CA2063758A1 - Genetic fingerprinting of yeasts - Google Patents
Genetic fingerprinting of yeastsInfo
- Publication number
- CA2063758A1 CA2063758A1 CA002063758A CA2063758A CA2063758A1 CA 2063758 A1 CA2063758 A1 CA 2063758A1 CA 002063758 A CA002063758 A CA 002063758A CA 2063758 A CA2063758 A CA 2063758A CA 2063758 A1 CA2063758 A1 CA 2063758A1
- Authority
- CA
- Canada
- Prior art keywords
- primers
- yeast
- targeted
- sequence
- long terminal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
- C12P17/185—Heterocyclic compounds containing sulfur atoms as ring hetero atoms in the condensed system
- C12P17/186—Heterocyclic compounds containing sulfur atoms as ring hetero atoms in the condensed system containing a 2-oxo-thieno[3,4-d]imidazol nucleus, e.g. Biotin
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
ABSTRACT.
GENETIC FINGERPRINTING OF YEAST.
The present invention relates to the identification of yeast strains by way of application of the polymerase chain reaction to amplify nucleic acid sequences characteristic of their TY transposon long terminal repeats. Polymerase chain reaction product is analysed, conveniently by agarose gel electrophoresis, and its nature related to the presence of a particular yeast strain or strain type.
GENETIC FINGERPRINTING OF YEAST.
The present invention relates to the identification of yeast strains by way of application of the polymerase chain reaction to amplify nucleic acid sequences characteristic of their TY transposon long terminal repeats. Polymerase chain reaction product is analysed, conveniently by agarose gel electrophoresis, and its nature related to the presence of a particular yeast strain or strain type.
Description
2 ~
GENETIC FINGERPRINTING OF YEAST~.
The present invention relates to the identification of yeast strains by way of nucleic acid sequences which vary in their frequency of occurrence and distribution from strain to strain. In particular the present invention provides for the polymerase chain reaction amplification of these characteristic sequences such that production of amplified nucleic acid product will depend upon the par-ticular strain or mixture of strains under investigation.
The genetic fingerprinting of yeasts is a technique which should, inter alia, offer the yeast supply industry, the fermenting industry and others making yeast derived products the ability to monitor their strains for variation and thus improve their quality assurance. Such variations might have deleterious effect upon the quality of products and thus it is vital that a yeast strain can be identified and d:if-ferentiated from any contaminant yeast strains. Ideally such technique should identify characteristics which vary in a stable manner from strain to strain. A number of approaches have been used to tackle this problem, for example RFLP gene mapping (Panchal et al.,l987), TAFE (Petering et al.,l988) and OFAGE (Takata et al.,l989) which identify differences in chromosomal length.
More recently Walmsley et al. (1989) used probes to the telomere regions of Saccharomvces cerevisiae to differentiate between closely related strains, a method that works outside Saccharomyces species, while Van Vuuren and Van der Meer, (1987) have used protein electrophoresis to give characteristic patterns. These and the above methods are costly in time and materials and limit the number of samples which can be processed.
The present inventors have exploited a different approach based upon characteristic TY regions of the yeast DNA. In 1979 Cameron et al.
showed that the transposon TYl exists in about 35 copies in the haploid genome of Saçcharomyces cerevisiae and that its distribution g showed some strain to strain variation. It was also shown that the terminal repeats (delta seguences) of the transposon occur independently at a rate of approximately 100 copias per haploid genome. These "solo" deltas were thought to be the result of previous transposition events where the central part of the TY element has been lost through homologous recombination and the clelta sequence remains as a "footprint".
The terminal delta sequences from TYl and TY2 have been found to associate themselves with tRNA gene regions (del Rey et al.,1983;
Lochmuller et al.,1989) while other terminal repeat elements such as sigma from TY3 (Clark et al.,1988) and tau from TY4 (Chisholm et al.,1984) are also found in the so called recombination "hotspots".
Analysis of the DNA sequences in these areas has now revealed that the delta and sigma elements contain regions of conserved sequence and that the distance between TY elements in SaGcharomyces c~revisiae is characterstic of each strain or strain type.
The present inventors have provided a method of determining the identity of a yeast as being of a characteristic strain or strain type by use of the polymerase chain reaction (PCR) to produce products characteris-tic of the yeast's TY long terminal repeat distribution.
Using the PCR to amplify specific regions of DNA in vitro using the thermostable Taq polymerase with specifically designed synthetic oligonucleotide primers targeted at amplifying the parts of the 'ho-tspot' regions they have found that products characteristic of particular yeast strains or strain types can be obtained.
As the nucleic acid sequences of these repeat elements are found to occur running in both directions within the yeast genome this method allows use of odd numbers of primers directed at their characteristic sequences to derive amplification products; thus even a single primer may potentially give rise to a characterising product which may contain different components to that obtained with multiple primers.
g Though the primers can ba used in single or pairwise combinations, it has been particularly found that use of the polymerase chain reaction (PCR) in a four primer multiplex system gives a pattern which is particularly adapted Por allowing practical comparison between strains, eg. in an industrial test timescale needing ~4 hour turnaround. This method avoids the need to isolate and purify DNA
from yeast, and produces a rapid fingerprint which can be visualised by agarose gel electrophoresis within a working day.
Multiplex PCR fingerprinting of Saccha~Qmvces cerevisiae offers the opportunity not only of improved characterising capability over existing techniques, but also allows introduction of previously impracticable analytical tests. ~any pure research ]aboratories routinely use a variety of yeast strains, each with different genetic markers and chromosomal complements. Verification of each strain at the beginning of, and throughout, a long term piece of research can be time consuming but essential work. The enablement of the application of PCR in fingerprinting provided by the present invention can not only speed up this process, but also allows rapid authentication of the yeast progeny from mating experiments, and confirmation of the relationship between a diploid yeast and its two haploid parents.
An important consideration for both research scientist and industrialist alike is strain stability. PCR fingerprinting off`ers due opportunity to monitor natural variation in a strain over a period of years or decades of continuous or discontinuous use.
The test provides sensitivity inter alia because several different sites within the yeast genome are all challenged simultaneously, and the answer to each challenge is an all-or-nothing event. The PCR
profile depends upon the juxtaposition of TY long terminal repeat elements which are unlikely to have any bearing upon the biochemical characteristics of the particular yeast strain. This autonomy enables conflrmation of integrity of a yeast strain which may have given an otherwise ambiguous biochemical test result.
4 ~ $
As well as strain stability the test offers the ability to monitor the relative levels of strains within a mixed culture oP saccharom~ç~
cerevisiae. This is important to brewers who may feel that the particular characteristics of their product rely upon maintenance of perhaps a minority yeast strain population within the starter culture. Once each individual strain has been identified and fingerprinted, any deviation from a diagnostic pattern in terms of proportion or type can be readily detected. This also means that introduction of a wild Saccharomyces cerevisiae yea~t into a culture can be detected with equal ease, allowing the brewer to intervene much more swiftly than previously possible. By using the PCR fingerprint of the wild yeast the cause of the contamination can be traced eg. to one of the raw materials. This quality control aspect cannot be over emphasized. Currently, microbiological testing of a fermentation process is often an after-the-event exercise des:igned only to pinpoint the batch where a particular problem may have arisen. Since, with the present, same day results are st~dard, on-line surveillance of yeast would be possible even in ale fermentations which last only a few days. This would allow the brewer to determine -that no detrimental change had occured to his yeast since inoculation with the starter, and enable him with confidence to use the final biomass for re-pitching.
In its broadest aspect the present invention provides a method for characterising a yeast as being of a particular strain or strain type comprising:
(a) carrying out a polymerase chain reaction using the nucleic acid of the yeast as the reaction template and one or more oligonucleotide primers which are each targeted at nucleic acid sequences characteristic of yeast TY transposon long terminal repeats and (b) determining the nature of the reaction product from (a) and relating that to the presence of a particular yeast strain or strain type.
2 ~ ~ 3 ~ , ~
The TY transposon long terminal repeats of yeast are typically of some 300 base pairs in length and many such repeat sequences may be found detailed in the literature and commerc~ally available data bases as will be known to the man skilled in the art; eg. from the EMBL data library, Germany. While it is found that targeting of TY transposon long terminal repeats alone will be enough to distinguish between many yeasts the optional targeting of addi~ional primers at o-ther parts of the yeast genome is advantageously used in tandem with these.
A particularly efficacious form of the method of the present invention is provided wherein Pour or more oligonucleotide primers are used and two are targeted at each of two characteristic sequences selected.
Particularly effectively all the primers will be targeted at sequences characteristic of the yeast TY transposon long terminal repeats; more particularly those sequences characteristic of delta, slgma ancl/or tau element long terminal repeats.
Primers showing good ability to distinguish between various yeasts include those targeted at a sequence characteristic of the TYl delta element long terminal repeats and primers targeted at a sequence characteristic oP TY3 sigma element long terminal repeats and particularly good results are obtained if a four primer multiplex PCR
is carried out using a pair of primers for each of these repeats.
The delta and sigma long terminal repeats are of about 300 base pairs in length and characteristic sequences within them may be targeted by a variety of primers with a resultant variation in product for a yeast under investigation. Suitable primers for characterising purposes may be selected by trial and error. Examples of primers targeted at the TYl delta element long terminal repeats that have been found to be particularly satisfactory in achieving distinctive patterns are those targeted at the double stranded DNA sequence I:
5'- AGCCTrrATCAACAATGGMTCCCM CAATTATCT -3' SEQUENCE I
GENETIC FINGERPRINTING OF YEAST~.
The present invention relates to the identification of yeast strains by way of nucleic acid sequences which vary in their frequency of occurrence and distribution from strain to strain. In particular the present invention provides for the polymerase chain reaction amplification of these characteristic sequences such that production of amplified nucleic acid product will depend upon the par-ticular strain or mixture of strains under investigation.
The genetic fingerprinting of yeasts is a technique which should, inter alia, offer the yeast supply industry, the fermenting industry and others making yeast derived products the ability to monitor their strains for variation and thus improve their quality assurance. Such variations might have deleterious effect upon the quality of products and thus it is vital that a yeast strain can be identified and d:if-ferentiated from any contaminant yeast strains. Ideally such technique should identify characteristics which vary in a stable manner from strain to strain. A number of approaches have been used to tackle this problem, for example RFLP gene mapping (Panchal et al.,l987), TAFE (Petering et al.,l988) and OFAGE (Takata et al.,l989) which identify differences in chromosomal length.
More recently Walmsley et al. (1989) used probes to the telomere regions of Saccharomvces cerevisiae to differentiate between closely related strains, a method that works outside Saccharomyces species, while Van Vuuren and Van der Meer, (1987) have used protein electrophoresis to give characteristic patterns. These and the above methods are costly in time and materials and limit the number of samples which can be processed.
The present inventors have exploited a different approach based upon characteristic TY regions of the yeast DNA. In 1979 Cameron et al.
showed that the transposon TYl exists in about 35 copies in the haploid genome of Saçcharomyces cerevisiae and that its distribution g showed some strain to strain variation. It was also shown that the terminal repeats (delta seguences) of the transposon occur independently at a rate of approximately 100 copias per haploid genome. These "solo" deltas were thought to be the result of previous transposition events where the central part of the TY element has been lost through homologous recombination and the clelta sequence remains as a "footprint".
The terminal delta sequences from TYl and TY2 have been found to associate themselves with tRNA gene regions (del Rey et al.,1983;
Lochmuller et al.,1989) while other terminal repeat elements such as sigma from TY3 (Clark et al.,1988) and tau from TY4 (Chisholm et al.,1984) are also found in the so called recombination "hotspots".
Analysis of the DNA sequences in these areas has now revealed that the delta and sigma elements contain regions of conserved sequence and that the distance between TY elements in SaGcharomyces c~revisiae is characterstic of each strain or strain type.
The present inventors have provided a method of determining the identity of a yeast as being of a characteristic strain or strain type by use of the polymerase chain reaction (PCR) to produce products characteris-tic of the yeast's TY long terminal repeat distribution.
Using the PCR to amplify specific regions of DNA in vitro using the thermostable Taq polymerase with specifically designed synthetic oligonucleotide primers targeted at amplifying the parts of the 'ho-tspot' regions they have found that products characteristic of particular yeast strains or strain types can be obtained.
As the nucleic acid sequences of these repeat elements are found to occur running in both directions within the yeast genome this method allows use of odd numbers of primers directed at their characteristic sequences to derive amplification products; thus even a single primer may potentially give rise to a characterising product which may contain different components to that obtained with multiple primers.
g Though the primers can ba used in single or pairwise combinations, it has been particularly found that use of the polymerase chain reaction (PCR) in a four primer multiplex system gives a pattern which is particularly adapted Por allowing practical comparison between strains, eg. in an industrial test timescale needing ~4 hour turnaround. This method avoids the need to isolate and purify DNA
from yeast, and produces a rapid fingerprint which can be visualised by agarose gel electrophoresis within a working day.
Multiplex PCR fingerprinting of Saccha~Qmvces cerevisiae offers the opportunity not only of improved characterising capability over existing techniques, but also allows introduction of previously impracticable analytical tests. ~any pure research ]aboratories routinely use a variety of yeast strains, each with different genetic markers and chromosomal complements. Verification of each strain at the beginning of, and throughout, a long term piece of research can be time consuming but essential work. The enablement of the application of PCR in fingerprinting provided by the present invention can not only speed up this process, but also allows rapid authentication of the yeast progeny from mating experiments, and confirmation of the relationship between a diploid yeast and its two haploid parents.
An important consideration for both research scientist and industrialist alike is strain stability. PCR fingerprinting off`ers due opportunity to monitor natural variation in a strain over a period of years or decades of continuous or discontinuous use.
The test provides sensitivity inter alia because several different sites within the yeast genome are all challenged simultaneously, and the answer to each challenge is an all-or-nothing event. The PCR
profile depends upon the juxtaposition of TY long terminal repeat elements which are unlikely to have any bearing upon the biochemical characteristics of the particular yeast strain. This autonomy enables conflrmation of integrity of a yeast strain which may have given an otherwise ambiguous biochemical test result.
4 ~ $
As well as strain stability the test offers the ability to monitor the relative levels of strains within a mixed culture oP saccharom~ç~
cerevisiae. This is important to brewers who may feel that the particular characteristics of their product rely upon maintenance of perhaps a minority yeast strain population within the starter culture. Once each individual strain has been identified and fingerprinted, any deviation from a diagnostic pattern in terms of proportion or type can be readily detected. This also means that introduction of a wild Saccharomyces cerevisiae yea~t into a culture can be detected with equal ease, allowing the brewer to intervene much more swiftly than previously possible. By using the PCR fingerprint of the wild yeast the cause of the contamination can be traced eg. to one of the raw materials. This quality control aspect cannot be over emphasized. Currently, microbiological testing of a fermentation process is often an after-the-event exercise des:igned only to pinpoint the batch where a particular problem may have arisen. Since, with the present, same day results are st~dard, on-line surveillance of yeast would be possible even in ale fermentations which last only a few days. This would allow the brewer to determine -that no detrimental change had occured to his yeast since inoculation with the starter, and enable him with confidence to use the final biomass for re-pitching.
In its broadest aspect the present invention provides a method for characterising a yeast as being of a particular strain or strain type comprising:
(a) carrying out a polymerase chain reaction using the nucleic acid of the yeast as the reaction template and one or more oligonucleotide primers which are each targeted at nucleic acid sequences characteristic of yeast TY transposon long terminal repeats and (b) determining the nature of the reaction product from (a) and relating that to the presence of a particular yeast strain or strain type.
2 ~ ~ 3 ~ , ~
The TY transposon long terminal repeats of yeast are typically of some 300 base pairs in length and many such repeat sequences may be found detailed in the literature and commerc~ally available data bases as will be known to the man skilled in the art; eg. from the EMBL data library, Germany. While it is found that targeting of TY transposon long terminal repeats alone will be enough to distinguish between many yeasts the optional targeting of addi~ional primers at o-ther parts of the yeast genome is advantageously used in tandem with these.
A particularly efficacious form of the method of the present invention is provided wherein Pour or more oligonucleotide primers are used and two are targeted at each of two characteristic sequences selected.
Particularly effectively all the primers will be targeted at sequences characteristic of the yeast TY transposon long terminal repeats; more particularly those sequences characteristic of delta, slgma ancl/or tau element long terminal repeats.
Primers showing good ability to distinguish between various yeasts include those targeted at a sequence characteristic of the TYl delta element long terminal repeats and primers targeted at a sequence characteristic oP TY3 sigma element long terminal repeats and particularly good results are obtained if a four primer multiplex PCR
is carried out using a pair of primers for each of these repeats.
The delta and sigma long terminal repeats are of about 300 base pairs in length and characteristic sequences within them may be targeted by a variety of primers with a resultant variation in product for a yeast under investigation. Suitable primers for characterising purposes may be selected by trial and error. Examples of primers targeted at the TYl delta element long terminal repeats that have been found to be particularly satisfactory in achieving distinctive patterns are those targeted at the double stranded DNA sequence I:
5'- AGCCTrrATCAACAATGGMTCCCM CAATTATCT -3' SEQUENCE I
3'- TCGGA M TAG~TGTTACCTTAGGGTTGTTAATAGA -5' 6 ~37~
An example of a suitable primer pair targeted at sequence I are oligonucleotides consisting of sequences II and III respectively:
5'- GAATCCCAACAATTATCT -3' SEQUENCE II
3'- TCGGAAATAGTTGTTACC -5' SEQUENCE III
Primers targeted at the TY3 sigma element long terminal repeats that have been found to be particularly satis~actory are those targeted at the double stranded DNA sequence IV:
5'- ACAGTTTATCAGATTAATTCACGGAATGTTACTTATCTT -3' SEQUENCE IV
3'- TGTCAAATAGTCTAATTAAGTGCCTTACAATGAATAGAA -5' An example of a suitable primer pair targeted at sequence IV are oligonucleotides consisting of sequences V and VI respectively:
5'- ACGGAATGTTACTTATCrT -3' SEQUENCE V
3'- TGTCAAATAGTCTAATTAAG -5' SEW ENCE VI
The yeast nucleic acid to be characterised may be included in the PCR
reaction mixture in isolated form but is conveniently provided as whole yeast cells. For example cultured yeast sample grown on an agar growth plate or yeast cells grown in liquid culture may be utilised.
In the case of agar cultures a sterile implement may be used to transfer a small part of a colony, eg. about 0.2mg, to a volume of sterile water, preferably cold, eg. 4C or less, in a PCR reaction tube wherein the yeast cells are resuspended and used directly with PCR reaction components.
2~3~
In the case of liquid cultures a sample volume eg.100~1 of yeast cells from overnight growth in liquid culture is conveniently transferred to a sterile microcentrifuge tube, centrifuged to provide a pellet (eg.
for ~l eppendorf tube using an eppendorf centrifuge - 18,000 rpm for 5 seconds) and the supernatant is removed. A small part of the pellet is resuspended in sterile water as before directly in the PCR reaction tube and used directly with PCR reaction components.
The polymerase chain reaction may thus be carried out by mixing the resuspended sample with all the other reaction components, covering the mixture with a sterile oil (eg. paraffin) overlay and then sub~ecting the mixture to cycles of temperature suitable for denaturing target duplexes, for annealing of primers to them and for primer extension to produce oligonucleotide fragments in the known way.
The cycles of temperature preferably comprise primer annealing periods a-t between 45C and 62C. Using the primers II, III, V and VI the optimu~ primer annealing period temperature for production of readily distinguished product is between 50C and 55C. This temperature will vary, as will be understood by the man skilled in the art, with the length of the primers and the ratio of the bases G, C, T, A therein, and thi~ priciple will of course apply whichever transposon long terminal repeat sequence/primer combina-tion is selected.
sibilt~ studv:
Four primers II, III, V and VI were designed for their ability to amplify TY element long terminal repeats of selected yeast strains. A
wide variety of yeast strains were chosen for evaluation of the PCR
fingerprinting technique. All the baking, distilling, lager and wine strains in the UK National Collection of Yeast Cultures were tested.
In addition, a selection of the ale and general strains were also examined. The results are presented below.
o ~ 7 5 ~
Strain type Number examined Number of distinct patterns A Ale 100 58 B Baking 12 12 D Distilling l~ l~
G General lZ 11 L Lager 63 26 W Wine 29 26 Total 220 137 When Southern blots of restriction-digested chromosomal DNA from dif~erent strains were probed with del-ta se~uences from TYl, patterns were found which readily enabled strain differentlation. ~owever, this method requires the isolation, puriPication, restriction, blotting and Southern analysis of DNA from each yeast strain.
The present invention essentially replaces this time consuming. highly skilled process with one which enables a large sample throughput by relatively unskilled personnel. Moreover, the fragments produced are generally below 2kb in length allowing the results to be easily interpreted following electrophoresis on a 1.5% agarose gel.
The method of -~he present invention will now be illustrated by way of exemplification only by reference to the Pollowing Figure and protocol example but it will be understood that the number and nature of the primers and conditions shown therein may be varied within its scope.
FIGURE.
Figure 1: shows the agarose gel electrophoresis patterns given by multiplex PCR of thirteen diPferent NCYC yeast samples using the primers II, III, V and VI as described herein. * = DNA standard~
2~738 EXAMPLE.
Methods: Taq polymerase was used in 5 units/~l concentration.
2'-deoxynucleoside 5'-triphosphate solutions (lOOmM) were obtained from Pharmacia. Oligonucleotide primeræ II, III, V and VI were synthesized on ~n Applied Biosystems 381A DNA synthesi~er using phosphoramidite chemistry and were diluted in lOmM TrisHCl pH7.6, lmM
EDTA to lOOO~g/ml and stored as frozen stocks.
Yeast strains for testing were obtained from the UK National Collection of Yeast Cultures. The yeasts were cultured on YEPD media containing (per litre) lOg Bacto yeast extract, 20g Bacto peptone, 20g glucose, 20g Oxoid agar. Following growth on plates A sample of colony waæ removed approx (0~2mg) and resuspended in lOul ice cold sterile water. 90ul of PCR mix was then added and the reaction mix covered ~ith 60,ul of sterile paraffin oil overlay.
The final reaction mix contains:
10 mM Tris.HCl pH 9.0 50 mM KCl 1.5 mM MgCl2.
0.1 % gelatln (w/v) 0.1 % Triton X-lOO
0.2 mM dATP
O.2 mM dCTP
o.? mM dGTP
0.2 mM dTTP
200ng of each of the four primers Two uniks of Taq polymerase were used per reaction.
Reactions were carried ou~ in a Hybaid Thermal Reactor on plate control for 30 cycles of 92C for 2 minutes, 52C for 3 minutes and 72C for 2 minutes.
2~37~
Electro~horesis: Agarose gel was prepared by standard methods (see Maniatis et al: Molecular Cloning~ A Laboratory Manual, Second Edition, Pub. Cold Spring Harbour Laboratory Press 19~9) using 150ml TBE electrophoresis buffer ~10.8g Tris Base, 5.5g boric acid, 4ml 0.5M
EDTA (pH 8.0) per litre) to 2.25~ agarose. Approximately 20ul aliquots of PCR post reaction mixtures with added loading dye are placed in gel slots made by a lmm well comb. Unamplified ~X174 HaeIII
or lambda BstEII DNA made up in 788,ul sterile water, 100~1 of reaction buffer (lOOmM Tris.HCl pH 9.0, 500~M KCl, 15mM MgCl2 1% gelatin, 1%
Triton X-100), 8ul oP a mix of lOul each of the lOOmM 2'-deoxy -nucleoside-5'-triphosphate solutions, and 2~1 of lOOO~g/ml of each primer is placed in a further slot and is run with the reaction samples as a standard.
Electrophoresis was carried out using a constant voltage of 100 volts applied across the gel, positive electrode at the bottom, f`or a period of about 4 hours until the blue dye has migrated about lOcm.
The gels are developed using ethidlum bromide ~care, mutagen) at a concentration of 0.5mg/litre for 30 minutes and viewed under UV light illumination at 302nm.
The electrophoresis patterns produced proved suitable for the purpose of characterising individual yeast strains or strain types sufficient for ready identification of presence of contaminant yeast to be possible by comparison with standard yeast PCR product patterns. As the products include a variety of oligonucleotide and polynucleotide components derived from sequences found between any two primer hybridization sites it will be seen that performance of two or more PCRs using a different combinations of primers on a given yeast sample each time will provide still further resolving power in investigation of its identity.
It will be realised by the person skilled in the art that the term 'targeted at' as used to describe the primers used in the method of the present invention means that these are capable of hybridi~ing with ~ r~
the target sequences with 8 specificity high enough to avoid binding to other parts of the yeast genome to any significant degree. While such specificity may be provided by less than 100~ match (G to C and T to A) it is convenlent in practice to utilise such 100% match. It will be understood how~ver that the lenæth of a ~pecific primer need not be anything like that of the sequence toward which it is targeted and that suitable primer lengths ~ill thus be of shorter length that their target sequence, conveniently these primers being of the order of 10 to 30 bases long.
In this regard, the present invention further provides kits for performing the method of the present invention, said kits comprising one or more oligonucleotide polymerase chain reaction primers as described in this specification and claimed below.
An example of a suitable primer pair targeted at sequence I are oligonucleotides consisting of sequences II and III respectively:
5'- GAATCCCAACAATTATCT -3' SEQUENCE II
3'- TCGGAAATAGTTGTTACC -5' SEQUENCE III
Primers targeted at the TY3 sigma element long terminal repeats that have been found to be particularly satis~actory are those targeted at the double stranded DNA sequence IV:
5'- ACAGTTTATCAGATTAATTCACGGAATGTTACTTATCTT -3' SEQUENCE IV
3'- TGTCAAATAGTCTAATTAAGTGCCTTACAATGAATAGAA -5' An example of a suitable primer pair targeted at sequence IV are oligonucleotides consisting of sequences V and VI respectively:
5'- ACGGAATGTTACTTATCrT -3' SEQUENCE V
3'- TGTCAAATAGTCTAATTAAG -5' SEW ENCE VI
The yeast nucleic acid to be characterised may be included in the PCR
reaction mixture in isolated form but is conveniently provided as whole yeast cells. For example cultured yeast sample grown on an agar growth plate or yeast cells grown in liquid culture may be utilised.
In the case of agar cultures a sterile implement may be used to transfer a small part of a colony, eg. about 0.2mg, to a volume of sterile water, preferably cold, eg. 4C or less, in a PCR reaction tube wherein the yeast cells are resuspended and used directly with PCR reaction components.
2~3~
In the case of liquid cultures a sample volume eg.100~1 of yeast cells from overnight growth in liquid culture is conveniently transferred to a sterile microcentrifuge tube, centrifuged to provide a pellet (eg.
for ~l eppendorf tube using an eppendorf centrifuge - 18,000 rpm for 5 seconds) and the supernatant is removed. A small part of the pellet is resuspended in sterile water as before directly in the PCR reaction tube and used directly with PCR reaction components.
The polymerase chain reaction may thus be carried out by mixing the resuspended sample with all the other reaction components, covering the mixture with a sterile oil (eg. paraffin) overlay and then sub~ecting the mixture to cycles of temperature suitable for denaturing target duplexes, for annealing of primers to them and for primer extension to produce oligonucleotide fragments in the known way.
The cycles of temperature preferably comprise primer annealing periods a-t between 45C and 62C. Using the primers II, III, V and VI the optimu~ primer annealing period temperature for production of readily distinguished product is between 50C and 55C. This temperature will vary, as will be understood by the man skilled in the art, with the length of the primers and the ratio of the bases G, C, T, A therein, and thi~ priciple will of course apply whichever transposon long terminal repeat sequence/primer combina-tion is selected.
sibilt~ studv:
Four primers II, III, V and VI were designed for their ability to amplify TY element long terminal repeats of selected yeast strains. A
wide variety of yeast strains were chosen for evaluation of the PCR
fingerprinting technique. All the baking, distilling, lager and wine strains in the UK National Collection of Yeast Cultures were tested.
In addition, a selection of the ale and general strains were also examined. The results are presented below.
o ~ 7 5 ~
Strain type Number examined Number of distinct patterns A Ale 100 58 B Baking 12 12 D Distilling l~ l~
G General lZ 11 L Lager 63 26 W Wine 29 26 Total 220 137 When Southern blots of restriction-digested chromosomal DNA from dif~erent strains were probed with del-ta se~uences from TYl, patterns were found which readily enabled strain differentlation. ~owever, this method requires the isolation, puriPication, restriction, blotting and Southern analysis of DNA from each yeast strain.
The present invention essentially replaces this time consuming. highly skilled process with one which enables a large sample throughput by relatively unskilled personnel. Moreover, the fragments produced are generally below 2kb in length allowing the results to be easily interpreted following electrophoresis on a 1.5% agarose gel.
The method of -~he present invention will now be illustrated by way of exemplification only by reference to the Pollowing Figure and protocol example but it will be understood that the number and nature of the primers and conditions shown therein may be varied within its scope.
FIGURE.
Figure 1: shows the agarose gel electrophoresis patterns given by multiplex PCR of thirteen diPferent NCYC yeast samples using the primers II, III, V and VI as described herein. * = DNA standard~
2~738 EXAMPLE.
Methods: Taq polymerase was used in 5 units/~l concentration.
2'-deoxynucleoside 5'-triphosphate solutions (lOOmM) were obtained from Pharmacia. Oligonucleotide primeræ II, III, V and VI were synthesized on ~n Applied Biosystems 381A DNA synthesi~er using phosphoramidite chemistry and were diluted in lOmM TrisHCl pH7.6, lmM
EDTA to lOOO~g/ml and stored as frozen stocks.
Yeast strains for testing were obtained from the UK National Collection of Yeast Cultures. The yeasts were cultured on YEPD media containing (per litre) lOg Bacto yeast extract, 20g Bacto peptone, 20g glucose, 20g Oxoid agar. Following growth on plates A sample of colony waæ removed approx (0~2mg) and resuspended in lOul ice cold sterile water. 90ul of PCR mix was then added and the reaction mix covered ~ith 60,ul of sterile paraffin oil overlay.
The final reaction mix contains:
10 mM Tris.HCl pH 9.0 50 mM KCl 1.5 mM MgCl2.
0.1 % gelatln (w/v) 0.1 % Triton X-lOO
0.2 mM dATP
O.2 mM dCTP
o.? mM dGTP
0.2 mM dTTP
200ng of each of the four primers Two uniks of Taq polymerase were used per reaction.
Reactions were carried ou~ in a Hybaid Thermal Reactor on plate control for 30 cycles of 92C for 2 minutes, 52C for 3 minutes and 72C for 2 minutes.
2~37~
Electro~horesis: Agarose gel was prepared by standard methods (see Maniatis et al: Molecular Cloning~ A Laboratory Manual, Second Edition, Pub. Cold Spring Harbour Laboratory Press 19~9) using 150ml TBE electrophoresis buffer ~10.8g Tris Base, 5.5g boric acid, 4ml 0.5M
EDTA (pH 8.0) per litre) to 2.25~ agarose. Approximately 20ul aliquots of PCR post reaction mixtures with added loading dye are placed in gel slots made by a lmm well comb. Unamplified ~X174 HaeIII
or lambda BstEII DNA made up in 788,ul sterile water, 100~1 of reaction buffer (lOOmM Tris.HCl pH 9.0, 500~M KCl, 15mM MgCl2 1% gelatin, 1%
Triton X-100), 8ul oP a mix of lOul each of the lOOmM 2'-deoxy -nucleoside-5'-triphosphate solutions, and 2~1 of lOOO~g/ml of each primer is placed in a further slot and is run with the reaction samples as a standard.
Electrophoresis was carried out using a constant voltage of 100 volts applied across the gel, positive electrode at the bottom, f`or a period of about 4 hours until the blue dye has migrated about lOcm.
The gels are developed using ethidlum bromide ~care, mutagen) at a concentration of 0.5mg/litre for 30 minutes and viewed under UV light illumination at 302nm.
The electrophoresis patterns produced proved suitable for the purpose of characterising individual yeast strains or strain types sufficient for ready identification of presence of contaminant yeast to be possible by comparison with standard yeast PCR product patterns. As the products include a variety of oligonucleotide and polynucleotide components derived from sequences found between any two primer hybridization sites it will be seen that performance of two or more PCRs using a different combinations of primers on a given yeast sample each time will provide still further resolving power in investigation of its identity.
It will be realised by the person skilled in the art that the term 'targeted at' as used to describe the primers used in the method of the present invention means that these are capable of hybridi~ing with ~ r~
the target sequences with 8 specificity high enough to avoid binding to other parts of the yeast genome to any significant degree. While such specificity may be provided by less than 100~ match (G to C and T to A) it is convenlent in practice to utilise such 100% match. It will be understood how~ver that the lenæth of a ~pecific primer need not be anything like that of the sequence toward which it is targeted and that suitable primer lengths ~ill thus be of shorter length that their target sequence, conveniently these primers being of the order of 10 to 30 bases long.
In this regard, the present invention further provides kits for performing the method of the present invention, said kits comprising one or more oligonucleotide polymerase chain reaction primers as described in this specification and claimed below.
Claims (19)
1. A method for characterising a yeast as being of a particular strain or strain type comprising:
(a) carrying out a polymerase chain reaction using the nucleic acid of the yeast as the reaction template and one or more oligonucleotide primers targeted at nucleic acid sequences characteristic of yeast TY
transposon long terminal repeats and (b) determining the nature of the reaction product from (a) and relating that to the presence of the particular strain or strain type.
(a) carrying out a polymerase chain reaction using the nucleic acid of the yeast as the reaction template and one or more oligonucleotide primers targeted at nucleic acid sequences characteristic of yeast TY
transposon long terminal repeats and (b) determining the nature of the reaction product from (a) and relating that to the presence of the particular strain or strain type.
2. A method as claimed in claim 1 wherein four or more oligonucleotide primers are used and two are targeted at each of the characteristic sequences.
3. A method as claimed in claim 1 or claim 2 wherein one or more further oligonucleotide primers are targeted at further sequences characteristic of the yeast genome.
4. A method as claimed in claim 2 wherein the target yeast TY
transposon terminal repeats are selected from the group comprising delta, sigma and/or tau element long terminal repeats.
transposon terminal repeats are selected from the group comprising delta, sigma and/or tau element long terminal repeats.
5. A method as claimed in claim 4 wherein the oligonucleotide primers comprise primers targeted at a sequence characteristic of the TY1 delta element long terminal repeats and/or primers targeted at a sequence characteristic of TY3 sigma element long terminal repeats respectively.
6. A method as claimed in claim 5 wherein the primers targeted at the sequence characteristic of the TY1 delta element long terminal repeats are targeted at the double stranded DNA sequence I:
SEQUENCE I
SEQUENCE I
7. A method as claimed in claim 6 wherein two primers are targeted at sequence I and consist of oligonucleotides having sequences II and III
respectively:
SEQUENCE II
SEQUENCE III
respectively:
SEQUENCE II
SEQUENCE III
8. A method as claimed in claim 5 wherein the primers targeted at the sequence characteristic of the TY3 sigma element long terminal repeats are targeted at the double stranded DNA sequence IV:
SEQUENCE IV
SEQUENCE IV
9. A method as claimed in claim 8 wherein two primers are targeted at sequence IV and consist of oligonucleotides having sequences V and VI
respectively:
SEQUENCE V
SEQUENCE VI
respectively:
SEQUENCE V
SEQUENCE VI
10. A method as claimed in any one of claims 1 to 9 wherein the yeast nucleic acid is provided in the form of a yeast sample which has been resuspended in sterile water.
11. A method as claimed in claim 10 wherein the polymerase chain reaction is carried out by mixing the resuspended sample with all the other reaction components, covering the mixture with a sterile oil overlay and then subjecting it to cycles of temperature suitable for denaturing duplexes, for annealing of primers and for primer extension to produce oligonucleotide fragments.
12. A method as claimed in claim 11 wherein the cycles of temperature comprise primer annealing periods at between 45°C and 62°C.
13. A method as claimed in claim 12 wherein the primer annealing period temperature is between 50°C and 55°C.
14. A kit for the characterisation of yeast strains by the method of any one of claims 1 to 13 comprising one or more oligonucleotide polymerase chain reaction primers consisting of nucleotide sequences selected for their ability to specifically hybridize with sequences characteristic of yeast TY transposon long terminal repeats.
15. A kit as claimed in claim 14 wherein the oligonucleotide primers are targeted at sequences characteristic of yeast TY transposon long terminal repeat delta, sigma and/or tau elements.
16. A kit as claimed in claim 14 wherein the oligonucleotide primers are targeted at TY1 delta element long terminal repeats and/or TY3 sigma element long terminal repeats respectively.
17. A kit as claimed in claim 16 wherein the oligonucleotide primers comprise one pair of primers targeted at the double stranded DNA
sequence I.
sequence I.
18. A kit as claimed in claim 16 wherein the oligonucleotide primers comprise one pair of primers targeted at the double stranded DNA
sequence IV.
sequence IV.
19. A kit as claimed in claim 14 wherein the oligonucleotide primers include one or more primers selected from the group consisting of the primers II, III, V and VI.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB8906210A GB2216530B (en) | 1988-03-22 | 1989-03-17 | Genetic material for expression of biotin synthetase enzymes |
| CA002063758A CA2063758A1 (en) | 1988-03-22 | 1992-03-23 | Genetic fingerprinting of yeasts |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB888806804A GB8806804D0 (en) | 1988-03-22 | 1988-03-22 | Genetic material for expression of biotin synthetase enzymes |
| CA002063758A CA2063758A1 (en) | 1988-03-22 | 1992-03-23 | Genetic fingerprinting of yeasts |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2063758A1 true CA2063758A1 (en) | 1993-09-24 |
Family
ID=25675045
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002063758A Abandoned CA2063758A1 (en) | 1988-03-22 | 1992-03-23 | Genetic fingerprinting of yeasts |
Country Status (2)
| Country | Link |
|---|---|
| CA (1) | CA2063758A1 (en) |
| GB (1) | GB2216530B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006086846A1 (en) * | 2005-02-16 | 2006-08-24 | Genetic Technologies Limited | Methods of genetic analysis involving the amplification of complementary duplicons |
| AU2006214800B2 (en) * | 2005-02-16 | 2012-06-07 | Cy O'connor Erade Village Foundation | Methods of genetic analysis involving the amplification of complementary duplicons |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100250692B1 (en) * | 1991-09-13 | 2000-04-01 | 후쿠하라 요시하루 | Biotin operon |
| WO1994008023A2 (en) * | 1992-10-02 | 1994-04-14 | Lonza Ag | Biotechnological method of producing biotin |
| US6277609B1 (en) | 1993-01-06 | 2001-08-21 | Basf Aktiengesellschaft | Method to produce biotin |
| EP0635572A3 (en) | 1993-06-25 | 1995-03-08 | Hoffmann La Roche | Biotin biosynthesis in bacillus subtilis. |
| US5859335A (en) * | 1994-12-08 | 1999-01-12 | Novartis Finance Corporation | Enhanced biotin biosynthesis in plant tissue |
| US5869719A (en) * | 1995-03-08 | 1999-02-09 | Novartis Finance Corporation | Transgenic plants having increased biotin content |
| JP4087919B2 (en) * | 1996-04-06 | 2008-05-21 | ディーエスエム アイピー アセッツ ビー．ブイ． | Production of d-biotin by fermentation |
| JP4329129B2 (en) * | 1997-03-03 | 2009-09-09 | 住友化学株式会社 | DNA fragment containing biotin biosynthesis gene and use thereof |
| US6787337B1 (en) | 1997-09-24 | 2004-09-07 | Aventis Cropscience S.A. | Recording of DNA sequences to enable them to be expressed in yeasts, and the transformed yeasts obtained |
| FR2768748B1 (en) * | 1997-09-24 | 2001-06-08 | Rhone Poulenc Agrochimie | RECODING OF DNA SEQUENCES ALLOWING THEIR EXPRESSION IN YEAST AND PROCESSED YEAST OBTAINED |
| TWI220675B (en) * | 2000-10-07 | 2004-09-01 | Nat Science Council | Yeast with high biotin-productivity and the preparation method thereof |
| EP1452601A1 (en) * | 2003-02-28 | 2004-09-01 | Roche Diagnostics GmbH | Enhanced expression of fusion polypeptides with a biotinylation tag |
| EP2221358A1 (en) | 2009-02-24 | 2010-08-25 | Universität für Bodenkultur Wien | Biotin-prototrophic yeasts |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0740922B2 (en) * | 1985-03-05 | 1995-05-10 | 株式会社資生堂 | Biotin-producing microorganism |
| CA1317245C (en) * | 1985-08-26 | 1993-05-04 | Eric F. Fisher | System for biotin synthesis |
| JPS62155081A (en) * | 1985-12-27 | 1987-07-10 | Shiseido Co Ltd | Novel microorganism and production of biotin by fermentation with said microorganism |
-
1989
- 1989-03-17 GB GB8906210A patent/GB2216530B/en not_active Expired
-
1992
- 1992-03-23 CA CA002063758A patent/CA2063758A1/en not_active Abandoned
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006086846A1 (en) * | 2005-02-16 | 2006-08-24 | Genetic Technologies Limited | Methods of genetic analysis involving the amplification of complementary duplicons |
| AU2006214800B2 (en) * | 2005-02-16 | 2012-06-07 | Cy O'connor Erade Village Foundation | Methods of genetic analysis involving the amplification of complementary duplicons |
Also Published As
| Publication number | Publication date |
|---|---|
| GB2216530A (en) | 1989-10-11 |
| GB8906210D0 (en) | 1989-05-04 |
| GB2216530B (en) | 1992-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Michelmore et al. | Molecular markers for genetic analysis of phytopathogenic fungi | |
| Cobb et al. | A simple procedure for optimising the polymerase chain reaction (PCR) using modified Taguchi methods | |
| de Barros Lopes et al. | PCR differentiation of commercial yeast strains using intron splice site primers | |
| CA2063758A1 (en) | Genetic fingerprinting of yeasts | |
| CN100415898C (en) | Method of judging flocculating properties of bottom brewer's yeast | |
| Masneuf et al. | Development of a polymerase chain reaction/restriction fragment length polymorphism method for Saccharomyces cerevisiae and Saccharomyces bayanus identification in enology | |
| JPH08205900A (en) | Dna molecule used for discriminating flocculating property of yeast and method for discriminating flocculating property | |
| Fach et al. | Detection by in vitro amplification of the alpha‐toxin (phospholipase C) gene from Clostridium perfringens | |
| Perret et al. | Rapid identification of Rhizobium strains by targeted PCR fingerprinting | |
| Altman et al. | Identification of an ochre-suppressing anticodon | |
| EP0885310B1 (en) | Genetic markers and methods for the detection of escherichia coli serotype-0157:h7 | |
| Goosen et al. | Molecular genetic analysis | |
| Meaden | DNA FINGERPRINTING OF BREWERS'YEAST: CURRENT PERSPECTIVES | |
| EP0647718B1 (en) | Genetic fingerprinting of yeasts | |
| Makkonen et al. | Genetic variation in the ribosomal internal transcribed spacers of Aphanomyces astaci Schikora from Finland | |
| Jibiki et al. | Application of polymerase chain reaction to determine the flocculation properties of brewer's lager yeast | |
| Jiang et al. | Development of type-specific PCR for typing Pneumocystis carinii f. sp. hominis based on nucleotide sequence variations of internal transcribed spacer region of rRNA genes | |
| Hoff | Molecular typing of wine yeasts: Evaluation of typing techniques and establishment of a database | |
| Lehmann et al. | Isoenzyme changes in Candida albicans during domestication | |
| Simon et al. | The absence of a correlation between plasmids and luminescence in marine luminous bacteria | |
| Karwan et al. | Ribonuclease H (70) from Saccharomyces cerevisiae possesses cryptic reverse transcriptase activity. | |
| Khalil | Identification of Cladosporium sp. Fungi by in-silico RFLP-PCR | |
| Ceccato-Antonini | Methods for the identification and characterization of yeasts from ethanolic fermentation | |
| Schulze et al. | Critical review of identification techniques for Armillaria spp. and Heterobasidion annosum root and butt rot diseases | |
| SK284231B6 (en) | Method of genetic varietal differentiation of hop |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |