GB2216530A - Genetic material for expression of biotin synthetase enzymes - Google Patents

Abstract

Plasmids are provided which are capable of replication and expression in an organism other than E. coli and containing one or more genes derived from an E.coli bioA, bioB, bioC, bioD or bioF gene. Plasmids are also provided containing one or more of these derived genes in a form enabling their manipulation. Methods of preparing these plasmids are also described.

Description

GENETIC MATERIAL FOR EXPRESSION OF BIOTIN SYNTHETASE ENZYMES.

This invention relates to the use of recombinant genetic material (ie DNA sequences) for the expression of enzymes of the biotin synthetic pathway from micro-organisms, in particular from micro-organisms such as Escherichia coli. The invention also relates to micro-organisms which have been genetically transformed by introduction into them of such genetic material.

Biotin, (also known as vitamin H) has the structure (1):

It is probably an essential component of all living cells.

Consequently it isa useful component of nutrients, especially of nutrients for those organisms which suffer from a deficiency of biotin, or which are unable to synthesise biotin effectively from their foodstuffs, for example certain yeasts and all mammals.

Biotin may be produced via synthetic organic chemistry but this is difficult and expensive. It is desirable to produce biotin biosynthetically from micro-organisms which are able to synthesise it from cheap starting materials such as glucose etc. In recent years the new technology of genetic engineering has become available whereby the genes of convenient micro-organisms may be modified by the introduction of genetic material which causes them to express a desired biosynthetic product which may then be harvested from a culture of the micro-organism.

Such genetic material is generally introduced into the microorganism in the form of a plasmid, ie a circular length of extrachromosomal DNA that is capable of autonomously replicating itself within the organism as the organism reproduces itself by cell division.

Alternatively the genetic material may be integrated into the chromosome by recombination.

The prokaryotic micro-organism Escherichia coli is able to synthesise biotin from the simple precursor pimelic acid via the metabolic pathway shown in figure 1. In the course of this pathway five enzymes are involved, one for each biosynthetic step. These five enzymes are each the expression product of a portion of the biotin operon, the portions being described as the genes bioA, bioB, bioF, bioC, and bioD. The identity of the enzymes expressed by these genes is also shown in fig. 1. Herein "biotin synthetase" is used collectively for the expression products of all five genes of the biotin operon, but normally this term is used only for the product of bio3.

The entire biotin operon of E. coli, located between the bacteriophage ss attachment site and uvr-B gene loci at approximately 17 minutes on the E. coli genetic map (Bachmann and Low, 1980) has already been cloned from biotin-transducing N phage (Das Gupta et al., 1978; Cohen et al., 1978). It comprises five closely linked complementation groups corresponding to the genes bioA, bioB, bioF, bioC and bioD which are divergently transcribed from two overlapping promoters (Cleary et al., 1972). This promoter region has been sequenced (Otsuka and Abelson, 1978; Barker et al., 1981). The leftwards transcript contains only the bioA gene whilst the rightwards transcript contains the remaining four genes (Guha et al., 1971) with bioB as the first translational product of the rightward transcript.

The bioB gene product has an estinated molecular weight of 36,000 Da (Dottin et al, 1975) and performs the lual function of catalyzing the incorporation of a sulphur atom into dethiobiotin with the loss of two protons and concomitant ring closure to form biotin.

Attempts have been made to improve the ability of E. coli to produce biotin by genetic modification. For example WO 87/01391 describes a method whereby the entire bioA - bioD sequence is isolated from an E. coli plasmid pLC2523, ligated with other DNA and then reintroduced into E. coli. JP-A 60/42928 describes a similar method. JP-A 272605/84 describes a method whereby pLC 25-29 is cleaved to isolate a fragment containing an E. coli bioB and part of a bioF gene positioned between linkers, which is then ligated into various plasmids which are suitable vectors for transformation of E. coli. Evidence is presented in JP-A 272605/84 that the ability of E. coli to convert dethiobiotin to biotin is improved when that organism is transformed with these vectors.

Another class of micro-organism which is widely employed in industrial biotechnology, including the long established arts of brewing, winemaking, baking etc is the yeasts, such as Saccharomyces cerevisiae. Yeasts are eukaryotic organisms.

Sacch. cerevisiae is unable to synthesise biotin from simple precursors such as glucose or pimelic acid and therefore is not believed to contain all the enzymes of the normal biotin biosynthetic pathway. It does however, by inference from supplementation experiments with intermediates of the pathway in the absence of biotin, contain the final three enzymes, which perform a function equivalent to bioA, bioD and bioB of E. coli (Eisenberg 1973).

Early work on the conversion of dethiobiotin to biotin by this yeast (Niimura et al., 1964) demonstrated that exposure in the culture medium to dethiobiotin at concentrations greater than 2 x 10-7M (4' 50 > g L 1) decreased any subsequent biotin formation, a phenomenon which was ascribed to enzyme repression (Eisenberg, 1973). Although no more is known specifically about the regulation of biotin biosynthesis in Sacch. cerevisiae, it is clear that this step forms a major physiological block.

Eukaryotic organisms are substantially more complex than prokaryotic organisms, and this is reflected in the relative complexity.

size and organisation of their genetic material. Whilst prokaryotes generally contain a single circular chromosome, eukaryotes often contain several chromosomes in their nucleus as well as mitochondrial DNA.

There is therefore no prima facie reason to expect that a gene could be transplanted from a prokaryote into a eukaryote to achieve the same expressive effect in the latter.

The E. coli biotin operon is polycistronic. This means that the four genes of the rightwards transcript are translateS in tandem form from the same FNA messenger molecule, rather than being produced individually. In addition there are likely to be attenuation sequences located between the genes of the E. coli operon which moiify the quantitative efficiency of expression of each gene product. In this way the operon produces each biotin synthesase enzyme in a controlled quantity appropriate to the rate at which it performs its function so that biotin is synthesised at the rate at which E. coli requires it.

By isolating the genes separately in the form of "cassettes" this level of control is removed and higher expression can be achieved.

Transcription in E.coln is controiled by the bir A gene of the E. coli chromosome. Additionally there are located in upstream positions relative to each E. coli biotin gene the appropriate shine delgano (SD) sequences which help to initiate the translational process carried out b the ribosome. The necessity for these DNA seqences .n the E.coln bXotin cDeron to control the activity of the five biotin genes suggests that these genes are precisely adapted to the synthesis of biotin by E. coli and that incorporation into other organisms would not produce a useful result.

Research into the effect of incorporation of the individual E. coli bio genes into organisms other than E. coli, and exploitation of such incorporation in industrial biosynthesis is at present hindered in practice by the unavailability of these individual genes in a form isolated from the other genes and from genetic material which is specific to E. coli.

It is an object of the invention to provide genetic material which may be introduced into micrcorganisms such as Sacch. cerevisiae to improve their ability to synthesise biotin. It is also an object of the invention to provide biotin genes in a form free of extraneous . coli genetic material.

According to a first aspect of the invention there is provided a novel plasmid, capable of replication and expression in an organism other than P..coli, and containing one or more derived genes. being derived from an E. coli bioA, bioE, M,ioC bioD or bio gene, By the term "derived gene" herein is meant a gene that expresses the same product or a product having the same or substantially the same biochemical function as that expressed by the gene from which it is derived, and which either has the same DNA sequence as the gene from which it is derived, or which has a high degree of conformity to the DNA sequence of the gene from which it is derived, eg 70% or more, or which contains degenerate or preferred codons in place of the equivalent codons of the gene from which it is derived, or contains extra bases or lacks some bases relative to the gene from which it is derived.

In a preferred embodiment the term "derived from" includes a gene which is derived from the E. coli gene and has its codon sequence modified in favour of the other organism. Such modification is a consequence of the degeneracy of the genetic code, in that a number of codons may express the same amino acid, and whereas E. coli may use preferred codons for each amino acid encoded in its genes, another organism may use a different but degenerate set of codons to express the same amino acids. A derived gene modified in favour of a particular organism therefore has such alternately preferred codons in place of those used by the gene from which it is derived.

An example of an E. coli bioB gene modified in favour of expression in the yeast Sacch. cerevisiae is listed in table 1.

The plasmid is preferably capable of replication and expression in yeasts, fungi, lactobacillus anl other bacteria, but especially in yeasts, particularly Sacch. cerevisiae and will therefore contain suitable control DNA sequences operatively linked to the gene, including transcription / translation, promoter and terminator DNA sequences appropriate to the organism concerned. Suitable additional genetic material which may be combined with the gene to form a plasmid capable of replication and expression in a particular micro-organism will depend upon the nature of the micro-organism.

Certain plasmifs of. this aspect oc the invention may also be capable of replication and erpression in. coli as well as the other organism.

In the case of yeasts, preferred additional genetic material is the known plasmi s pMA91, pMAF6c or preferably pKV49, ani the plasmid may therefore consist of pMA91, MA36e or pKV49 having the gene inserted into a suitable restriction site therein. In the case of Lactobacillus, suitable genetic material includes the known plasmid pCK965, and the plasmid may therefore consist of this plasmid having the gene inserted into a suitable restriction site, eg the polylinker site therein. The restriction map of pCK965 is shown in Fig 9.

Other known plasmids which are capable of replication in yeast lactobacillus or other organisms may also be used. Suitable transcription/translation promotors for use in yeast include Trp, Gap, Pho 5, Gal 1-10, Pal and PGK.

In the plasmid of the first aspect of the invention, the gene(s) may be linked at the end(s) into the plasmid via known linkers or adaptors. Conveniently these may be linkers or adaptors which allow easy excision of the gene from the plasmid by the use of appropriate restriction enzymes, and reinsertion of the gene into other genetic material, eg. other plasmids, by the use of suitable ligating enzymes. In this embodiment of the invention the plasmid provides the gene in a form which allows easy insertion into other microorganisms, via appropriate plasmids. Particularly suitable linkers are BglII and/or BamHl linkers.

As well as containing the gene, linkers, expression and replication operators, the plasmid may also contain other genetic material which is coding or non-coding, for example genetic markers to enable easy selection during cloning operations eg. resistance to antibiotics such as ampicillin or tetracycline.

In a preferred embodiment of this first aspect of the invention the plasmid is substantially free of any E. coli genetic material from the biotin operon which is other than directly coding for the bioA, bio3, bioC, bioD or bioF gene or genes contained in the plasmid.

It is particularly preferred in this case that the plasmid contains no E. coli promoters, attenuation sequences, Shine ialgarno sequences or fragments acting on these E. coli genes. When the plasmid contains only one bioA, B, C, D or F gene it is particularly desirable that no fragments of the other genes are present in the plasmid, and further that there should be no ATG base sequence between the linker or adaptor 5' to the start codon of the gene.

The novel plasmids of the first aspect of the invention may be used as vectors, that is they may be introduced into a microorganism in which they will replicate and express their gene product, in this case one of the biotin synthetase enzymes.

Introduction of such a vector into a micro-organism mav usefully modify the biosynthetic pathway by which biotin or its precursors ("vitamers") are synthesised within the organism. For example introduction of vectors containing bioC and bioF genes into yeast can be used to enable the yeast to grow in the absence of biotin, for example by enabling it to synthesise the two precursors pimelyl CoA and 7-keto-8-aminopelargonic acid. This has the potential for use as a novel selective marker for yeasts in fermentation.

Many known selective markers rely on the presence of resistance to certain antibiotics in the strain being selected. Insertion ofbioC and bioF genes would enable the useful possibility of selection of a strain that will grow in the absence of biotin. Similarly insertion of bicA, bioB and/or bioD genes into yeast can supplement the activity of the corresponding genes already present in the yeast. In such ways the yield of biotin from an organism which exports biotin may be improved, or intracellular levels increased, in some cases substantially, and the ability of an organism which lacks the ability to synthesise biotin for its own use to grow in a medium containing little or no biotin may be improved.

In the course of synthesis of the plasmid of the first aspect of the invention (see below) other useful novel plasmids are provided.

In particular according to a second aspect of the invention there is provided a plasmid containing one or more derived genes, being derived rom an F. coli bioA bioB bioC bio) or bioF gene and containing no E.coli control sequences in a position to act on said derived gene. The derived gene is preferably linked into the plasmid via synthetic linkers.

As well as containing the gene and the linkers, the plasmid of this second aspect of the invention may also contain additional DNA, eg it may contain control sequences located upstream and/or downstream of the gene such as the yeast promoters mentioned above. Preferably the gene is linked into the plasmid by linkers or adaptors which are positioned as close as possible to the 3' and 5' end of the gene, so that as little non-coding DNA as possible is included with the gene and any control sequences which are present between the linkers.

Preferably linkers are chosen that may be conveniently cleaved by restriction endonuclease enzymes, to excise the gene embodied in a DNA sequence having ends which may then be conveniently ligated into other genetic material, such as the yeast pMA9l, pMA36c and preferred pKVb9 plasmids referred to above, or into E.coli expression vectors with promoters such as those of pKK223-3 or pDR720 available from Pharmacia LKB Biotechnology, S-751 82 Uppsala, Sweden. Preferred linkers are Bam H1 and Bgl II.

The plasmid of thissecond aspect of the invention advantageously provides the gene it contains in the form of a cassette which can be easily excised and then reinserted into other genetic material.

If the regulatory control signals are absent from the 3' and 5' ends the gene may be inserted in different transcriptional orientations relative to their orientation in the E. coli chromosome, and combined with other regulatory signals to produce an artificial operon.

The plasmid of the first or second aspects of this invention may contain one or more of the derived genes referred to above, but conveniently to enable the properties of a single gene to be investigated it contains only one such gene, for example bioB, bioC, bioF etc.

Using such a cassette, the gene(s) it contains may be inserted into for example other plasmids (which may be plasmids of the first aspect of the invention) or into the chromosome of an organism.

The plasmids of the above aspects of the invention may be used to transform microorganisms, using known transformation techniques.

As a further aspect of the invention therefore a novel microorganism is provided, comprising a known microorganism which has been transformed by insertion of a plasmid of the invention. The known microorganism may for example be a yeast, lactobacillus or other bacillus or E. coli, but is preferably a yeast, for example Sacch. cerevisiae.

Yarrowia lipolytica and Pichia 2.

Plasmids according to the first and second aspects of the invention may be prepared by the method generally described below: (1) The known phase Charon 4A is used to take up the whole of the biotin operon, containing the bioA, bioB, bioF, bioC and bioD genes from E. coli.

(2) The DNA containing the biotin operon is isolated from the phage, for example by phenol extraction and ethanol precipitation.

(3) A length of the DNA known to contain the operon is excised using restriction enzymes, for example EcoRI and Hind III, and the fragment containing the operon is isolated, for example by gel electrophorecis.

(4) The fragment from (3) is combined with a suitable plasmid for cloning eg pUC8. The combined plasmid and fragment are cloned. Clones containing the combination are selected, and the combined DNA is isolated.

(5) By the use of appropriate known restriction endonuclease en zymes, ligation enzymes and cloning techniques, including sequen cing and the polymerase chain reaction ("PCR"). the five genes bioA.

bioB, bloC, bioD and bioF may be separated from each other and from E. coli DNA and inserted into other genetic material to form the novel plasmids of the invention.

A gene having its sequence modified in favour of another organism may be synthesised using known DNA synthesis techniques. It may then have suitable synthetic linkers such as Bam HI and/or Bgl II ligated on at its 3' and 5' ends, by means of which it may be inserted into genetic material to form a plasmid of the first and second aspects of the invention using conventional techniques.

The invention will now be described by way of example only with reference to the following figures.

Fig 1. shows the biosynthetic pathway for synthesis of biotin from pimelic acid. The role of the biotin synthetase genes is shown together with the express on product of the genes.

Fig 2. shows the restriction map of plasmid plH7.

Fig 3. shows the procedure for preparation of plasmids pBioAI, pBioAIIand a plasmid pMA91-BioA.

Fig 4. shows the restriction map of plasmid pBioAII.

Fig 5. shows the preparation of plasmids pMA91224 and pMA36cSb4.

Fig 6. shows the preparation of plasmids ptrpBioC, pMA9lBioC and pMA36BioC Fig 7. shows the preparation of plasmids ptrpBioDI, pMA9lBioD and pMA36BioD Fig 8. shows the preparation of plasmids pMA9lBioF and pMA36BioF rig 9. shows the restriction map of plasmid pCK965, which is a lactobacillus expression vector.

Fig 10. shows the incorporation of the individual bio A, bio B, bio C. bio X, bio F genes into a yeast expression vector pKV 49.

In the following examples the following materials and methods were employed.

Microorganism strains Escherichia coli strain JM 83 (known strain: ACTT 35607).

(ara, # (lac-proAB) thi, strA, # 80, lacZm Ml5) used routinely was kindly provided by R James of the University of East Anglia, Norwich, UK, whilst Saccharomyces cerevisiae (NCYC 1527 ( alpha ) (leu2-3, leu2-112, ura 3, his3-ll, his3-15 trpl) was obtained from the National Collection of Yeast Cultures, AFRC Institute of Food Research, Norwich.

Culture media Escherichia coli was grown routinely in LB medium or a minimal medium with or without additions of ampicillin (100 g ml-1), ss-indoleacrylic acid (5 g ml-1), dethiobiotin (2 g ml-1) or avidin (0.1 g ml-1) as required, Saccharomyces cerevisiae was grown either on YEPD or Vit-2 medium. The composition of the media were as follows (per L of water). LB: Bacto tryptone (10 g), Bacto yeast extract (5g), NaCl (lOg), pH 7.5.Minimal medium: glucose (2g), vitamin assay casamino acids (2g), Na2HP04 (7g), KH2PO4 (3g), NaCl (0.5g), NH4Cl (1g) Na2SO4 (0.8g), MgSO4 (0.3g), CaC12 (20mg), thiamine HCl (2Omg) histidine HC1 (20mg), thymine (40mg), proline (20mg), diaminopimelic acid (100mg), thymidine (40mg). YEPD: Bacto yeast extract (lOg), Bactopeptone (20g), glucose (20g). Vit-2 medium: Bacto vitamin-free yeast base (16.7g), inositol (lOmg), Ca pantothenate (2mg), pyridoxine HCl (0.4mg) thiamine HCl (0.4mg), nicotinic acid (0.4mg), para-aminobenzoic acid (0.2mg), riboflavin (0.2 mg), folic acid (2 g).

Plasmids and phage Plasmid plH7 containing the whole biotin operon was prepared in our laboratory by insertion of an EcoRI-Hind III fragment from the A -bio transducing phage Charon 4A (obtained from N Ellis AFRC, John Innes Institute, Norwich, UK) into the complementary polylinker sites of pUC8 (Vieria and Messing, 1982). pMA91 was obtained from A J and S Kingsman, Dept Biochemistry, University of Oxford, Oxford, UK.

DNA sequence determination Sequencing was performed by the Sanger dideoxy method (Sanger et al, 1977; 1980) using 35S-labelled nucleotides. Briefly, random restriction fragments obtained by digestion with Sau3A, Taq I and Hpa II of the EcoRl/HindIII fragment of plasmid 1H7 containing the entire operon isolated from an agarose gel by freeze squeezing (Tautz & BR< Renz, 1983) were cloned into the appropriate polylinker sites of Ml3mpl8 and/or Ml3mpl9. Similarly, the C-terminus of the bioB gene was confirmed by sequencing from the Bgl II linker inserted into a deletion series prepared by Bal 31 digestion of Bgl II cut lH7.

Sequence data analysis was done by the DNA-sequencing program DNASTAR for IM personal computers by DNASTAR Inc. 1801 University Avenue, Madison WI, 53705.

Measurement of biotin Biotin was measured in the specific microbiological assay employing Lactobacillus plantarum NCIB 6376 by the method of Wright and Skeggs (1944).

Preparation of plasmids containing biotin genes 1. Preparation of plasmid plH7 The transducing phage charon 4A contains the whole biotin operon from E.coli. The phage is phenol extracted with phenol equilibrated with TE(lOmM Tris-HCl, lmM EDTA pH 8.0), precipitated with 0.1 volume 3M sodium acetate pH 7.4 and 2 volumes of ethanol, left at -200 for 30 minutes and centrifuging at 12,000g for 30 minutes at 40C. The pellet was washed with 70% ethanol, dried in a vacuum and resuspended in TE. The DNA (lO > g) is then cut with 5 units of the restriction endonucleases EcoRI and HindIII for three hours at 370C in 50mM Tris-HCl pH 8.0, lOmM MgC12,100mM NaC1.The fragments are run on a 1% agarose gel in TAE buffer, stained with ethidium bromide 1 ug/ml and visualised under UV. The band at approx 6.3kb (using lambda HindIII as standard) was cut out and eluted. The DNA is then ethanol precipitated and resuspended in TE.

The plasmid pUC8 (long) is digested with EcoRI and HindIII as above, phenol extracted, ethanol precipitated and resuspended in TE. The digested pUC8 and the 6.3kb fragment are then ligated in ligation buffer with 1 unit of T4 ligase at 140C for 12 hours. This is then used to transform B. coli JM83, and ampicillin resistant white colonies (ss-galactosidase negative, white on X-gal medium) grown up and screened for the presence of the 6.3kb fragment following digestion with HindIII and EcoR1 is called plH7, and its structure is shown in Fig 2.

Plasmid plH7 was used as the starting point for preparation of plasmids containing the other biotin synthetase genes.

2. PreParation of plasmids containing the BioA gene.

The plasmid 1H7 (10 g) was cut with 5 units of the restriction endonuclease AccI at 37 C for 3 hours in 50mM Tris-HCl pH 8.0, 10 mM MgC12, 100 mM NaCl, phenol extracted and ethanol precipitated, washed with 70% ethanol and vacuum dried. The plasmid was resuspended and treated with the exonuclease Ba131 in 20mM Tris-HCl pH 8.0, 12 mM MgC12, 12mM CaC12, 600 mM NaCl, lmM EDTA at 150C, until approx 100 bp were removed. The mix was then phenol extracted and ethanol precipitated. The plasmid was resuspended and treated with 5 units of restriction endonuclease EcoRl at 370C for 3 hours in 50 mM Tris HCl pH 8.0, lOmM MgC12, lOOmM NaCl, phenol extracted and ethanol precipitated.

The ends were filled with DNA polymerase polymerase klenow fragment and blunt end ligated with a BglII linker. This removes the other genes from the operon leaving BioA. The plasmid is now designated pBioAI and is cut with the restriction endonuclease HindIII, phenol extracted and ethanol precipitated. The plasmid is resuspended and treated with Ba131 exonuclease in 20 mM Tris-HCl pH a o, 12 mM MgCl2, 12 mM CaCl2, 600 mM NaCl, 1 mM EDTA at 15 Cto remove non-bioA coding DNA, and the ends are filled in using DNA polymerase klenow fragment. Another BglII linker is ligated and the construct used to transform the E. coli JM83.

The ampicillin resistant colonies are tested for plasmid containing two BglII sites and now termeA pBLoAII. The BioA gene is now able to be inserted as a cassette. By ligating the BglII fragment containing the 3ioA gene into BglII digested pMA91 or BamHI digested pMA36C we have novel plasmids, for expression in yeast. This procedure is shown in Fig 3, a more complete restriction map of pBioAII being shown in Fig 4.

This BioA gene will supplement the gene already present in yeast to increase conversion of 7-keto-8-aminopelargonic acid to 7,8 diaminopelargonic acid. The fragment is also suitable for expression in other yeasts, lactobacillus and bacillus species using appropriate vectors and promoters. The gene has been partially sequenced using the dideoxy chain termination method. The part sequenced contains the BamHI site (see table 2).

3. Preparation of plasmids containing the BioB gene The plasmid plH7 prepared in 1 above was digested with the restriction endonucleases BamH1 and Hind III and the trp promoter cartridge is ligated in to form pDON1.

The BioB gene has a unique NcoI restriction site at the start. The pD0Nl plasmid (lÇjug) was digested with five units of NcoI for three hours at 370C in 50mM Tris-HC1 pH8.0, lOmM MgC12, 50mM NaC1, phenol extracted and ethanol precipitated. The pellet was washed with 70% ethanol, vacuum dried and resuspended in klenow polymerase buffer. The ends were filled in with DNA polymerase klenow fragment and ligated in the presence of an eight base pair BamHI linker. The colonies are checked for the presence of two BamHI sites and those digested with BamHI, self ligated and screened for the presence of a single BamHI site.

The plasmid pBioBFCD is now digested with BglII and incubated with the exonuclease Ba131 for 20 minutes. The single stranded ends are filled in using DNA polymerase klenow fragment and ligated in the presence of a BglII linker. Following transformation, colonies are screened for a 1070bp BamHI-BglII fragment indicating the isolation of the BioB gene. Selection was on the basis of sequence analysis, the DNA samples being subcloned into M13mpl9 virus and sequenced using the dideoxy chain termination method. Clones with the minimum 3' sequence were chosen for use. The sequence was found to be that of JPA 272605/48, ie as listed in table S.

By ligating the BainHI-B 1II fragment into BglIIdigested pMA91 or BamHl digested pMA36C novel plasmids pMAB4 and pMA36Ch4 were prepared, suitable for expression in yeast. pMA91 expresses at a higher level than pMA36C. The insertion method is shown overall in Fig 5, and is described below.

Method Clone b 4 from the pBioB-D series (produced by cutting plH7 at Ncol, ligating in BamHl linker, BamHI digest, self ligate, then BamHl/HindIII and insert a trp promoter. Digest with BglII, treat with Ba131 and put in a BglII linker. The bioB gene was removed by cutting A 4 with BamHl/BglII, running the digest on a mini gel and removing the small fragment.

The strip of gel containing the bioB gene was set in thebottomof a 1% agarose gel and a piece of DE 81 filter paper inserted at the bottom of the strip and the DNA run into that overnight by electrophoresis. The DNA was then extracted from the paper in 1.5 M NaCI.

ImM EDTA, phenol extracted and ethanol precipitated and dissolved in 10 > 1 water.

Then both the pMA91 BglII and pMA36C BamHl digests were ligated separately overnight at 140C with the Baml/BglII b 4 digested DNA.

The product was phenol extracted, ethanol precipitated, resuspended in 10 l water and 2u1 used to transform competent JM83.

The ligation medium below was used: lul pMA91 (Bg III) pMA36c (Bam Hl) 2 I#4 4 (Bam H1 digested) 2 > 1 x 5 lign. buffer 1 1 ligase 4 ul water Mini preps of DNA were made from the transformants and the DNA was cut with BamHl/HindIII. pMA36C #4 was seen to have an insert in the correct orientation.

DNA was prepared from the transformants and cut with HindIII/ BamHl to see if an insert was present, and the orientation of these were investigated by cutting with HindIII and HindIII/BglII.

This BioB gene will supplement the gene already present to increase conversion of dethiobiotin into d-biotin by yeast in culture. The fragment is also suitable for expression in other yeasts, lactobacillus and bacillus using appropriate vectors incorporating control sequences for expression in these three organisms.

4. Preparation of plasmids containing the BioC gene The gene is situated between BioF and BioD in the biotin of E.coli. Plasmid plH7(10 g) was cut with five units of the restriction endonucleases HindIII and EcoRI in 50mM Tris-HC1 pH 8.0, lOmM MgCl2, 100mM NaCl and incubated at 370C. After three hours the DNA was run on a 1% agarose gel in TAE buffer, stained with ethidium bromide (lug/mi), visualised under W and the band at 6.3kb cut out. The DNA was eluted from the gel, ethanol precipitated and resuspended in TE. The DNA is then digested with the restriction endonuclease MspI in 50mM Tris HC1 pH 8.0, 10mM MgC12, 50mM NaCl and incubated at 370C for three hours. The BioC gene is bounded by two Msp I sites and the fragment is about 900bp in length.The digested DNA is run on an 1.2% agarose gel in TAE buffer, stained with ethidium bromide (lVg/ml) and visualised under UV, and the band at approx.

772 bp cut out and eluted. The fragment was then ethanol precipitated, vacuum dried and resuspended in TE.

The plasmid pUC8(lOug) was digested with five units of the restriction endonuclease AccI in 50mM Tris-XC1 pH 8.0, lOmM MgCl2, lOOsM NaC1 and incubated at 370C for three hours, phenol extracted, ethanol precipitated and ligated with the BioC containing fragment in a 1:2 ratio. E.coli JM83 was transformed and plasmid prepared from white amplicillin resistant colonies growing on LB amp plus X-Gal. These were checked for the presence and orientation of the BioC gene by cutting with restriction endonucleases HindIII and BglII. This gave plasmid pBio CI.

Plasmid pBioCI (lOug) was digested with 5 units of restriction endonucleases PstI and HindIII in 50mM Tris-HCL pH 8.0, lOmM MgCl2, 100 mM NaCl and incubated for 3 hours, phenol extracted, ethanol precipitated and resuspended in TE. The trp promoter was inserted giving plasmid ptrpBioC which is capable of expressing pimelyl CoA synthetase activity in E.coli.

Plasmid pBioCi was digested with the restriction endonuclease PstI in 50mM Tris-HCl pH 8.0, lOmM MgC12, 100 mM NaCl and incubated for 3 hours, phenol extracted, ethanol precipitated and resuspended in TE followed by Ba131, to remove approximately 200 bp, filled in with DNA polymerase klenow fragment and ligated with a BamHI linker. BamHI digestion of this plasmid now provides a cassetteforthe movement of this gene into other organisms for expression. For example into BglII digested pMA91 or BglII digested pMA36C for expression in yeast. This procedure is shown in Fig 6. The sequence of this BioC gene is shown in table 4.

Other linkers may be put at either or both ends of the BioC gene to provide a cassette for insertion into plasmids suitable for transformation of other microorganisms.

5. Preparation of plasmids containing the BioD gene The plasmid plH7 (1Fig) is cut with five units of each of the restriction endonucleases BglII and BamHI in 50mM Tris-HC1 pH 8.0, lOmM MgC12, lOOmM NaC1 and incubated at 37DC for three hours. The DNA is run on a 1% agarose gel stained with ethidium bromide (leg/ml) visualised with DV and the DNA in the band at 5390bp removed.

The DNA is treated with the exonuclease Bal31 in 20mM Tris-HCl pH 8.0, 12mM MgC12, 12mM CaCl2, , 600mM NaCl, lmM EDTA at 150C, ends filled in with DNA polymerase klenow fragment and ligated in the presence of a BamHI linker. Following transformation plasmid is prepared from the ampicillin resistant colonies and checked by cutting with BaHBI in 50mM Tris-HCl pH 8.0, lOmM MgC12, lOOmM NaCl and incubated at 370C for three hours. Those with linker inserted then have their BamHI PstI fragment subcloned into Ml3mp19 virus and sequenced using the dideoxy chain termination method. The start of the gene was identified and the clone with its Shire Delgarno sequence still intact was designated p'asmid 23io?I.

start of the Bio D gene is liste- in table 5.

The Trp and Tac promoter can be used for expression in E.coli by inserting these in the correct orientation in place of the lkb BamHI HindIII fragment from pBioDI. The plasmid is cut at the EcoRI site, phenol extracted, ethanol precipitated, treated with Ba131 exonuclease in 20mM Tris-HCl pH 8.0, 12 mM MgC12, 12mM CaC12, 600 mM Nail, lmM EDTA at 15 C to remove Approximately 200 bp, and the ends are filled in using DNA polymerase klenow fragment. A BamHl linker is inserted and this provides a cassette for expression of dethiobiotin synthetase in yeast, lactobacillus or bacillus under appropriate promoter control By ligating the BamHI-BamHI fragment into pMA91 or pMA36C as described above a novel plasmid for expression in yeast is provided. This procedure is shown in Fig 7.

6. Preparation of plasmids containing the BioF gene The plasmid plH7 (lO g) was digested with 5 units of the restriction endonuclease NcoI in 50nM Tris-Hcl pH 8.0, 10 mM MgC12, 50mM NaCl and incubated at 370C for three hours. It was then phenol extracted, ethanol precipitated and resuspended in 20mM Tris-HCl pH 8.0, 12mM MgC12, 12mM CaCl2, 600mM NaCl, then reacted at 150C with the exonuclease Bawl31. After removal of approx 2Kb the reaction was stopped by the addition of EDTA, phenol extracted, ethanol precipitated, vacuum dried and resuspended in TE. The DNA was ligated in the presence of a BamHI linker and transformed into the E.coli JM83 and ampicillin resistant colonies selected.Transformants had their plasmid DNA (lops) isolated and this cut with the restriction endonucleases BamHI and PstI to indicate the length of deletion and then appropriate clones sequenced by subcloning into BamHI- PstI cut Ml3mp19 virus and sequenced using the dideoxy chain termination method. A clone was found which had the Shine Delgarno sequence intact but none of the BioB gene remained 5' to this.The plasmid (lO g) was cut with 5 units of the endonuclease PstI at 770C for three hours in 50mM Tris-HC1 pH 8.0, lOmM MgC12, l00mM NaClJ then phenol extracted, ethanol precipitate and resuspended in 20mM Tris-HCl pH 8.0, 12mM MgC12, 12mM CaCl2, 600mM NaC1, lmM EDTA and reacted at 150C with the exonuclease Bawl31. After removal of approx 1.8Kb the reaction was stopped by means of the addition of EGTA, phenol extracted, ethanol precipitated and vacuum dried. The pellet was resuspended in TE, blunt ends formed with DNA polymerase klenow fragment and ligated in the presence of BglII linker.

Digestion with BamHI and HindIII facilitates the insertion of either an E. coli trp or tac promoter. The BamH1 BglII fragment can be used as a cassette for the expression of 7-keto-8-aminopelargonic acid synthetase in a range of microorganisms including yeasts, bacillus, lactobacillus etc.

The DNA sequence of the bio F gene is listen in table 6.

Ligation of the BamHI BglII fragment into pMA91 or pMA36C provided novel plasmids suitable for transformation of yeast.

The procedure is shown in Fig 8.

7. Nucleotide and Amino acid sequence of Bio gene.

Confirmation that pBiOBla contained a functional biotin synthetase gene was by complementation of E.coli JM83-14a, a bioB mutant constructed in our laboratory, grown on a minimal-ampicillin medium plus dethiobiotin. The complete nucleotide sequence and deduced amino-acid sequence are displayed in Table 1.

The Bio B gene comprises 346 coins with a calculate protein molecular weight of 38, 637 daltons. The Mr value is approximately 2.637 larger than that predicted by Dottin et al. (1975) using S.D.S polyacrylamide gel electrophoresis, a difference probably due to errors involved in Mr determination by this method owing to protein conformation.

From our data the Robson conformation for secondary structure of the protein (Garnier et al, 1978) gives helix 45%, extended 36%, turn 9% and coil 10% whilst the Chou-Fassman method (Chou and Fassman, 1978), with its inherent overlap (Nishikawa, 1983), the proportions are helix 57%, extended 72% and turn 29%. These regions are distributed more or less evenly throughout the molecule in tracts of no more than 24 amino-acid residues.

Nath and Guha (1982) suggested that translation of the bioB gene could not initiate at the ATG aleady defined (Otsuka and Abelson, 1978; Barker et al, 1981) because of an in-frame terminating codon, TGA, situated 73 bases downstream.

This observation was based on dissertation material (Otsuka, 1979) which we have not seen. However, our sequence indicates that although a TGA triplet does exist at approximately that position, it is in fact out of frame.

Similarly, although not directly part of this work, we have also sequenced the regulatory region of the biotin operon (data not shown) and find TGGAGAAGCCCC immediately preceeding the initiating ATG of the bioB gene. This sequence is in agreement with that of Barker et al, (1981) but not with that of Otsuka and Abelson (1978) in which the GA pair (underlined) is missing. Therefore we reaffirm the location of the start of the bioB gene.

Whilst attempts to purify enzymes of the biotin operon from E.coli have found only small amounts of protein (Krell and Eisenberg, 1970; Stoner and Eisenberg, l97), suggesting that the operon is weakly expressed, which is to be expected because of the very small quantities of biotin (2 lOng L 1 ) required for normal grown of this bacterium, analysis of the codon usage does not reflect this. Although within the bioB coding region there is indeed an 81% base match for weakly expressed E.coli genes, there is also a 78% base match for strongly expressed genes (DNASTAR). If the same analysis is performed for yeast genes, then only a 73% base match is found.

8. Incorporation of E. coli Bio A, B, C, D and F genes into other Yeast expression vectors.

Using techniques analogous to those described above the Blo A, B C. 3 and r genes were incorporated into the Yeast expression vector plasmil pKV49 as shown in Pig 10. The BglII expression site shown in pKV 49 is a convenient region for insertion of the indic- ated gene cassettes containing the particular gene.

Use of Polymerase Chain Reaction to construct cassettes containing the Biotin oDeron genes.

The recently developed Polymerase Chain Reaction (PCF.) provi-es a method for increasing the number or copies of a given DNA sequence, without the nee to culture the organism which contains it. The FCE proceeds in three phases.

1. The DNA is denatured.

2. The short oligomer primers are annealed to the DNA flanking the target DNA sequence.

@ The target DNA is enzymatically extended from the primers across the target region using Taq JNA polymerase.

The process is repeated and results in the exponential accumulation of the specific target sequence, approximately 2n. where n is the number of cycles of melting an primer extension. The method is of use in the construction of specific sequences where one wishes to add particular restriction sites, or modify the ends of the target genes.

This is achievei by constructing a primer oligomer. part of which bin Is to the target gene and which acts as a primer, and the rest of which forms the restriction sites of the adaptor. Speciric constructions for each of the Biotin genes are detailed below.

Approximately 1.0 ug of the plasms 1H7 DNA in water is mixed with the appropriate primers, buffer water 20% Triton and Taq DNA polymerase at the concentrations shown in methods 1 2 and A The reaction tubes are set up in the PCR reaction programmable heating cooling block at the segment temperatures and times detailed in method 1.

At the end of the reaction cycles the DNA is run on a 1% agarose gel ma7e up in Tris-HCl 0.889 M. boric acid 0.099 M, EDTA 0 002 M, and electrophoresed ror approximately 15 hours at 25V. The gel was stained with ethidium bromine (1 ug/ml) and visualised with UV. The prominent bans of DNA at the expected molecular weight is electrophoresed onto DE 81 paper.The JNA is removed from this paper in a high salt buffer comprising NaCl 2X, Tris-HCl pH8.0 50 mM. and EDTA 1.0 m. The DNA is ethanol precipitated using 0.1 volume 3M sodium acetate pH 7.5, 2 volumes of 95% ethanol. left at -200C for 70 minutes an centri nudged at 12.000g for 30 minutes at 40C.

The pellet is then washed three times with 70% ethanol and vacuum dried. The DNA is then resuspended to 0.1 ug/ml in TE (lOmM Tris HCl, lmM ENTA pH 9.0). The DNA obtained is cut with the appropriate restriction enzymes and inserted into the plasmid of choice using standard ligation protocols.

Thus the genes may be male suitable for expression in a variety of species. eg yeasts lactobacillus and bacillus using the appropriate vectors.

The individual gerw products. following insertion of the gene alone or in combination, are thus made available to either supplement the enzyme activity already present or to provide an activity which was previously lacking in that particular species.

It should be noted that the start codon of the bio B gene as it occurs in E. coli has been changed from GTG which codes for formyl methionine in E. coli. to ATG which codes for methionine, and now allows expression or this gene in other species. particularly eukaryotes.

Method 1 Programme 1: Temp C Time mins.

Segment 1 90 2.0 Segment 2 55 2.5 Segment 3 70 Polymerase Chain Reaction X 4 Buffer: Component Final Concn. Stock Amount j lml X X 4 mix Tris HCl pH8.3 10.0 mM 1.0 M 40.0 L KCl 50.0 mM 1.0 M 200.0 pL MgC12 1.5 mM 1.0 M 6.0 pL Gelatin 0.01 % 1.0 % 40.0 L dATP 200 m 100 mM 8.0 L dTTP 200 m 100 mM 8.0 L (contd.) Component Final concn. Stock Amount / lml X 4 mix dCTP 200 m 100 mM 8.0 L dGTP 50 m 100 mM 2.0 L dc7GTP 150 m l0.OmM 15.0 uL Make up to 1000 L with sterile distilled water use 25 pL per 100 L reaction.

Oligonucleotide Synthesis: Oligonucleotides were synthesised using cyanoethyl phosphoramidite method on an Applied Biosystems 381A synthesiser at o.2 pM scale.

Method h Bio A gene from E coli: construction of cassette for expression in heterologous organism oligo 1 = 5' gcggccgcgaattcagatctataatgacaacggacgatettgcc 3' oligo 2 = 5' gcggccgcaagcttagatcttattgcaaaaaaaatgttca 3' Bio A gene oligo 1 44/mer 2253 yg/ml oligo 2 42/mer 2@36 g/ml want final concentration of approximately 20 pmol dilute: oligo 1 1:15 66 6 l of oligo + 939.4 pl of water = 10 pmol = 145ng/ l oligo 2 1:21 47.6p1 of oligo + 952.4 l Of water = 10 pmol = 138ng/ l PCP x4 Buffer 25 pl primer 1 2.0 Xul primer 2 2.0 rl 10% triton 1.0 l DNA 10.0 pl (approx 1.0 pg) Taq 1.0 l (5.0 U) Water 59 l Total 100 l Overlay 100 ul sterile mineral oil 25 x cycles programme 1 (DNA = biotin operon Eco/Eco fragment of lH7) Method B Bio B gene from E. coli: construction of cassette for expression in heterologous organism.

oligo 1 = 5' gcggccgcgaattcagatctataatggctcaccgcccacgctgg 3' oligo 2 = 5' gcggccgcaagcttggatcctcataatgctgccgcgttgtaa 3' Bio B gene oligo 1 44/mer 2153. g/ml oligo 2 42/mer 2279 yg/ml want final concentration ot approxmately 20 pmol dilute oligo 1 1:15 66.6 l of oligo + 933.4 pl of water = 10 pmol = 145 ng/ul oligo 2 1 15 62.5 l of oligo + 937.5 l of water = 10 pmol = 138 ng/ l PCR X 4 Buffer 25 rl primer 1 2.0 primer 2 2.0 l 10 % triton 1.0 l DNA 10.0 pl (approx 1.0 pg) Taq 1.0 l (5.0 U) Water 59 l Total 100 overlay 100 l of sterile mineral oil 25x cycles programme 1 (DNA = biotin operon Eco/Eco fragment of 1H7) Method C Bio C gene from E. coli: construction of cassette for expression in heterologous organism.

oligo 1 = 5' gcggccgcgaattcggatccataatggcaacggttaataaacaa 3' oligo 2 = 5' gcggccgcaagcttggatccttactcacgagcaatcactcc 3' Bio C oligo 1 44 mer 2617 pg/ml oligo 2 41 mer 2167 g/ml want final concentration of approximately 20 pmol dilute: oligo 1 1:18 55.5p1 of oligo + 944.5p1 of water =. lOpmol = 145 ng/pl oligo 2 1::16 62.5 l of oligo + 9@7.5 l of water = lOpmol = 135 ng/pl PCR X4 buffer 25 ,ul primer 1 2.0 pl primer 2 2.0 ul 10% triton 1.0 l DNA 10.0 lul (approx l.o g) Taq polymerase 1.0 l (5.0 U) Water 59 l Total 100 l overlay 100 of sterile mineral oil 25 x cycles programme 1 (DNA = biotin operon Eco/Eco fragment of 1H7) Method D Bio D gene from. coli: construction of cassettes or expression in heterologous orgamisns oligo 1 = 5' tctagaattcggatccataatgagtaaacgttattttgtca 3' oligo 2 = 5' tctagaagcttagatctacaacaaggcaaggttatgt Bio D oligo 1 (left) 41 mer 2391 g/ml oligo 2 (right) 38 mer 229@ g/ml want final concentration of approximately 20 pmol dilute: oligo 1 1.15 yl @ oligo = 20 pmol = 274 ngIpl oligo 2 1.1 pl of oligo = 20 pmol = 254 ng/ l PCR X4 buffer 25 pl primer 1 1.15 pl primer 2 1.1 pl 10% triton 1.0 l DNA 10.0 p1 (approx 5.0 g) Taq polymerase 1.0 pl (5.0U) water 60.75 yl total 100 ul overlay 100 l of sterile mineral oil 25 x cycles programme 1 (DNA = biotin operon Eco/Eco fragment of 1H7) Method F Bio F gene from E. coli: construction of cassette for expression in heterologous organism.

oligo 1 = 5' aagcttggatccataatgagctggcaggagaaaatcaacgcggc oligo 2 = 5' cagctgcagatctttaaccgttgccatgcagcacctccagca 3' Bio F gene oligo 1 44/mer 2040 g/ml oligo 2 42/mer @000 pg/ml want final concentration of approximately 20 pmol dilute: oligo 1 1:14 71.5 l of oligo + 92@.5 1 of water = 10 pmol - 145ng/,ul oligo 2 1: :22 45.5 l of oligo + 954.5 pl of water = 10 pmol = 138ng/ l POP X4 buffer 25 l primer 1 2.0 l primer 2 2.0 l 10% triton 1.0 pl DNA 10.0 l (approx. l.Opg) Taq polymerase 1.0 pl (5.0 U) Water 59 pl Total 100 l overlay 100 l of sterile mineral oil 25 x cycles programme 1 (1NA = biotin operon Eco/Eco fragment of 1H7) References Sanger, F, Nicklen, S and Coulson A R. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467.

Tautz, D and Renz, M: Optimised Freeze-squeeze method for recovery of DNA fragments from agarose gels. Anal Biochem 132 (1983) 14-19.

Wright, L D. and Skeggs, H R: Determination of biotin with Lactobacillus arabinosus. Proc. Soc. Exp. Med 56 (1944) 95-102.

Dottin, R P, Cutler, L S and Pearson M L: Repression and autogenous stimulation in vitro by bacteriophage lambda repressor. Proc. Nat. Acad. Sci. USA 72 (1975) 084-808.

Garnier, J, Osugthorpe, D and Robson, B: Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins. J. Mol. Biol.

120 (1978) 97-120.

Chou, P P, and Fassman G D: Prediction of the secondary structure of proteins from their amino-acid sequence. Adv.

Enzymol. 46 (1978) 45-148.

Nishikawa, K: Assessment of secondary-structure prediction of proteins, comparison of computerized Chou-Fassman method with others. Biochim. Biophys. Acta 748 (1983) 285-199.

Nath, S K and Guha A: Abortive termination of bioBFCD RNA synthesized in vitro from the bio ABFCD operon of Escherichia coli K-12. Proc. Natl. Aced. Sci. USA 79 (1982) 1786-1790.

Otsuka, A and Abelson J: The regulatory region of the biotin operon in Escherichia coli. Nature 276 (1978) 689-693.

Barker, D F. Kuhn J and Campbell, A M: Sequence and properties of operator mutations in the bio operon of Escherichia coli.

Gene 13 (1981) 89-102.

Otsuka, A: Ph.D Thesis, University of California, San Diego, 1979.

Krell, K and Eisenberg, M A: The purification and properties of dethiobiotin synethase. J. Biol. Chem 245 (1970) 6558-6566.

Stoner, G L and eisenberg, M A: Purification and properties of 7,8,-diaminopelargonic acid aminotransferase. J. Biol. Chem.

250 (1975) 4029-4036.

Cohen G. Zimmer A, Gurevitch B, and Yankofsky S, : Isolation and Characterisation of a ColEl plasmi containing the entire bio gene cluster of scherichia coli K-12. zol. Gen. Genet 166 (1978).

Cleary @@@ Campbell A, and Chang H: Location of promoter an operator sites in the biotin gene cluster. Proc. Natl. Acad.

Sci. USA 69 (1972) 2219-2223, Guha A, Saturen Y, and Szybalski W : Divergent orientation of transcription from the biotin locus of Escherichia coli. J. Mol.

Biol. 56 (1971) 53-62.

Eisenberg N A : Biotin: biogenesis, transport and their regulation.

Adv. Enzymol. 38 (1973) 317-372.

Niimura T, Suzuki F and Sahashi Y : Stuiies on the formation of biotin from dethiobiotin and sulphate in Saccharomyces cerevisiae J. Vitaminol. 10 (1964) 218-223.

Das Gupta C K, Guha A (1973) Isolation of the regulatory segment of the Biotin operon of E. coli K-12, Gene, 3. p232-246.

Viere J, Messing J (1932) The pJC plasmids, an M13mp7-derived systen for insertion mutogenesis and sequencing with synthetic universal primers.

Bachmann @ @, Low H B (19@0) Linkage map of E. coli K-12, edition 6 Miorobiol. @ev., 44, 1-56.

Table 1 E. coli Bio B gene with sequence modified for Yeast.

1 ATGGCTCATAGACCAAGATGGACTTTGTCTCAAGTTACTGAATTGTTCGA 50 51 AAAGCCATTGTTGGACTTGTTGTTCGAAGCTCAACAAGTTCACAGACAAC 100 101 ACTTCGACCCAAGACAAGTTCAAGTTTCTACTTTGTTGTCTATCAAAACT 150 151 GGTGCTTGTCCAGAAGACTGTAAGTACTGTCCACAATCTTCTAGATACAA 200 201 GACTGGTTTGGAAGCTGAAAGATTGATGGAAGTCGAACAAGTTTTGGAAT 250 251 CTGCTAGAAAGGCTAAGGCTGCTGGTTCTACTAGATTCTGTATGGGTGCT 300 301 GCTTGGAAAAACCCACACGAAAGAGACATGCCATACTTGGAACAAATGGT 350 351 TCAAGGTGTTAAGGCTATGGGTTTGGAAGCTTGTATGACTTTGGGTACTT 400 401 TGTCCGAATCCCAAGCTCAAAGATTGGCTAACGCTGGTTTGGACTACTAC 450 451 AACCACAACTTGGACACTTCTCCAGAATTCTACGGTAACATTATTACTAC 500 501 TAGAACCTACCAAGAAAGATTGGACACCTTGGAAAAGGTTAGAGACGCTG 550 551 GTATTAAGGTTTGTTCCGGTGGTATCGTTGGTTTGGGTGAAACTGTTAAG 600 601 GACAGAGCTGGTTTGTTGTTGCAATTGGCCAACTTGCCAACCCCACCAGA 650 651 ATCTGTTCCAATTAACATGTTGGTTAAGGTTAAGGGTACTCCATTGGCTG 700 701 ACAACGACGACGTTGACGCTTTCGACTTCATTAGAACTATCGCTGTTGCT 750 751 AGAATTATGATGCCAACTTCCTACGTTAGATTGTCCGCTGGTAGAGAACA 800 801 AATGAACGAACAAACCCAAGCTATGTGTTTCATGGCTGGTGCTAACTCTA 850 851 TCTTCTACGGTTGTAAGTTGTTGACTACTCCAAACCCAGAAGAAGACAAG 900 901 GATTTGCAATTGTTCAGAAAGTTGGGTTTGAACCCACAACAAACCGCTGT 950 951 CTTGGCTGGTGACAACGAACAACAACAAAGATTGGAACAAGCTTTGATGA 1000 1001 CTCCAGATACTGATGAATACTACAACGCTGCTGCTTTGTAG 1041 Table 2 THE BIOA GENE OF E.coli; DNA SEQUENCE, DERIVED ANIN@ A@ID SEQUENCE AND PRIMEFS USED TO CONSTRUCT THE SENE CASSETTE.

gcggccgcaattcegatctataATGACAACGGACGATCTTGCCTTTGACCAACCGCATATCTGGCACCCATACACATCCATG -------±--------±--------±--------±--------±--------± MetThrThrAspAspLeuAlePheAspGlnProHisIleTrpHisProTyrThrSerMet ACCTCCCCTCTGCCGGTTTATCCGGTGGTGAGCGCCSAAGGTTGCGAGCTGATTTTGTCT -------±--------±--------±--------±--------±--------± ThrSerPro@euProValTyrProValValSerAlaGluGluCysGluLeuIleLeuSer GACGGCAGACGCCTGGTTGACGGTATGTCGTCCTGGTGGGCGGCGATCCACGGCTACAAT -------±--------±--------±--------±--------±--------± AspGlyArgArgLeuValAspGlyMetSerSerTrpT@pAlaAlaIleHisGlyTyrAsp CAGCCGCAGCTTAATSCGGCGATGAAGTCGCAAATTSGTGCCATGTCGCATGTGATSTTT -------±--------±--------±--------±--------±--------± HisProBinLeuAsnAlaAla@etLysGetSlnIleAspAleMetSerHisValMetPhe GGCGGTATCACCCATGCGCCAGCCATTGAGCTGTGCCGCAAACTGGTGGCGATGACGC@G -------±--------±--------±--------±--------±--------± GlyGlyIleThrHisAleProAlaIleGluLeuCysArgLyeLeuValAlaMetThr@@@ @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@AGCGGTGGAAGTGGCGATG -------±--------±--------±--------±--------±--------± GlnProLeuGluCysValPheLeuAlaAspSerSlySerValAlaValGluValAlaMet AAAATGGCGTTGCAGTACTGGCAAGCCAAAGGCGAAGCGCGCCAGCGTTTTCTGACCTTC -------±--------±--------±--------±--------±--------± LysMetAlaLeuGlnTysTrpGinAlaLysGlyGluAlaArgGlnArgPheLeuThrPhe CGCAATGGTTATCATGGCSATACCTTTGGCGCGATGTCGGTGTSCSATCCGGATAACTCA -------±--------±--------±--------±--------±--------± ArgAsnGlyTyrHisGlyAspThrPheGlyAlaMetSerValCysAspProAspAsnSer ATGCACAGTCTGTGGAAAGGCTACCTGCCAGAAAACCTGTTTGCTCCCGCCCGCCAAAGC -------±--------±--------±--------±--------±--------± MetHisSerLeuTrpLysGlyTyrLeuProGluAsnLeuPheAlaProAlaProGlnSer CGCATGGATGGCGAATGGGATGAGCGCGATATGGTGGGCTTTGCCCGCCTGATGGCGGCG -------±--------±--------±--------±--------±--------± ArgMetAspGlyGluTrpAspGluArgAspMetValGlyPheAleArgLeuNetAlaAla CATCGTCATGAAATCGCGGCGGTGATCATTGAGCCGATTGTCCAGGGCGCAGGCGGGATE -------±--------±--------±--------±--------±--------± HisArgHisGluIleAiaAlaVelIleIleGluProIleValGlnElvAleGlyGlyMet Table 2 (contd.) CGCATGTACCATCCGGAATGGTTAAAACGAATCCGCAAAATATGCGATCGCGAAGGTATT -------±--------±--------±--------±--------±--------± ArgMetTv@HisProGluTroLeuLesArgIleArgLysIleCysAspArgGluGlyIle TTGCTGATTGCCGACGAGATCGCCACTGGATTTGGTCGTACCGGGAAACTGTTTGCCTGT -------±--------±--------±--------±--------±--------± LeuLeuIleAsaAspGluIleAlaThrGlyPheGlyArgThrGlyLysLeuPheAla@ye GAACATGCAGAAATCGCGCCGGACATTTTGTGCCTCGGTAAAGCCTTAACCGGCGGCACA -------±--------±--------±--------±--------±--------± GluHisAlaGluIleAlaPraAspIleLeuCysLeuGlyLysAlaLeuThrGlyGlyThr ATGACCCTTTCCGCCACACTCACCACGCGCGAGGTTGCAGAAACCATCAGTAACGGTGAA -------±--------±--------±--------±--------±--------± MetThrLeuSerAlaThrLeuThrThrArgGluValAlaGluThrIleSerAsnGlyGlu GCCGGTTGCTTTATGCATGGGCCAACTTTTATGGGCAATCCGCTGGCCTGCGCGGCAGCA -------±--------±--------±--------±--------±--------± AlaGlyLysPhe@etHisGlyAreThrPheMetGlyAsnPreLeuAlaCysAlaAlaAla AACGCCAGCCTGGCGATTCTCGAATCTGGCGACTGGCAGCAACAGGTGGCGGATATTGAA -------±--------±--------±--------±--------±--------± A@nAlaSerLeuAieIleLeuGluGerGlyAspTrpGlnGlnGlnValAlaAspIleGlu GTACAGCTGGGCGAGCAACTTGCCCCCGCCCGTGATGCCGAAATGGTTGCCGATGTGCGC -------±--------±--------±--------±--------±--------± ValGlnLeuArgGluGlnLeuAleProAlaArgAspAlaGluMetValAlaAspValArg GTACTGGGGGCCATTGGCGTGGTCGAAACCACTCATCCGGTGAATATGGCGGCGCTGCAA -------±--------±--------±--------±--------±--------± ValLeuGlyAleIleGlyValValGluThrThrHisProValAsnMetAlaAlaLeuGln AAATTCTTTGTCGAACAGGGTGTCTGGATCCGGCCTTTTGGCAAACTGATTTACCTGATG -------±--------±--------±--------±--------±--------± L@sPhePheValGluGlnGlyValTrpIleArgProPheGlyLysLeuIleTyrLeuMet CCGCCCTATATTATTCTCCCGCAACAGTTGCAGCGTCTGACCGCAGCGGTTAACCGCGCG -------±--------±--------±--------±--------±--------± ProProTyrIleIleLeuProGlnGlnLeuGlnArgLeuThrAlaAlaValAsnArgAle GTACAGGATGAAACATTTTTTTGCCAATAAagatctaagcttgcggccgc -------±--------±--------+ ValGlnAspGluThrPhePheGysGlnEnd

5' start @' Gli@@@ 44mer at eta@@ GCGGCCGCGAATTCAGATCTATAATGACAACGGACGATCTTGCC

St:,-:' @@ @@@ at end GCGGCCGCAAGCTTAGATCTTTATTGGCA

Table 3 THE BIOE BENE OF E.colin DNA SEQUENCE, DERIVE@ AMIND A@ID GEQUENCE AND PRIMERS USED TO @ONSTRUCT THE GENE CASSETTE.

gcggccgcgaettcagatctetaATGGCTCACCGCCCACGCTGGACATTGTCGCAAGTCACAGAATTATTTGAAAAACCGTTG -------±--------±--------±--------±--------±--------± MetAlaHisArgProArgTrpThrLeuSerGlnValThrGluLeuPheGluLysProLeu CTGGATCTGCTGTTTGAAGCGCAGCAGGTGCATCGCCAGCATTTCGATCCTCGTCAGGTG -------±--------±--------±--------±--------±--------± LeuAspLeuLeuPheGluAleGlnGlnValHisArgGlnHisPheAspProArgGlnVal CAGGTCAGCACGTTGCTGTCGATTAAGACCGGAGCTTGTCCGGAAGATTGCAAATACTGC -------±--------±--------±--------±--------±--------± GlnValSerThrLeuLeuSerIleLysThrGlyAlaCysProGluAspCysLysTyrCys CCGCAAAGCTCGCGCTACAAAACCGGGCTGGAAGCCGAGCGGTTGATGGAAGTTGAACAG -------±--------±--------±--------±--------±--------± ProGlnSerSerArgTyrLysThrGlyLeuGluAlaGluArgLeuMetGluValGluGln GTGCTGGAGTCGGCGCGCAAAGCGAAAGCGGCAGGATCGACGCGCTTCTGTATGGGCGCG -------±--------±--------±--------±--------±--------± ValLeuGluSerAleArgLysAleLysAleAlaGlySerThrArgPheCysMetGlyAle GCGTGGAAGAATCCCCACGAACGCGATATGCCGTACCTGGAACAAATGGTGCAGGGGGTA -------±--------±--------±--------±--------±--------± AlaTrpLysAsnProMisGluArgAspMetProTyrLeuGluGlnMetValGlnGlyVal AAAGCGATGGGGCTGGAGGCGTGTATGACGCTGGGCACGTTGAGTGAATCTCAGGCGCAG -------±--------±--------±--------±--------±--------± LysAlaMetGlyLeuGluAlaCysMetThrLeuGlyThrLeuSerGluSerGlnAlaGln CGCCTCGCGAACGCCGGGCTGGATTACTACAACCACAACCTGGACACCTCGCCGGAGTTT -------±--------±--------±--------±--------±--------± ArgLeuAlaAsnAlaGlyLeuAspTyrTyrAsnHisAsnLeuAspThrSerProGluPhe TACGGCAATATCATCACCACACGCACTTATCAGGAACGCCTCGATACGCTGGAAAAAGTG -------±--------±--------±--------±--------±--------± T@rGlyAsnIleIleThrThrArgThrTyrGlnGluArgLeuAspThrLeuGluLysVal CGCGATGCCGGGATCAAAGTCTGTTCTGGCGGCATTGTGGGCTTAGGCGAAACGGTAAAA -------±--------±--------±--------±--------±--------± ArgAsPAlaGlyIleLysValCysSerGlyGlyIleValGlyLeuGlyGlnThrValLys GATCGCGCCGGATTATTGCTGCAACTGGCAAACCTGCCGACGCCGCCGGAAAGCGTGCCA -------±--------±--------±--------±--------±--------± AspArgAlaSlyLeuLeuLeuGlnLeuAlaAenLeuProThrProProGluSerVelPro ATCAAGATGCTGGTGAAGGTGAAAGGCACGCCGCTTGCCGATAACGATGATGTCGATGCC -------±--------±--------±--------±--------±--------± IleAenMetLeuVelLysValLysGlvThrProLeuAlaAspAenAspAspVelAspAla Table 3 (contd.) TTTGATTTTATTCACACCATTGCGGTCGCGCGGATCATGATGCCAACCTCTTACGTGCGC -------±--------±--------±--------±--------±--------± PheAsoFheIleArgThrIleAlaValAlaArgIleMetMetProThrGerTyrValArg CTTTCTGCCGGACGCGAGCAGATGAACGAACAGACTCAGGCGATGTGCTTTATGGCAGGC -------±--------±--------±--------±--------±--------± LeuGerAlaGlyArgGluGlnMetAsnGluGlnThrGlnAlaMetGysPheMetAlaGly GCAAACTCGATTTTCTACGGTTGCAAACTGCTGACCACGCCGAATCCGGAAGAAGATAAA -------±--------±--------±--------±--------±--------± AlaAsnGerIlePhaTyrGlyGysLysLeuLeuThrThrProAsnProGluGluAspLys GACCTGCAACTGTTCCGCAAACTGGGGCTAAATCCGCAGCAAACTGCCGTGCTGGCAGGG -------±--------±--------±--------±--------±--------± AspLeuGlnLeuPheArgLysLeuGlyLeuAsnProGlnGlnThrAlaValLeuAlaGly GATAACGAACAACAGCAACGTCTTGAACAGGCGCTGATGACCCCGGACACCGACGAATAT -------±--------±--------±--------±--------±--------± AspAsnGluGlnGlnGlnArgLeuGluGlnAlaLeuMetThhrProAspThrAspGluTyr TACAACGCGGCAGCATTATGAggatccaagcttgcggcctc -------±--------±- TyrAsnAlaAlaAlaLeuEnd

Cli@@@ 44mer et start GCGGCCGCGAATTCAGATCTATAATGGCTCACCGCCCACGCTGG @' stop 3' C@@@@@ 48mer at end GCGGCCGCAAGCTTGGATCCTCATAATGCTGCCGCGTTGTAA

Table 4 THE BI@@ GENE OF E.coli; DNA SEQUENCE, DERIVED AMINC ACID SEQUENCE AND PRIMEPS USED TO CONET@@@ THE GENE CASSTTE.

Ecor: @@@ gcggccgcgesttcggatccataATGGCAACGGTTAATAAACAAGCCATTGCAGCGGCATTTGGTCGGGCAGCCGCACACTAT ±--------±---------±-------±--------±--------±------- MetAlaThrValAsnLysGlnAlaIleAlaAlaAlaPheGlyArgAlaAlaAlaHisTyr GAGCAACATGCAGATCTACAGCGCCAGAGTGCTGACGCCTTACTGGCAATGCTTCCACAG ±--------±---------±-------±--------±--------±------- GluGlnHisAlaAspLeuGlnArgGlnGerAlaAspAlaLeuLeuAlaMetLeuProGln CGTAAATACACCCACGTACTGGACGCGGGTTGTGGACCTGGCTGGATGAGCCGCCACTGG ±--------±---------±-------±--------±--------±------- ArgLysTyrThrHisValLeuAspAlaGlyCysGlyProGlyTrpMetGerArgHisTrp CGGGAACGTCACGCGCAGGTGACGGCCTTAGATCTCTCGCCGCCAATGCTTGTTCAGGCA ±--------±---------±-------±--------±--------±------- ArgGluArgHisAlaGlnValThrAlaLeuAspLeuGerProProMetLeuValGlnAla CGCCAGAAGGATGCCGCAGACCATTATCTGGCGGGAGATATCGAATCCCTGCCGTTAGCG ±--------±---------±-------±--------±--------±------- ArgGlnLysAspAlaAlaAspHisTyrLeuAlaGlyAspIleGluGerLeuProLeuAla ACTGCGACGTTCGATCTTGCATGGAGCAATCTCGCAGTGCAGTGGTGCGGTAATTTATCC ±--------±---------±-------±--------±--------±------- ThrAlaThrPheAspLeuAlaTrpGerAsnLeuAlaValGlnTrpGysGlyAsnLeuGer ACGGCACTCCGCGAGCTGTATCGGGTGGTGCGCCCCAAAGGCGTGGTCGCGTTTACCACG ±--------±---------±-------±--------±--------±------- TerAlaLeuArgGluLeuTyrArgValValArgProLysGlyValValAlaPheThrThr CTGGTGCAGGGATCGTTACCCGAACTGCATCAGGCGTGGCAGGCGGTGGACGAGCGTCCG ±--------±---------±-------±--------±--------±------- LeuValGlnGluGerLeuProGluLeuHisGlnAlaTrpGlnAlaValAspGluArgPro CATGCTAATCGCTTTTTACCGCCAGATGAAATCGAACAGTCGCTGAACGGGGTGCATTAT ±--------±---------±-------±--------±--------±------- @@@AlaAsnArgPheLeuProProAspGluILeGluGlnGerLeu@@@GlyValHisTyr CAACATCATATTCAGCCCATCACGCTGTGGTTTGATGATGCGCTCAGTGCCATGCGTTCG ±--------±---------±-------±--------±--------±------- GlnHis@isIleGlnProIleThrLeuTrpPheAspAspAlaLeuGerAlaMetArgGer Table 4 (contd.) CTGAAAGGCATCGGTGCCACGCATGTTCATGAAGGGGGCGACCCGCGAATATTAACGCGT ±--------±---------±-------±--------±--------±------- LeuLysGlnIleGlyAlaThr@@@LeuHisGlnGlyArgAspProArgIleLeuThrArg TCGCAGTTGCAGCGATTGCAACTGGCCTGGCCGCAACAGCAGGGGCGATATCCTCTGACG ±--------±---------±-------±--------±--------±------- GerGlnLeuGlnArgLeuGlnLeuAleTrpProGlnGlnGlnGlyArgTyrProLeuThr TATCATCTTTTTTTGGGAGTGATTGCTCGTGAGTAAggatccaagcttgcggccgc t T TyrHisLeuPheLeuGlyValIleAlaArgGluEnd

Gl@@@ 44mer at start GCGGCCGCGAATTCGGATCCATAATGGCAACGGTTAATAAACAA

@@@@@ 4@mer et start GCGGCCGCAAGCTTGGATCCTTACTCACTCACGAGCAATCACTCC Table 5 THE BIOD GENE OF E.col@; DNA GEQUENCE, DERIVED AMING ACID SEQUENCE AND BRIMERS USED TO CONSTBUCT THE GENE CASSE@@E.

tttggatccataaTGAGTAAACGTTATTTTGTCACCGGAACGGATACCGAAGTGGGGAAAACTGTCGCCAGT --±--------±--------±--------t---------±--------t MetGerL@sArgTyrPheValThrGlyThrAspThrGluValGlyLysThrValAleGe- TGTGCACTTTTACAAGCCGCAAAGGCAGCAGGCTACCGGACGGCAGGTTATAAACCGGTC --±--------±--------±--------±--------±--------±----- CysAlaLeuLeuGlnAlaAlaLysAlaAlaGlyTyrArgThrAlaGlyTyrLysProVal GCCTCTGGCAGCGAAAAGACCCCGGAAGGTTTACGCAATAGCGACGCGCTGGCGTTACAG --±--------±--------±--------±--------±--------±----- AlaGerGlyGerGluLusThrProGluGlyLeuArgAsnGerAspAlaLeuAlaLeuGln CGCAACAGCAGCCTGCAGCTGGATTACGCAACAGTAAATCCTTACACCTTCGCAGAACCC --±--------±--------±--------±--------±--------±----- ArgAenGerGerLeuGlnLeuAspTyrAlaThrValAsnProTyrThrPheAlaGluPro ACTTCGCCGCACATCATCAGCGCGCAAGAGGGCAGACCGATAGAATCATTGGTAATGAGC t + t t t @ ThrGerProHisIleIleGerAlaGlnGluGlyArgProIleGluGerLeuValMe@Ger GCCGGATTACGCGCGCTTGAACACAAGGCTGACTGGGTGTTAGTGGAAGGTGCTGGCGGC --±--------±--------±--------±--------±--------±----- AlaGluLeuArgAlaLeuGluHisLysAlaAspTrpValLeuValGluGlyAlaGlyGly TGGTTTACGCCGCTTTCTGACACTTTCACTTTTGCAGATTGGGTAACACAGGAACAACTG --±--------±--------±--------±--------±--------±----- TrpPheThrProLeuGerAspThrPheThrPheAlaAspTrpVlaThrGlnGlnGlnLeu CCGGTGATACTGGTAGTTGGTGTGAAACTCGGCTGTATTAATCACGCGATGTTGACTGCA --±--------±--------±--------±--------±--------±----- ProValIleLeuVelValGlyValLysLeuGlyCysIleAsnHisAlaMetLeuThrAla CAGGTAATACAACACGCCGGACTGACTCTGGCGGGTTGGGTGGCGAACGATGTTACGCCT --±--------±--------±--------±--------±--------±----- GlnValIleGlnMisAlaGlyLeuThrLeuAlaGlyTrpValAlaAsnAspValThrPro Table 5 (contd.) CCGGGAAAACGTCACGCTGAATATATGACCACGCTCACCCGCATGATTCCCGCGCCGCTG --±--------±--------±--------±--------±--------±----- ProGlyLysArgHisAlaGlaTyrMetThrThrLeuThrArgMetIleProAleProLeu CTGGGAGAGATCCCCTGGCTTGCAGAAAATCCAGAAAATGCGGCAACCGGAAAGTACATA ------------±--------±--------±--------±--------±----- LeuGlyGluIleProTrpLeuAlaGluAsnProGluAsnAlaAiaThrGlyLysTyrIle AACCTTGCCTTGTTGTAGatctaagcttctaga --±--------±--- AsnLeuAlaLeuLeuEnd

r. start 41@er et start TCTAGAATTCGGATCCATAATGAGTAAACGTTATTTTGTCA

5' stop 3' @@@@@@@ @@@@2 et end TCTAGAAGCTTAGATCTACAACAAGGCAAGGTTTATGT

Table 6 THE BIOF GENE OF E.coli: DNA SEQUENCE, DERIVED AMINC ACID SEQUENCE AND PRIMERS USED TO CONSTRUCT THE GENE CASSETTE.

@@@@ @@gcttggatccataATGAGCTGGCAGGAGAAAATCAACGCGGCGCTCGATGCGCGGCGTGCTGCCGATGCCCTG -------±--------±--------±--------±--------±--------± MetGerTrpGlnGluLysIleAsnAlaAlaLeuAspAlaArgArgAlaAlaAspAlaLeu CGTCGCCGTTATCCGGTGGCGCAAGGAGCCGGACGCTGGCTGGTGGCGGATGATCGCCAG -------±--------±--------±--------±--------±--------± ArgArgArgTyrProValAlaGlnGlyAlaGlyArgTrpLeuValAlaAspAspArgGln TATCTGAACTTTTCCAGTAACGATTATTTAGGTTTAAGCCATCATCCGCAAATTATCCGT -------±--------±--------±--------±--------±--------± TyrLeuAsnPheGerGerAsnAspTyrLeuGlyLeuGerHisHisProGlnIleIleArg GCCTGGCAGCAGGGGGCGGAGCAATTTGGCATCGGTAGCGGCGGCTCCGGTCACGTCAGC -------±--------±--------±--------±--------±--------± AlaTrpGlnGlnGlyAlaGluGlnPheGlyIleGlyGerGlyGlyGerGlyHisValGer GGTTATAGCGTGGTGCATCAGGCACTGGAAGAAGAGCTGGCCGAGTGGCTTGGCTATTCG -------±--------±--------±--------±--------±--------± GlyTyrGerValVelHisGlnAlaLeuGluGluGluLeuAlaGluTrpLeuGlyTyrGer CGGGCACTGCTGTTTATCTCTGGTTTCGCCGCTAATCAGGCAGTTATTGCCGCGATGATG -------±--------±--------±--------±--------±--------± ArgAlaLeuLeuPheIleGerGlyPheAleAleAenGlnAleValIleAleAlaMetMet GCGAAAGAGGACCGTATTGCTGCCGACCGGCTTAGCCATGCCTCATTGCTGGAAGCTGCC -------±--------±--------±--------±--------±--------± AlaLysGluAspArgIleAlaAleAspArgLeuGerHisAlaGerLeuLeuGluAlaAla AGTTTAAGCCCGTCGCAGCTTCGCCGTTTTGCTCATAACGATGTCACTCATTTGGCGCGA -------±--------±--------±--------±--------±--------± GerLeuGerProGerGlnLeuArgArgPheAlaHisAsnAspValThrHisLeuAlaArg TTGCTTGCTTCCCCCTGTCCGGGGCAGCAAATGGTGGTGACAGAAGGCGTGTTCAGCATG -------±--------±--------±--------±--------±--------± LeuLeuAlaGerProCysProGlyGlnGlnMetValValThrGluGlyValPheGerMet GACGGCGATAGTGCGCCACTGCGAATCCAGCAGGTAACGCAACAGCACAATGGCTGGTTG -------±--------±--------±--------±--------±--------± AspGlyAspGerAlaProLeuArgIleGlnGlnValThrGlnGlnHisAsnGlyTrpLeu ATGGTCGATGATGCCCACGGCACGGGCGTTATCGGGGAGCAGGGGCGCGGCAGCTGCTGG -------±--------±--------±--------±--------±--------± MetValAspAspAlaHisGlyThrGlyValIleGlyGlyGlnGlyArgGlyGerCysTrp CTGCAAAAGGTAAAACCAGAATTGCTGGTAGTGACTTTTGGCAAAGGATTTGGCGTCAGC -------±--------±--------±--------±--------±--------± LeuGlnLysValLysProGluLeuLeuValValThrPheGlyLysGlyPheGlyValGer Table 6 (contd.) FIGURE 7.sart@ GGGGCAGCGGTGCTTTGCTCCAGTACGGTGGCGGATTATCTGCTGCAATTCGCCCGCCAC -------±--------±--------±--------±--------±--------± GlyAlaAleVelLeuCysGerGerThrValAlaAspTyrLeuLeuGlnPheAlaArgHis CTTATCTACASSACCAGTATGCCGCCCGCTCAGGCGCAGGCATTACGTGCGTCGCTGGCG -------±--------±--------±--------±--------±--------± LeuIletyrGerThrGerMetProProAieGlnAlaGlnAleLeuArgAlaGerLeuAla GTCATTCGCAGTGATGAGGGTGATGCACGGCGCGAAAAACTGGCGGCACTCATTACGCGT -------±--------±--------±--------±--------±--------± ValIleArgGerAspGluGlyAspAlaArgArgGlyLysLeuAlaAlaLeuIleThrArg TTTCGTGCCGGAGTACAGGATTTGCCGTTTACGCTTGCTGATTCATGCAGCGCCATCCAG -------±--------±--------±--------±--------±--------± PheArgAlaGlyValGlnAspLeuProPheThrLeuAlaAspGerGysGerAlaIleGln CCATTGATTGTCGGTGATAACAGCCGTGCGTTACAACTGGCAGAAAAACTGCGTCAGCAA -------±--------±--------±--------±--------±--------± ProLeuIleValGlyAspAsnGerArgAlaLeuGlnLeuAlaGluLysLeuArgGlnGln GG@@GCTGGTCA@GGCGATTCGCCCGCCAACCGTA@@@@GCTGGTACTGCGCGACTGCGC -------±--------±--------±--------±--------±--------± GlyGysTrpValThrAlaIleArgProProThrValProAlaGlyThrAlaArgLeuArg TTAACGCTAACCGCTGCGCATGAAATGCAGGATATCGACCGTCTGCTGGAGGTGCTGCAT -------±--------±--------±--------±--------±--------± LeuThrLeuThrAlaAleHisGluMetGlnAspIleAspArgLeuLeuGluValLeuHis GGCAACGGTTAA@gat@tg@atctg -------±-- GlyA@@GlyEnd @@@@ 5' s@@@@ 3' @@@@@@@@@@@@ AA@@@@@@@@@@ATAATSAGCTGGCAGGAGGCGGC

5' stop 3' @@@@@@ @@@@ et end CASCTGCAGATCTTTAACCGTTGCCATGCATGCACCTCCAGCA

Claims (1)

1. Claims 1. A plasms capable of replication and. expression in an organism other than Escherichia coli and containing one or more derived genes said genes being derived from an E.coli, bioA. bioB bioC biQ or bio gene.

   2. A plasmid according to claim 1 containin only one derived gene said one derived gene being derived from any one of the E. coli bioA. bioB bioC, bioD or bioF genes.

   3. A plasmid according to claim 1 or 2 wherein the derived gene is a gene derived from an E. coli bioA, bioB, bioC bio or bioF gene and having its codon sequence modified in favour of the organism other than E. coli 4. A plasmid according to claim 3 wherein the derived gene is an E coli bio B gene mollified in favour of the yeast Sacch. cerevisiae.

   5. A plasmid according to claim 1 or 2 capable of replication in yeasts, fungi. lactobacillus or other bacteria.

   6. A plasmid according to claim 5 capable of replication in the yeast Sacch. cerevisiae.

   7. A plasms @ according to claim 5 or 6 comprising the said derived gene combined with the plasmid pMA91, pMA36c. pKV49 or pCK495.

   8. A plasmid according to any one of the preceding claims which contains no E. coli promoters, attenuation sequences, Shine Dalgarno sequences or fragments acting on the derived gene or genes.

   9. A method of use of a plasmid as claimed in any one of claims 1 to 3. as a vector for the genetic transformation of a microorganism.

   10. A microrganism comprising a microorganism which has been transformed by insertion of a plasmid as claimed in any one of claims 1 to 8.

   11. A plasmi-1 containing one or more derived genes said genes being derived from an E. coli bioA. bioB, bioC. bioD or bioF gene and containing no E. coli control sequences in a position to act on said derived gene.

   12. A plasmi according to claim 11 and containing only one derived gene. being erived from an E.coli bioA gene.

   1?. A plasmi? according to claim 11 and containing only one derived gene being derived from an E.coli bioB gene 14. A plasmid according to claim 11 and containing only one derived gene being derived from an E.coli bioC gene.

   15. A plasmid according to claim 11 and containing only one derived gene. being derived from an E.coli bio D gene.

   16. A plasmid according to claim 11 and containing only one derived gene being derived from an E.coli bio, gene.

   17. A method for preparing a plasmid which comprises the steps: (1) using the phage Charon 4A to take up the whole of the biotin operon containing the bioA bioB, bioC bioD and bio F genes from E.coli (2) isolating the DNA containing the biotin operon rom the said phage (@) excising a length of the said DNA known to contain the biotin operon using restriction enzymes (4) combining the fragment from (#) with a plasmid suitable for cloning (5) separating the bioA, bioB. bioC bioD and bio genes and then reinserting one or more of them into genetic material to form a plasmi-..

   l. Use of a method as claimed in claim 17 to prepare a plasmid as claimed in any one of claims 1 to 8 or 11 to 16.

   19. A plasmid according to any one of claims 1 to 8 or 11 to 16 substantially as hereinbefore described with reference to the accompanying figures.

   20. A method according to claim 17 or 1 substantially as herienbefore described with reference to the accompanying figures.