GB2288807A - Delta-latroinsectotoxin - Google Patents

Abstract

The isolation of a protein and the cloning and expression of the corresponding gene which encodes the neurotoxin delta-latroinsectotoxin (delta-LIT) is disclosed. The protein is isolated from the venom of the Black Widow Spider, Latrodectus mactans Tredecimguttatus. The native gene encodes a precursor protein which is non-toxic. Truncation of the gene at both the N-terminus and C-terminus yields a toxic protein which can be expressed in bacterial cells. It is postulated that delta-LIT may be used as an insecticide. In addition, the gene may be introduced and expressed in both plants and non-human animals.

Description

A Novel Toxin and a Method of Producing a loxin The present invention relates to a novel toxin, and a method of producing a toxin, particularly but not exclusively to an insect specific neurotoxin -Latroinsectotoxin (b -LIT), and a method of producing same.

A family of high molecular weight neurotoxins has been found in the venom of the black widow spider (Latrodectus mactans Tredecimguttatus). Some of these toxins have been identified as being either vertebrate or invertebrate specific. oc-Latrotoxin ( -LT) and oc -Latroinsectotoxins (oc -LIT) are two such neurotoxins that have been characterised as being vertebrate and invertebrate specific respectively. The primary structures of these proteins have been determined, but characterisation of the structural features of the cloned toxins has not been possible due to the inability to achieve functional expression of their genes.

It is an object of the present invention to provide a novel toxin and a method of producing a toxin usually naturally produced by post-translational modification of a precursor protein, using recombinant technology.

According to the present invention there is provided a polypeptide, such as a toxin, formed by expression of a truncated form of a gene sequence, or an analogue thereof.

Preferably the polypeptide is a neurotoxin and preferably corresponds to a toxic derivative of a substantially non-toxic precursor polypeptide encoded by the gene sequence. The polypeptide may comprise an amino acid sequence that corresponds to a truncated form of the amino acid sequence of a substantially non-toxic precursor polypeptide. Preferably the amino acid sequence of the polypeptide corresponds to the amino acid sequence of the precursor polypeptide with truncation thereof principally at the carboxy (C) end, and desirably by about 150 to 200 amino acids. The polypeptide amino acid sequence may in addition correspond to the precursor polypeptide amino acid sequence truncated at the amino end (N) preferably by less than 50 amino acids, and desirably by 7 or 28 amino acids.

The amino acid sequence of the polypeptide may be homologous to the amino acid sequence of the insect specific neurotoxin ;-Latroinsectotoxin (;-LIT) or an active derivative thereof, and preferably comprises an amino acid sequence as shown in SEQIDN01 and SEQIDN02 or an active derivative thereof. Preferably the toxin is expressed from a nucleotide construct or truncated form of the gene sequence comprising a sequence as shown in SEPIDNO1, or active variants thereof. Preferably the toxin is expressed from a sequence substantially as provided in a microorganism deposited at The National Collections of Industrial and Marine Bacteria Limited, under Accession No. NCIMB 40632.

The invention also provides a protein for use as a toxin comprising an amino acid sequence substantially as shown in SEPIDNO1 and SEQIDN02, or an active derivative thereof.

According to a further aspect of the present invention there is provided a nucleotide sequence comprising a truncated form of a gene sequence or an analogue thereof, for use in the expression of a polypeptide, such as a toxin.

Preferably the nucleotide sequence corresponds to a gene encoding for a precursor polypeptide and truncated at the 3' end thereof or an active derivative thereof.

Preferably the nucleotide sequence corresponds to the gene truncated by about 400 to 650 nucleotide bases, and desirably between 550 to 600 nucleotide bases.

The nucleotide sequence may also correspond to the gene truncated at the 5' thereof, preferably by less than 100 nucleotide bases, and desirably by either 84 or 21 nucleotide bases.

Preferably the nucleotide sequence corresponds to part of a gene encoding for a neurotoxin in the venom of the Black Widow Spider (Latrodectus mactans Tredecimguttatus) , or an active derivative thereof.

The nucleotide sequence may correspond to part of the gene encoding the precursor polypeptide of insect specific toxin ;-Lactoinsectotoxin ( ;-LIT), or an active derivative thereof. The nucleotide sequence preferably codes for a polypeptide comprising a sequence of 991 amino acids.

Preferably the nucleotide sequence comprises a base sequence as shown in SEQIDNO1, or an active derivative thereof, and preferably as comprised in a microorganism deposited under Accession No. NCIMB 40632 at The National Collections of Industrial and Marine Bacteria Limited.

Preferably the nucleotide sequence codes for a polypeptide having an amino acid sequence as shown in SEQIDNO1 and SEQIDN02, or an active derivative thereof.

The nucleotide sequence may be a cDNA derived from mRNA by the use of an enzyme such as reverse transcriptase. The nucleotide sequence may alternatively be an oligonucleotide DNA construct produced perhaps using the polymerase chain reaction (PCR).

According to a further aspect of the present invention there is provided a method of producing a polypeptide, the method comprising producing a recombinant DNA molecule comprising a truncated form of a gene, and expressing the truncated form in a host expression system, such as a viral or bacterial expression system, to produce the polypeptide.

Preferably the polypeptide produced is an active toxin and desirably a neurotoxin substantially as defined above. Preferably the truncated form comprises part of a gene which encodes for a non-toxic precursor polypeptide.

Preferably the truncated form comprises a nucleotide sequence substantially as defined above, and as shown in SEQIDN01, or an active derivative thereof.

Preferably the expression system comprises E.coli BL21 (DE3) bacterial cells transformed with pT7-7 vectors comprising the truncated form of the sequence, desirably substantially as deposited under Accession No. NCIMB 40632 at The National Collections of Industrial and Marine Bacteria Limited. The expression system may comprise a baculovirus system.

In a further aspect of the present invention there is provided a recombinant DNA molecule, such as a virus, and in particular a baculovirus comprising a truncated form of a gene encoding for a toxin generally as defined above, and substantially as provided in the microorganism deposited under Accession No. NCIMB 40632.

A still further aspect of the present invention provides an expression vector comprising a truncated form of a gene, the truncated form encoding for a toxin generally as defined above.

The invention also provides a cell, such as a viral or bacterial cell transformed with a recombinant molecule as defined above.

There is also provided an insecticide comprising a toxin as defined above. The insecticide may be so as to be administered orally or topically. The insecticide may comprise a spray.

This invention also provides an insecticide system comprising means for expressing a truncated form of a gene to produce a toxin as described above in an insect to kill or incapacitate the insect. The insecticide system may comprise a viral expression system, and desirably a baculovirus expression system.

According to a further aspect there is provided a plant comprising a genetically modified cell containing a truncated form of a gene sequence substantially as defined above.

Still further according to the present invention there is provided a non-human animal comprising a genetically modified cell containing a truncated form of a gene sequence substantially as defined above.

According to a further aspect of the present invention there is provided a toxin formed by processing of a substantially isolated non-toxic precursor polypeptide.

The toxin is preferably a neurotoxin and is preferably formed by truncation toward the carboxy (C) end of the precursor polypeptide, preferably by site-directed mutagenesis. Desirably the toxin amino acid sequence generally corresponds to the amino acid sequence of the precursor polypeptide, truncated by between 150 and 200 amino acids. The toxin amino acid sequence may also be formed by truncation toward the amino (N) end of the precursor polypeptide amino acid sequence, the fragment cleaved therefrom preferably being significantly smaller than the fragment cleaved from the carboxy end, and may comprise 7 or 28 amino acids.

Preferably the toxin has an amino acid sequence corresponding to polypeptide encoded by part of a gene of the Black Widow Spider (Latrodectus mactans Tredecimguttatus). The toxin may comprise or be an analogue of the insect specific neurotoxin -Latroinsectotoxin (; -LIT), or an active derivative thereof.

Preferably the toxin comprises an amino acid sequence as shown in SEQIDNO1 and SEQIDN02 or an active derivative thereof.

In a further aspect of the present invention there is provided a method of producing an active polypeptide from an inactive precursor polypeptide, the method comprising truncating the isolated precursor polypeptide.

Preferably the isolated precursor polypeptide is truncated at the Carboxyl end, perhaps using proteolytic cleavage, and preferably by site directed mutagenesis.

Truncation of the N terminus may also be provided.

Preferably the active polypeptide is a toxin and is substantially as described above.

According to another aspect of the present invention there is provided an isolated nucleotide base sequence encoding for a toxin precursor polypeptide as defined above and preferably with an amino acid sequence as shown in SEQIDN04 or an active derivative thereof. The base sequence preferably comprises the sequence shown in SEQIDN03 or a derivative thereof. The nucleotide base sequence preferably encodes a precursor polypeptide of the neurotoxin ;-Latroinsectotoxin (s-LIT). Preferably the base sequence is substantially as provided in the microorganism deposited under Accession No. NCIMB 40633.

In a further aspect there is provided a recombinant DNA molecule such as a virus, and more particularly a baculovirus comprising a sequence as defined in the preceding paragraph.

In a still further aspect the invention provides a cell, such as a bacterial cell or viral cell, transformed with a recombinant DNA molecule as described in the preceding paragraph.

This invention also provides an insecticide system comprising means for expressing a gene as described above to produce a precursor polypeptide as described above and to process the precursor polypeptide to produce a toxin in an insect to kill or incapacitate the insect. The insecticide system may comprise a viral expression system, and desirably a baculovirus expression system.

According to a further aspect there is provided a plant comprising a genetically modified cell containing a gene as defined above.

Still further according to the present invention there is provided a non-human animal comprising a genetically modified cell containing a gene as defined above.

Preferred embodiments of the present invention will now be described by way of example only, with reference to the accompanying sequences, in which: SEQ ID NO. 1 shows the nucleotide base sequence and the corresponding amino acid sequence of a truncated form of a gene and a polypeptide encoded thereby, according to one aspect of the present invention; SEQ ID NO. 2 shows the polypeptide sequence of SEQIDNO1; SEQ ID NO. 3 shows the nucleotide base sequence and the corresponding amino acid sequence of a gene and a polypeptide encoded thereby, according to another aspect of the present invention; and SEQ ID NO. 4 shows the polypeptide sequence of SEQIDN03.

Referring to the sequences, a polypeptide such as a toxin as in SEQIDN02 is formed by expression of a truncated form of a gene sequence (SEQIDN01), or an analogue thereof.

A toxin from Black Widow Spider (Latrodectus mactans Tredecimguttatus) venom (BWSV), r-Latroinsectotoxin, (-LIT) has been purified and shown to possess insect specific toxicity. The s-LIT structural gene has been cloned and sequenced and the Nand C terminii of the native (precursor) and functional protein toxin have been determined as described below.

Site directed mutagenesis of ;-LIT cDNA enabled expression of the mature protein product (toxin) in bacteria, and this has been shown to be toxic to locusts.

Expression and production of this and other such toxins in bacterial expression systems has hitherto not been possible. The invention includes identification of the sites for cleavage of the precursor protein to produce the toxin, and the precise site of truncation of the gene sequence which has enabled the toxin to be expressed in bacterial, and indeed other suitable hosts.

Microorganism deposits have been made under the Budapest Treaty on 3rd May 1994, at the National Collections of Industrial and Marine Bacteria Limited, of 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom.

Escherichia coli (XL-1 Blue pT7.M) cloned with the truncated form of the gene sequence is deposited under Accession No. 40632, and Escherichia coli (HMS 174 pT7.FL) cloned with substantially the full gene sequence is deposited under Accession No. 40633).

In more detail, the cDNA cloning and sequencing was conducted as follows. Poly(A+)-RNA was isolated from venom glands of the Black Widow Spider (Latrodectus mactans Tredecimguttatus) and a cDNA library constructed in the plasmid vector pSP65 (according to Kiyatkin et al, 1993). A library of 6x104 clones was screened with an end-labelled 23-mer oligonucleotide probe based on the N-terminal sequence of oP-LIT (amino acid residues 1-8)5' GA(C/T)GA(A/G)GA(A/G)GA(C/T)GG(A/T)CAAAT 3' Hybridization was performed. Positive clones were colony-purified and analysed by restriction mapping. The inserts were excised and fragmented by sonication as described (Sambrook et al, 1989) followed by cloning into the SmaI site of pBluescript II SK+ and SK- vectors (Stratagene, USA). Single-stranded templates for sequencing were obtained after infection with helper phage VCS (Stratagene). The DNA sequences were determined by the chain-termination method (Sanger et al, 1977) using Sequenase 2.0 version kit (USB Corporation) and T7 and T3 vector-specific primers (Stratagene). Each sequence was determined at least twice on both strands.

Synthetic primers were used to sequence regions that were not covered by isolated subcloned fragments.

DNA and protein sequence analysis was performed using the computer software DNASTAR (Dnastar Inc) and PCGENE (IntelliGenetics Inc). This work benefitted from the CCC programme mounted on the SERC Daresbury SEQNET facility (Devereux, Haeberli and Smithies, (1984), Nucleic Acids Research 12(1); 387-395).

The full-length cDNA construction was carried out as follows. Two sets of oligonucleotide primers were used to produce N- and C- overlapping parts of ;-LIT coding sequences by polymerase chain reaction. To facilitate subcloning into the expression vector the 5' sense primer (P1) (TTGGGATCCGATGAAGAAGATGGAGAA) and 3' antisense primer (P8) (CAATGGTCGACACAGAAGGAATGGTA) contained BamHI and SalI restriction enzyme sites. Two other primers -P9, sense (GTCTGAACCATTTACTGTCC) (position 1283-1302) and P3, antisense (GTAAGATTACCATCTGCAAC) (complementary to position 2253-2272) were chosen to produce overlapping fragments with an internal NcoI (2056) restriction site. An oligonucleotide was designed to terminate the protein sequence after amino acid 9915' CGTTTCGTCGACTCATTCCGGTAAAGTACGACGAAA 3' . The polymerase chain reaction was performed using 1 unit of Taq-polymerase (Promega) under standard conditions (30 cycles, 550C for 1 min, 720C for 3 min, 940C for 1 min, with 100 pmol of each primer and 1-10 ng first-strand cDNA). In the first cycle the denaturation time was elongated to 5 min. The molecular mass of the amplified material was checked on an agarose gel. First-strand cDNA synthesis was carried out using First-strand cDNA Synthesis Kit (Pharmacia) with both random and specific primers as recommended by the manufacturer. The PCR products were purified from agarose gel using GeneClean Kit (Bio 101 Inc.), digested with appropriate pairs of enzymes (BamHI and NdeI for the N-terminus part and SalI/NdeI for the C-terminus) and cloned into the pT7-7 vector restricted with the similar pairs of enzymes. The full-length cDNA was created as a result of three-way ligation between N-terminal BamHI/NdeI-fragment, C-terminal NdeI/SalI-fragment and pT7-7 BamHI/SalIdigested vector. The final construct had eight additional amino acid residues at the amino terminal end (MARIRARG). All plasmid constructs were verified by sequencing from both ends and through the junction region. The full length construct was designated pT7 i.FL a sample of which is deposited at the NCIMB, accession No 40633 and the truncated clone (1-991 amino acids) was designated pT7.M. (NCIMB No 40632).

In order to verify the identity of the s-LIT cDNA, this clone was expressed in the bacterial pT7-7 vector in E.coli BL21(DE3) cells. A full-length toxin cDNA (corresponding to Asp residue 29 to 1186) 1214 of SEQIONO4 was constructed and designated pT7.;FL. The first 28 amino acids are believed to be present in the precursor polypeptide in spider venom glands, but cleaved during N-terminal processing. The recombinant protein constitutes approximately 10, of the total bacterial lysate protein. A polyclonal antibody specific was raised to ;-LIT purified from spider venom glands, and demonstrated to be specific for the ;toxin. This protein specifically detected a protein of 130 kDa in bacteria expressing recombinant full-length c7-LIT.

Comparison of the molecular mass of the bacterially expressed full-length # -LIT and the toxin purified from venom glands demonstrated a size difference of approximately 23kDa, in agreement with the calculated molecular mass. The full-length #-LIT had no toxicity towards insects and is considered to be an inactive precursor form of the toxin.

-LIT purified from venom glands was analysed by mass spectrometry (on a Kratos Kompact MALDI 3 Mass Spectrometer, using sinapinic acid as a matrix. The nitrogen laser excitation was at 337nm, and the positive ion was detected in the linear mode) yielding a prominent molecular ion with a m/z+ ratio of 110916. This corresponds closely to the expected molecular mass of -LIT which is truncated at amino acid 991. By comparison, the bacterially expressed full length #-LIT yielded a molecular ion with an m/z+ ratio of 133631 (VK, DRB, PNRU, Data not shown), within 100 Da of the calculated value. Site directed mutagenesis was used to create a novel -LIT cDNA clone (pT7 < iM), which was truncated after amino acid 991 of the 5 -LIT sequence (SEQIDN02). This protein was expressed in bacteria, yielding a protein of similar molecular mass to the mature toxin isolated from spider venom.

E. coli BL21(DE3) cells transformed with pT7 clones were grown in LB medium containing 100mg ampicillin/ml at 300C to an A 600nm of approximately 0.5. Then expression was induced by addition of IPTG (1mM) to the medium, and incubation continued for 1 hour. For functional studies, bacteria were washed and resuspended in 50 mM TrisHC1, 100mM NaCl, 1OmM KCI, 0.4 Triton X-100, 12% (W/V) sucrose, 5mM DTT, 2 Ag/ml aprotonin, 2mM EDTA, pH8, and sonicated on ice. Ammonium sulphate was added to the cleared supernatant to a final concentration of 20 of saturation, and the pellet was resuspended in buffer without DTT. These samples (5-151) were used for thoracic injection into locusts (100-300 mg body weight); each test was performed on more than 4 locusts, and the locusts were examined for toxicity for 24 hours.

Extracts from pT7-7 and pT7.FL produced no effects on the locusts, but extracts from bacteria carrying pT7.M caused rapid lethality. The time of death of the locusts varied from 5 minutes - 4 hours, depending on the potency of the batch of toxin.

Preliminary studies were undertaken on neurally-excited and resting retractor unguis nerve-muscle preparations isolated from metathoracic legs of adult (male and female) locusts (Usherwood and Machili, 1968). s-LIT was applied in standard locust saline (mM: NaCl, 180; KCl, 10; CaCl2, 2; Hepes, 10 (pH 6.8)). A few studies were undertaken using saline in which CaCl2 was omitted. Mechanical responses were recorded using a Grass strain guage connected to a Grass pen recorder. Recordings of miniature excitatory postsynaptic potentials were made from fibres of metathoracic extensor tibiae muscles of adult locusts (either sex) using intracellular microelectrodes (approximately lOmflresistance). -LIT was applied in either standard locust saline, saline in which CaCl2 was omitted or saline which contained MgCl2 substituted for NaCl. The miniature potentials were recorded on video tape and analysed on a MassComp computer using in-house software. Membrane bilayers were formed at the tips of patch pipettes (diam 1-2,am; fabricated from Clark Electromedical glass) from monolayers of either diphytanoyl phosphatidylcholine or a mixture of 9 parts isolectin and 1 part cholesterol using a pipette dipping technique (Montal and Muller, 198). Similar patch pipettes were used to excise membrane patches from locust metathoracic extensor tibiae muscle fibres (Huddie et al). In order to reduce the activities of endogenous potassium channels KCl was eliminated from the pipette and bath salines.

The neurally-evoked twitch contraction of the locust retractor unguis muscle was reduced by approximately 40aa by 10 M -LIT (applied in standard saline) and was abolished during application of 10 10M toxin. Small spontaneous contractions sometimes occurred during ; -LIT application. The changes in twitch amplitude were accompanied by an irreversible muscle contracture. The appearance of the contracture was delayed and its amplitude was reduced when the concentration of J -LIT was lowered. A muscle contracture also occured when toxin was applied when the muscle was not neurally stimulated. Twitch contractions do not occur in clacium-free saline and when 10-10M toxin was applied to a preparation equilibrated in this saline a contracture did not occur even after 30 min application of the toxin.

When inside-out patches excised from locust muscle fibres were exposed to 10-11M &alpha; -LIT in the patch pipette, channel opening, of maximum conductance approximately 40pS, were observed. Channel openings of this type were never seen in the absence of toxin.

The channel current exhibited inward rectification when the patch pipette and bath contained identical salines (including 2mM CaCl2), and channel open times were longer at negative than at positive pipette potentials. When there was a 1-fold Ca2+ gradient across a patch, the reversal potential of the channel current was +/- 15mV, the sign being dependent on the Ca2+ gradient.

In the artificial bilayer studies where 10 M ; -LIT was placed in the patch pipettes, single channel openings of approximately 30pS conductance were observed. These channels were not seen when toxin was omitted from the patch pipette. With identical salines (containing 2mM CaCl2) in the patch pipette and bath, the current-voltage characteristic of the -LITx channel was sigmoidal with a reversal potential at OmV. The channel was shown to be Ca-selective by manipulating the ionic regimes of patch pipette and bath.

A cDNA library from venom gland cDNA was screened with a 23-bp oligonucleotide probe corresponding to the N-terminal sequence of Or -LIT (as described above). To reduce the number of nucleotide ambiguities the codon usage data available from the nucleotide sequences of 4-LT and DC -LIT cDNA (Kiyatkin et al, 1990, Kiyatkin et al 1993) was referred to. Five positive cDNA clones were colony-purified and sequenced. The longest clone (pDT-1) contained more than 2 (kb) of #-LIT coding region. A PstI-3' fragment was used to rescreen the cDNA library to search for clones encoding the C-terminal part of the toxin. An additional cDNA clone, pDT-17, was isolated, which covered the C-terminal coding region of the S -LIT.

Two overlapping clones, covering the entire open reading frame, have been sequenced in their entirety. The two clones have been demonstrated to be part of a single, continuous RNA from venom glands by polymerase chain reaction across the overlapping region, using two distinct sets of primers. The composite clones encode a cDNA with a frame of 3642 bp starting from the first in-frame Methionine and ending with TAA stop codon (SEQIDN03).

The Met residue is preceded by an in-frame stop codon confirming the full length of the deduced sequence.

-LIT was purified to homogeneity from Black Widow Spider venom by three rounds of column chromatography according to (Krasnoperov et al, 1992). 23 amino acid residues of the N-terminal sequence of ; -LIT was sequenced. The pure toxin was digested with trypsin and seven individual peptides were isolated and partially sequenced.

Direct N-terminal sequence determination demonstrates that the mature protein starts from the sequence DEEDGEM..., so residue 1 in SEQIDN01 and 2 is the first Asp of this sequence. The deduced polypeptide starting from Asp (+1) consists of 1186 amino acid (as shown in SEQIDN03+4, Asp residue 29 to residue 1214) residues with a predicted molecular mass of 132671 Daltons and pI of 5.4. It contains all of the peptide sequences determined by amino acid sequencing analysis.

There are two in-frame Met residues (-7 and -28) upstream of the N-terminus (as shown in SEQIDNO3) of the mature protein which can serve as translation initiation sites.

The nucleotide sequence surrounding the ATG codon for Met (-7) correlates better with the classical Kozak consensus (Kozak, 1989), but the nucleotide arrangement for Met (-28) strongly corresponds to starting points for at least two other known proteins which have been isolated from arachnids: Major house dust mite allergen (AAAATGA) (Yuuki et al, 1991) and Low molecular weight protein co-purified with oC-Latrotoxin (AAATGA) (Kiyatkin et al, 1992). In both cases, the deduced sequence preceding the N-terminus of the mature protein does not correspond to classical signal peptide structures. We conclude that post-translational modification of ;-LIT N-terminus is limited to removal of 7 or 28 amino acid residues. The existence of a cluster of positive amino acid residues Arg-X-Lys-Arg (-1-4) which can serve as a potential endopeptidase-cleavage site supports the hypothesis that post-translational processing occurs at the N-terminus.

Analysis of the deduced structure of J'-LIT with PEST (Rogers, S. et al, 1986) reveals the presence of an amino acid sequence enriched in P, E, S and T, which has previously been correlated with rapid degradation of intracellular proteins (Gottesman & Maurizi, 1992). This region has the sequence EESGAPEGSFDSPSS, and is situated between residues 956-970. The presence of the PEST-region in the C-terminal part of ;-LIT is consistent with C-terminal processing of this protein.

Computer analysis of g -LIT predicts three putative transmembrane helixes two of them situating in terminal regions (residues 39-67 and 221-240) and the third one of a minimal length (residues 580-595) being in the central region. The second putative transmembrane helix (residues 221-240) belongs to a very conservative region between all spider high molecular weight protein neurotoxins (Kiyatkin et al, 1993).

Dot-matrix analysis of the p al, 1990). The sequence of 13 amino acids which precede the first repeat can be viewed as a reduced repeated unit according to its good correlation with a consensus sequence. The majority of ; -LIT repeated units are 33-34 amino acids in length. but two repeats contain 35 (R1) and 36(R6) residues, respectively.

Analysis with the PCOMPARE programme showed the linear correlation between the repeated units of two insect-specific toxins. Strong linear correspondence has been found for s-LIT repeats R2-R9 in comparison to the analogous repeats in -LIT (Kiyatkin et al, 1993). The first repeat in 6-LIT does not correspond well to the first one in -LIT and shows high similarity to R7 from > -LIT. s-LIT repeat R10 is most similar to R19 from -LIT: this repeat is unusual in having Ser and Gly residues at position 8 and 31, respectively. The next stretch of similarity is found between R11-R13 of 6-LIT and R10-R12 of oc-LIT. We have noted that the R7, R2 and R9 repeats are the most highly conserved between the insectotoxins, suggesting a functional role in insectotoxicity. It has been shown that Erythrocyte Ankyrin repeats are not equivalent in respect of their functional ability to bind different proteins (Davis et al, 1991), and thus toxin repeats are also expected to make different contributions to their function.

Dot-matrix comparison of - and oc-LIT shows that they share a similar overall organization, with the strong central diagonal broken once (between 900 and 1130 amino acid residues of z b-LIT) and restored for the last 160 amino acids of both toxins. The displacement of the central diagonal reflects the difference in toxin length; -LIT is 190 amino acids shorter than its insect-specific counterpart.

The mature protein can be divided into several structural domains: an N-terminus consisting of about 470 amino acid residues and possessing strong linear homology with o(-LIT; the central domain of about 430 amino acids almost completely comprised of tandemly arranged ankyrin-like repeated units and a C-terminal domain of about 160 amino acids.

Alignment of the insectotoxin protein sequences shows that both the N- and C-terminal structural domains demonstrate the presence of high identity regions separated by rather dissimilar sequences, with a high level of identity (44.9 Ó for the N-terminal domain and 37.1at for the C-terminus). The most dramatic changes in primary structure of the two insectotoxins are concentrated in C-terminal parts of the repeat containing domains. A stretch of homology is localized to 13 ankyrin repeat units of -LIT. This region is followed by a sequence of about 110 amino acid residues that has no obvious homology either withes -LIT or &alpha; LT nor with any other proteins from NBRF-PIR database.

Interestingly, this domain, which is absent from J -LIT, forms a specific region in the primary structure of C < -LIT that has an unusual clustering of Cys-residues and possesses homology with mammalian-specific o < LT (Kiyatkin et al, 1993). So striking structural difference between the two insect-specific neurotoxins suggests that the C-terminal part of the ankyrin-like repeated domain plays a particular role in providing a structural basis for their different functional properties.

The high molecular weight protein toxins from the venom of the Black Widow Spider are a potent and specific class of toxins. These toxins offer a great potential for elucidating the function of neural proteins, and for providing insect specific toxins. However this potential has not previously been realised due to the inability to express these protein toxins with any function. The present invention provides for the cloning of a novel DNA transcript encoding for a novel insect-specific toxin, and functional expression of this toxin, and other polypeptides in bacteria.

The ; -LIT cDNA was cloned with an oligonucleotide based on the sequence of amino acids 1-23 of the toxin, and its identity confirmed by additional peptide sequences, and immunochemical identity, using an antibody specific for the # -LIT. The deduced primary structure of # -LIT has considerable similarity to the mammalian specific #LT and the insect-specific #-LIT, suggesting that these toxins are part of a family with similar structure. The three proteins have a central domain which is composed of "ankyrin-like" repeats, with 13 repeats in #-LIT. The ankyrin family of proteins couple spectrin to a variety of integral membrane proteins (Bennett, 1992), and it is believed that the "ankyrin repeat" domain of the ankyrins is responsible for specific binding to proteins (Davis and Bennett, 1990 J Biol Chem 265: 10589-10596; Davis et al (1991) J. Biol Chem 266: 11163-11169). This structural similarity with the ankyrin family is reflected in the known functional properties of the latrotoxins; o < LT is known to bind to a receptor with high affinity (Kd 10 9M). It remains to be determined whether this specific binding to there LT receptor is mediated via the ankyrin repeat region of the toxin.

Surprisingly, #-LIT has no greater similarity to the insect-specific &alpha;-LIT (38%) than to the mammalianspecific cCLT (37%). WhereasJ-LIT has only 13 repeats, theoCLT and &alpha;-LIT have 19 and 20 ankyrin repeats, respectively. The latter 6/7 repeats have no counterpart in the J-LIT, and may be a structural unit, as they toxins both contain 6 cysteine residues in this region, with partially conserved spacing. However, in view of the differences in target toxicity of the 0 < LT and oC-LIT, it is not possible to identify this structural features with insect-specific toxicity. cS -LIT exhibits a marked disparity between the molecular weight of the toxin, as deduced from the cDNA sequence, and the relative mobility of the pure toxin purified from venom. Whilst the N-terminus of the protein has been identified unambiguously by protein sequencing, the precise position of the C-terminus has been difficult to document. Expression of the full length ci-LIT cDNA in bacteria demonstrated that the calculated molecular mass is accurately reflected in the relative mobility of the protein on SDS-PAGE, and that the natural venom derives predominantly, if not wholly from proteolytic, C-terminal processing. The full-length recombinant protein was purified, but was not toxic to locusts under any conditions. The full-length protein is an inactive precursor of the functional toxin.

The precise site of the C-terminus of ci-LIT purified from venom was assessed by MALDI-mass spectrometry, which localised the site of cleavage to amino acid 991 of the protein. The cDNA was mutated to produce a protein of 991 amino acids with a sequence as shown in SEQIDN02, and expressed in bacteria. The mature recombinant protein was soluble and was lethal to locusts. Partial purification of the protein suggests that the toxin is highly toxic.

Expression of the mature toxin from using the truncated form of the full gene sequence as described above has considerable advantages. Firstly, the toxin can be produced relatively easily by functional expression of the truncat-ed form in a bacterial system, thereby obviating the need to purify toxin from venom glands of spiders. This enables industrial production of the toxin and hence commercial exploitation, for example as the major component of an insecticide system.

Moreover, it presents possible administration systems for the toxin as an insecticide, beside conventional methods such as spraying. For example it may be possible to produce a modified plant cell or plant, such as a crop plant, containing a recombinant molecule incorporating the truncated sequence. Such a system comprises a recombinant baculovirus comprising the truncated form. Such viruses are highly infectious in vivo and resistant to inactivation in host cells, and are capable of high levels of expression of the inserted nucleotide sequence in host insect cells. This is expected to be harmless to the plant and indeed to vertebrates. Upon ingestion of the plant tissue an insect will take in the recombinant molecule and/or toxin, resulting ultimately in the death of the insect.

Since the toxin is insect specific, it is expected to have no detrimental effect to humans or animals upon consumption.

This is an example of one use of one embodiment of the invention to express a toxin that is usually produced by post-translational modification of a precursor protein in biological systems, in a bacterial expression system.

It is to be appreciated that the truncated form of other genes coding for other proteins could be expressed in this way, and fall within the scope of the present invention.

The invention also provides toxin formed from the expression of a full, isolated gene to produce a precursor polypeptide which is then post-translationally modified. The precursor polypeptide has an amino acid sequence as shown in SEQIDN04, and the toxin has a sequence as shown in SEQIDN02.

The isolated gene (SEQIDN03) (or an analogue) encoding for the precursor polypeptide of the toxin ; LIT can be cloned into a vector for expression of the precursor polypeptide. A baculovirus expression system can be used. The precursor polypeptide thus produced can then be truncated at the sites indicated above, by site directed mutagenesis, to produce an active toxin. This enables the toxin JLIT or an active derivative thereof, to be produced independently of the Black Widow Spider, and thus on an industrial scale, for use as indicated as an insecticide.

Whilst endeavouring in the foregoing specification to draw attention to those features of the invention believed to be of particular importance it should be understood that the Applicant claims protection in respect of any patentable feature or combination of features hereinbefore referred to and/or shown in the drawings whether or not particular emphasis has been placed thereon.

SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: BRITISH TECHNOLOGY GROUP LIMITED (B) STREET: 101 NEWINGTON CAUSEWAY (C) CITY: LONDON (E) COUNTRY: UNITED KINGDOM (F) POSTAL CODE (ZIP): SE1 6BU (ii) TITLE OF INVENTION: A NOVEL TOXIN AND A METHOD OF PRODUCING A TOXIN (iii) NUMBER OF SEQUENCES: 4 (iv) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (O) SOFTWARE: PatentIn Release 1.0, Version 1.30 (EPO) (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2976 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "PLASMID DNA" (vi) ORIGINAL SOURCE: (A) ORGANISM: LATRODECTUS MACTANS TREDECIMGUTTATUS Cvii) IMMEDIATE SOURCE: (B) CLONE: pT7.deltaM (ix) FEATURE: (A) NAME/KEY: COS (B) LOCATION:1..2976 Cxi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GAT GAA GAA GAT GGA GAA ATG ACT CTA GAA GAA AGA CAA GCA CAA TGC 48 Asp Glu Glu Asp Gly G1u Met Thr Leu Glu Glu Arg Gin Ala Gln Cys 1 5 10 15 AAA GCA ATA GAG TAC AGC AAT TCA GTT TTT GGG ATG ATC GCT GAT GTA Lys Ala Ile Glu Tyr Ser Asn Ser Val Phe Gly Met lie Ala Asp Val 20 25 30 GCT AAC GAC ATC GGT TCC ATT CCT GTA ATT GGC GAA GTA GTT GGC ATT 144 Ala Asn Asp lie Gly Ser lie Pro Val Ile Gly Glu Val Val Gly Ile 35 40 45 GTA ACT GCC CCA ATT GCC ATC GTA AGT CAC ATT ACT AGC GCA GGC TTG 192 Val Thr Ala Pro lie Ala lie Val Ser His lie Thr Ser Ala Gly Leu 50 55 60 GAT ATA GCT TCT ACG GCA TTA GAT TGT GAT GAT ATA CCT TTT GAT GAG 240 Asp lie Ala Ser Thr Ala Leu Asp Cys Asp Asp Ile Pro Phe Asp Glu 65 70 75 80 ATT AAG GAA ATA TTA GAA GAA AGA TTC AAT GAA ATA GAT AGA AAG TTG 288 lie Lys G7u lie Leu G7u G7u Arg Phe Asn G7u lie Asp Arg Lys Leu 85 90 95 GAC AAG AAC ACA GCT GCT TTG GAA GAG GTC TCT AAA CTG GTA AGT AAA 336 Asp Lys Asn Thr Ala Ala Leu G7u G7u Val Ser Lys Leu Val Ser Lys 100 105 110 ACT TTT GTT ACG GTG GAA AAA ACA AGG AAT GAA ATG AAC GAA AAT TTT 384 Thr Phe Val Thr Val G7u Lys Thr Arg Asn G7u Met Asn Glu Asn Phe 115 120 125 AAG CTT GTT TTG GAA ACT ATA GAA AGC AAA GAA ATA AAA TCA ATT GTA 432 Lys Leu Val Leu Glu Thr lie Glu Ser Lys Glu lie Lys Ser lie Val 130 135 140 TTC AAA ATA AAT GAT TTT AAA AAG TTT TTT GAA AAA GAA CGA CAA AGA 480 Phe Lys Ile Asn Asp Phe Lys Lys Phe Phe Glu Lys Glu Arg Gin Arg 145 150 155 160 ATT AAA GGT TTG CCT AAA GAT AGG TAT GTT GCT AAG CTT CTA GAA CAA 528 Ile Lys Gly Leu Pro Lys Asp Arg Tyr Val Ala Lys Leu Leu Glu Gin 165 170 175 AAA GGT ATT TTA GGT TCT TTA AAA GAA GTA AGA GAA CCA TCT GGA AAC 576 Lys Gly Ile Leu Gly Ser Leu Lys Glu Val Arg Glu Pro Ser Gly Asn 180 185 190 AGT CTG AGC TCC GCG TTA AAT GAA CTC TTA GAC AAA AAC AAC AAC TAT 624 Ser Leu Ser Ser Ala Leu Asn Glu Leu Leu Asp Lys Asn Asn Asn Tyr 195 200 205 GCC ATC CCA AAA GTG GTT GAT GAT AAT AAG GCC TTT CAG GCG CTG TAT 672 Ala Ile Pro Lys Val Val Asp Asp Asn Lys Ala Phe Gln Ala Leu Tyr 210 215 220 GCT TTA TTT TAT GGA ACT CAG ACT TAT GCA GCC GTT ATG TTT TTC TTA 720 Ala Leu Phe Tyr Gly Thr Gln Thr Tyr Ala Ala Val Met Phe Phe Leu 225 230 235 240 CTC GAA CAA CAT TCT TAT CTG GCT GAT TAT TAT TAC CAA AAA GGT GAT 768 Leu Glu Gln His Ser Tyr Leu Ala Asp Tyr Tyr Tyr Gln Lys Gly Asp 245 250 255 GAT GTA AAT TTT AAT GCA GAA TTT AAT AAT GTA GCA ATT ATT TTT GAT 816 Asp Val Asn Phe Asn Ala Glu Phe Asn Asn Val Ala lie Ile Phe Asp 260 265 270 GAC TTT AAA TCA TCA CTA ACA GGA GGA GAT GAC GGA TTA ATA GAT AAT 864 Asp Phe Lys Ser Ser Leu Thr Gly Gly Asp Asp Gly Leu lie Asp Asn 275 280 285 GTC ATT GAG GTT CTT AAC ACC GTG AAA GCA TTA CCA TTT ATA AAG AAC 912 Val lie Glu Val Leu Asn Thr Val Lys Ala Leu Pro Phe Ile Lys Asn 290 295 300 GCC GAC AGT AAA CTA TAC AGA GAA TTA GTA ACT AGA ACA AAA GCT TTA 960 Ala Asp Ser Lys Leu Tyr Arg Glu Leu Val Thr Arg Thr Lys Ala Leu 305 310 315 320 GAG ACT CTT AAA AAT CAA ATC AAA ACG ACT GAT TTG CCT CTT ATA GAT 1008 Glu Thr Leu Lys Asn Gin lie Lys Thr Thr Asp Leu Pro Leu lie Asp 325 330 335 GAT ATA CCC GAA ACT TTG TCT CAA GTG AAC TTT CCG AAT GAC GAA AAT 1056 Asp lie Pro G7u Thr Leu Ser G7n Val Asn Phe Pro Asn Asp G7u Asn 340 345 350 vAA TTG CCT ACA CCA ATA GGA AAT TGG GTT GAT GGC GTA GAA GTT AGG 1104 Gin Leu Pro Thr Pro lie Gly Asn Trp Val Asp Gly Val G7u Val Arg 355 360 365 TAC GCA GTA CAG TAT GAA AGT AAG GGC ATG TAT TCG AAA TTC AGT GAA 1152 Tyr Ala Val G7n Tyr G7u Ser Lys Gly Met Tyr Ser Lys Phe Ser G7u 370 375 380 TGG TCT GAA CCA TTT ACT GTC CAA GGT AAC GCT TGT CCG ACT ATA AAA 1200 Trp Ser G7u Pro Phe Thr Val Gin Gly Asn Ala Cys Pro Thr lie Lys 385 390 395 400 GTT CGT GTT GAT CCG AAA AAG AGA AAT AGA CTT ATC TTT AGG AAG TTC 1248 Val Arg Val Asp Pro Lys Lys Arg Asn Arg Leu Ile Phe Arg Lys Phe 405 410 415 AAC TCA GGA AAA CCT CAG TTT GCT GGA ACC ATG ACT CAT TCA CAA ACA 1296 Asn Ser Gly Lys Pro Gln Phe Ala Gly Thr Met Thr His Ser Gln Thr 420 425 430 AAT TTT AAA GAT ATT CAT CGT GAT CTA TAC GAT GCA GCC TTA AAT ATT 1344 Asn Phe Lys Asp Ile His Arg Asp Leu Tyr Asp Ala Ala Leu Asn Ile 435 440 445 AAT AAG TTG AAA GCA GTG GAT GAA GCT ACA ACT TTG ATT GAA AAG GGT 1392 Asn Lys Leu Lys Ala Val Asp Glu Ala Thr Thr Leu Ile Glu Lys Gly 450 455 460 GCA GAC ATA GAA GCA AAA TTT GAC AAT GAC AGA AGT GCA ATG CAC GCA 1440 Ala Asp Ile Glu Ala Lys Phe Asp Asn Asp Arg Ser Ala Met His Ala 465 470 475 480 GTT GCA TAT CGA GGA AAT AAC AAA ATA GCC TTA AGA TTT CTT TTG AAA 1488 Val Ala Tyr Arg Gly Asn Asn Lys lie Ala Leu Arg Phe Leu Leu Lys 485 490 495 AAT CAA TCC ATT GAC ATC GAG TTA AAA GAT AAA AAC GGC TTT ACT CCT 1536 Asn Gin Ser lie Asp lie Glu Leu Lys Asp Lys Asn Gly Phe Thr Pro 500 505 510 CTA CAC ATC GCA GCT GAA GCA GGT CAG GCA GGA TTT GTT AAG TTA CTA 1584 Leu His Ile Ala Ala Glu Ala Gly Gln Ala Gly Phe Val Lys Leu Leu 515 520 525 ATA AAT CAT GGA GCT GAT GTG AAT GCA AAA ACA AGT AAG ACA AAT TTG 1632 Ile Asn His Gly Ala Asp Val Asn Ala Lys Thr Ser Lys Thr Asn Leu 530 535 540 ACA CCA TTA CAT CTT GCA ACA CGT AGT GGA TTT TCA AAA ACT GTA AGA 1680 Thr Pro Leu His Leu Ala Thr Arg Ser Gly Phe Ser Lys Thr Val Arg 545 550 555 560 AAT TTA CTA GAA AGC CCA AAT ATT AAG GTA AAT GAA AAG GAG GAT GAC 1728 Asn Leu Leu Glu Ser Pro Asn Ile Lys Val Asn Glu Lys Glu Asp Asp 565 570 575 GGA TTT ACA CCT TTG CAT ACT GCA GTA ATG AGT ACT TAT ATG GTT GTC 1776 Gly Phe Thr Pro Leu His Thr Ala Val Met Ser Thr Tyr Met Val Val 580 585 590 GAT GCT TTG CTA AAT CAT CCA GAC ATT GAT AAA AAT GCG CAG TCT ACG 1824 Asp Ala Leu Leu Asn His Pro Asp Ile Asp Lys Asn Ala Gln Ser Thr 595 600 605 CA GGA TTG ACT CCT TTC CAT TTA GCA ATT ATT AAT GAA AGT CAA GAA 1872 Ser Gly Leu Thr Pro Phe His Leu Ala lie lie Asn Glu Ser Gln Glu 610 615 620 GTT GCA GAA TCT TTA GTG GAA AGT AAT GCT GAT CTA AAT ATT CAG GAT 1920 Val Ala Glu Ser Leu Val Glu Ser Asn Ala Asp Leu Asn lie Gin Asp 625 630 635 640 GTT AAC CAT ATG GCT CCT ATT CAT TTT GCA GCT TCA ATG GGT AGT ATT 1968 Val Asn His Met Ala Pro lie His Phe Ala Ala Ser Met Gly Ser lie 645 650 655 AAA ATG CTT AGA TAT CTC ATT TCC ATA AAA GAT AAA GTT AGT ATT AAT 2016 Lys Met Leu Arg Tyr Leu lie Ser lie Lys Asp Lys Val Ser lie Asn 660 665 670 TCT GTG ACT GAG AAT AAT AAC TGG ACA CCT TTA CAT TTT GCT ATA TAT 2064 Ser Val Thr Glu Asn Asn Asn Trp Thr Pro Leu His Phe Ala Ile Tyr 675 680 685 TTT AAA AAA GAA GAT GCT GCA AAA GAA TTG TTG AAA CAA GAT GAC ATA 2112 Phe Lys Lys Glu Asp Ala Ala Lys Glu Leu Leu Lys Gin Asp Asp lie 690 695 700 AAT TTA ACA ATT GTT GCA GAT GGT AAT CTT ACC GTT TTA CAT CTT GCT 2160 Asn Leu Thr lie Val Ala Asp Gly Asn Leu Thr Val Leu His Leu Ala 705 710 715 720 GTT TCG ACA GGA CAA ATA AAT ATA ATT AAA GAA TTA TTG AAG AGA GGC 2208 Val Ser Thr Gly Gin Ile Asn lie lie Lys Glu Leu Leu Lys Arg Gly 725 730 735 TCC AAT ATA GAA GAA AAA ACT GGA GAA GGA TAT ACA TCT CTC CAC ATC 2256 Ser Asn lie Glu Glu Lys Thr Gly Glu Gly Tyr Thr Ser Leu His lie 740 745 750 GCT GCG ATG CGA AAG GAG CCA GAG ATA GCT GTT GTT TTG ATT GAA AAC 2304 Ala Ala Met Arg Lys Glu Pro Glu lie Ala Val Val Leu lie Glu Asn 755 760 765 GGT GCT GAC ATA GAA GCT CGA TCA GCT GAT AAT TTA ACA CCT TTA CAT 2352 Gly Ala Asp lie Glu Ala Arg Ser Ala Asp Asn Leu Thr Pro Leu His 770 775 780 TCT GCC GCA AAA ATA GGA AGG AAA TCT ACA GTA CTT TAC TTA TTA GAA 2400 Ser Ala Ala Lys lie Gly Arg Lys Ser Thr Val Leu Tyr Leu Leu Glu 785 790 795 800 AAA GGA GCT GAC ATT GGA GCT AAA ACA GCA GAC GGT TCT ACT GCC TTG 2448 Lys Gly Ala Asp lie Gly Ala Lys Thr Ala Asp Gly Ser Thr Ala Leu 805 810 815 CAT TTA GCT GTA TCT GGT CGT AAA ATG AAA ACT GTT GAA ACT CTA TTA 2496 His Leu Ala Val Ser Gly Arg Lys Met Lys Thr Val Glu Thr Leu Leu 820 825 830 AAT AAA GGA GCA AAT TTA AAA GAA TAC GAT AAC AAT AAA TAT TTG CCA 2544 Asn Lys Gly Ala Asn Leu Lys Glu Tyr Asp Asn Asn Lys Tyr Leu Pro 835 840 845 ATA CAT AAA GCT ATT ATT AAT GAT GAC CTT GAC ATG GTA CGT TTG TTT 2592 lie His Lys Ala Ile lie Asn Asp Asp Leu Asp Met Val Arg Leu Phe 850 855 860 CTT GAA AAA GAT CCC AGT CTC AAA GAT GAT GAA ACA GAA GAG GGT AGA 2640 Leu GLu Lys Asp Pro Ser Leu Lys Asp Asp Glu Thr Glu Glu Gly Arg ,65 870 875 880 ACT TCA ATT ATG TTA ATT GTT CAG AAA TTG CTT CTT GAA TTA TAT AAC 2688 Thr Ser Ile Met Leu Ile Val Gln Lys Leu Leu Leu Glu Leu Tyr Asn 885 890 895 TAT TTT ATA AAT AAT TAT GCT GAA ACT TTG GAT GAA GAA GCT TTA TTC 2736 Tyr Phe lie Asn Asn Tyr Ala Glu Thr Leu Asp Glu Glu Ala Leu Phe 900 905 910 AAC CGC TTA GAT GAA CAA GGG AAA TTA GAG CTT GCA TAT ATC TTC CAT 2784 Asn Arg Leu Asp Glu Gin Gly Lys Leu Glu Leu Ala Tyr Ile Phe His 915 920 925 AAT AAA GAA GGT GAT GCA AAA GAG GCT GTT AAG CCA ACT ATC CTT GTT 2832 Asn Lys Glu Gly Asp Ala Lys Glu Ala Val Lys Pro Thr lie Leu Val 930 935 940 ACA ATT AAA CTT ATG GAA TAC TGC TTA AAA AAA CTT CGC GAA GAG TCT 2880 Thr Ile Lys Leu Met Glu Tyr Cys Leu Lys Lys Leu Arg Glu Glu Ser 945 950 955 960 GGA GCT CCT GAA GGT AGT TTC GAT TCT CCA TCT TCA AAG CAA TGT ATT 2928 Gly Ala Pro Glu Gly Ser Phe Asp Ser Pro Ser Ser Lys Gin Cys lie 965 970 975 TCT ACC TTT TCA GAG GAT GAA ATG TTT CGT CGT ACT TTA CCG GAA TGA 2976 Ser Thr Phe Ser Glu Asp G7u Met Phe Arg Arg Thr Leu Pro Glu * 980 985 990 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 992 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Asp Glu Glu Asp Gly Glu Met Thr Leu Glu Glu Arg Gln Ala Gln Cys 1 5 10 15 Lys Ala Ile Glu Tyr Ser Asn Ser Val Phe Gly Met Ile Ala Asp Val 20 25 30 Ala Asn Asp lie Gly Ser lie Pro Val lie Gly Glu Val Val Gly lie 35 40 45 Val Thr Ala Pro lie Ala lie Val Ser His lie Thr Ser Ala Gly Leu 50 55 60 Asp lie Ala Ser Thr Ala Leu Asp Cys Asp Asp lie Pro Phe Asp Glu 65 70 75 80 Ile Lys Glu Ile Leu Glu Glu Arg Phe Asn Glu Ile Asp Arg Lys Leu 85 90 95 Asp Lys Asn Thr Ala Ala Leu Glu Glu Val Ser Lys Leu Val Ser Lys 100 105 110 Thr Phe Val Thr Val Glu Lys Thr Arg Asn Glu Met Asn Glu Asn Phe 115 120 125 Lys Leu Val Leu Glu Thr lie Glu Ser Lys Glu lie Lys Ser lie Val 130 135 140 Phe Lys lie Asn Asp Phe Lys Lys Phe Phe Glu Lys Glu Arg Gin Arg 145 150 155 160 lie Lys Gly Leu Pro Lys Asp Arg Tyr Val Ala Lys Leu Leu Glu Gin 165 170 175 Lys Gly lie Leu Gly Ser Leu Lys Glu Val Arg Glu Pro Ser Gly Asn 180 185 190 Ser Leu Ser Ser Ala Leu Asn Glu Leu Leu Asp Lys Asn Asn Asn Tyr 195 200 205 Ala lie Pro Lys Val Val Asp Asp Asn Lys Ala Phe Gin Ala Leu Tyr 210 215 220 Ala Leu Phe Tyr Gly Thr Gin Thr Tyr Ala Ala Val Met Phe Phe Leu 225 230 235 240 Leu Glu Gin His Ser Tyr Leu Ala Asp Tyr Tyr Tyr Gln Lys Gly Asp 245 250 255 Asp Val Asn Phe Asn Ala Glu Phe Asn Asn Val Ala lie lie Phe Asp 260 265 270 Asp Phe Lys Ser Ser Leu Thr Gly Gly Asp Asp Gly Leu lie Asp Asn 275 280 285 Val lie Glu Val Leu Asn Thr Val Lys Ala Leu Pro Phe Ile Lys Asn 290 295 300 Ala Asp Ser Lys Leu Tyr Arg Glu Leu Val Thr Arg Thr Lys Ala Leu 305 310 315 320 Glu Thr Leu Lys Asn Gin Ile Lys Thr Thr Asp Leu Pro Leu Ile Asp 325 330 335 Asp Ile Pro Glu Thr Leu Ser Gin Val Asn Phe Pro Asn Asp Glu Asn 340 345 350 Gin Leu Pro Thr Pro Ile Gly Asn Trp Val Asp Gly Val Glu Val Arg 355 360 365 Tyr Ala Val Gin Tyr Glu Ser Lys Gly Met Tyr Ser Lys Phe Ser Glu 370 375 380 Trp Ser Glu Pro Phe Thr Val Gin Gly Asn Ala Cys Pro Thr Ile Lys 385 390 395 400 Val Arg Val Asp Pro Lys Lys Arg Asn Arg Leu Ile Phe Arg Lys Phe 405 410 415 Asn Ser Gly Lys Pro Gln Phe Ala Gly Thr Met Thr His Ser Gin Thr 420 425 430 Asn Phe Lys Asp Ile His Arg Asp Leu Tyr Asp Ala Ala Leu Asn Ile 435 440 445 Asn Lys Leu Lys Ala Val Asp Glu Ala Thr Thr Leu Ile Glu Lys Gly 450 455 460 Ala Asp lie Glu Ala Lys Phe Asp Asn Asp Arg Ser Ala Met His Ala 465 470 475 480 Val Ala Tyr Arg Gly Asn Asn Lys Ile Ala Leu Arg Phe Leu Leu Lys 485 490 495 Asn Gin Ser Ile Asp lie Glu Leu Lys Asp Lys Asn Gly Phe Thr Pro 500 505 510 Leu His Ile Ala Ala Glu Ala Gly Gln Ala Gly Phe Val Lys Leu Leu 515 520 525 lie Asn His Gly Ala Asp Val Asn Ala Lys Thr Ser Lys Thr Asn Leu 530 535 540 Thr Pro Leu His Leu Ala Thr Arg Ser Gly Phe Ser Lys Thr Val Arg 545 550 555 560 Asn Leu Leu Glu Ser Pro Asn Ile Lys Val Asn Glu Lys Glu Asp Asp 565 570 575 Gly Phe Thr Pro Leu His Thr Ala Val Met Ser Thr Tyr Met Val Val 580 585 590 Asp Ala Leu Leu Asn His Pro Asp Ile Asp Lys Asn Ala Gin Ser Thr 595 600 605 Ser Gly Leu Thr Pro Phe His Leu Ala lie Ile Asn Glu Ser Gln Glu 610 615 620 Val Ala Glu Ser Leu Val G1u Ser Asn Ala Asp Leu Asn lie Gin Asp 625 630 635 640 Val Asn His Met Ala Pro Ile His Phe Ala Ala Ser Met Gly Ser Ile 645 650 655 Lys Met Leu Arg Tyr Leu Ile Ser lie Lys Asp Lys Val Ser Ile Asn 660 665 670 Ser Val Thr Glu Asn Asn Asn Trp Thr Pro Leu His Phe Ala Ile Tyr 675 680 685 Phe Lys Lys G1u Asp Ala Ala Lys Glu Leu Leu Lys Gln Asp Asp Ile 690 695 700 Asn Leu Thr Ile Val Ala Asp Gly Asn Leu Thr Val Leu His Leu Ala 705 710 715 720 Val Ser Thr Gly Gln lie Asn Ile lie Lys Glu Leu Leu Lys Arg Gly 725 730 735 Ser Asn lie Glu Glu Lys Thr Gly Glu Gly Tyr Thr Ser Leu His lie 740 745 750 Ala Ala Met Arg Lys Glu Pro Glu Ile Ala Val Val Leu Ile Glu Asn 755 760 765 Gly Ala Asp Ile Glu Ala Arg Ser Ala Asp Asn Leu Thr Pro Leu His 770 775 780 Ser Ala Ala Lys Ile Gly Arg Lys Ser Thr Val Leu Tyr Leu Leu Glu 785 790 795 800 Lys Gly Ala Asp Ile Gly Ala Lys Thr Ala Asp Gly Ser Thr Ala Leu 805 810 815 His Leu Ala Val Ser Gly Arg Lys Met Lys Thr Val Glu Thr Leu Leu 820 825 830 Asn Lys Gly Ala Asn Leu Lys Glu Tyr Asp Asn Asn Lys Tyr Leu Pro 835 840 845 lie His Lys Ala lie lie Asn Asp Asp Leu Asp Met Val Arg Leu Phe 850 855 860 Leu Glu Lys Asp Pro Ser Leu Lys Asp Asp Glu Thr Glu Glu Gly Arg 865 870 875 880 Thr Ser lie Met Leu lie Val Gln Lys Leu Leu Leu Glu Leu Tyr Asn 885 890 895 Tyr Phe Ile Asn Asn Tyr Ala Glu Thr Leu Asp Giu Glu Ala Leu Phe 900 905 910 Asn Arg Leu Asp Glu Gln Gly Lys Leu Glu Leu Ala Tyr Ile Phe His 915 920 925 Asn Lys Glu Gly Asp Ala Lys Glu Ala Val Lys Pro Thr lie Leu Val 930 935 940 Thr lie Lys Leu Met Glu Tyr Cys Leu Lys Lys Leu Arg Glu Glu Ser 945 950 955 960 Gly Ala Pro Glu Gly Ser Phe Asp Ser Pro Ser Ser Lys G1n Cys Ile 965 970 975 Ser Thr Phe Ser Giu Asp Glu Met Phe Arg Arg Thr Leu Pro Glu * 980 985 990 (2) INFORMATION FOR SEQ ID NO: 3: Ci) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3706 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D 1015 1020 1025 CTA GAA GAA AGA CAA GCA CAA TGC AAA GCA ATA GAG TAC AGC AAT TCA 200 Leu Glu Glu Arg Gin Ala Gin Cys Lys Ala lie Glu Tyr Ser Asn Ser 1030 1035 1040 GTT TTT GGG ATG ATC GCT GAT GTA GCT AAC GAC ATC GGT TCC ATT CCT 248 Val Phe Gly Met lie Ala Asp Val Ala Asn Asp lie Gly Ser Ile Pro 1045 1050 1055 1060 GTA ATT GGC GAA GTA GTT GGC ATT GTA ACT GCC CCA ATT GCC ATC GTA 296 Val lie Gly Glu Val Val Gly lie Val Thr Ala Pro lie Ala lie Val 1065 1070 1075 AGT CAC ATT ACT AGC GCA GGC TTG GAT ATA GCT TCT ACG GCA TTA GAT 344 Ser His lie Thr Ser Ala Gly Leu Asp lie Ala Ser Thr Ala Leu Asp 1080 1085 1090 TGT GAT GAT ATA CCT TTT GAT GAG ATT AAG GAA ATA TTA GAA GAA AGA 392 Cys Asp Asp lie Pro Phe Asp Glu lie Lys Glu lie Leu Glu Glu Arg 1095 1100 1105 TTC AAT GAA ATA GAT AGA AAG TTG GAC AAG AAC ACA GCT GCT TTG GAA 440 Phe Asn Glu lie Asp Arg Lys Leu Asp Lys Asn Thr Ala Ala Leu Glu 1110 1115 1120 GAG GTC TCT AAA CTG GTA AGT AAA ACT TTT GTT ACG GTG GAA AAA ACA 488 Glu Val Ser Lys Leu Val Ser Lys Thr Phe Val Thr Val Glu Lys Thr 1125 1130 1135 1140 AGG AAT GAA ATG AAC GAA AAT TTT AAG CTT GTT TTG GAA ACT ATA GAA 536 Arg Asn Glu Met Asn Glu Asn Phe Lys Leu Val Leu Glu Thr Ile Glu 1145 1150 1155 AGC AAA GAA ATA AAA TCA ATT GTA TTC AAA ATA AAT GAT TTT AAA AAG 584 Ser Lys Glu lie Lys Ser lie Val Phe Lys lie Asn Asp Phe Lys Lys 1160 1165 1170 TTT TTT GAA AAA GAA CGA CAA AGA ATT AAA GGT TTG CCT AAA GAT AGG 632 Phe Phe Glu Lys Glu Arg Gin Arg lie Lys Gly Leu Pro Lys Asp Arg 1175 1180 1185 TAT GTT GCT AAG CTT CTA GAA CAA AAA GGT ATT TTA GGT TCT TTA AAA 680 Tyr Val Ala Lys Leu Leu Glu Gin Lys Gly lie Leu Gly Ser Leu Lys 1190 1195 1200 GAA GTA AGA GAA CCA TCT GGA AAC AGT CTG AGC TCC GCG TTA AAT GAA 728 Glu Val Arg Glu Pro Ser Gly Asn Ser Leu Ser Ser Ala Leu Asn Glu 1205 1210 1215 1220 CTC TTA GAC AAA AAC AAC AAC TAT GCC ATC CCA AAA GTG GTT GAT GAT 776 Leu Leu Asp Lys Asn Asn Asn Tyr Ala lie Pro Lys Val Val Asp Asp 1225 1230 1235 AAT AAG GCC TTT CAG GCG CTG TAT GCT TTA TTT TAT GGA ACT CAG ACT 824 Asn Lys Ala Phe Gln Ala Leu Tyr Ala Leu Phe Tyr Gly Thr Gin Thr 1240 1245 1250 TAT GCA GCC GTT ATG TTT TTC TTA CTC GAA CAA CAT TCT TAT CTG GCT 872 Tyr Ala Ala Val Met Phe Phe Leu Leu Glu Gln His Ser Tyr Leu Ala 1255 1260 1265 GAT TAT TAT TAC CAA AAA GGT GAT GAT GTA AAT TTT AAT GCA GAA TTT 920 Asp Tyr Tyr Tyr Gln Lys Gly Asp Asp Val Asn Phe Asn Ala Glu Phe 1270 1275 1280 AAT AAT GTA GCA ATT ATT TTT GAT GAC TTT AAA TCA TCA CTA ACA GGA 968 Asn Asn Val Ala lie lie Phe Asp Asp Phe Lys Ser Ser Leu Thr Gly 1285 1290 1295 1300 GGA GAT GAC GGA TTA ATA GAT AAT GTC ATT GAG GTT CTT AAC ACC GTG 1016 Gly Asp Asp Gly Leu lie Asp Asn Val lie Glu Val Leu Asn Thr Val 1305 1310 1315 AAA GCA TTA CCA TTT ATA AAG AAC GCC GAC AGT AAA CTA TAC AGA GAA 1064 Lys Ala Leu Pro Phe lie Lys Asn Ala Asp Ser Lys Leu Tyr Arg Glu 1320 1325 1330 TTA GTA ACT AGA ACA AAA GCT TTA GAG ACT CTT AAA AAT CAA ATC AAA 1112 Leu Val Thr Arg Thr Lys Ala Leu Glu Thr Leu Lys Asn Gin lie Lys 1335 1340 1345 ACG ACT GAT TTG CCT CTT ATA GAT GAT ATA CCC GAA ACT TTG TCT CAA 1160 Thr Thr Asp Leu Pro Leu lie Asp Asp lie Pro Glu Thr Leu Ser Gin 1350 1355 1360 GTG AAC TTT CCG AAT GAC GAA AAT CAA TTG CCT ACA CCA ATA GGA AAT 1208 Val Asn Phe Pro Asn Asp Glu Asn Gin Leu Pro Thr Pro Ile Gly Asn 1365 1370 1375 1380 TGG GTT GAT GGC GTA GAA GTT AGG TAC GCA GTA CAG TAT GAA AGT AAG 1256 Trp Val Asp Gly Val Glu Val Arg Tyr Ala Val Gin Tyr Glu Ser Lys 1385 1390 1395 GGC ATG TAT TCG AAA TTC AGT GAA TGG TCT GAA CCA TTT ACT GTC CAA 1304 Gly Met Tyr Ser Lys Phe Ser Glu Trp Ser Glu Pro Phe Thr Val Gin 1400 1405 1410 GGT AAC GCT TGT CCG ACT ATA AAA GTT CGT GTT GAT CCG AAA AAG AGA 1352 Gly Asn Ala Cys Pro Thr lie Lys Val Arg Val Asp Pro Lys Lys Arg 1415 1420 1425 AAT AGA CTT ATC TTT AGG AAG TTC AAC TCA GGA AAA CCT CAG TTT GCT 1400 Asn Arg Leu lie Phe Arg Lys Phe Asn Ser Gly Lys Pro Gin Phe Ala 1430 1435 1440 GGA ACC ATG ACT CAT TCA CAA ACA AAT TTT AAA GAT ATT CAT CGT GAT 1448 Gly Thr Met Thr His Ser Gin Thr Asn Phe Lys Asp lie His Arg Asp 1445 1450 1455 1460 CTA TAC GAT GCA GCC TTA AAT ATT AAT AAG TTG AAA GCA GTG GAT GAA 1496 Leu Tyr Asp Ala Ala Leu Asn lie Asn Lys Leu Lys Ala Val Asp Glu 1465 1470 1475 GCT ACA ACT TTG ATT GAA AAG GGT GCA GAC ATA GAA GCA AAA TTT GAC 1544 Ala Thr Thr Leu lie Glu Lys Gly Ala Asp lie Glu Ala Lys Phe Asp 1480 1485 1490 AAT GAC AGA AGT GCA ATG CAC GCA GTT GCA TAT CGA GGA AAT AAC AAA 1592 Asn Asp Arg Ser Ala Met His Ala Val Ala Tyr Arg Gly Asn Asn Lys 1495 1500 1505 ATA GCC TTA AGA TTT CTT TTG AAA AAT CAA TCC ATT GAC ATC GAG TTA 1640 lie Ala Leu Arg Phe Leu Leu Lys Asn Gin Ser lie Asp lie Glu Leu 1510 1515 1520 AAA GAT AAA AAC GGC TTT ACT CCT CTA CAC ATC GCA GCT GAA GCA GGT 1688 Lys Asp Lys Asn Gly Phe Thr Pro Leu His lie Ala Ala Glu Ala Gly 1525 1530 1535 1540 CAG GCA GGA TTT GTT AAG TTA CTA ATA AAT CAT GGA GCT GAT GTG AAT 1736 Gin Ala Gly Phe Val Lys Leu Leu lie Asn His Gly Ala Asp Val Asn 1545 1550 1555 GCA AAA ACA AGT AAG ACA AAT TTG ACA CCA TTA CAT CTT GCA ACA CGT 1784 Ala Lys Thr Ser Lys Thr Asn Leu Thr Pro Leu His Leu Ala Thr Arg 1560 1565 1570 AGT GGA TTT TCA AAA ACT GTA AGA AAT TTA CTA GAA AGC CCA AAT ATT 1832 Ser Gly Phe Ser Lys Thr Val Arg Asn Leu Leu Glu Ser Pro Asn Ile 1575 1580 1585 AAG GTA AAT GAA AAG GAG GAT GAC GGA TTT ACA CCT TTG CAT ACT GCA 1880 Lys Val Asn Glu Lys Glu Asp Asp Gly Phe Thr Pro Leu His Thr Ala 1590 1595 1600 GTA ATG AGT ACT TAT ATG GTT GTC GAT GCT TTG CTA AAT CAT CCA GAC 1928 Va7 Met Ser Thr Tyr Met Val Val Asp Ala Leu Leu Asn His Pro Asp 1605 1610 1615 1620 ATT GAT AAA AAT GCG CAG TCT ACG TCA GGA TTG ACT CCT TTC CAT TTA 1976 Ile Asp Lys Asn Ala Gln Ser Thr Ser Gly Leu Thr Pro Phe His Leu 1625 1630 1635 GCA ATT ATT AAT GAA AGT CAA GAA GTT GCA GAA TCT TTA GTG GAA AGT 2024 Ala lie Ile Asn Glu Ser Gin Glu Val Ala Glu Ser Leu Val Glu Ser 1640 1645 1650 AAT GCT GAT CTA AAT ATT CAG GAT GTT AAC CAT ATG GCT CCT ATT CAT 2072 Asn Ala Asp Leu Asn Ite Gln Asp Val Asn His Met Ala Pro lie His 1655 1660 1665 TTT GCA GCT TCA ATG GGT AGT ATT AAA ATG CTT AGA TAT CTC ATT TCC 2120 Phe Ala Ala Ser Met Gly Ser Ile Lys Met Leu Arg Tyr Leu Ile Ser 1670 1675 1680 ATA AAA GAT AAA GTT AGT ATT AAT TCT GTG ACT GAG AAT AAT AAC TGG 2168 lie Lys Asp Lys Val Ser Ile Asn Ser Val Thr Glu Asn Asn Asn Trp 1685 1690 1695 1700 ACA CCT TTA CAT TTT GCT ATA TAT TTT AAA AAA GAA GAT GCT GCA AAA 2216 Thr Pro Leu His Phe Ala Ile Tyr Phe Lys Lys Glu Asp Ala Ala Lys 1705 1710 1715 GAA TTG TTG AAA CAA GAT GAC ATA AAT TTA ACA ATT GTT GCA GAT GGT 2264 Glu Leu Leu Lys Gin Asp Asp Ile Asn Leu Thr lie Val Ala Asp Gly 1720 1725 1730 AAT CTT ACC GTT TTA CAT CTT GCT GTT TCG ACA GGA CAA ATA AAT ATA 2312 Asn Leu Thr Val Leu His Leu Ala Val Ser Thr Gly Gln lie Asn Ile 1735 1740 1745 ATT AAA GAA TTA TTG AAG AGA GGC TCC AAT ATA GAA GAA AAA ACT GGA 2360 lie Lys Glu Leu Leu Lys Arg Gly Ser Asn lie Glu Glu Lys Thr Gly 1750 1755 1760 GAA GGA TAT ACA TCT CTC CAC ATC GCT GCG ATG CGA AAG GAG CCA GAG 2408 Glu Gly Tyr Thr Ser Leu His Ile Ala Ala Met Arg Lys Glu Pro Glu 1765 1770 1775 1780 ATA GCT GTT GTT TTG ATT GAA AAC GGT GCT GAC ATA GAA GCT CGA TCA 2456 lie Ala Val Val Leu Ile Glu Asn Gly Ala Asp lie Glu Ala Arg Ser 1785 1790 1795 GCT GAT AAT TTA ACA CCT TTA CAT TCT GCC GCA AAA ATA GGA AGG AAA 2504 Ala Asp Asn Leu Thr Pro Leu His Ser Ala Ala Lys Ite Gly Arg Lys 1800 1805 1810 TCT ACA GTA CTT TAC TTA TTA GAA AAA GGA GCT GAC ATT GGA GCT AAA 2552 Ser Thr Val Leu Tyr Leu Leu Glu Lys Gly Ala Asp lie Gly Ala Lys 1815 1820 1825 ACA GCA GAC GGT TCT ACT GCC TTG CAT TTA GCT GTA TCT GGT CGT AAA 2600 Thr Ala Asp Gly Ser Thr Ala Leu His Leu Ala Val Ser Gly Arg Lys 1830 1835 1840 ATG AAA ACT GTT GAA ACT CTA TTA AAT AAA GGA GCA AAT TTA AAA GAA 2648 Met Lys Thr Val Glu Thr Leu Leu Asn Lys Gly Ala Asn Leu Lys Glu 1845 1850 1855 1860 TAC GAT AAC AAT AAA TAT TTG CCA ATA CAT AAA GCT ATT ATT AAT GAT 2696 Tyr Asp Asn Asn Lys Tyr Leu Pro lie His Lys Ala lie lie Asn Asp 1865 1870 1875 GAC CTT GAC ATG GTA CGT TTG TTT CTT GAA AAA GAT CCC AGT CTC AAA 2744 Asp Leu Asp Met Val Arg Leu Phe Leu Glu Lys Asp Pro Ser Leu Lys 1880 1885 1890 GAT GAT GAA ACA GAA GAG GGT AGA ACT TCA ATT ATG TTA ATT GTT CAG 2792 Asp Asp Glu Thr Glu Glu Gly Arg Thr Ser lie Met Leu lie Val Gin 1895 1900 1905 AAA TTG CTT CTT GAA TTA TAT AAC TAT TTT ATA AAT AAT TAT GCT GAA 2840 Lys Leu Leu Leu Glu Leu Tyr Asn Tyr Phe lie Asn Asn Tyr Ala Glu 1910 1915 1920 ACT TTG GAT GAA GAA GCT TTA TTC AAC CGC TTA GAT GAA CAA GGG AAA 2888 Thr Leu Asp Glu Glu Ala Leu Phe Asn Arg Leu Asp Glu Gin Gly Lys 1925 1930 1935 1940 TTA GAG CTT GCA TAT ATC TTC CAT AAT AAA GAA GGT GAT GCA AAA GAG 2936 Leu Glu Leu Ala Tyr lie Phe His Asn Lys Glu Gly Asp Ala Lys Glu 1945 1950 1955 GCT GTT AAG CCA ACT ATC CTT GTT ACA ATT AAA CTT ATG GAA TAC TGC 2984 Ala Val Lys Pro Thr lie Leu Val Thr lie Lys Leu Met Glu Tyr Cys 1960 1965 1970 TTA AAA AAA CTT CGC GAA GAG TCT GGA GCT CCT GAA GGT AGT TTC GAT 3032 Leu Lys Lys Leu Arg Glu Glu Ser Gly Ala Pro Glu Gly Ser Phe Asp 1975 1980 1985 TCT CCA TCT TCA AAG CAA TGT ATT TCT ACC TTT TCA GAG GAT GAA ATG 3080 Ser Pro Ser Ser Lys Gin Cys lie Ser Thr Phe Ser Glu Asp Glu Met 1990 1995 2000 TTT CGT CGT ACT TTA CCG GAA ATT GTA AAA GAA ACG AAC AGC AGA TAT 3128 Phe Arg Arg Thr Leu Pro Glu lie Val Lys Glu Thr Asn Ser Arg Tyr 2005 2010 2015 2020 TTA CCA CTA AAG GGC TTT TCT CGC AGC CTA AAT AAG TTT CTC CCT TCT 3176 Leu Pro Leu Lys Gly Phe Ser Arg Ser Leu Asn Lys Phe Leu Pro Ser 2025 2030 2035 CTA AAA TTT GCC GAA AGT AAG AAT AGC TAC AGA TCT GAA AAT TTT GTT 3224 Leu Lys Phe Ala Glu Ser Lys Asn Ser Tyr Arg Ser Glu Asn Phe Val 2040 2045 2050 AGC AAT ATT GAT TCC AAC GGA GCA TTA CTT TTA CTC GAT GTA TTT ATC 3272 Ser Asn lie Asp Ser Asn Gly Ala Leu Leu Leu Leu Asp Val Phe lie 2055 2060 2065 AGA AAG TTT ACT AAT GAG AAA TAC AAT TTG ACT GGA AAA GAA GCT GTA 3320 Arg Lys Phe Thr Asn Glu Lys Tyr Asn Leu Thr Gly Lys Glu Ala Val 2070 2075 2080 CCC TAT CTG GAA GCA AAG GCT TCA TCA TTA CGT ATC GCT TCT AAA TTT 3368 Pro Tyr Leu Glu Ala Lys Ala Ser Ser Leu Arg lie Ala Ser Lys Phe 2085 2090 2095 2100 GAA GAA CTT CTA ACT GAA GTT AAA GGT ATT CCG GCT GGA GAG CTA ATT 3416 Glu Glu Leu Leu Thr Glu Val Lys Gly lie Pro Ala Gly Glu Leu lie 2105 2110 2115 AAT ATG GCC GAA GTG AGT TCC AAC ATA CAT AAG GCA ATT GCA AGT GGT 3464 Asn Met Ala Glu Val Ser Ser Asn lie His Lys Ala lie Ala Ser Gly 2120 2125 2130 AAG CCT GTA TCA AAA GTC TTA TGT TCG TAT TTG GAT ACC TTT TCT GAA 3512 Lys Pro Val Ser Lys Val Leu Cys Ser Tyr Leu Asp Thr Phe Ser Glu 2135 2140 2145 TTA AAT TCT CAA CAA ATG GAA GAA TTA GTT AAC ACA TAC TTA TCC ACC 3560 Leu Asn Ser Gin Gin Met Glu Glu Leu Val Asn Thr Tyr Leu Ser Thr 2150 2155 2160 AAA CCT TCT GTA ATT ACG TCA GCA TCT GCA GAT TAC CAG AAA CTT CCT 3608 Lys Pro Ser Val lie Thr Ser Ala Ser Ala Asp Tyr Gin Lys Leu Pro 2165 2170 2175 2180 AAT TTG TTA ACT GCA ACT TGC TTA GAA CCA GAA AGA ATG GCT CAA CTT 3656 Asn Leu Leu Thr Ala Thr Cys Leu Glu Pro Glu Arg Met Ala Gln Leu 2185 2190 2195 ATA GAT GTG CAT CAA AAG ATG TTT TTA CGT TAAAATACCA TTCCTTCTGT 3706 Ile Asp Val His Gin Lys Met Phe Leu Arg 2200 2205 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1214 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: Met His Ser Lys Glu Leu Gin Thr lie Ser Ala Ala Val Ala Arg Lys 1 5 10 15 Ala Val Pro Asn Thr Met Val lie Arg Leu Lys Arg Asp Glu Glu Asp 20 25 30 Gly Glu Met Thr Leu Glu Glu Arg Gin Ala Gln Cys Lys Ala lie Glu 35 40 45 Tyr Ser Asn Ser Val Phe Gly Met lie Ala Asp Val Ala Asn Asp lie 50 55 60 Gly Ser Ile Pro Val lie Gly Glu Val Val Gly lie Val Thr Ala Pro 65 70 75 80 lie Ala lie Val Ser His lie Thr Ser Ala Gly Leu Asp Ile Ala Ser 85 90 95 Thr Ala Leu Asp Cys Asp Asp lie Pro Phe Asp Glu Ile Lys Glu Ile 100 105 110 Leu Glu Glu Arg Phe Asn Glu Ile Asp Arg Lys Leu Asp Lys Asn Thr 115 120 125 Ala Ala Leu Glu Glu Val Ser Lys Leu Val Ser Lys Thr Phe Val Thr 130 135 140 Val Glu Lys Thr Arg Asn Glu Met Asn Glu Asn Phe Lys Leu Val Leu 145 150 155 160 Glu Thr lie Glu Ser Lys Glu lie Lys Ser lie Val Phe Lys lie Asn 165 170 175 Asp Phe Lys Lys Phe Phe Glu Lys Glu Arg Gln Arg Ile Lys Gly Leu 180 185 190 Pro Lys Asp Arg Tyr Val Ala Lys Leu Leu Glu Gln Lys Gly lie Leu 195 200 205 Gly Ser Leu Lys Glu Val Arg Glu Pro Ser Gly Asn Ser Leu Ser Ser 210 215 220 Ala Leu Asn Glu Leu Leu Asp Lys Asn Asn Asn Tyr Ala lie Pro Lys 225 230 235 240 Val Val Asp Asp Asn Lys Ala Phe Gin Ala Leu Tyr Ala Leu Phe Tyr 245 250 255 Gly Thr Gin Thr Tyr Ala Ala Val Met Phe Phe Leu Leu Glu Gin His 260 265 270 Ser Tyr Leu Ala Asp Tyr Tyr Tyr Gin Lys Gly Asp Asp Val Asn Phe 275 280 285 Asn Ala Glu Phe Asn Asn Val Ala lie lie Phe Asp Asp Phe Lys Ser 290 295 300 Ser Leu Thr Gly Gly Asp Asp Gly Leu lie Asp Asn Val lie Glu Val 305 310 315 320 Leu Asn Thr Val Lys Ala Leu Pro Phe lie Lys Asn Ala Asp Ser Lys 325 330 335 Leu Tyr Arg Glu Leu Val Thr Arg Thr Lys Ala Leu Glu Thr Leu Lys 340 345 350 Asn Gin lie Lys Thr Thr Asp Leu Pro Leu Ile Asp Asp Ile Pro Glu 355 360 365 Thr Leu Ser Gln Val Asn Phe Pro Asn Asp Glu Asn Gin Leu Pro Thr 370 375 380 Pro lie Gly Asn Trp Val Asp Gly Val Glu Val Arg Tyr Ala Val Gin 385 390 395 400 Tyr Glu Ser Lys Gly Met Tyr Ser Lys Phe Ser Glu Trp Ser Glu Pro 405 410 415 Phe Thr Val Gln Gly Asn Ala Cys Pro Thr Ile Lys Val Arg Val Asp 420 425 430 Pro Lys Lys Arg Asn Arg Leu Ile Phe Arg Lys Phe Asn Ser Gly Lys 435 440 445 Pro Gin Phe Ala Gly Thr Met Thr His Ser Gin Thr Asn Phe Lys Asp 450 455 460 Ile His Arg Asp Leu Tyr Asp Ala Ala Leu Asn Ile Asn Lys Leu Lys 465 470 475 480 Ala Val Asp Glu Ala Thr Thr Leu Ile Glu Lys Gly Ala Asp lie Glu 485 490 495 Ala Lys Phe Asp Asn Asp Arg Ser Ala Met His Ala Val Ala Tyr Arg 500 505 510 Gly Asn Asn Lys lie Ala Leu Arg Phe Leu Leu Lys Asn Gin Ser Ile 515 520 525 Asp lie Glu Leu Lys Asp Lys Asn Gly Phe Thr Pro Leu His lie Ala 530 535 540 Ala Glu Ala Gly Gin Ala Gly Phe Val Lys Leu Leu lie Asn His Gly 545 550 555 560 Ala Asp Val Asn Ala Lys Thr Ser Lys Thr Asn Leu Thr Pro Leu His 565 570 575 Leu Ala Thr Arg Ser Gly Phe Ser Lys Thr Val Arg Asn Leu Leu Glu 580 585 590 Ser Pro Asn lie Lys Val Asn Glu Lys Glu Asp Asp Gly Phe Thr Pro 595 600 605 Leu His Thr Ala Val Met Ser Thr Tyr Met Val Val Asp Ala Leu Leu 610 615 620 Asn His Pro Asp lie Asp Lys Asn Ala Gln Ser Thr Ser Gly Leu Thr 625 630 635 640 Pro Phe His Leu Ala lie Ile Asn Glu Ser Gln Glu Val Ala Glu Ser 645 650 655 Leu Val Glu Ser Asn Ala Asp Leu Asn lie Gin Asp Val Asn His Met 660 665 670 Ala Pro lie His Phe Ala Ala Ser Met Gly Ser lie Lys Met Leu Arg 675 680 685 Tyr Leu lie Ser lie Lys Asp Lys Val Ser Ile Asn Ser Val Thr Glu 690 695 700 Asn Asn Asn Trp Thr Pro Leu His Phe Ala Ile Tyr Phe Lys Lys Glu 705 710 715 720 Asp Ala Ala Lys Glu Leu Leu Lys Gln Asp Asp Ile Asn Leu Thr Ile 725 730 735 Val Ala Asp Gly Asn Leu Thr Val Leu His Leu Ala Val Ser Thr Gly 740 745 750 Gln Ile Asn Ile Ile Lys Glu Leu Leu Lys Arg Gly Ser Asn Ile Glu 755 760 765 Glu Lys Thr Gly Glu Gly Tyr Thr Ser Leu His Ile Ala Ala Met Arg 770 775 780 Lys Glu Pro Glu lie Ala Val Val Leu lie Glu Asn Gly Ala Asp lie 785 790 795 800 Glu Ala Arg Ser Ala Asp Asn Leu Thr Pro Leu His Ser Ala Ala Lys 805 810 815 lie Gly Arg Lys Ser Thr Val Leu Tyr Leu Leu Glu Lys Gly Ala Asp 820 825 830 lie Gly Ala Lys Thr Ala Asp Gly Ser Thr Ala Leu His Leu Ala Val 835 840 845 Ser Gly Arg Lys Met Lys Thr Val Glu Thr Leu Leu Asn Lys Gly Ala 850 855 860 Asn Leu Lys G7u Tyr Asp Asn Asn Lys Tyr Leu Pro lie His Lys Ala 865 870 875 880 lie lie Asn Asp Asp Leu Asp Met Val Arg Leu Phe Leu Glu Lys Asp 885 890 895 Pro Ser Leu Lys Asp Asp Glu Thr Glu Glu Gly Arg Thr Ser lie Met 900 905 910 Leu lie Val Gln Lys Leu Leu Leu Glu Leu Tyr Asn Tyr Phe lie Asn 915 920 925 Asn Tyr Ala Glu Thr Leu Asp Glu Glu Ala Leu Phe Asn Arg Leu Asp 930 935 940 Glu Gin Gly Lys Leu Glu Leu Ala Tyr lie Phe His Asn Lys G7u Gly 945 950 955 960 Asp Ala Lys Glu Ala Val Lys Pro Thr lie Leu Val Thr lie Lys Leu 965 970 975 Met Glu Tyr Cys Leu Lys Lys Leu Arg Glu Glu Ser Gly Ala Pro Glu 980 985 990 Gly Ser Phe Asp Ser Pro Ser Ser Lys Gln Cys lie Ser Thr Phe Ser 995 1000 1005 Glu Asp Glu Met Phe Arg Arg Thr Leu Pro Glu|Ile Val Lys Glu Thr 1010 1015 1020 Asn Ser Arg Tyr Leu Pro Leu Lys Gly Phe Ser Arg Ser Leu Asn Lys 1025 1030 1035 1040 Phe Leu Pro Ser Leu Lys Phe Ala Glu Ser Lys Asn Ser Tyr Arg Ser 1045 1050 1055 Glu Asn Phe Val Ser Asn lie Asp Ser Asn Gly Ala Leu Leu Leu Leu 1060 1065 1070 Asp Val Phe Ile Arg Lys Phe Thr Asn Glu Lys Tyr Asn Leu Thr Gly 1075 1080 1085 Lys Glu Ala Val Pro Tyr Leu Glu Ala Lys Ala Ser Ser Leu Arg Ile 1090 1095 1100 Ala Ser Lys Phe Glu Glu Leu Leu Thr Glu Val Lys Gly Ile Pro Ala 1105 1110 1115 1120 Gly Glu Leu Ile Asn Met Ala Glu Val Ser Ser Asn Ile His Lys Ala 1125 1130 1135 Ile Ala Ser Gly Lys Pro Val Ser Lys Val Leu Cys Ser Tyr Leu Asp 1140 1145 1150 Thr Phe Ser Glu Leu Asn Ser Gin Gln Met Glu Glu Leu Val Asn Thr 1155 1160 1165 Tyr Leu Ser Thr Lys Pro Ser Val Ile Thr Ser Ala Ser Ala Asp Tyr 1170 1175 1180 Gln Lys Leu Pro Asn Leu Leu Thr Ala Thr Cys Leu Glu Pro Glu Arg 1185 1190 1195 1200 Met Ala Gln Leu Ile Asp Val His Gln Lys Met Phe Leu Arg 1205 1210

Claims (78)

1. CLAIMS 1. A polypeptide, such as a toxin, formed by expression of a truncated form of a gene sequence, or an analogue thereof.
2. 2. A polypeptide as claimed in claim 1, in which the polypeptide is a neurotoxin.
3. 3. A polypeptide as claimed in any preceding claim, in which the polypeptide corresponds to a toxic derivative of a substantially non-toxic precursor polypeptide encoded by the gene sequence.
4. 4. A polypeptide as claimed in any preceding claim, in which the polypeptide comprises an amino acid sequence that corresponds to a truncated form of the amino acid sequence of a substantially non-toxic precursor polypeptide.
5. 5. A polypeptide as claimed in claim 4, in which the amino acid sequence of the polypeptide corresponds to the amino acid sequence of the precursor polypeptide with truncation thereof principally at the carboxy (C) end.
6. 6. A polypeptide as claimed in claim 5, in which truncation is by about 150 to 200 amino acids.
7. 7. A polypeptide as claimed in any of claims 4 to 6, in which the polypeptide amino acid sequence in addition corresponds to the precursor polypeptide amino acid sequence truncated at the amino end (N).
8. 8. A polypeptide as claimed in claim 7, in which the truncation is by less than 50 amino acids, and desirably by 7 or 28 amino acids.
9. 9. A polypeptide as claimed in any preceding claim, in which the amino acid sequence of the polypeptide is homologous to the amino acid sequence of the insect specific neurotoxin ; -Latroinsectotoxin (d-LIT) or an active derivative thereof.
10. 10. A polypeptide as claimed in any preceding claim, in which the polypeptide comprises an amino acid sequence as shown in SEPIDNO1 and SEQIDN02 or an active derivative thereof.
11. 11. A polypeptide as claimed in any preceding claim, in which the toxin is expressed from a nucleotide construct or truncated form of a gene sequence comprising a sequence as shown in SEQIDNO1, or active variants thereof.
12. 12. A polypeptide as claimed in any preceding claim, in which the polypeptide is expressed from a sequence substantially as provided in a microorganism deposited at The National Collections of Industrial and Marine Bacteria Limited, under Accession No. NCIMB 40632.
13. 13. A protein for use as a toxin comprising an amino acid sequence substantially as shown in SEQIDN01 and SEQIDN02, or an active derivative thereof.
14. 14. A nucleotide sequence comprising a truncated form of a gene sequence or an analogue thereof, for use in the expression of a polypeptide, such as a toxin.
15. 15. A nucleotide sequence as claimed in claim 14, in which the nucleotide sequence corresponds to a gene encoding for a precursor polypeptide and truncated at the 3' end thereof, or an active derivative thereof.
16. 16. A nucleotide sequence as claimed in claim 15, in which the nucleotide sequence corresponds to the gene truncated by about 400 to 650 nucleotide bases, and desirably between 550 to 600 nucleotide bases.
17. 17. A nucleotide sequence as claimed in any of claims 14 to 16, in which the nucleotide sequence corresponds to the gene truncated at the 5' thereof.
18. 18. A nucleotide sequence as claimed in claim 17, in which the truncation is by less than 100 nucleotide bases, and desirably by either 84 or 21 nucleotide bases.
19. 19. A nucleotide sequence as claimed in any of claims 14 to 18, in which the nucleotide sequence corresponds to part of a gene encoding for a neurotoxin in the venom of the Black Widow Spider (Latrodectus mactans Tredecimguttatus) , or an active derivative thereof.
20. 20. A nucleotide sequence as claimed in claim 19, in which the nucleotide sequence corresponds to part of the gene encoding the precursor polypeptide of insect specific toxin S-Lactoinsectotoxin ( d -LIT) , or an active derivative thereof.
21. 21. A nucleotide sequence as claimed in any of claims 14 to 20, in which the nucleotide sequence codes for a polypeptide comprising a sequence of 991 amino acids.
22. 22. A nucleotide sequence as claimed in any of claims 14 to 21, in which the nucleotide sequence comprises a base sequence as shown in SEQIDN01, or an active derivative thereof.
23. 23. A nucleotide sequence as claimed in any of claims 14 to 22, in which the nucleotide sequences comprises a base sequence substantially as comprised in a microorganism deposited under Accession No. NCIMB 40632 at The National Collections of Industrial and Marine Bacteria Limited.
24. 24. A nucleotide sequence as claimed in any of claims 14 to 23, in which the nucleotide sequence codes for a polypeptide having an amino acid sequence as shown in SEQIDN01 and SEQIDN02, or an active derivative thereof.
25. 25. A nucleotide sequence as claimed in any of claims 14 to 24, in which the nucleotide sequence is a cDNA derived from mRNA by the use of an enzyme such as reverse transcriptase.
26. 26. A nucleotide sequence as claimed in any of claims 14 to 25, in which the nucleotide sequence is an oligonucleotide DNA construct produced perhaps using the polymerase chain reaction (PCR).
27. 27. A method of producing a polypeptide, the method comprising producing a recombinant DNA molecule comprising a truncated form of a gene, and expressing the truncated form in a host expression system, such as a viral or bacterial expression system, to produce the polypeptide.
28. 28. A method as claimed in claim 27, in which the polypeptide produced is an active toxin substantially as claimed in any preceding claim.
29. 29. A method as claimed in claim 27 or claim 28, in which the truncated form comprises part of a gene which encodes for a non-toxic precursor polypeptide.
30. 30. A method as claimed in any of claims 27 to 29, in which the truncated form comprises a nucleotide sequence substantially as claimed in any of claims 14 to 26.
31. 31. A method as claimed in any of claims 27 to 30, in which the expression system comprises E.coli BL21 (DE3) bacterial cells transformed with pT7-7 vectors comprising the truncated form of the sequence.
32. 32. A method as claimed in any of claims 27 to 31, in which the expression system comprises a baculovirus system.
33. 33. A recombinant DNA molecule comprising a truncated form of a gene encoding for a toxin generally as claimed in any preceding claim.
34. 34. A recombinant DNA molecule as claimed in claim 33, in which the molecule comprises a virus.
35. 35. A recombinant DNA molecule as claimed in claim 34, in which the molecule comprises a baculovirus.
36. 36. A recombinant DNA molecule substantially as provided in the microorganism deposited under Accession No. NCIMB 40632.
37. 37. An expression vector comprising a truncated form of a gene generally as claimed in any of claims 14 to 26.
38. 38. A cell, such as a viral or bacterial cell transformed with a recombinant molecule substantially as claimed in any of claims 33 to 37.
39. 39. An insecticide comprising a toxin substantially as claimed in any of claims 1 to 13.
40. 40. An insecticide as claimed in claim 39, in which the insecticide is so as to be administered orally or topically.
41. 41. An insecticide as claimed in claim 39 or claim 40, in which the insecticide comprises a spray.
42. 42. An insecticide system comprising means for expressing a truncated form of a gene to produce a toxin substantially as claimed in any preceding claim in an insect to kill or incapacitate the insect.
43. 43. An insecticide system as claimed in claim 42, in which the insecticide system comprises a viral expression system.
44. 44. An insecticide system as claimed in claim 43, in which the viral expression system comprises a baculovirus expression system.
45. 45. A plant comprising a genetically modified cell containing a truncated form of a gene sequence substantially as claimed in any of claims 14 to 26.
46. 46. A non-human animal comprising a genetically modified cell containing a truncated form of a gene sequence substantially as claimed in any of claims 14 to 26.
47. 47. A toxin formed by processing of a substantially isolated non-toxic precursor polypeptide.
48. 48. A toxin as claimed in claim 47, in which the toxin is formed by truncation toward the carboxy (C) end of the precursor polypeptide.
49. 49. A toxin as claimed in claim 48, in which the toxin amino acid sequence generally corresponds to the amino acid sequence of the precursor polypeptide, truncated by between 150 and 200 amino acids.
50. 50. A toxin as claimed in any of claims 47 to 49, in which the toxin amino acid sequence is formed by truncation toward the amino (N) end of the precursor polypeptide amino acid sequence.
51. 51. A toxin as claimed in claim 50, in which the fragment cleaved from the amino end is significantly smaller than the fragment cleaved from the carboxy end.
52. 52. A toxin as claimed in claim 50 or claim 51, in which the fragment cleaved off comprises 7 or 28 amino acids.
53. 53. A toxin as claimed in any of claims 47 to 52, in which the toxin has an amino acid sequence corresponding to a polypeptide encoded by part of a gene of the Black Widow Spider (Latrodectus mactans Tredecimguttatus).
54. 54. A toxin as claimed in any of claims 47 to 53, in which the toxin comprises or is an analogue of the insect specific neurotoxin 6-Latroinsectotoxin ( ;-LIT), or an active derivative thereof.
55. 55. A toxin as claimed in any of claims 47 to 54, in which the toxin comprises an amino acid sequence as shown in SEQIDNO1 and SEQIDN02 or an active derivative thereof.
56. 56. A method of producing an active polypeptide from an isolated inactive precursor polypeptide, the method comprising truncating the isolated precursor polypeptide.
57. 57. A method as claimed in claim 56, in which the isolated precursor polypeptide is truncated at the Carboxyl end.
58. 58. A method as claimed in claim 56 or claim 57, in which the truncation is effected using proteolytic cleavage, and preferably by site directed mutagenesis.
59. 59. A method as claimed in any of claims 56 to 58, in which truncation of the N terminus may be provided.
60. 60. A method as claimed in claims 56 to 59, in which the active polypeptide is a toxin and is substantially as claimed in any of claims 1 to 13, 47 to 55.
61. 61. An isolated nucleotide base sequence encoding for a toxin precursor polypeptide with an amino acid sequence as shown in SEQIDNO4 or a derivative thereof.
62. 62. An isolated base sequence comprising a base sequence as shown in SEQIDN03 or a derivative thereof.
63. 63. An isolated base sequence as claimed in any of claims 61 or 62, in which the nucleotide base sequence encodes a precursor polypeptide of the neurotoxin ;-Latroinsectotoxin ( c(-LIT).
64. 64. An isolated base sequence substantially as provided in the microorganism deposited under Accession No. NCIMB 40633.
65. 65. A recombinant DNA molecule comprising a sequence substantially as claimed in any of claims 61 to 64.
66. 66. A recombinant molecule as claimed in claim 65, in which the molecule comprises a virus.
67. 67. A recombinant molecule as claimed in claim 66, in which the virus comprises a baculovirus.
68. 68. A cell, such as a bacterial or viral cell, transformed with a recombinant DNA molecule substantially as claimed in any of claims 65 to 67.
69. 69. An insecticide system comprising means for expressing a base sequence substantially as claimed in any of claims 61 to 64 to produce a precursor polypeptide and to process the precursor polypeptide to produce a toxin in an insect to kill or incapacitate the insect.
70. 70. An insecticide system as claimed in claim 68, in which the system comprises a viral expression system.
71. 71. An insecticide system as claimed in claim 69, in which the viral expression system comprises baculoyirus.
72. 72. A plant comprising a genetically modified cell containing a nucleotide sequence substantially as claimed in any of claims 61 to 64.
73. 73. A non-human animal comprising a genetically modified cell containing a nucleotide sequence substantially as claimed in any of claims 61 to 64.
74. 74. A novel toxin substantially as hereinbefore described with reference to SEQIDNO1 and SEQIDN02.
75. 75. A nucleotide sequence substantially as hereinbefore described with reference to SEQIDNO1.
76. 76. An isolated polypeptide substantially as hereinbefore described with reference to SEQIDN03 and SEQIDN04.
77. 77. An isolated nucleotide sequence substantially as hereinbefore described with reference to SEQIDN03.
78. 78. Any novel subject matter or combination including novel subject matter disclosed, whether or not within the scope of or relating to the same invention as any of the preceding claims.