AU701101B2 - A novel toxin and a method of producing a toxin - Google Patents

Description

A NOVEL TOXIN AND A METHOD OF PRODUCING A TOXIN The present invention relates to novel methods of producing an insect specific neurotoxin, 6-Latroinsectotoxin (6-LIT), to toxin produced thereby and to its use in insecticidal systems.

A family of high molecular weight neurotoxins has been found in the venom of the black widow spider (Latrodectus mactans Tredecimguttatus). Some of these toxins have been identified as being either vertebrate or invertebrate specific.

a-Latrotoxin (a-LT) and a-Latroinsectotoxins (a-LIT) are two such neurotoxins that have been characterised as being vertebrate and invertebrate specific respectively.

The primary structures of these proteins have been determined, but characterisation of the structural features of the cloned toxins has not been possible S due to the inability to achieve functional expression of their genes.

it is an object of the present invention to provide a method of producing the -Latroinsectotoxin usually naturally produced by post-translational modification of S a precursor protein, using recombinant technology.

.o According to a first aspect of the present invention there is provided an active insect specific neurotoxin polypeptide including an amino acid sequence corresponding to that of the active insect specific neurotoxin 6-Latroinsectotoxin (-LIT) present in the venom of the Black Widow Spider (Latrodectus mactans Tredecimguttatus), or an active derivative thereof characterised in that the polypeptide is formed by truncation of isolated precursor polypeptide of 5-Latroinsectotoxin (6-LIT) or an active derivative thereof or by expression of a nucleotide sequence corresponding to that of a truncated form of the gene encoding for the precursor polypeptide of the 6 8-Lafroinsectotoxin or an active variant thereof.

1 -r 2 Preferably the polypeptide includes an amino acid sequence that corresponds to a truncated form of the amino acid sequence of the substantially non-toxic 8-Latroinsectotoxin (5-LIT) precursor polypeptide.

Preferably the amino acid sequence of the polypeptide corresponds to the amino acid sequence of the precursor polypeptide with truncation thereof principally at the carboxy end, and desirably by about 150 to 200 amino acids. The polypeptide amino acid sequence may in addition correspond to the precursor polypeptide amino acid sequence truncated at the amino end preferably by less than amino acids, and desirably by 7 or 28 amino acids.

The amino acid sequence of the polypeptide preferably includes an amino acid sequence as shown in SEQ ID No 1 and SEQ ID No 2 or an active derivative thereof. Preferably the toxin is expressed from a nucleotide construct or truncated S form of the gene sequence including a sequence as shown in SEQ ID No 1, or active variants thereof. Preferably the toxin is expressed from a sequence substantially as provided in a microorganism deposited at The National Collections 9 of Industrial and Marine Bacteria Limited, under Accession No. NCIMB40632.

According to a second aspect of the present invention th6te is provided a polynucleotide including a nucleotide sequence corresponding to a truncated form of a gene sequence encoding for the precursor peptide of 6-Latroinsectotoxin S(6-LIT) present in the venom of the Black Widow Spider (Latrodectus mactans Tredecimguttatus) or an active variant thereof and which encodes for the S expression of a polypeptide as described in the first aspect or an analogue thereof, for use in the expression of a polypeptide, such as a toxin.

Preferably the nucleotide sequence corresponds to a gene encoding for a precursor polypeptide and truncated at the 3' end thereof or an active derivative thereof.

C

Il *-rll~ I 3 Preferably the nucleotide sequence corresponds to the gene truncated by about 400 to 650 nucleotide bases, and desirably between 550 to 600 nucleotide bases.

The nucleotide sequence may also correspond to the gene truncated at the thereof, preferably by less than 100 nucleotide bases, and desirably by either 84 or 21 nucleotide bases.

The nucleotide sequence preferably codes for a polypeptide having a sequence of 991 amino acids.

Preferably the nucleotide sequence includes a base sequence as shown in SEQ ID No 1, or an active derivative thereof, and preferably as included in a microorganism deposited under Accession No. NCIMB 40632 at The National Collections of Industrial and Marine Bacteria Limited.

Preferably the nucleotide sequence codes for a polypeptide having an amino acid S sequence as shown in SEQ ID No 1 and SEQ ID No 2, or an active derivative S thereof.

The nucleotide sequence may be a cDNA derived from mRNA by the use of an enzyme such as reverse transcriptase. The nucleotide sequence may alternatively Sbe an oligonucleotide DNA construct produced perhaps using the polymerase chain reaction (PCR).

According to a third aspect of the present invention there is provided a method of producing a polypeptide as described above, the method including producing a recombinant DNA molecule including a nucleotide sequence that corresponds to a polynucleotide as described above and expressing that in a host expression system, such as a viral or bacterial expression system, to produce the polypeptide.

S~i The polypeptide produced is an active neurotoxin substantially as defined above.

Preferably the truncated form includes part of a gene which encodes for the non-toxic precursor polypeptide.

Preferably the truncated form includes a nucleotide sequence substantially as defined above, and as shown in SEQ ID No 1, or an active derivative thereof.

transformed with pT7-7 vectors including the nucleotide sequence, desirably substantially as deposited under Accession No. NCIMB 40632 at The National Collections of Industrial and Marine Bacteria Limited. The expression system may I be a baculovirus system.

In a fourth aspect of the present invention there is previded a recombinant DNA molecule, such as a virus, and in particular a baculovirus including a truncated form o of a gene encoding for a toxin generally as defined above, and substantially as provided in the microorganism deposited under Accession No. NCIMB 40632.

0 0 A fifth aspect of the present invention provides an expression vector including a truncated form of a gene, the truncated form encoding for a toxin generally as defined above.

S The invention also provides a cell, such as a bacterial cell transformed with a recombinant molecule as defined above.

0: There is also provided an insecticide including a toxin as defined above. The insecticide may be so as to be administered orally or topically. The insecticide may include a spray.

This invention also provides an insecticide system including means for expressing a polynucleotide as described to produce a toxin as described above in an insect to kill or incapacitate the insect. The insecticide system may be a viral expression system, and desirably a baculovirus expression system.

i ;r _1 According to a sixth aspect there is provided a plant including a genetically modified cell containing a polynucleotide substantially as defined above.

Still further according to the present invention there is provided a non-human animal including a genetically modified cell containing a polynucleotide substantially as defined above.

According to a preferred form of the first aspect of present invention there is provided a toxin formed by processing of the substantially isolated non-toxic precursor polypeptide.

The processing preferably includes truncation toward the carboxy end of the precursor polypeptide. Desirably the toxin amino acid sequence generally corresponds to the amino acid sequence of the precursor polypeptide, truncated by between 150 and 200 amino acids. The toxin amino acid sequence may also be formed by truncation toward the amino end of the precursor polypeptide amino o acid sequence, the fragment cleaved therefrom preferably being significantly S smaller than the fragment cleaved from the carboxy end, and may be 7 or 28 amino acids.

0 I Preferably the toxin includes an amino acid sequence as shown in SEQ ID No 1 and SEQ ID NO. 2 or an active derivative thereof.

In a seventh aspect of the present invention there is provided a method of producing the active polypeptide from an inactive precursor polypeptide, the method including truncating the isolated precursor polypeptide.

Preferably the isolated precursor polypeptide is truncated at the Carboxyl end, perhaps using proteolytic cleavage. Truncation of the N terminus may also be provided.

/I rs hL I- I I II y 6 According to another aspect of the present invention there is provided an isolated polynucleotide of base sequence encoding for a toxin precursor polypeptide as defined above and preferably with an amino acid sequence as shown in SEQ ID No 4 or an active derivative thereof. The base sequence preferably includes the sequence shown in SEQ ID No 3 or a derivative thereof. The nucleotide base sequence preferably encodes a precursor polypeptide of the neurotoxin 8-Latroinsectotoxin (8-LIT) substantially as provided in the microorganism deposited under Accession No. NCIMB40633.

In an eighth aspect there is provided a recombinant DNA molecule such as a virus, and more particularly a baculovirus including a sequence as defined in the preceding paragraph.

4I In a ninth aspect the invention provides a cell, such as a bacterial cell, transformed with a recombinant DNA molecule as described in the preceding paragraph.

S This invention also provides an insecticide system including means for expressing S a gene as described above to produce a precursor polypeptide as described above and to process the precursor polypeptide to produce a toxin in an insect to kill or incapacitate the insect. The insecticide system may be a v;ral expression system, Sand desirably a baculovirus expression system.

According to a tenth aspect there is provided a plant including a genetically modified cell containing a polynucleotide as defined above.

0 Still further according to the present invention there is provided a non-human animal including a geneticaiiy modified cell containing a polynucleotide as defined above.

Preferred embodiments of the present invention will now be described by way of example only, with reference to the accompanying sequences, in which:k-- 7 SEQ ID No. 1 shows the nucleotide base sequence and the corresponding amino acid sequence of a truncated form of a gene and a polypeptide encoded thereby, according to one aspect of the present invention; SEQ ID No. 2 shows the polypeptide sequence of SEQ ID No 1; SEQ ID No. 3 shows the nucleotide base sequence and the corresponding amino acid sequence of a gene and a polypeptide encoded thereby, according to another aspect of the present invention; and SEQ ID No. 4 shows the polypeptide sequence of SEQ ID No 3.

Referring to the sequences, a polypeptide such as a toxin as in SEQ ID No2 is formed by expression of a truncated form of a gene sequence (SEQ ID Nol), or an analogue thereof.

A toxin from Black Widow Spider (Latrodectus mactans Tredecimguttatus) venom (BWSV), 8-Latroinsectotoxin, (8-LIT) has been purified and shown to possess insect specific toxicity. The 8-LIT structural gene has been cloned and sequenced and the N- and C-terminii of the native (precursor) and functional protein toxin have been 0 determined as described below. Site directed mutagenesis of 8-LIT cDNA enabled 0 expression of the mature protein product (toxin) in bacteria, and this has been shown to be toxic to locusts.

Expression and production of this and other such toxins in bacterial expression systems has hitherto not been possible. The invention includes identification of the sites for cleavage of the precursor protein to produce the toxin, and the precise site of truncation of the gene sequence which has enabled the toxin to be expressed in bacterial, and indeed other suitable hosts.

r d 8 Microorganism deposits have been made under the Budapest Treaty on 3rd May 1994, at The National Collections of Industrial and Marine Bacteria Limited, of 23 St. Machar Drive, Aberdeen, Scotland, United Kingdom. Escherichia col (XL-1 Blue pT7.dM) cloned with the truncated form of the gene sequence is deposited under Accession No. 40632, and Escherichia coli (HMS 174 pT7.dFL) cloned with substantially the full gene sequence is deposited under Accession No. 40633).

In more detail, the cDNA cloning and sequencing was conducted as follows.

Poly(A+)-RNA was isolated from venom glands of the Black Widow Spider (Latrodectusmactans Tredecimguttatus) and a cDNA library constructed in the plasmidvector pSP65 (according to Kiyatkin et al, 1993). A library of 6 x 104 clones was screened with an end-labelled 23-mer oligonucleotide probe based on the N-terminalsequence of 8-LIT (amino acid residues 1-8)- Hybridization was performed. Positive clones were colony-purified and analysed by restriction mapping.

:00 The inserts were excised and fragmented by sonication as described (Sambrook et al, 1989) followed by cloning into the Smal site of pBluescript II SK+ and SK- S vectors (Stratagene,USA). Single-stranded templates for sequencing were obtained after infection with helper phage VCS (Stratagene). The DNA sequences were determined by the chain-termination method (Sanger et al, 1977) using Sequenase 2.0 version kit (USB Corporation) and T7 and T3 vector-specific o 0 primers (Stratagene). Each sequence was determined at least twice on both strands. Synthetic primers were used to sequence regions that were not covered by isolated subcloned fragments.

DNA and protein sequence analysis was performed using the computer software DNASTAR (Dnastar inc) and PCGENE (Intelli Genetics Inc). This work benefited from the GCG programme mounted on the SERC Daresbury SEQNET facility (Devereux,Haeberli and Smithies, (1984), Nucleic Acids Research 12(1); 387-395).

C

A -1----3s~133 111~1~ 1 er 11 1111 The full-length cDNA construction was carried out as follows. Two sets of oligonucleotide primers were used to produce N- and C- overlapping parts of 8-LIT coding sequences by polymerase chain reaction. To facilitate subcloning into the expression vector the 5' sense primer (P1) (TTGGGATCCGATGAAGAAGATGGAGAA) and 3' antisense primer (P8) (CAATGGTCGACACAGAAGGAATGGTA) contained BamHI and Sail restriction enzyme sites. Two others primers -P9, sense (GTCTGAACCATTTACTGTCC) (position 1283-1302) and P3, antisense (GTAAGATTACCATCTGCAAC) (complementary to position 2253-2272) were chosen to produce overlapping fragments with an internal Ncol (2056) restriction site. An oligonucleotude was designed to terminate the protein sequence after amino acid 991- The polymerase chain reaction was performed using 1 unit of Taq-polymerase (Promega) under standard conditions (30 cycles, 55C for 1 min, 72C for 3 min, 94C for 1 min, with 100 pmol of each primer and 1-10 ng first-strand cDNA). In the first cycle the denaturation time was elongated to 5 min. The molecular mass of the amplified material was co, checked on an agarose gel.

0* 4 First-strand cDNA synthesis was carried out using First-strand cDNA Synthesis Kit (Pharmacia) with both random and specific primers as recommended by the manufacturer. The PCR products were purified from agarose gel using GeneClean Kit (Biol01 Inc.), digested with appropriate pairs of enzymes (BamHI and Ndel for the N-terminus part and Sail/Ndei for the C-terminus) and cloned into the pT7-7 vector restricted with the similar pairs of enzymes. The full-length cDNA was created as a result of three-way ligation between N-terminal BamHI/Ndel-fragment, C-terminal Ndel/Sall-fragment and pT7-7 BamHI/Sall-digested vecr or. The final construct had eight additional amino acid residues at the amino terminal end (MARIRARG). All plasmid constructs were verified by sequencing from both ends and through the junction region. The full length construct was designated pT7d.FL a sample of which is deposited at the NCIMB, Accession No. 40633 and the truncated clone (1-991 amino acids) was designated pT7.dM. (NCIMB No. 40632).

cl~ ~e In order to verify the identity of the 8-LIT cDNA, this clone was expressed in the bacterial pT7-7 vector in E. coli BL21 (DE3) cells. A full-length toxin cDNA (corresponding to Asp residue 29 to 1186) 1214 of SEQ ID No 4 was constructed and designated pT7.dFL. The first 28 amino acids are believed to be present in the precursor polypeptide in spider venom glands, but cleaved during N-terminal processing. The recombinant protein constitutes approximately 10% of the total bacterial lysate protein. A polyclonal antibody specific was raised to 8-LIT purified from spider venom glands, and demonstrated to be specific for the d toxin. This protein specifically detected a protein of 130 kDa in bacteria expressing recombinant full-length 8-LIT. Comparison of the molecular mass of the bacterially expressed full-length 5-LIT and the toxin purified from venom glands demonstrated a size difference of approximately 23 kDa, in agreement with the calculated molecular mass. The full-length 8-LIT had no toxicity towards insects and is considered to be an inactive precursor form of the toxin.

6-LIT purified from venom glands was analysed by mass spectrometry on a Kratos Kompact MALDI 3 Mass Spectrometer, using sinapinic acid as a matrix. The nitrogen laser excitation was at 337 nm, and the positive ion was detected in the linear mode yielding a prominent molecular ion with a m/z+ ratio of 110916.

a 0 This corresponds closely to the expected molecular mass of 8-LIT which is S truncated at amino acid 991. By comparison, the bacterially expressed full length 6-LIT yielded a molecular ion with an m/z+ ratio of 133631 (VK, DRB, PNRU, Data not shown), within 100 Da of the calculated value. Site directed mutagenesis was 0 0 used to create a novel 8-LIT cDNA clone (pT7dM), which was truncated after amino acid 991 of the 5-LIT sequence (SEQ ID No This protein was expressed in bacteria, yielding a protein of similar molecular mass to the mature toxin isolated from spider venom.

4 11 E. coli BL21 (DE3) ceiis transformed with pT7 clones werp grown in LB medium containing 100 mg ampicillin/ml at 30C to an A600nm of approximately 0.5. Then expression was induced by addition of IPTG (1 mM) to the medium, and incubation continued for 1 hour. For functional studies, bacteria were washed and resuspended in 50mM TrisHCI, 100 mM NaCI, 10 mM KCI, 0.4% Triton X-100, 12% sucrose, 5mM DTT, 2 g/ml aprotonin, 2 mM EDTA, pH 8, and sonicated on ice. Ammonium sulphate was added to the cleared supernatant to a final concentration of 20% of saturation, and the pellet was resuspended in buffer without DTT. These samples (5-15 I) were used for thoracic injection into locusts (100-300 mg body weight); each test was performed on more than 4 locusts, and the locusts were examined for toxicity for 24 hours. Extracts from pT7-7 and pT7.dFL produced no effects on the locusts, but extracts from bacteria carrying pT7.dM caused rapid lethality. The time of death of the locusts varied from minutes 4 hours, depending on the potency of the batch of toxin.

Preliminary studies were undertaken on neurally-excited and resting retractor unguis nerve-muscle preparations isolated from metathoracic legs of adult (male S and female) locusts (Usherwood and Machili, 1968). 5-LIT was applied in standard a locust saline (mM:NaCI, 180; KCI, 10; CaCl 2 2; Hepes, 10 (pH A few studies were undertaken using saline in which CaCl 2 was omitted. Mechanical a. responses were recorded using a Grass strain gauge connected to a Grass pen recorder. Recordings of miniature excitatory postsynaptic potentials were made from fibres of metathoracic extensor tibiae muscles of adult locusts (either sex) using intracellular microelectrodes (approximately 10rnO resistance).

a a 5-LIT was applied in either standard locust saline, saline in which CaCI2 was omitted or saline which contained MgCl 2 substituted for NaCI. The miniature potentials were recorded on video tape and analysed on a Mass Comp computer using in-house software. Membrane bilayers were formed at the tips of patch pipettes (diam 1-2m); fabricated from Clark Electromedical glass) from monolayers of either diphytanoyl phosphatidylcholine or a mixture of 9 parts isolectin and 1 part o tholesterol using a pipette dipping technique (Montal and Muller, 198).

12 Similar patch pipettes were used to excise membrane patches from locust metathoracic extensor tibiae muscle fibres (Huddie et al). In order to reduce the activities of endogenous potassium channels KCI was eliminated from the pipette and bath salines.

The neurally-evoked twitch contraction of the locust retractor unguis muscle was reduced by approximately ~40% by 10-11M 8-LIT (applied in standard saline) and was l,lished during application of 10-10M toxin. Small spontaneous contractions sometimes occurred during 8-LIT application. The changes in twitch amplitude wc re accompanied by an irreversible muscle contracture. The appearance of the contracture was delayed and its amplitude was roduced when the concentration of i was lowered. A muscle contracture also occurred when toxin was applied when the muscle was not neurally stimulated. Twitch contractions do not occur in calcium-free saline and when 10-10M toxin was applied to a preparation o equilibrated in this saline a contracture did not occur even after 30 min application of the toxin.

6 When inside-out patches excised from locust muscle fibres were exposed to 10-11M a-LIT in the patch pipette, channel opening, of maximum conductance approximately ~40 pS, were observed. Channel openings of this type were never seen in the absence of toxin. The channel current exhibited inward rectification when the patch pipette and bath contained identical salines (including 2 mM CaCI 2 and channel open times were longer at negative than at positive pipette potentials. When there was a 10-fold Ca 2 gradient across a patch, the reversal potential of the channel current was 15 mV, the sign being dependent on the Ca2+ gradient.

i C, 13 In the artificial bilayer studies where 10-11M 6-LIT was placed in the patch pipettes, single channel openings of approximately -30 pS conductance were observed.

These channels were not seen when toxin was omitted from the patch pipette. With identical salines (containing 2 mM Cl 2 in the patch pipette and bath, the current-voltage characteristic of the a-LITx channel was sigmoidal with a reversal potential at 0 mV. The channel was shown to be Ca-selective by manipulating the ionic regimes of patch pipettes and bath.

A cDNA library from venom gland cDNA was screened with a 23-bp oligonucleotlde probe corresponding to the N-terminal sequence of 6-LIT (as described above). To reduce the number of nucleotide ambiguities the codon usage data available from the nucleotide sequences of a-LT and a-LIT cDNA (Kiyatkin et at, 1990, Kiyatkinetal 1993) was referred to. Five positive cDNA clones were colony-purified and sequenced. The longest clone (pDT-1) contained more than 2 (kb) of 8-LIT coding region. A Pstl-3' fragment was used to rescreen the cDNA libray to search for clones encoding the C-terminal part of the toxin. An additional cDNA clone, pDT-17, was isolated, which covered the C-terminal coding region of the 8-LIT. Two overlapping clones, covering the entire open reading frame, have been sequenced in their entirety. The two clones have been demonstrated to be part of a single, continuous RNA from venom glands by S polymerase chain reaction across the overlapping region, using two distinct sets of primers. The composite clones encode a cDNA with a frame of 3642 bp starting S from the first in-frame Methionine and ending with TAA stop codon (SEQ ID No 3).

S The Met residue is preceded by an in-frame stop codon confirming the full length of the deduced sequence.

97 14 8-LIT was purified to homogeneity from Black Widow Spider venom by three rounds of column chromatography according to (Krasnoperov et al, 1992). 23 amino acid residues of the N-terminal sequence of 8-LIT were sequenced. The pure toxin was digested with trypsin and seven individual peptides were isolated and partially sequenced.

Direct N-terminal sequence determination demonstrates that the mature protein starts from the sequence DEEDGEM..., so residue 1 in SEQ ID No 1 and 2 is the first Asp of this sequence. The deduced polypeptide starting from Asp consists of 1186 amino acid (as shown in SEQ ID No 3+4, Asp residue 29 to residue 1214) residues with a predicted molecular mass of 132671 Daltons and pl of 5.4. It contains all of the peptide sequences determined by amino acid sequencing analysis. There are two in-frame Met residues and -28) upstream of the N-terminus (as shown in SEQ ID No 3) of the mature protein which can serve as translation initiation sites. The nucleotide sequence surrounding the ATG codon for Met correlates better with the classical Kozak consensus (Kozak,1989), but the nucleotide arrangement for Met strongly corresponds to starting points for at least two other known proteins which have been isolated from arachnids: Major house dust mite allergen (AAAATGA) (Yuuki et al, 1991) and Low molecular weight protein co-purified with a-Latrotoxin (AAATGA) (Kiyatkin et al, 1992). In both cases, the deduced sequence preceding the N-terminus of the mature protein does not correspond to classical signal peptide structures. We conclude that post-translational modification of 8-LIT N-terminus is limited to removal of 7 or 28 amino acid residues. The existence of a cluster of positive amino acid residues Arg-X-Lys-Arg which can serve as a potential endopeptidase-cleavage site supports the hypothesis that post-translational processing occurs athe N-terminus.

supports the hypothesis that post-translational processing occurs a the N-terminus.

19: Analysis of the deduced structure of 5-LIT with PEST (Rogers, S. et al, 1986) reveals the presence of an amino acid sequence enriched in P, E, S and T, which has previously been correlated with rapid degradation of intracellular proteins (Gottesman&Maurizi, 1992). This region has the sequence EESGAPEGSFDSPSS, and is situated between residues 956-970. The presence of the PEST-region in the C-terminal part of 6-LIT is consistent with C-terminal processing of this protein.

Computer analysis of 6-LIT predicts three putative transmembrane helixes two of them situating in terminal regions (residues 39-67 and 221-240) and the third one a minimal length (residues 580-595) being in the central region. The second putative transmembrane helix (residues 221-240) belongs to a very conservative region between all spider high molecular weight protein neurotoxins (Kiyatkin et al, 1993).

o Dot-matrix analysis of the predicted 5-LIT amino acid sequence revealed the presence of a repeated motif in the central part of the protein molecule. 460 amino acid residues of the 6-LIT primary structure comprise tandemly arranged imperfect copies of the ankyrin-like repeats (Michaely Bennett, 1992). Whereas a-LT and a-LIT (Kiyatakinetal, 1990, Kiyatkin et al, 1993) have no less than 20 repeats, 6-LIT has been found to have only 13 successive repeated units. Their optimal S alignment is with phasing originally suggested in (Lux et al, 1990). The sequence of 13 amino acids which precede the first repeat can be viewed as a reduced

S

repeated unit according to its good correlation with a consensus sequence. The r majority of 6-LIT repeated units are 33-34 amino acids in length, but two repeats contain 35 (R1) and 36 (R6) residues, respectively.

zt 16 Analysis with the PCOMPARE programme showed the linear correlation between the repeated units of two insect-specific toxins. Strong linear correspondence has been found for 6-LIT repeats R2-R9 in comparison to the analogous repeats in a-LIT (Kiyatkinet al, 1993). The first repeat in 8-LIT does not correspond well to the first one in a-LIT and shows high similarity to R7 from a-LIT. 5-LIT repeat R10 is most similar to R19 from a-LIT: this repeat is unusual in having Ser and Gly residues at position 8 and 31, respectively. The next stretch of similarity is found between R11-R13 of 6-LIT and R10-R12 of a-LIT. We have noted that the R7, R2 and R9 repeats are the most highly conserved between the insectotoxins, suggesting a functional role in insectotoxicity. It has been shown that Erythrocyte Ankyrin repeats are not equivalent in respect of their functional ability to bind different proteins (Davis et al, 1991), and thus toxin repeats are also expected to make different contributions to their function.

Dot-matrix comparison of 8- and a-LIT shows that they share a similar overall 0 organisation, with the strong central diagonal broken once (between 900 and 1130 amino acid residues of 6-LIT) and restored for the last 160 amino acids of both toxins. The displacement of the central diagonal reflects the difference in toxin length; 6-LIT is 190 amino acids shorter than its insect-specific counterpart.

The mature protein can be divided into several structural domains: an N-terminus consisting of about 470 amino acid residues and possessing strong linear homology with a-LI" the central domain of about 430 amino acids almost S completely comprised of tandemly arranged ankyrin-like repeated units and a C-terminal domain of about 160 amino acids.

RA*

cl 17 Alignment of the insectotoxin protein sequences shows that both the N- and C-terminal structural domains demonstrate the presence of high identity regions separated by rather dissimilar sequences, with a high level of identity (44.9% for the N-terminal domain and 37.1% for the C-terminus). The most dramatic changes in primary structure of the two insectotoxins are concentrated in C-terminal parts of the repeat containing domains. A stretch of homology is localized to 13 ankyrin repeat units of 8-LIT. This region is followed by a sequence of about 110 amino acid residues that has no obvious homology either with a-LIT or aLT nor with any other proteins from NBRF-PIR database. Interestingly, this domain, which is absent from 8-LIT, forms a specific region in the primary structure of a-LIT that has an unusual clustering of Cys-residues and possesses homology with mammalian-specific aLT (Kiyatkin et al, 1993). So striking structural difference between the two insect-specific neurotoxins suggests that the C-terminal part of the ankyrin-like repeated domain plays a particular role in providing a structural basis for their different functional properties.

The high molecular weight protein toxins from the venom of the Black Widow Spider are a potent and specific class of toxins. These toxins offer a great potential S for elucidating the function of neural proteins, and for providing insect specific toxins. However this potential has not previously been realised due to the inability to express these protein toxins with any function. The present invention provides for the cloning of a novel DNA transcript encoding for a novel insect-specific toxin, .,and functional expression of this toxin, and other polypeptides in bacteria.

l S The 6-LIT cDNA was cloned with an oligonucleotide based on the sequence of amino acids 1-23 of the toxin, and its identity confirmed by additional peptide sequences, and immunochemical identity, using an antibody specific for the 8-LIT.

p- -I 18 The deduced primary structure of 6-LIT has considerable similarity to the mammalian specific aLT and the insect-specific a-LIT, suggesting that these toxins are part of a family with similar structure. The three proteins have a central domain which is composed of "ankyrin-like" repeats, with 13 repeats in 5-LIT. The ankyrin family of proteins couple spectrin to a variety of integral membrane proteins (Bennett, 1992), and it is believed that the "ankyrin repeat" domain of the ankyrins is responsible for specific binding to proteins (Davis and Bennett, 1990 J. Biol.

Chem. 265: 10589-10596; Davis et al (1991) J. Biol. Chem 11163-11169).

This structural similarity with the ankyrin family is reflected in t 'iown functional properties of the latrotoxins; aLT is known to bind to a receptor with high affinity (Kd -10-9M). It remains to be determined whether this specific binding to the aLT receptor is mediated via the ankyrin repeat region of the toxin.

Surprisingly, 6-LIT has no greater similarity to the insect-specific a-LIT than co 0 to the mammalian-specific aLT Whereas 6-LIT has only 13 repeats, the aLT and a-LIT have 19 and 20 ankyrin repeats, respectively. The latter 6/7 repeats have no counterpart in the 8-LIT, and may be a structural unit, as the a-toxins both contain 6cysteine residues in this region, with partially conserved spacing.

a However, in view of the differences in target toxicity of the aLT and a-LIT, it is not 0 possible to identify this structural feature with insect-specific toxicity.

6-LIT exhibits a marked disparity between the molecular weight of the toxin, as deduced from the cDNA sequence, and the relative mobility of the pure toxin purified from venom. Whilst the N-terminus of the protein has been identified unambiguously by protein sequencing, the precise position of the C-terminus has been difficult to document. Expression of the full length 8-LIT cDNA in bacteria demonstrated that the calculated molecular mass is accurately reflected in the relative mobility of the protein on SDS-PAGE, and that the natural venom derives predominantly, if not wholly from proteolytic, C-terminal processing.

19 The full-length recombinant protein was purified, but was not toxic to locusts under any conditions. The full-length protein is an inactive precursor of the functional toxin.

The precise site of the C-terminus of B-LIT purified from venom was assessed by MALDI-mass spectrometry, which localised the site of cleavage to amino acid 991 of the protein. The cDNA was mutated to produce a protein of 991 amino acids with a sequence as shown in SEQ ID No 2, and expressed in bacteria. The mature recombinant protein was soluble and was lethal to locusts. Partial purification of the protein suggests that the toxin is highly toxic.

Expression of the mature toxin from using the truncated form of the full gene sequence as described above has considerable advantages. Firstly, the toxin can 0909 be produced relatively easily by functional expression of the truncated form in a oo o bacterial system, thereby obviating the need to purify toxin from venom glands of spiders. This enables industrial production of the toxin and hence commercial exploitation, for example as the major component of an insecticide system.

o 0 Moreover, it presents possible administration systems for the toxin as an insecticide, beside conventional methods such as spraying. For example it may be possible to produce a modified plant cell or plant, such as a crop plant, containing a recombinant molecule incorporating the truncated sequence.

4 S 4e Such a system includes a recombinant baculovirus including the truncated form.

Such viruses are highly infectious i" vivo and resistant to inactivation in host cells, and are capable of high levels of expression of the inserted nucleotide sequence in host insect cells. This is expected to be harmless to the plant and indeed to vertebrates. Upon ingestion of the plant tissue an insect will take in the recombinant molecule and/or toxin, resulting ultimately in the death of the insect.

Since the toxin is insect specific, it is expected to have no detrimental effect to humans or animals upon consumption.

RA This is an example of one use of one embodiment of the invention to express a toxin that is usually produced by post-translational modification of a precursor protein in biological systems, in a bacterial expression system. It is to be appreciated that the truncated form of other genes coding for other proteins could be expressed in this way, and fall within the scope of the present invention.

The invention also provides toxin formed from the expression of a full, isolated gene to produce a precursor polypeptide which is then post-transl atio nally modified. The precursor polypeptide has an amino acid sequence as shown in SEQ ID No 4, and the toxin has a sequence as shown in SEQ ID No 2.

The isolated gene (SEQ ID No 3) (or an analogue) encoding for the precursor polypeptide of the toxin 8LIT can be cloned into a vector for expression of the precursor polypeptide. A baculovirus expression system can be used. The ::precursor polypeptide thus produced can then be truncated at the sites indicated 9 above, to produce an active toxin. This enables the toxin 8LIT or an active 0: derivative thereof, to be produced independently of the Black Widow Spider, and thus on an industrial scale, for use as indicated as an insecticide.

Whilst endeavouring in the foregoing specification to draw attention to those features of the invention believed to be of particular importance it should be understood that the Applicant clairns protection in respect of any patentable feature at or combination of features hereinbefore referred to and/or shown in the drawings whether or not particular emphasis has been placed thereon.

21 SEQUENCE LISTING G-ENERAL l!NFOPMA7-zCN: Ci) PPLCANT: ()NAME:: BR7TSH TECHNOLOGY GROUP LI-MITED ()ST=REETi: 101 NEWT:NCTON CAUSEWAY C7-TY*: LONDON COUNTPY: UNITED KINGDOM POSTAL CODE SE1 6SU (ii) TITLE OF !NVENTI77ON: A NOVEL TOXIN ANO A MEHDOF PRODUCIrNG A TO XI-,N (iii) NUMBER OF SEQUENCES: 4 (iv) COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compa-zible CC) OPERATING SYSTEM: PC-00S/MS-DOQS ()SOF TNARE: Patent., Release Versicn .2 (E) C2) I-NFORMNATI-ON FOR SE- 7I0 NO: '1: C)SECUENCE CXARACTRSTICS: LENGTH: ZS75 base pairs TYPE: nucleic ac-, C)S7RANCEONESS: dcutie TOPOLOGY: unkncwn (ii) MOLECULE T YE: e-zhr nucleic aci:d CA) DEScazTION: /desc "PLAS14Z*0 DNA" t Cvi) ORIGINAL SO U C ORGANISMSN: LA*T=-=ECTUS MACTANSTRDIGFAS Cvii)IMMEIATESOURCE: CLONE: p77.deltaM Cix) FFATURE: NAN1E,'KE'-: C:;S LOCATON:i..2976 Cxi) SECUENCE DESCRIPTION: SEQ 1D NO: 1: *GAT GAA GAA GAT CGA GAATG ACTCTA GAA GAAAGA CAA C;,C A TC 48 *Asp Glu Glu As; Gly Glu Met The- Leu Giu Glu Arg Gin Ala Gin Cys AAA GCA A TA GAG TA;: AGC A.A7 TC.! C~ TTTG ATZ ATC GOCT GAT GTA 9= .Lys Ala lie G iu Tve- Ser ASr. Ser Val Phe C- iy Me-. lie Ala Aso Val 25 .GCT AAC GAC A7T: G QT7:C CCT G7A AtT GO GAA GTA GTT C-:0 ATT 1- Ala Asn Aso i i Ser -le F.-o Val Ie GlC11y Gitu Val Vai Giy lie TA ACT- CCC CZA A77 CC: A70 C7A Aaa CAC AsT AZT AGC GCA G~ G;- Val Tht rAl Ia a i Ala Tle Val See- X:s Tle. h See- Ala Giy Lau C-A A A r_ nT T-T ACZ C-CA 7A GAT7T GAT GAT A7A CO-T G AT GAG2- Aso -7te Ala Sa.- Ala Lau As= CY9 As= As; el Pe: oe As= Gl; 2; Al. AAG GAA ATA TA GAA GAA AGA C7 1ie Ls Glu -I e L au G Iu Giu Ar Phe AA-T GAA Asn Giu so CAT AGA AAG G :le As: Ar; Lys Leli GAC MAG AAC As; Lys As.

ACT T7 G77 Thr Phe Val 115

ACA

T h-.

100 GCT GCT TTG GA.

Ala Ala Leu Gil

GAG

i u 10 G 7C CT AA CTG Vat Sae Lys Le, G7A AT Val SeC Lys 110 Glu Asn Phe Thr Val Giu Lys

ACA

T.-.0 AGG AAT GAA ATG Arg Asn G1u Me- AAG C: a Lys Leu 130 Gt G GM ACT Val Leu Giu Thr GM1 AGC AMA GA Giu Ser Lys lu 140 AMA TCA ATT GTA Lys Se- lie Val AA ATA ^T GAT Lys Ile Asn Aso AAA AA FG 77 Lys Lys Fhe Phe Giu 13 AA C CA CAA Lys Glu Ar; Gln A7 AAA GG -t le Lys Gty Lau SM AT AGG TAT Lys As:: Ty r

GT

Vat I170 C G C CTA A ia. Lys L au Leau GMA CA Giu Gtr Lys Gly lIe AG7 U^C2 Ser Lau SaC 19.5 a 18c G- TC 7, A AAA Gl1y- Sec L Lys

GAA

G i u 183S G--A AGA G C:.

Val Gu Pc: aCT GGA AA Ser Gly As.

190 As; Asn Tyc 7ec Ala -A A.

Ser A, aLauA s C7c -1 A GA AA Leu Lau Asp Lys GC: ATO 210 O AMA GTG 0-77 Pro Lys Val Vai GAT A MT G GO"Ic As: A S. ILys Ala CAG C-C C9a TAT GI. Ala L9u Tyc 4**4 4*t4 *e 4.

4 4 Ala 225 7A TTTAT GGA Leu ?he Tc G i1 CAG ACT TT GcA Gin Tnr Tyr Ala Vat Me Phe Ph1e CTC G M CA CAT Leu Giu Gin hiis II Iyr Sec Tyc 2 .5 CTG GOT AT Leu Ala Asp TAT TAC CMA AMA Tyr Tyr G I Lys CGT GAT Gty As= 253 GAT GTA MAT aal MT CCA GMA Asp Val Asn Phe Asn Ala Glu Phe 250 Asn 255 MAT GT-A CA Aa- Asn Val Ala lie AT i t -t GAT Tia Phe As= 2.70 ATA GAT MAT le Asm A sn GAC AA MA Asp Phe Lys 275 TCA TCA CTA ACA Sec Ser Leu Thr CGA GAT GAC GGA Gly Asp As: GIy L a Le5 285 GTC A "l Val Tie 2S GAG G7TT CTT C Glu Val Le Asn GTG AAA CA -,A Val Lys Ala La- Phe 7ia Lys Asn

GCC

A GAC AGT AA CTA Asp Ser Lys Leu AGA GMA TTA GTA Ar; Glu Lau Val AC t AG A C AAA GCT T Lys Ala GAG AC, Ca -I T AA T CAA A7C AAA AC3 Gir t Le-, Lys ;sin 1ie Lys Trn ACT GA7 a:= sr s= LaeU 220J C ii A7A GA Lau lie As= 225 C C a 44 CAT ATA CC-- Asp I ie Pro CAA TTG COT Gin Leu Pro 355 ACT T7 CAA Th Leu See Gin AAC3 -I CCG AAT Asn Pne Pro Asn GAA

.A-

Glu A s- ACA CCA ATA GGA The Pro lie Gly Asn 350 TGG C-7- CAT GGO Trp Val Asp Gly G7A Val 2 GAA GTT AaG Glu Val Ar TAC GOA Tyr Ala 370 GTA CAG TAT GAA Val Gin Tyr Giu AAG GCGC AT TAT Lys Gly Me- Tyr AA A c T GAA Ly's Phe See- Glu

TGG

Trp 383 TCT GAA CCA TTT Ser Glu Pro Phe GTC CAA GGT AAC Vai Gin Gly Asn TGT CCG ACT A7,; Cys Pro Thr ie 1104 1152 1200 1248 1296 134- GtT CGT Gt GAT Val Arg Val Asp AAA AAG AGA r"AT Lys Lys Arg Asn 410 410S C i ATC 777 ACG Leu tIe Phe Aeg

A.-

Lys Phe 413 AAC TCA GGA Asn Ser Gly Asn Phe Lys 43

AA

Lys 420 CCT CAG -it GOT Pro GIn Phe Ala ACC ATG ACT CAT Thr Met Thr His TCA CAA ACA Se Gin The 430 TTA AAT AT Leu As- lie GAT A, CA, CGT Asp tie 1is Ar; Aso 110 CTA TAC GAT GCA Leu Tyr Asp Ala

GCO

Ala AdT AG Asn Lys 77G AAA GOA CTa Lau Lys Ala. Vi GAA GO T ACA ACT Giu Aia Thr Th -i.G Leu 160 ATT GAA AAG GT Ile Giu Lys Giy

GOA

Ala A4i a GAC ATA GAA GOA Asp ie G Iu Ala 71- GAC AAT GAC Phe Asp Asn Asp GT GOA A7G CAC: See- Ala Me-. rs GO-T A TAT CZA Vi Ala T yr Ar AAT AAC AAAAATA Asn As. Lys ie G- C -ki A AG ti, C 77 A Aia Leu Ar; Phe Leu Lau a-s 490 4g: a.Ve 0 0 ~0 0 *e 0 *u 0* e AA7 CAA TOO Asn Gin Se C7A C AC ATC Leu His 3ie 513 GA ATC GAG Asp Zle G i Let, GA T AAA AAC GGC As: Lys Asn GIy ACT CC-T P he Th.- Pra 510 AAG TTA CTA Lys Lau Leu GOA GCT CAA OCA Ala Ala Giu Ala CAG GOA GGA 7 1- Gin Ala Gly Phe

TT

Val 323 1 44 1 18s 1536 1 3d 1532 1680 1 72e ie Asn 330 CAT GGA GOT GAT His Gly Ala Asp AA7 GCA AAACA Asn Ala Lys Thr See 540 AAG ACA AAT 770G Lys Thr Asn Leu

ACA

The 543 CCA TA CAT CTT Pro Leu .H is Leu ACA CGT AGT OGA Thr Ae- Ser Gly TCA AAA ACT GTA Ser Lys Thr Val A7T -TA CTA GAA Asn Leu Leu Giu C^A AAT ATT AAG Pr As~ tie Lys AAT G.AA AAG GAG Asn Git. Lys Glu CAT CAC Aso As: :1:~5 Gy Ph Thr

COT

Fro sac .G CAT ACT GCA Leu his Thr Aka An See- AC ,yA Niet Ser Thr Tyr A73 GTT GC Me: Val VaL A. a. 7 CTA AA OA CA CA A7T GAT AAA A.A7 GCG CA! 7Z7 AC3 As: A a Le- Asn his P.r Asp ti7e Asp LI/s Asn Ala Gin Ser rhr ;12 r TCA GGA Gsy 610 GTT GCA Val Ala 625 GTT AAC Val Asn AAA ATG Lys Met TCT GTG Ser Val

AA;

Phe Ly 69 A sn Le 705

TO

Val Se Ser As GCT GC Ala Al GGT GC Gly A 7 CT GI Ser A 785 .AAA G Lys 6

CAT

H4s L AA.7 A AS. r AT A I 595 TTG ACT CCT Leu Thr Pro GAATC ii Glu Ser Lei CAT ATG GC His Met Al 64.

CTT AGA TA Leu Arg Ty 660 ACT GAG AA Thr Glu As 675 A A C-AA. G Lys Giu Ac A ACA A7T G u Thr lie V; G ACA G GA C.

r Thr Gly G 7 SATA GAA G n -le G-u G :G ATG CGA a Met Ar; L 755 T .AC ATA la Asp le CC GCA MA A la Ala Lys CA GT GAC ly Ala Asp 7A GCT. GTA .eu Ala Val 820 AA GGA GCA .ys Gly Ala :AT AA GCT his Lys Ala T7C Phe k C-TG u Val 630 7 CCT a Pro

S

T CTC r Leu T AAT n Asn T GCT ;p Ala T GC~ al Al 7 'I c AA AT, in Ilr 25 AA~ AAC *iu Ly .ys 61 lu Al ATA GC Ile G 1 7 te G 805 TCT G Ser G AT T Asn L Ile I 600 CAT TTA His Leu 615 GAA ACT Glu Ser ATT CAT Ile His A\T TV-f ile Ser MAC TGG Asn Trp 680 *GOA AAA Ala Lys 695 CAT GG7 L Asp Gly e Asn -i A ACT GGC s Thr G 1 G CA CA u Pr-: 61 76 T CGA TC a Ar; Se 775 :A AGG AA.

ly Ar- Ly 00 3A CT AA ly Ala L2 GT C3T A; ly Ar- L: TA AAA 6.

eu Lys G 8 7T A~T G e A sn A 8 5 GCA A7T AA Ala ie Ie As 62 AAT GCT 6AT CT Asn Ala AsP Le 625 GCA GCT TC Phe Ala Ala SE 650 ATA A GAT Ai Ile Lys Asp L 665 ACA CCT TA C.

Thr Pro Leu H GM 7G 7,G A C1u Leu Leu L 7 MAT CTT ACC G Asn Leu Thr V 715 ile Lys Gu L 730 GA GGA TAT A y Ciu G'y Ty.- G ATA GOT G7 u lie Ala Val 0 A GOT CAT 7T r Ala Aso Asn A TCT ACA GTA 's Ser Thr Val 795 A ACA GCA G.AC ss Thr Ala Asp 810 kA ATG AAA ACT ys Met Lys Thr a25 AA TAC GAT MAC lu Tyr Asp Asn '0 AT CGAO C ,.-AC s= As:: Lau ASP 605 7 GAA AGT CAA GM n Glu Ser Cin Glu .0 *A AAT ATT CAG GT -j Asn le Gln Aso 643 A ATG GGT AGT ATT ir Met Gly Ser Ile 655 G7 AGT AT AAT ys Val Ser Ile Asn 670 AT T GCT ATA TAT is Phe Ala ile Tyr 685 AA CAA GAT GAC ATA ys Gin Asp Asp Ile 00 77 TTA CAT CTT GCT Il Leu His Leu Aia 720 ,A A AG AGA GGO e u Leu Lys Ar; Giy 725 C TCT CTC CAC ATC ir Ser Leu his le 3 T GAA AAC /ai Leu -ie Gu Asn 765 ACA CCT 7TA CAT Leu Thr Pro Leu His 780 C77 TAc TTA TA GMA Leu Tyr- Leu Leu Glu 800 6T TOT ACT GCC ii Gly Ser Thr Ala Leu 815 677 GAA ACT CTA TTA Val Glu Thr Leu Leu 830 AAT AAA TAT TG CCA Asn Lys Tyr Leu Pr-z 845 ATG C-TA CT 75 T 77 Me: Val Ar; Lau P-e 1872 1920 1968 2016 2064 2112 2160 2208 2256 2304 2352 2400 2448 2496 a* a.

at.., 25S2 c.

A

-GAA AAA GAT CZ: AGr C7Z AAA GAT GAT Gij- AC~ eu Glu Lys AS= Pro Ser LeQ Lys AS= As: Glu T h e70 E7S C A A ,G G CAG au C I r Sefr Ie me-- Le'j ile Val Gln Lys Le LeU Le A7 7 A7A AA7 AA T TAT 07T GAA ACT GAT G~ yr Phe 7-1e Asn Asn Tyr Ata Gtu 7h.- LeU AS ZG .AC C3C TTA GAT GA CAA GGG AAA 77A GAG C G~ .sn Ar; Leu Asp Glu Gin Gly Lys Leu Glu Leu A 920 LAT AA.A GAA GG7 GAT GO-A AAA GAG GCT =T AAG C~ Isin Lys Giu Gly Asp Ala Lys Giu ,'lIa Val Lys P 930 9zz 9 3,rCA A -M AAA C ATG GAA TAC 73C -i7A AAA AAA C rhr 7-1e Lys L.eu Me- Glu Tyr Cys Leu Lys Lys L GGA GC-, C=7 GAA GG7 ACT-, 7Z: GT T C=A T- CT Gly Ala Pro C-1 Gly Ser ?he Az= S er Fr: Ser S 970 A GAG SAT A7G Ser Thr ?he Ser Glu Asp GIQ Me-- Phe Ar; Ar; TNX=0..%A7ZN Fn-R S3 :0 NC: 2 L-F-NCGT: SS2 ainc a=4ds ai-caci*d ()TOPCLGYI.: I aar (4i) MOL=-CUT.Z TYE: :ren 'OUN"= DSSOITI SEC Dr: NO: 2: As, GIL, Gl AS: Gly Giu Me:z Thr Leu Gi!-u Glu 1 Lys At a le Gh Ser Asn Ser Val Phe Gly Alaz Asn As: e G i Ser lie Val Ile Gly '75 A0 Val Thr Ala cIte Ata Tle Val 5 er F I te so Azz le Ala Ser Thr Ala Leu As; Cys Aso As: Q5 z 3 75 ieLys G1u t: Le u Gh G IL Ar g Phe Asn G-u 55 so As= Lys Asn -hr Ala Ala Le'u 0lu Glu Val Ser SPne ~Valn 7hr Val Glu Lys 7hr Arg As l i a eu er

GAA

C-1 u

GAA

A TI ~yr- 925 Ar; Ly s *Lau GAG GG7 Leu Tyr ass Aia Leu lie Leu

GAG

-u U lu C-A 7 .:i Gin CYS Pro5 Glu S C.0

ASGA

Ph e

CAT

Ki S Val Ser 950

AL

25C

B

2725 2222 2380 2S23 9 9**9 9 9.

IS 9 *9 0 9 9, 55 9 9 9 t.~ 99.0 9. 9 0~ 90999 9 9 0 GI u i.e -ys Gin Ala.

I ie Al a Val Va 1 Ser Ala Prhe Asp Ar; Lei~ V? As:- GI U 125 Az:

AS=

Lys Ser Sa Cys Va Leu Ly s r I~rl; i~ I r*p.

4 Lys Le 13 Phe L lie L' Lys G Ser L Ala I 2 Ala

L

225 Leu C Asp Asp Val Aia 305 Gi u Asp Gn Tyr Trp 38S' Val As.1 iu Va PS II; (s C' ly I' eu S 1 le P 10 .eu P ilu G (al ~he 290 As Tr Leu Ala 370 Ser Arg Ser i ly er ro he i n -ys S e Le' Pr Pr Va

V;

Gi Leu Asn; L au Leu 180 Ser Lys Tyr His 250 Se! Va Ly 3 4i .1 Gi u Pr ly A Giu Tr Asp P~ It Pro L: 165 Giy S Ala L Val V Gly T 2 Ser I 24-5 Asn r Ser Leu s Leu Asn 325 u Thr .0 r Pro n Tyr a Phe sp Pro 405 s Pro rr le 50

YS

er eu al 'h r .30 yr Il a Let As; Ty 31C iI Gi Th 39 L'y

GI

ile GI 135 Lys L: Asp A.

Lau L Asn G 2 Asp A 215 Gin T Leu .P Giu Thr 295 Arg r: .ie u Ser e G1y u Ser 375 r Val rs Lys r. Phe lu ys ys Iu 00 S5p 'hr 1 a h e iy 780 Val G1

L

Ly~ As; 36 Ly

A-

A!

Ser L, Phe PI Tyr V 1 Glu V 185 Leu L Asn L Tyr A Asp I Asn 265 Sly Lys Lau ni Val 3A5 Strp s Glt n Sly G Asn1 a SIy 425 Cu Giu 155 Le 140 Ly s Lys Gi L Ser Arg at Ala Lys Leu Lau Glu GIn 70 eu .ys la yr !50 son :3

S.-

Val T In r 330 Asn Val Me' As

A.-

T h Ar; Asp Ala Ala 235 Tyr Val Asp 3 15 Asp Phe Asp Tyr Ail 39~ Le rMe' iu P Lys A 2 Phe C 220 Val I Tyr C Ala Sly 3C0 Ar; Leu Prc Sar 380 L Cys z) Aa Leu Ser 'ro sn 105 I n 4et in Leu Phe Pro Asn Val Lyi Pr; Al~ 44! Al:

I

Ser G 190 Asn i Ala I Phe I Lys 270 lia Lys Le-- As z 350 Giu Phe SThr a Arg s S a.

4r30 L a a GiP a Mez Ily isn Lau Phe Gly Phe Asp Lys Ala 2 e 325 Giu Val Ser IIe Lyi 411

C-'

As; Ly x I Asn Tyr iyr Le 240 Asp Asp Asn As n Leu 320 Asp Asn Ar; Giu Lys 400 Phe s G1 v S Ala -8C an a a a., a. a a a a.

a a ar ao Wa.,.

As.i Phe Lys Asp lie His As= Leu 'Y As 43544 As AI a Lys Asp Lys Giu Ala Ala Val Lys 470 Ap Phe su As:= Al a As n Th Ar i K Val Asn Leu SIe Al a G In His Asn Tyr His Ar; G "Iy aie As; Sao Ala Ala Giy Ala Asn lie G1 u As;~ ASrt Giu Ala Val Lys L eu As.rI -L7e Lys C5 ir Alla Asp Lys Leu Lys Gy C-11 Arg A s Phe Sr Phe Gly Val 525 Ly s Leu Phe Lys Lev Asrt thr Pro Leu His Leu Ala Thr Arg Ser Gly Phe Ser Lys Thr Val :z Asn Li Gly PI Asp A 3cr G E2 Val Lys Ser Phe As r.

705 Val Ser Al a c-I y a tiy Met Ia 4e~ Val Ly: 69( La' Se As Al Al Leu Lau csz Lau F. s La

TT

s Ly r in n I I a ME a A~ aC Giu S( PrG L

CEO

L eu A i nr -chr Ser L Me. a Cu lu r ile C I rt Gly s; I ie er Cu sn As.

Va G 1 72 Ly 550 Pro A-- His "I His F Phe H

E

Val Q 62 0 L e SAsn Ala I Ala 710 u Lys s G iu u A Ia sn hr 15 .Ie te As; AsZ

A.-

77 1ie L Ala V As Se r 650 Lys I C9.r ;S Ser .ys 14 ~al N~ ie Tia Gi u Asrt Ile Gi u 745 I e rai iTO 650 Let ksp Le Alal Lys Ly: 73( Gi Ai Asn C Ser Lys lie Asp As; Lau Leu Thr 715 s Glu y Tyr a Val :Iu 1 .1 62C Lau Ser Lys Lys 700 Val, L et Th: Va; LeP 7 B Lys Tyr Ala 605 Giu Asn Val Leu Ser Le 7= Giu A

S

Met V Ie Gly( S er As p Lys Leu i lie sps 757 'al er

IC

s: ce Lau Gl= Le~ Ar g 7 3 Lt ,,r

CEO

Asp Val T1hr c-Iu Asn As3 -ite 720 lie s~ 1 t

CA,,

Cu *4 C

C

*u C I. A *r A A! a s; A~sn Lys

S

Lev Le Aa A I a Lys As;: Val E Z C lie Gly Ar; lie GIy Ala 5r Gly Lv Ly s Lvs

C-.

C,

Lys Val As As;: Thr..

Lev TVr Lev C-IV c~c Val Giu lIh i i-:l n 28 Asn Lys Gly Ala Asn Leu Lys Glu Tyr Asp Asn ASn Lys Tyr Lau Pr2 835 840 845 Ile His Lys Ala lie lie Asrn Asp Asp Lau Asp Met Val Ar; Leu Ph.e 850 833 860 Leu Glu Lys Asp Pr: 5cr Leu Lys Aso Asp Glu Tr Giu Glu Gly Ar; 8635 E70 875 82c Thr Ser lie Met Le'u ile Val Gin Lys Lau Leu Leu C-1 Lau Tyr As~ Bas ES0 ass Tyr Phe Ile Asn Asn Tyr Ala Glu Thr Lau Asp Giu Giu AlIa Lau Phe So0 vas 9ic Asn Ar; Lau Asp Glu Gin Gly Lys Leu Glu Lau Ala Tyr Ile Phe His 915 920 925 Asn Lys Glu Gly Asp Ala Lys Glu Ala Val Lys P.-o Thr Ile Lau Vat 930 935 9-10 Thr Ile Lys Lau M ez Giu Tyr Cys Lau* Lys Lys Leu Ar;g G Iu GlIu Ser 94s 950 953 960 Gly Ala Pr Glu CG1ly Ser Phe ASP Ser Pro Ser Ser Lys G Cys Zia 963 970 975 Ser Thr Phe Ser GlIu AS= Giu Met Phe Ar; Ar; Th r L -a Ctu 980 981590 :_NFNiPAT:CN FOR _70 NC: 2: Ci) 38:_U=8NC= CxAR.A78?.ISTIC=: CA) LENGTH.: 370S base Pai rs (8)TYS:nucleic acid C)STRAN0EONE-51: daublIe TOPOLOGY: circular (ii) MOLECUJLE TYPE: c-cher nucleic acid OESzCRZFTZCN: /desc "PLASM,_0 DNA" (vi CRP.!'NAL SOURCE: ORGANZ SM: LATROCCTUS MAC7ANS TRE0-)_=0MGUTT7-ATL1S 9 (vii) ZMMEOIAT= SOURCE: 3) CLON: piT.delta=L (i x) FEATURE: A) NAME_/KEzY: COS LCCATION:.5. .3686 (x)SVCUZNCT DzC_=,IN SEC0 '0 NC: 2: GGc* GA AACTTT jATCA T AGZ3ATTCAC_ T7,T C tATAT AaAAT AA *Met Xis Ser Lys *GAA TTA CAA ACT AT TCA CA GcZ G TA C-CA CGA AAA GCA G7A CCC AAT Gl% Lau C-.n Thr !1 e Ser A" a A! a Val A!la Arg Lys Ala Vat Pro Asn A .T A C- GTT A77 C33t TT* AA AG. GAT G-AA GAA C-AT GGA GAA ATG ACT Thr me-- Vai le Ar; Lau Lys Ar; AS= Glu GtU AS s; G GC1,L MC a t T- I 4 29 1015 1020 1025 CTA GAA GAA AGA CAA GCA CA TGO AA GCA ATA GAG TAC AGO AAT TCA 200 Leu Glu Glu Ar; Gin Ala Gin Cys Lys Ala lie Glu Tyr Ser Asn Ser 1030 1035 100 GTT 77T GGG AG ATO GOT GAT GTA GOT AAC GAC AT GGT TCC ATT OCT 248 Val Phe Gly Met ile Ala ASo Val Ala Asm As lie Gly Ser lie Pro 1045 1050 1055 1050 GTA ATT GGC GAA GTA GT GGC AT GTA ACT GCC CCA ATT GOC ATC GTA 295 Val ile Gly Giu Val Val Gly le Val Thr Ala Pro I.1 Ala Ile Val 1065 1070 1075 AGT CAC A-i ACT AGC GCA GGC TtG GAT ATA GOT TOT ACG GCA TA GAT Ser His lie Thr Ser Ala Gly Leu Asp Ile Ala Ser Thr Ala Leu Asp 1080 1085 1090 TGT GAT GAT ATA OCT T77 GAT GAG AT AAG GAA ATA TA GAA GAA AGA 392 Cys Asp Asp lie Pro Phe Asp Glu Ile Lys Giu lie Leu Glu Giu Arg 1095 1100 1105 TTC MT GAA ATA GAT AGA MAG GAC AAG AAC ACA GCT GOT -ii GM 440 Phe Asn Glu Lie Asp Ar; Lys Leu Asp Lys Asn Thr Ala Ala Leu Glu 1110 1115 1120 C, GAG GTC TOT MA CTG GTA AGT AM ACT T77 GTT ACG GTGGAAAACA Glu Val Ser Lys Leu Val Ser Lys Thr Phe Val T hr Val Glu Lys Thr 1125 1130 1135 1140 AGG MAT M ATG AAC GMA MT7 7-i Mt OTT GT 7 77 GM ACT ATA GM Ar; Asn lu Met Asn Giu Asn Phe Lys Leu Val Leu Glu Thr ie Glu 115 150 AGO MA GM ATA A TCA A77 GTA 7TT MA AT A T GAT it A A A G 58 Sen Lys Giu Lie Lys Ser 7ie Val Phe Lys le Asn Asp Phe Lys Lys 1160 115 1170 77T GM AMA GAA CGA CAA AGA A-i AM GG -sG CC7 AM GAT AGG 532 Phe Phe Glu Lys Glt Ar; Gi. Ar; -ie Lys Giy Leu Pro Lys Asp Ar; 1175 1180 115 TAT G-7 GOT AAG CTT CTA GAA CAA AAA GT ATT, T-A GGT TOT TTA AA 680 :T Tyr Val Ala Lys Leu Lau Glu Gin Lys Giy 1ie Leu Gly Sen Lau Lys 1190 1195 1200 :o GAA GTA AGA GM CCA TOT GGA AAO AGT CTG AGO TCC GOG TTA MT GM 72B Glu Val Ar; -1u Pro Ser Gly Asn Ser Leu Ser Sen Ala Leu Asn 0lu *1205 1210 1215 1220 00C -MA G-AO A MAC AAC AAC TAT G-CC ATC CA AMA GTG GTT GAT GAT 776 Leu Leu Asp Lys Asn Asn Asn Tyr Ala lie Pro Lys Val Val Aso Asp 1225 1230 1235 AAG GOC tit CAG GC3 CTG TT GT TA 77 TAT GGA ACT CAG ACT r2: Asn Lys Ala Phe Gin Ala Lau Tyr Ala Leu Phe Tyr Gly Thr Gin Thr *.12-10 1245 1250 TAT GOAGCG-TT T TT A 00 GAA CAA CAT TC TAT GG GOT 872 Tyr Ala Ala Val Met Phe Phe Leu Leu Giu Gin His Ser Tyr Lau Ala 1255 25 0 1255 GATT TAT C C. FAAAAA GG;TGAT GAT GTAAAT .T TGA GA TTT Tyr Tyr Tvr Gin Lys Gi As: AsO Val Asn Pne Asn Ala Glu Phe 1270 .275

/I

rt AAT AAT Asn Asn 1285 GTA GCA A i A TT Val Ala lie Ile Phe 1290 GAT GAC TT a TCA Asp ASP Phe Lys Ser 1295 SCA CTA ACA GGA Ser Leu Thr Giy 1300 CTT I;,C ACC GG Leu Asn Thr Val 1315 GGA GAT GAC GGA Gly Asp Asp Gly TTA ATA Lau Ile 1305 GAT AAT GTC AsP Asn Val ATT GAG Gt ie Glu Val 1310 AAA GCA TTA Lys Ala Leu CCA TTT Pro Phe 1320 ATA AAG AAC Ile Lys Asn GCC GAC Ala AsP 1325 ACT AAA CTA Ser Lys Leu TAC AGA GAA Tyr Arg Glu 1330 TTA GTA ACT AGA ACA AAA GCT T7A GAG ACT CTT AAA AAT CAA ATC AAA Leu Val Thr Arg Thr Lys Ala Leu Giu Thr Leu Lys Asn Gln lle Lys 1335 13-10 1345 ACG ACT GAT Thr Thr Asp 1350' TTG CCT CTT Leu Pro Leu ATA *GAT Ile Asp 1355 CAT ATA CCC Asp lie Pro GAA ACT Giu Tht- 1360 TTG TCT CAA Leu Ser Gin GTG AAC Val. Asn 1365 -iiiCCG AAT Phe Pro Asn GAC GAA Aso C1u 1370 MAT CAA TTG Asn Gin Lei' CCT ACA Pro Thr 1375 CCA ATA GGA Pro lie Gly

AAT

Asn 1380 TGG G-i GAT GGC Trp Val Asp Gly GTA G AA Val Giu 1385 G AGG TAC Val Ar; Tyr GCA G7A Ala Val 1290 CAG TAT GM AGT MAG Gin Tyr GIL Ser Lys 1395 C C-A T7, ACT GTC CM Pro Phe Thr Val Gin 1-1C GGC ATG TAT Gly Met Tyr TCG AAA Ser Lys 1400 71C AGT CA,% Phe Ser GIu 72G TCT GAA Tr-p Set G Iu 1105 GGT AAC GCT g',G Gly Asn Ala Cys 1415 M.T AGA CtT ATC Asn Ar; Leu 7ie 1430 CCG ACT A7A Pro Thr 1Ie MA Gt CCT G-T CAT CC3 AAA"G A GA Lys Vat Ar; Val Asp Pro Lys Lys Ar; 1420 1425 1016 "I064 1112 1 1208 1256 1.304 1352 1400 1496 1544 1592 1688 1725 AAG t, AAC Phe Ar; Lys Phe Asn 1435 TCA C-O AAA CCT CAG 777 GCT Ser Giy Lys Pro Gin T he Ala 1 440 ft..

ft.

ft. f ft fftf ft.

ft ft ft ft ft ft GO-A ACC Gly Thr 1 45 ATG ACT CAT Met Thr His TCA CMA Ser Gin 1450 ACA AAT 7iii Thr Asn Phe AA GAT A-T Lys Aso Ile 1455 CTA TAC GAT GCA Leu Tyr Asp Ala GCC 77AAA7 Ala Leu Asn 1465 AAT MAG tG AAA GCA Ile ASn Lys Leu Lys Ala 1470 CAT CCT GAT His Arg A s 1 075 GAT GAA Val Asp Giu 1475 AAA T T GAC Lys Phe AsP 1490 GCT ACA ACT Ala Thr Thr tG At Leu Ile 1480 GAA AAG GGT C-lu Lys Giy GCA GAC Aia Asp 1455 ATA GM GCA le Giu Ala ft.

f8 ft ft ft f ft ft.

ft ft ft oft fta 4 ft ft t ft.

fttffltf ft ft* ftfftfftf ft f MT GAC AGA AGT GCA Asn Asp Arg Ser Ala 1495 ATG CAC GCA GTT Met His Ala Val 1500 GCA TAT CSA Ala Tyr Arg GGA MT AAC A Gly Asn Asn Lys 1505 ATA GOC TTA lie Ala Leu 1510 AGA llT CTT Ar; Phe Leu 7G AAA AAT Leu Lys Asn 1515 CAA TCC A T, GAC AT GAG TTA Gin Ser 1 ie AsP 1le Giu Le 1520 AAA GAT AAA AAC GC-C Lys Asp Lys Asn Gly 1525 IT 7 A1 CC7 Phe Thr Pro 1530 CTA CAC ATC C-CA Lau His Ile Ala 5255 GCT GAA GOA Ala Gi- Ala GG7 1-iy 1540 CAG GCA GGA G AAG TA CTA ATA AAT CA7 C-GA CC-GAT G7T AA-.

Glin Ala Giy Phe Vat Lys Lau Let: lie AS.- his Gly A'a As= Val Asn 31 1550 GCA AAA ACA ACT ~A ACA AA7T GC ACA CCA 7A CAT c CCA C A! a Lys 7hr Ser Lys Thr Asn Leu 7" r Pr-o Lau His Let la Tt At; 1550 I 1'50 1570 AC-T C-CA 777 TA AAA AZ7 C-TA AG-A AA7 tiA Z.TA CAA AZC CcA :MA A-TT2 Ser C-1 y Phe Ser Lys T*t- Val Ar-; Asn Le, Le e-i Ser P-c ASn e 1575 11S1 AAG G-,AAA 7GAAG GAG C-AT C-AC C-A ACA 1C CAT ACT CCA Bea0 Lys Val As.n C-u Lys C-lu Asp Asp C-i>Y Phe Thr P ro Leu H Ts I.r Al a 1550 1555 1500 GTA ATG AT AZT TAT' AT- C- C-TC C-AT CC-7 TG CTA MT CAT CzA GAC 122 Val Me-. Ser Thr Tyr Mez Val Val Asp Ala Leu Leu As. His ot- Asp 160oS 1510 1515 120 AT7 C-A AAA AAC-CC- CA 7 AC3 7 CA C-C- T- ACT COT TTC CAT 1975 lie Asp Lys Asn Ala Gin Ser ht Set Gly Leu Tht- Pro Phe Fis Leu 1525 15:20 i E2 Gc-AA A AT ST G Ac-, CAA GAA G-1 Gc-A GAA 707 cTT1A C-T-I7 GAA AC-T Ala lie 2ie As- G!lu Ser C-1. C-lu Val Ala C-u S e- Leu Val G-lu Set- 1545 iss eAT GCT G-A7 C7,;A MT A T CAG C-AT AAC M CAT ArC- C-T CT ATT CAT 2072 Asn Ala As Leu Ass-. lie C-1in As; Val Asn tis ie-z Ala lie His 6360 155 GL C-A GC TZA ATC- G-7T TA -AA T C7: Phe A",a Aa Ser Me- Gly Se- lie LyS Me Leu TY.- La.u 1ie Ser ATA AA.~A c-AT, AAA Aa-t AT AAT 7-T 7CG ACT S-AG AA7 AAT MOT-- 2152 tie Lys' As; Lys Val Ser lie As. Se Vai ir C AZs. As ACA COT TA CAT Tl, GC-T ATA TAT 1MA CA-A GAT GC7 C-CA AA 2215 th.- P.-c Leu F:s Phe Ala lie

T

yr Phe Lys Lys Vu As; Al a Asz. Lys 171 C 71 G. V, "ACA C-T C-AC ATA A ACA ATT 1c-T C-CA; -AT GS 25 Clu Leu LeU Lys C-in As; Asp -ie Asn Le ie VaI Ala As; G-I y C 72C 1725 i73C C77 AC C G CTiCiG C-T 7CC ACA GA CA AT A AA7 AA.i As.% Levi:hr Val Leu His Leu Ala Val Set Thr Giy Gin lie Asn lie 172.5 1740 1745 A T, Am GA_ -TA 7- C- AC-A C--C 7CC AT TA G GA A ACT CCA 2250 7Lie Lys Cl u Leu Leu Lys ArS Gly Ser Asn lie Gthu C-lu Lys Tn:- Giy 1750 1755 1750 GA-A C-A TAT AcA TCT CC CAC AT: CCT G A7TC CCA AAG -AC CZA cGAG 2..S G it Cv Tht- Se Lev His Lie Ala Aia Me- Lys C-l P- CvGu 1770 17 A7A CCT GT CT TTC A C-AA C CT aC- C-AC ATA C-AA CC, CZA jZA 24== Ile Aa Val Val Leu lie C- Asm G ly Aa As= :ie C-Iu Ala S-er C-C C- CAT- AMA7 A ACA CCO CAT T7 cCC= C-A AAA A7A C-A AcCG AAA.

Aia As; Asn Leu TL-.t Pro Leu xis Ser ta Al. t2. Ls e Cly At-; Lyz C I

~A

TCT ACA GTA CTT TAC TTA TTA GAA AAA GA cCT cAGC AT GGA GCT Ser Thr Val Leu Tyr Leu Leu Glu Lys Gly Ala ASP Ile Cly Ala Lys 115 1820 1825 ACA GCA GAC GGT TCT ACT CC TTG CAT 7,A CT -TA TCT GGT CGT AAA Thr Ala Asp Gly 5cr Thr Ala Leu Hi s Leu Ala Val Ser Gly Ar; Lys 1830 1835 1840 ATG AA ACT GTT GAA ACT CTA TTA AAT AAA GGA GCA AAT TA AAA GM 2548 Met Lys Thr Val Clu Thr Leu Leu Asn Lys Gly Ala Asn Leu Lys -lu 1845 1850 1855 1860 TAC GAT MC AAT AA TAT T7G CCA ATA CAT AAA CCT ATt AT AAT C-nT 2596 Tyr Asp Asn Asn Lys Tyr Leu Pro Ile His Lys Ala ie Ile Asn Asp 1865 1870 1875 c-AC CT GAC ATG GTA CGT TG TTT CT GAA AAA GAT CCO ACT CTC AAA 27-h Asp Leu Asp Met Val Arg, Leu Phe Leu clu Lys Asp Pro Ser Leu Lys 1880 1885 1890 GAT G-AT GAA ACA GAA GAG G-T AGA ACT TCA AT ATG TTA ATT -TT CAU- 2792 Asp Asp Glu Thr Giu clu ciy Ar; Thr Ser lie Met Leu Ile Val Gin 1895 1900 1905 A TTG C- CTT G TTA TAT AAC TAT =TT ATA MT MT TAT cCT -M 2840 Lys Leu Leu Lau clu Leu Tyr Asn Tyr Phe lie Asn Asn Tyr Ala c-u 1910 1915 1920 ACT -7 GGAT GAA G A CT TTAT 770 MC CCC C-AT GAA C GGG AA 2888 Thr Leu Asp Giu C-lu Ala Leu Phe Asm Ar; Leu Asp Giu Gin Gly Lys 1925 1930 1935 1940 TA GAG CT7 GCA TAT ATC TC CAT MT 7 A GM GT GAT CA AM GA 2936 Leu Glu Leu Ala Tyr I e Phe His Asn Lys C-lu Gly Asp Ala Lys Clu 1945 1950 1955 GCT GTT MAG CCA ACT ATC C77 GtT ACA ATT CT. 'TG GAA TAC 298 Ala Val Lys Pro Thr Ile Leu Val Thr Tie Lys Leu Met clu Tyr Cys 1960 1965 1970 TTA AAA AAA C- CGO GAA GAG TcT cGA c-T CCT G AA GGT AGT TTC c-AT 3032 Leu Lys Lys Leu Ar; clu C-1u Ser Gly Ala Pro c-lu Gly Ser Phe Asp 1975 1980 1985 T 9T'h CCATCTTCAAAG CAATGTATTCTACC TT TCA GA G GAT GAA ATG 3080 Ser Pro Ser Ser Lys Gin Cys Ile Ser Thr Phe Ser clu Asp Glu Met 1990 1995 2000 CGT CGT ACT TTA CCc GMA ATT cTA MAA GAA ACc MC AcC AGA TAT 3,28 Phe Arg Ar; Thr Leu Pro clu te Val Lys Thr Asn Ser Arg Tyr 2005 2010 2015 2020 TTA CCA CTA AAG c-cC 74. TCT CcC Ac- CTA A7i AAG -iii CTC CCT TCT 3175 Leu Pro Leu Lys Gly Phe Ser Ar; Ser Leu Asn.Lys Phe Leu Pro Ser 20.25 2030 2035 CTA AAA it-T GCC GAA ACT AAG AAT Ac- TAC AG-A TCT GMA AT 77 C-TT 322- Leu Lys Phe Ala clu Ser Lys Asn Ser Tyr Ar; Ser clu Asn Phe Val S2040 2045 2050 Ac-C AT A7T GAT 1C: AAC c-GA GC 77A CT TTA CT: CAT cTA T ATC 372 Bar Asn tIe AS;: Ser ASn GlI A l--Ia Leu Lau Leu Le As: Val Phe I 2055 2050 ACGA AAG TT aCT AAT cAG A TAC AA ,G AC C-A AM GAc GC7 c-TA 3320 Ar; Lys Pre T h- As c-lu Lys Tyr Asn Le Thr G; LS CGlu Ala Val RA4/ 9 33 2070 2075 2080 COC TAT CTG GAA CCA G CT TCA TCA TTA CGT ATC cCT TCT AAA 226a Pro Tyr Leu clu Ala Lys Ala Ser- See Leu Ar; Ile Ala See Lys Phe 2055 2090 2095 2100 GAA GM CTT CTA ACT G-TT AA MA CG7 A C=CT C-A GAG CTA A-Ti6 clu clu Leu Leu Th.- clu Val Lys Gly Ile Pro Ala Gly Gh Leu lie 2105 2110 2115 AAT ATG cCC GAA GTG AGT 7CC AAC ATA CAT AAG GCA ArT cCA AGT GT 3464 Asn Met Ala clu Val See See Asn Ile His Lys Ala Ile Ala Ser G Iy 2120 2i25 2130 AAG CC- c-TA TCA kAA GTC TTA TGT TCG TAT TTG c-AT AC-C -i TCT GAA 3512 Lys Pro Val Se Lys Val Leu Cys Ser Tyr Leu Asp The Phe Ser Glu 2135 2140 2145 iA AA TCT CAA CAA ATG GAA GAA-iA G C ACATAC TA TCCACC 3560 Leu Asn Ser Gin Gin Met clu clu Leu Val Asn The Tyr Lu See- The 2150 2155 2160 MA CT TCT cTA AT ACG TCA GCA TOT c-CA cAT TAC CAG AM CTT CCT 3508 Lys Pro See Val lie The Ser Ala See Ala Asp Tyr Gln Lys Leu Pro 2165 2170 2175 2180 AAT ,7G tiA ACT cCA ACT TCTTA GAA CA GA AAAT GOT CAA CT 3656 Asn Leu Leu The Ala The Cys Leu c-lu P-o Glu Ar; Met Ala Gin Leu 2185 2190 2195 ATA cAT GTG CA CA AAG ATG T7A c3T TMMT ACCA 77 C: CT G- 3706 aie Asp Val His Gi Lys Met Phe Lou Ar; 2200 2205 INFORIMATION F-OR SEE I3 NO: 4: SE=OUENCE CHARACT =E-;.ZSTICS: CA) LENcT: 121, aninc acids TYFC: aninc acid TOPOLOGY: linear Cii) MOL E TY?E: ;rotein (xi) SEUENCE DESCRPTLON: SEQ IO NC: L: Me. His Se Lys clu Leu c-in The lie Ser -Ala Ala Val Ala Ar; Lys 1 5 10 Ala Val Pro Asn The Met Val Ile Ar; Leu Lys Ar Asp c-lu c-u Asp 25 1 C y -lu Met Th Leu clu clu Ar; Gin Ala c-in Cys Lys Ala Ile -lu 35 40 **00 Tyr See Asn See Val Phe Gly Met le Ala Asp Val Ala Asn, Asp Iie so ssO o e.o Gly 5cr lie Peo Val Iie GIy c-lu Val Val Gly ile Val Thr Ala Pro 05 70 75 E o a le Val Se:- His lie The Sear Al a Gy Lau As; Ie A? See- 60 95 Thr Ala Leu AsO Cys AsO ASO 1ie Pro ?re ASO CILu le Lys Giu lie 1CO so5 110 I- 1

A:

Leu Glu Glu 115 Ar; Phe Asn Glu Ile AsP Ar; Lys Leu Aso Lys Asn Thr 120 17 C Ala Val 145 Glu Asp Pro Ala 130 Glu Thr Phe Lys Leu Lys Ile Lys Asp 195 Gl u T Glu Lys 180 Arg Glu Ar; Ser 165 Phe Ty- Val Asn 150 Lys Phe Val Sen 135 -lu Glu Glu Ala 1 a ao a Oa Gly S 2 Ala L 225 Val V Gly T Ser T Ser 305 Leu Leu Asn Thr Pro 385 Tyr Phe ro er Leu Lys Glu Val 10 eu al 'hr yr l1 a Leu Asn Tyr Gir Let 37( 11

G

Ly Asn G Asp A GIn I Leu I 275 Giu trr r; Arg I lie 355 u Ser 0 e Gly u Ser r Va s Lys 42:z lu rs p hr a Vai iu 3-10 Lys Git Asr Ly Ar Leu Asn 245 Tyr Asp Asn- Lys 325 Leu Thr Val T Tr; s GlS C-i g As: 2 Leu A 230 Lys A Al a Tvs- Asrs Asp 310 Al a Val Thr Asn Val 390 Met SAsn t ArG Arg 15 sp .la a ryr V a -I 295 Th, As; Pht 3 7 As; Ty Le Lys L Met I I e Lys Lys 200 Glu Lys Phe Val Tyr 280 Al a Gy Pro Arg 3 Leu 360 e P.0 SGly Ser a Cys I-e eu _YSr -y s Ii u 185 Leu Pro Asn C-n Met 265 Gir Leu Phe Th r 345 Pro Asn Val Lyi Pr Pht Val I Glu Ser 170 Ar; Leu Ser Asn Ala 250 Phe L-yS ie ie 330 Lys Leu Asp C-u Phe 4. C SArc 3er %sn 155 Ile 31n lu Gly Asn 235 Leu Phe Gly Phe Asp 315 Lys Alla Ile Val 395 Ser Lyi Lys 140 Phe Val Ar; Gin Asn 220 Tyr Tyr As As: 300 Asn As; LeL As: Asr 3EC Ar Ly: 5 P~.

Thr Lys Phe Ile Lys 205 Ser Ala Ala Leu Aso 265 Vai Ala Asa 355 I Gin g T yr u Trp S Val a As:.

4 Phe Leu Lys Lys 190 Cll y Leu Ile L1 u 270 Val Ph e Asp Thr 350 Ile Leu Mla See Ar S er Val Val ile 1T Ile Ser Pro Phe 255 in As.- Lys Glu Ser Leu Pro Val C- u Va 1 GIy Thr Leu 160 Asn Leu Leu Sen Lys 240 Tyr .4i S Phe Sen Va1 320 Lys Lys G IL Thr 400 Pro As= Lys Pro Gin ezc Phe Aa G;y Thr Me- -r His Sr Girt T Asn Fne LyS As= Ac His Arg Asp Leu 465 Tyr Asp Ala Ala Leu Asn le An Lys LeU Lys 47O 475 480 Ala Val Asp Glu Ala T Ala I Gly E Asp Ala 545 Ala Leu Ser Leu Asn 625 Pro L eu -ys 'sn 530 Glu Asp Ala Pro His 610 His Phe Val Phe A Asn I 0-lu Ala Val Thr Asn 595 Thr Pro His C-u isp 00 Lys -Lu Gly Asn Ar g 580 Ile Ala A sP Leu Ser 660 185 ~sn lie Lys Gin Al a 565 Ser Lys Val Ile

A

A

hr Thr Leu lie Glu Lys 0 so Arg Ser Ala Met His A 505 ila Leu Ar-; Phe Leu Leu L 520 sp Lys Asn Gly Phe Thr F 535 kla Gly Phe Val Lys Leu 550 ZZ5 Lys Thr Ser Lys Thr Asn I 570 2iy Phe Ser Lys Thr Val J 55 Val Asn G1u Lys Glu Asp 600 Me" Ser T rr Tyr Met Val 615 Asp Lys Asn Ala Gin Ser 630 625 Ile lIe Asn G-lu Ser Gin 650 Ala Asp Leu Asn 11e Gln 665 Ala Ala Ser Met Gly Ser 680 Lys Asp Lys Val Ser lie 695 Pro Lau His Phe Ala Ile 710 715 Leu Leu Lys Gin As Asp 730 Leu Thr Val Leu His Leu 745 Lys Gz iu Leu Leu Lys Ar;g 760 Cly T yr Thr S er Leu HIs 775 Ala Val Val La lie 0-u 7SO 7 95 ly I a .y ro .eu Lau krg ksp Val 520 C-i u Asp lie Asn 700 Tyr Ile Alz

GIN

78C As Ala Val Asn 525 Leu lie Tb r Asn C-y 605 Aso Ser Val Val Lys Ser Phe Asn Val S Ser 765 e Aia 1 Gly kp ,la 510 3Gi His Asn Pro Leu 590 Phe Ala Gly Ala Asn 670 Met Val Lys Leu Ser 750 Asn Ala Al a le -lu 495 Tyr Arg Ser Ile lie Ala His Gly 560 Leu His 575 Leu Giu Thr Pro Leu Lau Leu Thr Clu Ser 655 His Mez Leu Ar; Thr Glu Lys Gu 720 Thr lie 735 Thr Gly lie -lu Me: Arc Asp lie 800 AI a 645 Asn *O a 0 95 a Ala Pro Ile His Phe 675 Tyr Asn 705 Asp Val C-Im Gi u Leu 690 Asn Ala Al a Ile Lys 770 Ile Asn Ala Asp Asn 755 Thr Ser Trp Lys Gly 740 lie C-ly 1i1e Thr Glu 725 Asn lie G i u Lys- C-1 u 7 Pro Glu lile 0-lu Ala Ars Se Ala 805 As: Asn Leu rr Proc S10 Leu His Set Aia Ala Lys r( iv~8.

a~l D yi" ?i i" ;e 1Ie Ile Ser Asn 865 Iie Pro Leu Asn Glu 945 As; M ea Gly Ar; L 8 Gly Ala L Gly Ar I 850 Leu Lys le As.n Ser Leu tIe Val 915 Tyr Ala 930 Gin Gly Ala Lys C -1u Tyr ys 20 .ys -ys ;7iu Asp Lys 900 C- n Gi u Lys Gi L Cy~ 98c Ser T Tr; Met I Tyr Asp 885 Asp Lys Thr Leu Ala 965 s Leu 3 hrr Il a -ys Asp 370 Leu A s p Leu Leu G- u 950 Val Lyl Val Asp Thr 855 Asn Asp G1 u Leu Asp 935 Leu Lys s Lys Leu Gly Val Asn Met Thr Leu 920 Giu Ala Pr La'.

T

8

S

G

C

C

yr Leu Leu Glu Lys G er Thr Ala Leu His L 845 lu Thr Leu Leu Asn L 860 *ys Tyr Lau Pro tIl e 875 al Ar; Leu Phe Leu C 890 aiu Gu Gly Ar; Thr ;as Siu Leu Tyr Asn Tyr 925 Ciu Ala Leu Phe Asn 940 Tyr lie Phe His Asn h;r ie Lau Val T:1r 970 Ar; C-1 Gu Scr Gly 985 Lys i Cys Ie Sar i0os Leu Pro GiUlIIe Val 1020 Gly Phe Ser Arg Ser 1035 lu Ser Lys Asn Ser 1050 Ser Asn Gly Ala Leu 1065 ly Ala A .eu Ala V .ys CIy A is Lys A 'Iu Lys 895 3er Ile h sic Phe lie Arg Leu Lys Gi u Ie Lys Ala r-0 990 Thr Phe Lys G lu Leu Asn Tyr Ar; 1055 Leu Lau 1070 al Ia Ila .sop let ksn ~ly Leu Ser Lys I 04C Leu 0000 0 0 00 *r 00 0r Gly Ser ?6e Asp Ser Prc Ser Ser 99q 1000 Glu Asp Glu Met Phe Ar; Ar; Thr 1010 1015 Asn Ser Ar; Tyr Leu Pro Leu Lys 1025 1030 Phe Leu Pro Ser Leu Lys Phe Ala 1045 Glu Asn Phe Val Ser Asn Ile Asp 1060 Asp Val Phe l1e Arg Lys Phe Thr 1075 108e Lys Giu Ala Val Prc Tyr Leu Giu 1090 1095 Ala Ser Lys Phe Gu C-h Leu Leu iCS 1110 Gly Giu Leu Ile Asn Mez Ala C1u

C

Asn Clu Lys Tyr Asm Leu Thr Giy 1065 Al a Val Lys I i Lys Ala Ser Sar 1100 Giu Val Lys Gly 1115 Ser Ser Asn Ile V11 Leu Cys Ser Leu His S1; Ar; lie Pro Ala Lys Ala I1,25 e la 5er Giy Lys Pro Val Ser *1 1 C Tyr Leu As= 1150 Thr Phe Ser Glu Leu Asn 1 Ser Gn Win% Mea Glu 1160 Giu Leu Val As. Thr 1155 4'> 37 Tyr Leu Ser Thr Lys Pro Ser Val ie Thr Ser Ala Ser Ala Asp Tyr 1170 1175 1180 Gin Lys Leu Pro Asn Leu Leu Thr Ala Thr CyS Leu Glu Pro Glu Arg 1185 1190 1195 1200 Met Ala Gln Leu ile Asp Val His Gln Lys Miet Ph"e Leu Arg 1205 1210

Claims (45)

1. An active insect specific neurotoxin polypeptide including of an amino 1 acid sequence corresponding to that of the active insect specific neurotoxin 8- latroinsectotoxin (8-LIT) present in the venom of the Black Widow Spider (Latrodectus mactans Tredecimguttatus), or an active derivative thereof characterised in that the polypeptide is formed by truncation of isolated precursor polypeptide of 8-latroinsectotoxin (8-LIT) or an active derivative thereof or by expression of a nucleotide sequence corresponding to that of a truncated form of the gene encoding for the precursor polypeptide of the 8- latroinsectotoxin or an active variant thereof.

2. The polypeptide as claimed in claim 1 characterised in that the amino acid sequence of the polypeptide corresponds to the amino acid sequence of the precursor polypeptide with truncation thereof principally at the carboxy (C) end.

3. The polypeptide as claimed in claim 2 in which truncation is by 150 to 200 amino acids.

4. The polypeptide as claimed in any one of claims 1 to 3 in which the ,polypeptide amino acid sequence corresponds to the amino acid sequence of the precursor polypeptide truncated at the amino end. *4 S: 5. The polypeptide as claimed in claim 4 in which the truncation is by less S" that 50 amino acids.

6. The polypeptide as claimed in claim 5 in which the truncation is by 7 or 28 amino acids. I e, 5111 r~e_ ~1 r_ 0\ 39

7. The polypeptide as claimed in any one of claims 1 to 6, in which the polypeptide includes an amino acid sequence as shown in SEQ ID No 1 and SEQ ID No 2 or an active derivative thereof.

8. The polypeptide as claimed in any one of claims I to 7. in which the toxin is expressed from a nucleotide construct or truncated form of a gene sequence including a sequence as shown in SEQ ID No 1, or an active variant thereof.

9. The polypeptide as claimed in any one of claims 1 t3 8, in which the polypeptide is expressed from a sequence encoding for 8-latroinsectotoxin LIT) substantially as provided in the microorganism deposited at The National Collections of Industrial and Marine Bacteria Limited, under Accession No. NCIMB 40632. A polynucleotide including a nucleotide sequence corresponding to a truncated form of a gene sequence encoding for the precursor peptide of the insect specific neurotoxin 8-latroinsectotoxin (5-LIT) present in the venom of the Black Widow Spider (Latrodectus mactans Tredecimguttatus) or an active derivative thereof and which encodes for expression of a polypeptide as Sclaimed in any one of claims 1 to 9. 1. The polynucleotide as -'imed in claim 10 in which the nucleotide sequence corresponds to the 6-LIT precursor polypeptide sequence truncated at the 3' end thereof.

12. The polynucleotide as claimed in claim 11 in which the nucleotide sequence corresponds to the gene truncated by 400 to 650 nucleotide bases.

13. The polynucleotide as claimed in claim 12 in which the nucleotide sequence corresponds to the gene truncated by between 550 to 600 nucleotide bases. I~ L~

14. The polynucleotide as claimed in any one of claims 10 to 13 in which the nucleotide sequence corresponds to the gene truncated at the 5' thereof. The polynucleotide as claimed in claim 14 in which the truncation is by less than 100 nucleotide bases.

16. The polynucleotide as claimed in claim 15 in which the truncation is by either 84 or 21 nucleotide bases.

17. The polynucleotide as claimed in any one of claims 10 to 16 in which the nucleotide sequence codes for a polypeptide consisting of a sequence of 991 amino acids.

18. The polynucleotide as claimed in any one of claims 10 to 17 in which the nucleotide sequence includes a base sequence as shown in SEQ ID No 1, or an active derivative thereof.

19. The polynucleotide as claimed in any one of claims 10 to 18 in which the nucleotide sequence includes a 8-latroinsectotoxin (6-LIT) encoding nucleotide sequence substantially as included in a microorganism deposited under Accession No. NCIMB 40632 at The National Collections of Industrial and o. Marine Bacteria Limited.

20. The polynucleotide as claimed in any one of claims 10 to 19 in which the nucleotide sequence encodes for a polypeptide having an amino acid Ssequence as shown in SEQ ID No 1 and SEQ ID No 2, or an active derivative thereof.

21. The polynucleotide as claimed in any one of claims 10 to 20 in which the nucleotide sequence is a cDNA derived from mRNA by the use of an enzyme such as reverse transcriptase. r 41

22. The polynucleotide as claimed in any one of claims 10 to 21 characterised in that it is in the form of a recombinant DNA molecule.

23. A recombinant DNA molecule as claimed in claim 22 characterised in that it is an expression vector including a polynucleotide as claimed in any one of claims 10 to 21.

24. A viral or bacterial expression system characterised in that it includes a recombinant DNA molecule as claimed in claim 23. The expression system as claimed in claim 24 characterised in that it is a baculovirus expression system.

26. A cell transformed with a recombinant molecule or expression system substantially as claimed in claims 24 or

27. A method of producing a polypeptide as claimed in any one of claims 1 to 9 including producing a recombinant DNA molecule which includes a nucleotide sequence that corresponds to a polynucleotide as claimed in any one of claims 10 to 23 and expressing that in a host expression system to produce the polypeptide.

28. The method as claimed in claim 27 in which the expression system consists of E. coi BL21 (DE3) bacterial cells transformed with pT7-7 vectors including the polynucleotide sequence. a So.

29. The method as claimed in claim 28 in which the c <ession system is a baculovirus system. PAL\ i I in L L I _L_ 42 A method of producing a polypeptide as claimed in any one of claims 1 to 9 characterised in that it includes truncation of isolated precursor polypeptide of 6-latroinsectotoxin (6-LIT) or an active derivative thereof.

31. The method as claimed in claim 30 characterised in that the isolated precursor polypeptide of 5-latroinsectotoxin (8-LIT) or active derivative thereof is produced by expression of a polynucleotide including a sequence corresponding to SEQ ID No 3 or an active variant thereof.

32. The method as claimed in claim 31 in which the toxin is formed by truncation toward the carboxy end of the precursor polypeptide.

33. The method as claimed in claim 31 or 32 in which the toxin amino acid sequence generally corresponds to the amino acid sequence of the precursor polypeptide, truncated by between 150 and 200 amino acids.

34. The method as claimed in claim 31 or 32 in which the toxin amino acid sequence is formed by truncation toward the amino end of the precursor "polypeptide amino acid sequence. S.

35. The method as claimed in claim 34 in which the fragment cleaved off consists of 7 or 28 amino acids.

36. An isolated polypeptide including an amino acid sequence of SEQ ID No or 4 which is truncatable to produce an active toxin polypeptide as claimed in any one of claims 1 to 9. a

37. An insecticide including a toxin substantially as claimed in any one of claims 1 to 9.

38. The insecticide as claimed in claim 37 characterised in that it is adapted ,a such as to be suitable to be administered orally or topically. a I-- 43

39. The insecticide as claimed in claim 37 or 38 characterised in that it is adapted to be administered as a spray. The insecticide system including means for expressing a polynucleotide as claimed in any one of claims 10 to 21 such as to kill or incapacitate the insect.

41. The insecticide system as claimed in claim 40 characterised in that it includes a viral expression system.

42. The insecticide system as claimed in claim 41 in which the viral expression system is a baculovirus expression system.

43. An isolated polynucleotide encoding for a toxin precursor polypeptide which includes an amino acid sequence as shown in SEQ ID No 4 or an analogue or derivative thereof.

44. An isolated polynucleotide including a base sequence as shown in SEQ ID No 3 or a derivative thereof. 0 45. An isolated polynucleotide having sequence substantially corresponding *0 to the precursor polypeptide of 5-latroinsectotoxin (6-LIT) encoding sequence as provided in the microorganism deposited under Accession No. NCIMB 40633.

46. A recombinant DNA molecule including a sequence substantially as a claimed in any one of claims 43 to o

47. A virus or bacterial cell including a molecule as claimed in claim 46.

48. A virus as claimed in claim 47 being a baculovirus. I- L I- r .~58 44

49. A cell transformed with a recombinant molecule or virus as claimed in any one of claims 46 to 48. An insecticide system including means for expressing a base sequence substantially as claimed in any one of claims 43 to 46 to produce a precursor polypeptide and to process the precursor polypeptide to produce a toxin in an insect to kill or incapacitate the insect.

51. The insecticide system as claimed in claim 50 in which the system includes a viral expression system.

52. The insecticide system as claimed in claim 51 in which the viral expression system is baculovirus.

53. A plant or non-human animal including a genetically modified cell containing a polynucleotide or recombinant DNA molecule as claimed in any one of claims 10 to 23.

54. A plant or non-human animal including a genetically modified cell containing a polynucleotide sequence of DNA molecule substantially as claimed in any one of claims 43 to 46. DATED this 19th day of October 1998 BRITISH TECHNOLOGY GROUP LIMITED 0P** 00 0440 *r p 0 a op 0 O 0 0c 9 0 WATERMARK PATENT TRADEMARK ATTORNEYS 290 BURWOOD ROAD HAWTHORN VICTORIA 3122 AUSTRALIA VAX DOC023 AU2264495.WPC LCG/JGC/RES -ti i~ i Bill ii