspberry ketone The benzalacetonc synthase gene (BAS; accession AF32691 l) from Rheum palmatunz (rhubarb) is used in a bacterial system to produce raspberry ketone. For this purpose, RNA is isolated from Rheum palmatum using a procedure as described by Abe et al. (2001).

From this RNA, cDNA is generated according to the following protocol. One lug of rhubarb RNA is taken in a volume of 3 Al, and mixed with 1 Al polyT primer (PolyT 5' TTTT1 1 1 1 1 1 1TTTTVV) (lo,uM). The mixture is incubated at 70 C for 2 minutes, and then immediately put on ice for 2 minutes. Then 2 Al Sx 1st strand buffer (Invitrogen), 1 Al 100 mM DTT, 1 Ill 10 mM dNTP, I soul Rnasin (Tnvitrogen) and 1 Ill SST Reverse Transcrptase (Invtrogen) are added and the mixture incubated at 42 C o95 for 90 minutes. After this, the mixture is inactivated for 7 minutes at 70 C, and stored on ice.

From this cDNA, the Rheum BAS gene Is amplified using oligonucleotides RheumSe (5' TGAGACTTATACTTGGGTAGAGAAATGGC) and RheumAs (5' GACCCTCGASTCACTTGTACATTTGA). For amplification, a 25 pI mixture l loo containing 1 HI rhubarb cDNA contains 2.5 ul lox BD Advantage 2 PCR buffer (BD Bioscience), 0.5 ul 50x Advantage 2 polymerase mix (BD Bioscience), 0.25 mM dNTP, and 0.15 pM of oligonucleotides RheumSe and RheumAs. The amplification reaction mix is incubated for 5 minutes at 94 C, and subsequently subjected to 10 cycles of 30 seconds 94 C, 30 seconds 52 C and 3 minutes 72 C, and 20 cycles of 30 seconds at 94 C, 30 seconds at 55 C and 3 minutes at 72 C. After these cycles, the mixture is incubated at 72 C for 5 minutes, after which it is cooled to 10 C. A secondary PCR is performed using 1 Al of the primary PCR reaction as a template, using the same circumstances, except that now oligonucleotides RheumFw (5' TATATGTCGACTAGCTAATTACGGGCATACTG) and Rheum Re (5' l l lo ATGGCGGATCCTGAGGAGATGAAGAAATTGG) are used. The amplified product is purified using the Qiaquick PCR purification kit (Qiagen). Analysis on an 1 % agarose gel shows that a DNA fragment of about 1100 bp is amplified, corresponding to the expected size of the coding region of the Rheum BAS gene.

When 1 lug of the purified fragment is obtained, by pooling PCR reactions, the 11 Is purified fragment is ligated into the pGEM-T easy vector, using the pGEM-T Easy Vector System I (Promega), and subsequently brought into E. cold XL-1 Blue cells by transformation according to standard procedures. Transformed cells are plated on LB agar plates with 100 ug/ml ampicillin. Of the resulting colonies after overnight incubation at 37 C, a few are grown in liquid culture. Clones containing plasmids with l 120 inserts can be identified by plasmid isolation and restriction digestion with EcoRI.

Plasmid pGEMT-BASRheum can be obtained in this way. The insert of this plasmid is sequenced using oligonucleotides SP6 (5' ATITAGGTGACACTATA) and T7 (5' AATACGACTCACTATAG). The sequence should appear to be identical or within 95% identical to the sequence of accession AF326911, except for the restriction sites designed in the oligonucleotides. Figure 3 shows the nucleotides and amino acid sequence of the rhubarb BAS (SEQ ID Nos 5 and 6).

Of the pGEMT-BASRheum plasmid, 1 lag is digested with BamHI and SalI restriction enzymes in the appropriate buffer for 2 hours. The digest is separated on a 1% agarose gel, and the +1175 bp restriction fragment is isolated from gel (this 1130 fragment is referred to as the Rheum BAS fragment). In parallel, the vector pAC- DVET-4CL-CHS (described in section 1.6) is digested with BglII and XhoI restriction enzymes using the same procedure, and a 5561 bp fragment is isolated from gel. This fragment is referred to as pAC-4CL. The Rheum BAS fragment is ligated into the pAC-4CL fragment according to standard procedures, and then transformed into 1135 competent XL-1 blue cells and selected overnight on chloramphenicol (30 microgram per ml) containing LB-agar plates. Colonies are inoculated into liquid LB medium, grown overnight at 37 C while shaking, and plasmid is isolated form the culture. The presence of the appropriate Rheum palmatum BAS gene in the pAC-4CL vector is verified by sequencing using oligonucleotide DuetSens2 (5' TTGTACACGGCCGCATAATC). A positive plasmid is termed pAC-4CL- BASrheum.

Tests for usefulness of the plasmid pAC-4CL-BASRheum are performed as described in sections 1.8, 1.9 and 2.12. The person carrying out the experimentation will observe formation of raspberry ketone depending on the presence of this plasmid.

Example 1.8 Expression of BAS and 4CL-2 in E. cold The pACYCDVET plasmid encodes both the 4CL and the BAS protein behind the T7 promoter. This promoter is not recognised by the bacterium, unless a gene encoding T7 polymerase is introduced. In the case of strain E. cold BL21- CodonPlusRIL, the T7 polymerase is encoded on the chromosome of the bacterium, under control of the lac-promoter. Thus, the expression of proteins is not possible in normal E. cold strains, while in E. cold BL21 CodonPlus- RIL, the expression of fusion protein can be repressed by glucose, and induced by IPTG. To improve this control, we provided in E. cold BL21 CodonPlus-RIL with plasmid pREP4 (Qiagen), which provides additional lacrepressor to the cold strain, and encodes a low level of kanamycin resistance.

E. cold BL21 CodonPlus-RIL-pREP4 is made competent by growing the cells overnight at 37 C and 250 rpm in LB with 1% glucose and 20 glml kanamycin. The next day, the overnight culture is diluted 100-fold in fresh LB medium with 1% glucose until an optical density at 600 nm of 0.4 is reached. 10 ml of culture is centrifuged for 5 minutes at 400xg. Supernatant is discarded and replaced by 10 ml of an ice-cold solution of 10 mM CaCI2 and 1 mM Tris-HCI pH = 7.5. Cells are resuspended and immediately centrifuged again at 400xg for 5 minutes. After discarding the supernatant, cells are resuspended in 2 ml of an ice-cold solution of 75 mM CaC12 and 1 mM Tris-HCI pH = 7.5. After incubation on ice for at least 30 minutes, cells can be used for plasmid transformation by standard procedures.

Plasmids pAC-4CL-BASrheum and pACYCDUET are used to transform these cells, and transformed colonies are selected on LB-agar plates supplied with 1% glucose, 20,ug/ml kanamycin and 30 1lg/ml chloramphenicol. Colonies are transferred to 1 ml liquid LB supplied with 1% glucose, 20,ug/ml kanamycin and 30,ug/ml chloramphenicol and grown overnight at 37 C and 250 rpm.

The next day, a 75 mM solution of p-coumaric acid (Sigma) is prepared in 0.1 N NaOH. After dissolving the coumaric acid, the solution is neutralised to pH = 8 by adding 1 N HCI. The overnight culture is diluted 100-fold in 10 ml fresh LB medium with 1% glucose and 15,ug/ml chloramphenicol until an optical density at 600 rim of 0.4 is reached. 10 ml of culture is centrifuged for 5 minutes at 400xg. Supernatant is discarded and cells are resuspended in 50 ml of LB supplied with 20 g/ml chloramphenicol and 1 mM IPTG and 3 mM p-coumaric acid. Then the cultures are grown overnight at 28 C and 250 rpm.

The next day, the cultures are transferred to separation funnels, and 20 ml ethyl i80 acetate is added under vigorous mixing. The funnels are left to separate the phases for minutes, after which the lower phases arediscarded. The upper phases are collected in centrifuge tubes, sonicated for 10 minutes In a bath and centrifuged for 5 minutes at 1200xg. The clear ethyl acetate phases are transferred to fresh tubes. The ethyl acetate is aspired under a nitrogen flow.

Example 1.9 Analysis of benzalacetone formation For analysis on 1:IPLC, residuals of dried samples are resuspended in lSO Al 100% methanol. Samples are injected in the following order: pACYC-DUET culture extract; pAC-4CL-BASrheum culture extract; benzalacetone standard; naringenin standard. 20 Ill of these samples Is injected into an HPLC system using a Luna 3u C18(2) 150x4.6 mm column (Phenomenex). The HPLC set-up is composed of a Waters 600 controller and a Waters 996 Photo Diode Array detector. The column is used at 40 C, flow rate 1 ml / min. The products are eluted with a gradient, made from buffer A (0.1% formic acid in water) and buffer B (100 % acetonitril).

* The gradient is defined as follows: t=0 A=95% B=5% t=30 A=75% B=25% t=35 A=70% B=30% t=37 A=50% B=50% t=40 A=50% B=50% 1200 t=42 A=95% B=5% t=47 A=95% B=5% The benzalacetone standard elutes at 27 minutes, and maximal absorption of this compound is observed at 320 nm. The naringenin standard elutes after 41 minutes, having maximal absorption at 288 nm. The extract of pAC-4CL-BASrheum 205 gives a peak at 27 minutes, in the region where benzalacetone elutes. This peak has an absorption spectrum exactly matching that of benzalacetone. Mass spectrometry confirms the presence of a compound with mass 163 ([M+H], corresponding to the mass of benzalacetone). Another clear peak is observed at 41 minutes, having the same absorption spectrum as naringemn. Both peaks are absent from the sample of the 1210 pACYC-DUET culture extract.

This shows that the rhubarb BAS, when expressed in combination with the 4CL-2 gene, is active in E. colt, and converts coumaric acid into both benzalacetone and naringenin. Therefore it is applicable as a tool to produce raspberry ketone in a microbial cellular environment.

1215 Example 1.10 Production of raspberry ketone and benzalacetone by host cells The production of raspberry ketone, benzalacetone and naringenin upon feeding of 4 mM p-coumaric acid to a 50 ml culture and growing overnight at 28 C is compared for bacterial strains (E cold BL21) transformed with the following vectors using standard transformation techniques as described in section 1.7.

220 pAC-DUET - the empty vector.

pAC-4CL-BASrheum from rhubarb Is prepared as described in 1.7.

The culture medium is 2xTY with 30,ug/ml chloramphenicol and SmM pcoumaric acid and lmM IPTG.

The results are summarized in Table 2.

Raspberry ketone Benzalacctone naringenin (microgram per 50 (microgram per 50 (microgram per 50 ml) ml) ml) pAC-4CL- 0.2 0.1 0 BASrheum Cloning of a Benzalacetone Reductase (BAR) gene The BAR protein is poorly charged which makes the purification procedure difficult.

Example 2.1 Crude purification 1230 As a first step, about 20g of ripe raspberry fruits from variety Tulameen are frozen in liquid nitrogen, and ground to powder in a cooled coffee mill. The powder, still frozen, is mixed with 65 ml buffer R (0.2 M KPO4 pH = 8.0, 2mM DTT), 8 mg sucrose, 2 g polymerised polyvinylpyrolidon and half a tablet of Protease inhibitors Complete (Roche). The mixture is stirred on ice for 10 minutes. The solid matter is 1235 removed by filtering through cheesecloth and centrifuged for 20 minutes at 20,000xg and 4 C. The supernatant is recovered, its volume measured, and 0.516 g (NH4)2SO4 per ml is slowly added during 20 minutes, under continuous stirring in 4 C. Stirring is continued overnight at 4 C. The next day the mixture is centrifuged in 4 tubes for 20 minutes at 20, 000xg and 4 C. The supernatant is removed carefully, and the pellet is 1240 resuspended in total 8 ml buffer R (4 C). Every 2 ml is filtered through glass wool, and loaded on a PD10 column (Pharmacia), which had been previously equilibrated with ml buffer A (20 mM Tris HCl pH = 8.5 + 5 mM 2-mercaptoethanol), by gravity.

The column is washed with 0.5 ml buffer A, and subsequently protein is eluted with 3.5 ml buffer A (4 C). The eluted protein from 4 PDl0 columns s pooled and stored 1245 on ice as Crude Enzyme.

Example 2.2 Enzyme assay Fractions from the Anion exchange column (see section 2.3) and the butyl FF column (see section 2.3) are analysed for presence of BAR activity. Of each fraction, Al is mixed with 20 Ill of substrate solution (containing 0.8 mg/ml p 250 hydroxyphenylbutenone) and 10 Ill NADPH solution (containing 10 mg/ml NADPH), and incubated at 30 C for 45 minutes under gentle shaking. Subsequently, the reaction mixture is added to 1 ml ethylacetate containing 1 lag /ml 4-(4-methoxyphenyl)-2 butanonc (Aldrich) as an Internal standard. The mixture is vortexed for 5 seconds, and centrifuged for 5 minutes at 1200xg. The ethylacetate phase is recovered, filtered over 255 solid sodium sulphate to remove residual water. Of the samples, 2 AL is analysed by GC-MS using a gas chromatograph (5890 series II, Hewlett- Packard) equipped with a 30-m x 0.25-mm i.d., 0.25-,um film thickness column (SMS, Hewlett-Packard) and a mass-selective detector (model 5972A, Hewlett-Packard). The GC is programmed at an imtial temperature of 45 C for I min. with a ramp of 10 C per min to 220 C and 260 final time of 5 min. The injection port (splitless mode), Interface, and MS source temperatures are 250 C, 290 C, and 180 C, respectively, and the He inlet pressure is controlled with an electronic pressure control to achieve a constant column flow of 1.0 mL per min. The ionisation potential is set at 70 eV. Compounds are detected in the selected-ion- montoring mode: m/z 107, 121 and 164. Masses at m/z 107 and 164 are 265 typical for raspberry ketone, while mass 121 is typical for the internal standard. The peak surface at m/z 107, eluting around 15 minutes, is used as a measure for the amount of raspberry ketone formed, and consequently for the BAR activity in the sample. To exclude errors caused by evaporation of the solvent during or after extraction, values are divided by the peak surface of the internal standard, measured at 270 m/z 121.

Example 2.3 anion exchange For anion exchange, 12 ml Crude Enzyme is slowly (0.5 ml/minute) pumped over a HiTrap Q FPLC column (1 ml, Pharmacia), which had been previously calibrated in buffer A (4 C). Subsequently the column is washed with 15 ml of buffer so 1275 A (4 C). Then the column is attached to an FPLC set up, in which Buffer A (20 mM Tris HCI pH = 8.5 + 5 mM 2-mercaptoethanol) and buffer B (20 mM Tris HCI pH = 8.5 + I M NaCI + 5 mM 2-mercaptoethanol) are held on ice. The FPLC is programmed to run the following gradient: Pump speed 1 ml/min,.

280 T=0 to t=2 min 100% A T=2 to t=4 min 5% B T=4 to t=7 min 7.5% B T=7 to t=10 min 10% B T=10 to t=13 min 12.5% B 1285 T=13 to T=15 min 15% B From T=15 to T = 30 minutes, a gradient from 15% B to 100 % B. Fractions are collected every minute.

The majority of BAR activity appeared to be bound to the anion-exchange column, and to elute n fractions 4 to 7, at 5-7.5 mM NaCl. A second (small and much 290 broader) peak elutes in fractions 9 to 13 (Figure 4).

Example 2.4 hydrophobic interaction From the 1 ml Anion-exchange fractions 3 to 7, 700 1 are pooled and added together to 20 ml 1M (NH4) 2SO4. Ths mixture is loaded on a 1 ml HiTrap Butyl FF column (Pharmacia) at +4 C, and the column s washed with ice-cold buffer C (20 mM 295 Tris HCI pH = 8.5 + 1 M (NH4)2SO4 + 5 mM 2-mercaptoethanol). Subsequently, the column is connected to an FPLC setup, from which 1 ml fractions are eluted every minute during a 30 minute gradient from 100% buffer C to 100 % Buffer A. Fractions are analysed for BAR activity according to 2.2.

Almost all activity is retained by the Butyl FF column. Most BAR activity is 300 eluted in fractions 24 to 30, although a large portion (about 50%) of activity is not recovered.

Example 2.5 proteins in active fractions Protein concentration is determined in the active fractions of 2.3 and 2.4, using the kilorad Protein Assay. From each relevant fraction, 25 Al is loaded on an analytical 305 15% SDS PAGE gel, and stained by silver staining according to Rabilloud et al. (1988). Active fractions from the butyl FF column appeared to contain 5 dominant protein bands, which are called BAR1, BAR2, BARS, BAR4 and BARS (Figure 5).

400 pi of each of fractions 25, 26, 27, 28 and 29 are added to 200 Ill 40% trichloracetic acid and 500 pi acetone. The mixtures are left on ice for I hour and centrifuged at 4 C 310 13,000xg for 15 minutes. Supernatant is removed, and 500 1 ice-cold acetone is used to wash each pellet. Pellets are pooled and totally dissolved in 25 Ill buffer containing mM Tris pH=6.8, 6% Glycerol, 1% SDS and 20 mM DTT, boiled for 5 minutes and loaded on a 15% SDS PAGE gel. After running the gel, it is stained with Coomassie BB. The bands corresponding to BAR1 to BARS are excised from the gel. Gel slices 315 are excised, dried, and protein is digested in gel with trypsin, according to Sevchenko et al. (1996).

Example 2.6 Qtof MS/MS analysis of peptides Protein is extracted from the gel slices, and loaded onto a C18 PepMap column (15 cm x 75 cm). Peptides are eluted by a 30 min. gradient from 0.5% formic acid in 320 water to 0.5% formic acid in 50 % acetonitrl at a speed of 0.2 ul/min. The C18 column is connected to the electro-electro-spray of a Q-Tof-2 Mass spectrometer (Mcromass) by a PcoTip (New Objective). The Qtof mass spectrometer is instructed to determine charge of the eluting peptides, and, if appropriate (i.e. 2+ or 3+), the QtofMS switched to the MS/MS mode applying collision-induced dissociation (CID).

325 The resulting CID spectrum contains the sequence information for a single peptide.

The Mass-Lynx package V4.0 (MicroMass) and Protein Lynx Global Server V2.0 are used to processing and deconvoluting MS data, and to search the NCBI non- redundant database. Spectra matching database entries are selected for further analysis.

Relevant peptides found in the automated search are shown in table 3. 1. S 5

E O

r. . . i. t D _ r 8 cot cot rat e D S 9 2. LO I on to xx a e C' IL <q ss "Hits" are found relevant when a protein with a molecular weight of similar size as observed for the sequenced BAR protein Is identified. The hit with isoflavone reductase homologues from protein BAR3 has the highest blast score and thus was 335 considered as being the best candidate for having BAR activity. The enzymatic class of isoflavone reductase Is EC 1.3.1.45 and hence the BAR enzyme should also be classified as belonging to enzymatic class EC 1.3.1.

To further confirm the identity of the BAR3 protein, the BioLynx PepSeq module is used to interpret MS/MS spectra and to generate peptide sequences from the 340 spectra manually. We looked in particular for peptides potentially matching the isoflavone reductase homologue from Betula pendula (gil4731376lgblAACO5116.2l).

The following peptides in Table 4 are deduced from the spectra.

9 S 9 1 9 93 9 9 9 c o 0 o PI Cat o cat cn en C m m:4 m m o en a: m 345 Clearly, these peptdes match a homologue of the Betula gene, especially if it is taken into account that the spectrum of peptde BAR3.2 is not clearly readable in the first part of the peptide, and that Isoleucin and Leucin cannot be distinguished by mass spectrometry.

Example 2.7 Obtaining a fragment of the BAR gene 350 Having several peptide sequences from the potential BAR protein in hand, oligonucleotides are designed matching these sequences (see Table 5) .

Table 5

Name Oligonucleotide sequence Peptide sequence Orientation JulR3 11YCCIWSIGARTTYGGIAAYGAYGTIGAY FPSEFGNDVDR sense

MG

JulR6 GGIGTIACIHT1HTITAYGGIGAYHTITAYGG GVTIIYGDIYG sense

ICA H

JulR7R GTRTAIGTICCIADRTCYTCYTCYTTRTTRA AIFNKEEDIGT antisense

AIADIGC YT

To amplify parts of the soflavone reductase homologue from raspberry, cDNA is prepared from total RNA isolated from ripe Tulameen raspberries, as described in 355 section 1.2 from this cDNA, 5 pi is used as a template in a 25 Al amplification reaction mix, which further contained 0.5 mM dNTP, 2.5 pi 10x BD Advantage 2 PCR buffer (BD Bioscience), 0.5 Al 50x Advantage 2 polymerase mix, 0.4,uM oligonucleotide JulR7R and 0.4 EM of either oligonucleotide JulR3 or oligonucleotide JulR6. This amplification reaction mix is incubated for 5 minutes at 94 C, and subsequently 360 subjected to 25 cycles of 30 seconds at 94 C, 30 seconds at 45 C, a ramp-trajectory of seconds during which the temperature is increased to 50 C, and 2 minutes at 68 C.

After these 25 cycles, the mixture is incubated at 68 C for 5 minutes, after which it is cooled to 10 C. The amplified mixture is separated on a 1% agarose gel.

The mixture with oligonucleotdes JulR6 and JulR7R yielded a fragment of 365 about 450 bp; the mixture with oligonucleotides JulR3 and JulR7R yielded a fragment of 280 bp. Both fragments are isolated from the gel into 40 1 of buffer TB.

From the isolated fragments, 1 1 is used in amplification reaction mixes, which further contained 0.5 mM dNTP, 2.5 ill lOx BD Advantage 2 PCR buffer (BD Bioscience), 0.5 pi 50x Advantage 2 polymerase mix, 0.4,uM oligonucleotide JulR7R 1370 and 0.4 EM of either oligonucleotide JulR3 or oligonucleotide JulR6. These amplification reaction mixes are incubated for 5 minutes at 94 C, and subsequently subjected to 35 cycles of 30 seconds at 94 C, 30 seconds at 50 C and 3 minutes at 72 C. After these cycles, the mixtures are incubated at 72 C for 5 minutes, after which they are cooled to 10 C. The amplified products are purified using the Qiaquick PCR t375 purification kit (Qiagen).

The purified fragments are ligated into the pGEM-T easy vector, using the pGEM-T Easy Vector System I (Promega), and subsequently brought into E. cold XL 1 Blue cells by transformation according to standard procedures.

Transformed cells are plated on LB-agar plates with 100 lug /ml ampicillin. Of 380 the resulting colonies after overnight incubation at 37 C, a few are grown in liquid culture. Clones containing plasmids with inserts are identified by restriction digestion with EcoRI. Plasmids pGEMT-BAR3.2 (resulting from the amplification with primers JulR3 and JulR7R) and pGEMT-BAR5. 1 (resulting from the amplification with primers JulR6 and JulR7R) are identified in this way. The nucleotide sequence of the i38s inserted DNA fragments is analysed usmg oligonucleotides T7 and SP6. A BLASTX analysis of the resulting DNA sequences revealed that both fragments have high homology to the Isoflavone reductasc homologue of Betula Pendula. Fragments of pGEMT-BAR5.1 match amino-acids 55 to 199 and fragments of pGEMT-BAR3.2 match amino acids 115 to 199 (3.2) of this protein.

1390 Example 2.8 Obtaining cDNA ends ot the BAR gene To extend the fragments of the gene obtained in section 2.7 to both the 5' end and the 3' end of the cDNA, the SMART RACE cDNA Amplification Kit (Clontech) is applied.

Firstly, based on the pGEMTBAR5. 1 DNA sequence, two forward primers 395 (BARFWD1 and BARFWD2) and two reverse primers (BARREV1 and BARREV2) are designed. Total RNA from red Tulameen raspberries (see Section 1.1) is isolated.

To obtain 5' RACE cDNA, 3 1 of this RNA is mixed with 1 pi of oligonucleotide PolyT (10 M) and 1 HI SMART IIA oligonucleotide (10 M). To obtain 3' RACE cDNA, 3 Al of this RNA is mixed with 1 1 3'CDS primer (10 '1M).

400 Both mixtures are heated for 2 minutes at 70 C, cooled on ice for 2 minutes and mixed with 2 pi 5xFirst-Strand Buffer, 1 Al 20 mM DTT, 1 Al 10 mM dNTP and 1 pi Powerscript Reverse Transcriptase.

For cDNA synthesis, the mixtures are incubated at 42 C for 1.5 hour. After that, 100 pI Dilution buffer (10 mM Tricine KOH pH = 8.5 + 1 mM EDTA) is added 405 and the mixtures are incubated at 70 C for 7 minutes, and cooled on ice.

For the 5' RACE reaction, 2.5 Al TRACE cDNA is mixed with 1 pi BARREV1 (10 'EM), 34.5 Al water, 5 1 10x Advantage 2 PCR buffer, 1 Al 10 mM dNTP and 5 1 UPM (consisting of 0.4 EM UPM Long oligonucleotide and 2 I1M UPM Short oligonucleotide).

410 For the TRACE reaction, 2.5 pi 3'RACE cDNA is mixed with 1 pi BARFWD1 (10,uM), 34.5 pI water, 5 Al 10x Advantage 2 PCR buffer, 1 Al 10 mM dNTP and 5 Al UPM (consisting of 0.4 AM UPM Long oligonucleotide and 2 AM UPM Short oligonucleotide).

These RACE mixes are incubated for 5 minutes at 94 C, and subsequently 1415 subjected to 35 cycles of 30 seconds at 94 C, 30 seconds at 56 C and 3 minutes at 68 C. After these cycles, the mixtures are incubated at 68 C for 5 minutes, after which they are cooled to 10 C. Both the 5P RACK mix and the TRACE mix are diluted 50 times in Dilution buffer. Of the TRACE dilution, 5 Al is mixed with 34.5 Al water, 5 Al lOx Advantage 2 PCR buffer, 1 Al 10 mM dNTP, I 1 of oligonucleotide 1420 BARREV2 and 1 Al of oligonucleotide NUP. Of the 3' RACE dilution, 5 soul is mixed with 34.5 HI water, 5 Al lOx Advantage 2 PCR buffer, 1 Al 10 mM dNTP, 1 Al of oligonucleotide BARFWD2 and 1 1 of oligonucleotide NUP. Both mixtures are incubated for 5 minutes at 94 C, and subsequently subjected to 20 cycles of 30 seconds at 94 C, 30 seconds at 56 C and 3 minutes at 68 C. After these cycles, the 1425 amplification mixtures are incubated at 68 C for 5 minutes, after which they are cooled to 10 C. Both mixtures are analysed on a 1% agarose gel.

The 5' RACE amplification mixture contained a 500 bp fragment, while the TRACE amplification mixture contained a 1000 bp fragment.

Both fragments are purified using the Qiaquick PCR purification kit (Qiagen).

1430 Each of the purified fragments is ligated into the pGEM-T easy vector, using the pGEM-T Easy Vector System I (Promega), and subsequently brought into E. cold XL-1 Blue cells by transformation according to standard procedures.

Transformed cells are plated on LB-agar plates with 100 log /ml ampicillin, and grown overnight at 37 C. A number of colonies are transferred into 20 Al water and 1435 incubated at 98 C for 10 minutes. After cooling to room temperature, 0.25 pI T7 oligonucleotide (lO M), 0.25 Al SP6 oligonucleotide, 2.5 Al SuperTaq buffer (SphaeroQ), 0.2 Ill 25 mM dNTP and 1 unit SuperTaq (SphaeroQ) are added, mixed and the mixtures are amplified by incubating for 5 minutes at 94 C, and subsequently undergoing 35 cycles of 30 seconds at 94 C, 30 seconds at 50 C and 3 minutes at 1440 72 C. After these cycles, the mixtures are incubated at 68 C for 5 minutes, after which they are cooled to 10 C.

Amplified products are analysed on a gel, and amplification products of size 600 (for TRACE) and 1100 (for 3'RACE) are selected.

Of these products, 1 pi is used for sequencing reactions with oligonucleotide 1445 T7 and oligonucleotide SP6. The resulting sequence data from both the TRACE product and the TRACE product are analysed by BLASTX, and appeared to match the Betula isoflavone reductase homologue.

DNA sequences of the TRACE product, the 3'RACE product and the internal fragment described in section 2.7 are assembled using the SEQMAN module of the 450 Lasergene system (DNASTAR). A consensus sequence is assembled and corrected for obvious interpretation mistakes. The resulting DNA sequence (SEQ ID No 3) and translated protein (SEQ ID No 4) are shown in Figure 6. Analysis by BLASTX reveals that the encoded protein is 84% identical to an isoflavone reductase-like protein from Betula pendula (gil10764491lgblAAG22740.1l) (261 out of 309 amino acids).

i455 Example 2.9 Cloning of the full-length BAR gene In order to produce the BAR gene recombinantly, it is cloned into the expression vector pRSETA.

With this aim, raspberry cDNA is produced (see section 1.2), from which 2 1 is used in an amplification reaction mix. The mix further contained 0.5 mM dNTP, 2.5 460 pi 10x BD Advantage 2 PCR buffer (BD Bioscience), 0.5 pl 50x Advantage 2 polymerase mix (BD Bioscience) and 0.4 AM of oligonucleotides Barstart and Barend.

The amplification reaction mix is incubated for 5 minutes at 94 C, and subsequently subjected to 10 cycles of30 seconds at 94 C,30 seconds at 60 C and 3 minutes at 72 C, and 20 cycles of30 seconds at 94 C,30 seconds at 55 C and 3 minutes at 72 C.

465 After these cycles, the mixture is incubated at 72 C for 5 minutes, after which it is cooled to 10 C. The amplified product Is purified using the Qiaquick PCR purification kit (Qiagen).

The purified fragment (which is 950 bp, as analysed on a 1% agarose gel) is ligated into the pGEM-T easy vector, usmg the pGEM-T Easy Vector System I t470 (Promega), and subsequently brought into E. cold XL-1 Blue cells by transformation according to standard procedures.

Transformed cells are plated on LB-agar plates with 100 log /ml ampicillin. Of the resulting colonies after overnight incubation at 37 C, three are grown in liquid culture. Clones containing plasmids with inserts are identified by restriction digestion 1475 with EcoRI. Plasmid pGEMT-BAR#1 is identified in this way.

About 1 lag of pGEMT-BAR#l is cleaved with EcoRI and BamHI in buffer React 3 (Invitrogen), in parallel with 1 lag of plasmid pRSETA. Both digestions are loaded on a I % agarose gel. After electrophoresis, fragments of the expected size (about 950 bp for the PCR fragment and about 2900 bp for the vector DNA) are 1480 observed, and isolated from the gel using Qiaex II DNA isolation kit (Qiagen).

The fragments are brought into 30 HI EB buffer (50 mM Tris pH = 8.5). To clone the benzalacetone reductase from raspberry into pRSETA, 1 Al of Xhol-NcoI cleaved pRSETA and 10 pi of purified and cleaved PCR product are mixed with 3 1 5xlgase buffer (Invitrogen) and I pi of T4 ligase (Invitrogen). The ligation mixture is 485 incubated for 3 hours at 16 C and 10 1 of it is transformed into competent E. cold XL 1 blue by standard procedures.

The transformation mixture is plated on 25 ml petri dishes containing LB medium, 1.5% technical agar and 100 lag /ml ampicillin. After overnight incubation at 37 C, colonies are picked into 3 ml liquid LB medium with 100 log /ml ampicillin and 1490 grown overnight at 37 C shaking at 250 rpm.

Plasmd is isolated from 1.5 ml of this culture using the Qiagen plasmid isolation kit, and clones containing plasmids with inserts are identified by restriction digestion with EcoRI and BamHI. Plasmid pRSETA-BAR#1 is identified in this way.

The nucleotide sequence of the inserted DNA fragment of pRSET-BAR#1 is 495 analysed using oligonucleotides T7 and pRSETrev. A sequence alignment with the DNA sequence obtained in section 2.8 revealed that both sequences are identical.

Example 2.10 Expression of the BA R genein E. cold As a first example of BAR activity in microbial systems, the BAR protein is purified from cell extract. For expression of the BAR gene, plasmid pRSETA and l5oo pRSETBAR#1 are transferred to E. cold BL21 CodonPlus-RTL-pREP4 as described in section 1.8.

After transformation, bacteria are plated on LB agar, supplied with 100, ug/ml ampicillin, 20,ug/ml kanamycin and 1% glucose, and incubated overnight at 37 C.

From both the pRSETA bacteria and the pRSET-BAR#1 bacteria, a colony is 50s inoculated in 1 ml LB medium, supplied with 100 ug/ml ampicillin and 1% glucose, and incubated overnight at 37 C and 250 rpm shaking. The next morning, 350,ul bacterial suspension is transferred to 35 ml LB medium supplied with 100 log /ml ampicillin and 1% glucose, and incubated in a 1 litre Erlenmeyer at 37 C until an optical density at 600 rim of 0.6 is reached.

510 Bacteria are recovered by centnfugation at 4000 rpm in a table centrifuge, medium is removed, and the pellets are resuspended in 35 ml LB medium, supplied with 50 g/ml ampicillin and 1 mM TPTG. The suspension is transferred to a 1 1itre erlenmeyer and incubated overnight at 16 C and 250 rpm shaking. The next day, bacteria are harvested by centrifugation at 4000 rpm for 10 minutes, after which the 515 medium is removed. The bacteria are resuspended in 1 ml ice-cold it- buffer (containing 50 mM Tris-HCI pH = 8 and 10 mM 2-mercaptoethanol). 10 lug Iysozyme is added and cells are sonicated on ice for 5 times 10 seconds, with 10 seconds break and an amplitude of 14 using an MSE Soniprep 150 sonicator. The sonicated cells are centrifuged for 10 minutes at 4 C and 14,000xg.

520 The supernatant is loaded on a Ni-NTA spin column (Qiagen) and centrifuged at 2000xg for 2 minutes. The flow-through is discarded, and the column is washed twice by loading it with 500 Al ice-cold R-buffcr and centrifuging it for 2 minutes at 2000xg. Then the fusion protein is eluted twice from the column by loading it with 100 Ill ice-cold it-buffer, supplemented with 200 mM imidazole and centrifuging for 1 525 minute at 2000xg. The resulting elutants are combined.

The purified BAR protein still carries a 31 amino-acid N-terminal extension, including the His tag. At the junction between this leader and the native BAR protein, there is an enterokinase cleavage site.

To remove the N-terminal extension, the His-purified protein is treated with the 530 Enterokinase Cleavage Capture kit from Novagen (Madison), according to instructions from the manufacturer. After removal of the enterokinase, the BAR protein preparation is immediately used for activity assays. Activity assays are carried out as described in section 2.2.

The GC-MS analysis clearly indicates that the BAR protein converted 535 benzalacetone into raspberry ketone, whereas a protein preparation made from cultures carrying pRSETA only, which are treated in exactly the same way, could not perform this conversion. This demonstrates that the BAR gene encodes the benzalacetone reductase.

Example 2.11 BAR activity of E. cold 540 As a second example, in viva production of raspberry ketone by E. coli, which had not been transformed with an expression vector comprising a heterologous BAR sequence, is performed.

For this purpose, benzalacetone is incubated in 1 ml LB medium at a concentration of 100 g/ml while shaking 14 hours at 250 rpm at 37 C, in the presence 545 and absence of a growing culture of E. cold BL21. Culture is inoculated by transferring a single colony into the medium. The complete culture is extracted with lml ethyl acetate with internal standard and further analysed on GC-MS as described in section 2.2. Figure 7 shows that E cold which have not been transformed with a vector comprising BAR have BAR activity in the presence of benzalacetone (BA).

550 The produced raspberry ketone (described as ratios of ion 107 and ion 121, see section 2.2) is compared between benzalacetone incubated with E. cold (ratio 107/121 = 4.33, and benzalacetone incubated with LB only (ratio 107/121 = 0.005). This clearly demonstrated that the E. cold culture converts benzalacetone into raspberry ketone.

555 Example 2.12 Production of raspberry ketone from p-coumaric acid by E. cold As a third example, an experiment is performed exactly as described in sections 1.7, with bacteria harbouring pACYC DUET and bacteria harbouring pAC-4CL BASRheum.

To detect the formation of raspberry ketone, the residual culture extract that 560 remains after ethyl acetate aspiration is dissolved in 0.5 ml ethyl acetate. 2 pi of these samples are injected in the following order: pACYC- DUET culture extract; pAC-4CL BASRheum culture extract; raspberry ketone standard. The pAC-4CL- BASRheum culture displays raspberry ketone, which is absent from the pACYC-DUET culture extract. This demonstrates that E. cold harbouring the tobacco 4CL2 gene and the 565 rhubarb BAS gene is able to convert p-coumaric acid into raspberry ketone.

REFERENCES

Abe I, Takahashi Y. Morita H. Noguchi H. (2001) Benzalacetone synthase. A novel polyketide synthase that plays a crucial role in the biosynthesis of phenylbutanoncs in Rheum palmatum. Eur J Biochem. 268(11), 3354-9.

570 Abe I, Sano Y. Takahashi Y and Noguchi H. (2003) Site-directed mutagenesis of benzalacetone synthase. The role of the Phe215 in plant type III polyketide syntheses. J Biol Chem. 278(27), 25218-26.

Borejsza-Wysocki W and Hrazdina G (1994) Biosynthesis of pHydroxyphenylbutan-2-one in raspberry fruits and tissue culture. Phytochemistry 35 is75 (3), 623-628.

Borejsza-Wysocki and Hrazdina (1996) Aromatic polyketide syntheses: Purification, characterization, and antibody development to benzalacetone synthase from raspberry fruits. Plant Phys. 110, 791-799.

Dudareva N. Murfitt LM, Mann CJ, Gorenstem N. Kolosova N. Kish CM, 580 Bonham C, Wood K (2000) Devclopmental Regulation of Methyl Benzoate Biosynthesis and Emission in Snapdragon Flowers Plant Cell. 12 (6): 949962 Franken,P., Niesbach-Klosgen,U., Weydemann,U., Marechal-Drouard,L., Saedler,H. and Wcnand,U. (1991) The duplicated chalcone synthase genes C2 and Whp (white pollen) of Zea mays are independently regulated; evidence for isss translatonal control of Whp expression by the anthocyann intensifying gene In.

EMBO J. 10 (9), 2605-2612 (1991) Fuganti C and Zucchi G (1998) Product distribution in the microbial biogeneration of raspberry ketone from 4hydroxybenzalacetone. J. Mol. Cata]. B 4, 289-293.

590 Hrazdina G. Kreuzaler F. Hahlbrock K, Gnsebach H (1976) Substrate specificity of flavanone synthase from cell suspension cultures of parsley and structure of release products in vitro. Arch. Biochem. Biophys. 175, 392-399 Hwang EI, Kaneko M, Ohshini Y and Horinouchi S (2003) Production of plant-specific flavanones by Eschericha cold containing an artificial gene cluster.

595 Appl. Environ. Microbiol. 69 (5): 2699-2706.

Jez JM, Bowman ME and Noel JP (2002) Expanding the biosynthetic repertoire of plant type III polyketide syntheses by altering starter molecule specificity.

Proc Natl Acad Sci U S A. 99(8), 5319-24.

Junghans,H., Dalkin,K. and Dxon,R.A. (1993) Stress responses in alfalfa 1600 (Medicago sativa L.). 15. Characterization and expression patterns of members of a subset of the chalcone synthase multigenc family. Plant Mol. Biol. 22 (2), 239-253 Koes,R.E., Spelt,C.E., Reif,H.J., van den Elzen,P.J., Veltkamp,E. and Mol,J.N.

(1986) Floral tissue of Petunia hybrida (V30) expresses only one member of the chalcone synthase multigene family. Nucleic Acids Res. 14 (13), 5229-5239 605 Kumar A and Ellis BE. (2003) A family of polyketide synthase genes expressed in ripening Rubus fruits. Phytochemistry 62(3):513-26.

Lee,D. and Douglas,C.J. (1996) Two divergent members of a tobacco 4coumarate:coenzyme A hgase (4CL) gene family. cDNA structure, gene inheritance and expression, and properties of recombinant proteins. Plant Physiol. 112 (1), 193 205.

Levy, C.C. and Weinstein, G.D. (1964) The metabolism of coumarin by a microorganism. II. The reduction of o-coumaric acid to melilotc acid. Biochemistry 3, 1944-1947 Rablloud T. Carpenter G. Tarroux P. (1988) Improvement and simplification 1615 of low-background silver staining of proteins by using sodium dithionite.

Electrophoress 9, 288-291.

Saleh NAM, Fritsch H. Kreuzaler F. Grisebach H (1978) Flavanone synthase from cell suspension cultures of Haplopappus graclis and comparison with the synthase from parsley. Phytochemistry 17, 183-186.

1620 Sevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996) Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal. Chem. 68, 850 858.

Sparvoli,F., Martin,C., Scienza,A., Gavazzi,G. and Tonelli,C. (1994) Cloning and molecular analysis of structural genes involved in flavonoid and stilbene 1625 biosynthesis in grape (Vitis vinifera L.). Plant Mol. Biol. 24 (5), 743-755 Weisshaar B and Jenkins GI (1998) Phenylpropanoid biosynthesis and its regulation. Curr. O. Plant Biol. 1:251-257.

Zheng,D., Schroder,G., Schroder,J. and Hrazdina,G. (2001) Molecular and biochemical characterization of three aromatic polyketide synthase genes from Rubus 1630 idaeus. Plant Mol. Biol. 46 (1), 1-15.

Each of the applications and patents mentioned in this document, and each document cited or referenced in each of the above applications and patents, including during the prosecution of each of the applications and patents ("application cited documents") and any manufacturer's instructions or catalogues for any products cited 1635 or mentioned in each of the applications and patents and in any of the application cited documents, are hereby incorporated herein by reference. Furthermore, all documents cited in this text, and all documents cited or referenced in documents cited m this text, and any manufacturer's instructions or catalogues for any products cited or mentioned in this text, are hereby incorporated herein by reference.

640 Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments and 645 that many modifications and additions thereto may be made within the scope of the invention. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the claims. Furthermore, various combinations of the features of the following dependent claims can be made with the features of the 650 independent claims without departing from the scope of the present invention.

Claims (1)

1. A host cell comprising a benzalacetone synthase (BAS) polypeptide sequence and a 4-coumarate:CoA ligase (4CL) sequence in which one or both of the BAS polypeptide sequence and the 4CL sequence is heterologous to the host cell.

655 3. A host cell according to Claim 1 or 2, in which the BAS polypeptide sequence is derived from rhubarb or raspberry, preferably from rhubarb.

4. A host cell according to Claim 1, 2 or 3, in which the BAS polypeptide sequence is accession number AF326911 or a sequence having at least 75% sequence homology thereto.

660 5. A host cell according to any preceding claim, in which the 4CL sequence is a tobacco 4CL sequence.

6. A host cell according to any preceding claim, in which the 4CL sequence is a sequence having an accession number U50846 or a sequence shown in SEQ ID NO: 2.

7. A host cell according to any preceding claim, in which the host cell is 665 transformed with an expression vector encoding the benzalacetone synthase (BAS) polypeptide sequence and an expression vector encoding the 4-coumarate:CoA ligase (4CL) sequence, or an expression vector encoding both sequences.

8. A host cell according to any preceding claim, in which the host cell is a microbial host cell selected from the group consisting of Escherichia spp, 1670 Saccharomyces spp, Pichia spp, Beauveria spp, Candida spp, Bacillis spp, Pseudomonas spp, Hansenula spp, Klayveromyces spp, Schizosaccharomyces spp, Streptomyces spp, Lactococcus spp, Lactobacillus spp, Pediococcus spp, Kloeckera SPP, Aureabasidium spp, and Streptococcus spp, preferably an E. colt.

9. A host cell according to any preceding claim, which is capable of producing 675 benzalacetone when supplied with a precursor of benzalacetone, preferably p-coumaric acid or a source of p-coumaric acid.

10. A host cell according to any preceding claim, In which the host cell has benzalacetone reductase (BAR) activity, preferably inherent benzalacetone reductase (BAR) activity.

680 11. A host cell according to any preceding claim, in which the host cell further comprises a benzalacetone reductase (BAR) sequence, preferably a heterologous BAR sequence, preferably shown as SEQ ID NO: 4.

12. A host cell according to any preceding claim, which is capable of producing raspberry ketone when supplied with a precursor of raspberry ketone, preferably 685 benzalacetone or a source of benzalacetone.

13. A host cell according to any preceding claim, which is capable of producing raspberry ketone when supplied with a precursor of raspberry ketone, preferably p- coumaric acid or a source of p-coumaric acid.

14. A host cell according to any preceding claim, which further comprises a 690 cinnamate-4-hydroxylase (C4H) sequence.

15. A host cell according to Claim 14, which is capable of producing benzalacetone or raspberry ketone, or both, when supplied with cinnamic acid or a source of cinnamic acid.

16. A host cell according to any preceding claim, which further comprises a 695 phenylalanine ammonia Iyase (PAL) sequence.

17. A host cell according to Claim 16, which is capable of producing benzalacetone or raspberry ketone, or both, when supplied with phenylalanine or a source of phenylalamne.

18. A method of producing benzalacetone, the method comprising the steps of: (a) 700 providing a host cell according to any of Claims I to 17; and (b) supplying the host cell with p-coumaric acid or a source of p-coumaric acid.

19. A method of producing raspberry ketone, the method comprising the steps of: (a) providing a host cell according to any of Claims 1 to 17; and (b) supplying the host cell with p-coumaric acid or a source of p-coumaric acid.

705 20. A method according to Claim 18 or 19, in which the host cell is a host cell according to any of Claims 14 to 17, and the source of pcoumaric acid is cinnamic acid.

21. A method according to Claim 18, 19 or 20, in which the host cell is a host cell according to Claim 16 or 17, and the source of p-coumaric acid is phenylalanine.

710 22. A method of producing raspberry ketone, the method comprising supplying a bacterium with benzalacetone or a source of benzalacetone.

23. A method according to Claim 22, in which the bacterium Is an E cold or a Bacillus.

24. A bacterial method of producing raspberry ketone.

715 25. A method according to Claim 24, in which the method comprises use of a host cell according to any of Claims 1 to 17.

26. Use of a BAS polypeptide in a bacterial method of production of benzalacetone or raspberry ketone, or both.

27. An expression vector comprising a nucleic acid sequence encoding a 720 benzalacetone synthase (BAS) polypeptide and a nucleic acid sequence encoding a 4- coumarate:CoA ligase (4CL), optionally together with a BAR sequence.

28. An expression vector comprising any one or more of the following: a nucleic acid sequence shown as SEQ ID NO: 5, a nucleic acid sequence shown as SEQ ID NO: 1 and a nucleic acid sequence shown as SEQ ID NO: 3.

725 29. An expression vector wherein the expression vector is pAC-4CLBASrheum.

30. An expression vector according to any of Claims 27 to 29, further comprising a PAL sequence or a C4H sequence, or both.

31. A host cell transformed with an expression vector comprising a sequence set out In any one of Claims 27 to 30.

730 32. A method of producing benzalacetone, the method comprising the steps of (a) providing a host cell according to Claim 31; and (b) supplying the host cell with p- coumaric acid or a source of p-coumaric acid.

33. A method of producing raspberry ketone, the method comprising the steps of (a) providing a host cell according to Claim 32; and (b) supplying the host cell with p 735 coumaric acid or a source of p-coumaric acid.