FR3109724A1 - Benzoporphyrin derivative and its use as an anti-viral - Google Patents

Abstract

The invention relates to the use of benzoporphyrin derivatives for the treatment or prevention of respiratory diseases resulting from a viral infection. Figure for abstract: no figure

Description

Benzoporphyrin derivative and its use as an anti-viral

The invention relates to a benzoporphyrin derivative and its use as an anti-viral.

Coronaviruses (CoV) are viruses that make up the Orthocoronavirinae subfamily of the Coronaviridae family. These are viruses consisting of a viral envelope protecting a positive-sense single-stranded RNA genome and a capsid. Spike-shaped proteins forming a crown (hence the name "corona"), envelope, membrane and capsid contribute to the overall structure of all coronaviruses. To date, 7 coronaviruses have been identified as infecting humans, but only 3 of them seem to date dangerous for humans.

Although coronaviruses were identified in the 1960s, a new coronavirus has emerged very recently: Severe acute respiratory syndrome coronavirus 2 virus or SARS-CoV- 2 . SARS-CoV-2 is a coronavirus that emerged in China at the end of 2019 and is responsible for the disease COVID-19. COVID-19 has become in a few weeks a global pandemic with more than 2,700,000 cases recorded and more than 190,000 deaths recorded on April 24, 2020 according to the World Health Organization (www.WHO.org).

To date, there are no antivirals or vaccines approved by the Food and Drug Administration (FDA) to treat coronavirus infections, let alone to treat SARS-CoV-2 infections. Current treatments to fight COVID-19 are limited to supportive therapy and the off-label use of FDA-approved drugs.

The development of potential antivirals is therefore greatly and urgently needed.

Molecules in repositioning have already been tested, in particular hydroxychhloroquine, whose initial use is intended for the treatment and prevention of malaria. However, the first results are controversial, and the scientific community is divided on its usefulness and effectiveness.

Also, the identification of a drug to treat or prevent COVID-19 remains.

The aim of the invention is to make up for the lack of the prior art.

The invention aims to provide a new application of compounds known to fight against this pandemic.

Another object of the invention is to provide a pharmaceutical kit which can be used directly by doctors.

Also, the invention relates to a compound of the following formula I:

(I)

Or

R ¹ and R ^'1 , independently of each other, are OH or O-CH ₃ ,

R ² is H or CH ₃ ,

R ³ is H, CH ₃ , CH ₂ -CH ₃ or CH=CH ₂ ,

R ⁴ is COOR ⁶ , where R ⁶ is H or CH ₃ , and

R ⁵ is H or CH ₃ ,

or a mixture of two or more compounds of formula (I),

for its use for the treatment or prevention of respiratory syndromes caused by viruses, in particular caused by coronaviruses.

The invention is based on the surprising observation made by the inventors that benzoporphyrin derivatives are useful and effective for the treatment and prevention of respiratory diseases, or respiratory syndromes, caused by viruses. Indeed, the inventors have been able to observe that such compounds act directly on the viruses responsible for these pathologies. In particular, the inventors have shown that such compounds inhibit the infection of cells by the viruses responsible for these pathologies, in particular the virus responsible for COVID-19.

Respiratory syndromes are diseases of the lungs and airways also called lung conditions. The most common symptoms of respiratory diseases include: cough, shortness of breath (dyspnea) and wheezing. Less commonly, obstruction of the airways between the mouth and the lungs results in a gasping sound when breathing (stridor). Lung diseases can also lead to coughing up blood (hemoptysis), abnormal bluish discoloration of the skin due to lack of oxygen in the blood (cyanosis), and chest pain. Other symptoms such as ageusia (loss of taste) and anosmia (loss of smell) are also identified.

The compound according to the invention can prevent the occurrence of these syndromes, or when the patient is affected by them, treat them.

The various compounds covered by the invention are the compounds of formula 1 where R ¹ , R′ ¹ , R ² , R ³ , R ⁴ and R ⁵ are the following:

Compound R1 R'1 R2 R3 R4 R5 #1 OH OH H H COOH H #2 OH OH H H COOH CH ₃ #3 OH OH H H COO-CH ₃ H #4 OH OH H H COO-CH ₃ CH ₃ #5 OH OH H CH ₃ COOH H #6 OH OH H CH ₃ COOH CH ₃ #7 OH OH H CH ₃ COO-CH ₃ H #8 OH OH H CH ₃ COO-CH ₃ CH ₃ #9 OH OH H _CH2 - _CH3 COOH H #10 OH OH H _CH2 - _CH3 COOH CH ₃ #11 OH OH H _CH2 - _CH3 COO-CH ₃ H #12 OH OH H _CH2 - _CH3 COO-CH ₃ CH ₃ #13 OH OH H CH=CH ₂ COOH H #14 OH OH H CH=CH ₂ COOH CH ₃ #15 OH OH H CH=CH ₂ COO-CH ₃ H #16 OH OH H CH=CH ₂ COO-CH ₃ CH ₃ #17 OH OH CH ₃ H COOH H #18 OH OH CH ₃ H COOH CH ₃ #19 OH OH CH ₃ H COO-CH ₃ H #20 OH OH CH ₃ H COO-CH ₃ CH ₃ #21 OH OH CH ₃ CH ₃ COOH H #22 OH OH CH ₃ CH ₃ COOH CH ₃ #23 OH OH CH ₃ CH ₃ COO-CH ₃ H #24 OH OH CH ₃ CH ₃ COO-CH ₃ CH ₃ #25 OH OH CH _{3 CH2} - _CH3 COOH H #26 OH OH CH _{3 CH2} - _CH3 COOH CH ₃ #27 OH OH CH _{3 CH2} - _CH3 COO-CH ₃ H #28 OH OH CH _{3 CH2} - _CH3 COO-CH ₃ CH ₃ #29 OH OH CH ₃ CH=CH ₂ COOH H #30 OH OH CH ₃ CH=CH ₂ COOH CH ₃ #31 OH OH CH ₃ CH=CH ₂ COO-CH ₃ H #32 OH OH CH ₃ CH=CH ₂ COO-CH ₃ CH ₃ #33 OH O-CH ₃ H H COOH H #34 OH O-CH ₃ H H COOH CH ₃ #35 OH O-CH ₃ H H COO-CH ₃ H #36 OH O-CH ₃ H H COO-CH ₃ CH ₃ #37 OH O-CH ₃ H CH ₃ COOH H #38 OH O-CH ₃ H CH ₃ COOH CH ₃ #39 OH O-CH ₃ H CH ₃ COO-CH ₃ H #40 OH O-CH ₃ H CH ₃ COO-CH ₃ CH ₃ #41 OH O-CH ₃ H _CH2 - _CH3 COOH H #42 OH O-CH ₃ H _CH2 - _CH3 COOH CH ₃ #43 OH O-CH ₃ H _CH2 - _CH3 COO-CH ₃ H #44 OH O-CH ₃ H _CH2 - _CH3 COO-CH ₃ CH ₃ #45 OH O-CH ₃ H CH=CH ₂ COOH H #46 OH O-CH ₃ H CH=CH ₂ COOH CH ₃ #47 OH O-CH ₃ H CH=CH ₂ COO-CH ₃ H #48 OH O-CH ₃ H CH=CH ₂ COO-CH ₃ CH ₃ #49 OH O-CH ₃ CH ₃ H COOH H #50 OH O-CH ₃ CH ₃ H COOH CH ₃ #51 OH O-CH ₃ CH ₃ H COO-CH ₃ H #52 OH O-CH ₃ CH ₃ H COO-CH ₃ CH ₃ #53 OH O-CH ₃ CH ₃ CH ₃ COOH H #54 OH O-CH ₃ CH ₃ CH ₃ COOH CH ₃ #55 OH O-CH ₃ CH ₃ CH ₃ COO-CH ₃ H #56 OH O-CH ₃ CH ₃ CH ₃ COO-CH ₃ CH ₃ #57 OH O-CH ₃ CH _{3 CH2} - _CH3 COOH H #58 OH O-CH ₃ CH _{3 CH2} - _CH3 COOH CH ₃ #59 OH O-CH ₃ CH _{3 CH2} - _CH3 COO-CH ₃ H #60 OH O-CH ₃ CH _{3 CH2} - _CH3 COO-CH ₃ CH ₃ #61 OH O-CH ₃ CH ₃ CH=CH ₂ COOH H #62 OH O-CH ₃ CH ₃ CH=CH ₂ COOH CH ₃ #63 OH O-CH ₃ CH ₃ CH=CH ₂ COO-CH ₃ H #64 OH O-CH ₃ CH ₃ CH=CH ₂ COO-CH ₃ CH ₃ #65 O-CH ₃ OH H H COOH H #66 O-CH ₃ OH H H COOH CH ₃ #67 O-CH ₃ OH H H COO-CH ₃ H #68 O-CH ₃ OH H H COO-CH ₃ CH ₃ #69 O-CH ₃ OH H CH ₃ COOH H #70 O-CH ₃ OH H CH ₃ COOH CH ₃ #71 O-CH ₃ OH H CH ₃ COO-CH ₃ H #72 O-CH ₃ OH H CH ₃ COO-CH ₃ CH ₃ #73 O-CH ₃ OH H _CH2 - _CH3 COOH H #74 O-CH ₃ OH H _CH2 - _CH3 COOH CH ₃ #75 O-CH ₃ OH H _CH2 - _CH3 COO-CH ₃ H #76 O-CH ₃ OH H _CH2 - _CH3 COO-CH ₃ CH ₃ #77 O-CH ₃ OH H CH=CH ₂ COOH H #78 O-CH ₃ OH H CH=CH ₂ COOH CH ₃ #79 O-CH ₃ OH H CH=CH ₂ COO-CH ₃ H #80 O-CH ₃ OH H CH=CH ₂ COO-CH ₃ CH ₃ #81 O-CH ₃ OH CH ₃ H COOH H #82 O-CH ₃ OH CH ₃ H COOH CH ₃ #83 O-CH ₃ OH CH ₃ H COO-CH ₃ H #84 O-CH ₃ OH CH ₃ H COO-CH ₃ CH ₃ #85 O-CH ₃ OH CH ₃ CH ₃ COOH H #86 O-CH ₃ OH CH ₃ CH ₃ COOH CH ₃ #87 O-CH ₃ OH CH ₃ CH ₃ COO-CH ₃ H #88 O-CH ₃ OH CH ₃ CH ₃ COO-CH ₃ CH ₃ #89 O-CH ₃ OH CH _{3 CH2} - _CH3 COOH H #90 O-CH ₃ OH CH _{3 CH2} - _CH3 COOH CH ₃ #91 O-CH ₃ OH CH _{3 CH2} - _CH3 COO-CH ₃ H #92 O-CH ₃ OH CH _{3 CH2} - _CH3 COO-CH ₃ CH ₃ #93 O-CH ₃ OH CH ₃ CH=CH ₂ COOH H #94 O-CH ₃ OH CH ₃ CH=CH ₂ COOH CH ₃ #95 O-CH ₃ OH CH ₃ CH=CH ₂ COO-CH ₃ H #96 O-CH ₃ OH CH ₃ CH=CH ₂ COO-CH ₃ CH ₃ #97 O-CH ₃ O-CH ₃ H H COOH H #98 O-CH ₃ O-CH ₃ H H COOH CH ₃ #99 O-CH ₃ O-CH ₃ H H COO-CH ₃ H #100 O-CH ₃ O-CH ₃ H H COO-CH ₃ CH ₃ #101 O-CH ₃ O-CH ₃ H CH ₃ COOH H #102 O-CH ₃ O-CH ₃ H CH ₃ COOH CH ₃ #103 O-CH ₃ O-CH ₃ H CH ₃ COO-CH ₃ H #104 O-CH ₃ O-CH ₃ H CH ₃ COO-CH ₃ CH ₃ #105 O-CH ₃ O-CH ₃ H _CH2 - _CH3 COOH H #106 O-CH ₃ O-CH ₃ H _CH2 - _CH3 COOH CH ₃ #107 O-CH ₃ O-CH ₃ H _CH2 - _CH3 COO-CH ₃ H #108 O-CH ₃ O-CH ₃ H _CH2 - _CH3 COO-CH ₃ CH ₃ #109 O-CH ₃ O-CH ₃ H CH=CH ₂ COOH H #110 O-CH ₃ O-CH ₃ H CH=CH ₂ COOH CH ₃ #111 O-CH ₃ O-CH ₃ H CH=CH ₂ COO-CH ₃ H #112 O-CH ₃ O-CH ₃ H CH=CH ₂ COO-CH ₃ CH ₃ #113 O-CH ₃ O-CH ₃ CH ₃ H COOH H #114 O-CH ₃ O-CH ₃ CH ₃ H COOH CH ₃ #115 O-CH ₃ O-CH ₃ CH ₃ H COO-CH ₃ H #116 O-CH ₃ O-CH ₃ CH ₃ H COO-CH ₃ CH ₃ #117 O-CH ₃ O-CH ₃ CH ₃ CH ₃ COOH H #118 O-CH ₃ O-CH ₃ CH ₃ CH ₃ COOH CH ₃ #119 O-CH ₃ O-CH ₃ CH ₃ CH ₃ COO-CH ₃ H #120 O-CH ₃ O-CH ₃ CH ₃ CH ₃ COO-CH ₃ CH ₃ #121 O-CH ₃ O-CH ₃ CH _{3 CH2} - _CH3 COOH H #122 O-CH ₃ O-CH ₃ CH _{3 CH2} - _CH3 COOH CH ₃ #123 O-CH ₃ O-CH ₃ CH _{3 CH2} - _CH3 COO-CH ₃ H #124 O-CH ₃ O-CH ₃ CH _{3 CH2} - _CH3 COO-CH ₃ CH ₃ #125 O-CH ₃ O-CH ₃ CH ₃ CH=CH ₂ COOH H #126 O-CH ₃ O-CH ₃ CH ₃ CH=CH ₂ COOH CH ₃ #127 O-CH ₃ O-CH ₃ CH ₃ CH=CH ₂ COO-CH ₃ H #128 O-CH ₃ O-CH ₃ CH ₃ CH=CH ₂ COO-CH ₃ CH ₃

These various compounds can be used alone or in combination 2 to 2 or more.

These compounds can also be in the form of pharmaceutically acceptable salts, or pro-drugs.

​Examples of pharmaceutically acceptable salts include, without limitation, non-toxic inorganic and organic acid salts such as hydrochloride, hydrobromide, nitrate, perchlorate, phosphate, sulfate, formate, acetate, aconate, ascorbate, benzenesulfonate, benzoate, cinnamate, citrate, embonate, enantate, fumarate, glutamate, glycolate, lactate, maleate, malonate, mandelate, methanesulfonate , naphthalene-2-sulfonate derivative, phthalate, salicylate, sorbate, stearate, succinate, tartrate, mesilate, toluene-p-sulfonate and the like. Such salts can be formed by procedures well known and described in the state of the art.

​Metal salts of a chemical compound of the invention include alkali metal salts, such as the sodium salt of a compound of the invention containing a carboxy group.

Advantageously, the invention relates to the aforementioned compound for its aforementioned use, wherein said respiratory syndromes are severe acute respiratory syndromes.

Acute respiratory distress syndrome, severe acute respiratory syndrome, is a sometimes fatal condition characterized by the inability of the lungs to deliver enough oxygen to vital organs. It is most often a complication of a serious pre-existing health condition, such as pneumonia or severe flu. Among the other risk factors mentioned, near-drowning, inhalation of smoke and toxic gases or even serious trauma to the lungs. More specifically, this first health problem causes damage to the walls of the capillaries, the blood vessels that line the alveoli.

The result of these syndromes is that the walls of the lungs become more permeable, leading to fluid accumulation and eventual collapse of the alveoli, which makes the exchange of oxygen and carbon dioxide in the lungs nearly impossible. The signs are known, mainly shortness of breath or cyanosis.

In the context of COVID-19 disease, the above respiratory symptoms are associated with a bout of fever (over 38°C) which may be high, sometimes associated with chills and other symptoms such as headache, muscle stiffness , malaise and myalgia. Early in the illness, some cases have mild respiratory symptoms. Rashes or neurological or gastrointestinal disturbances are usually not observed, although a few patients have reported diarrhea during the febrile prodromes. The disease progresses to the phase of lower respiratory involvement with the onset of a productive cough or dyspnoea, which may be accompanied more or less rapidly by hypoxemia.

Advantageously, the invention relates to the aforementioned compound for its use as defined above, where said coronaviruses are SARS-CoV, MERS-CoV or SARS-Cov-2

Among the known coronaviruses, 7 are pathogenic in humans.

Four of the 7 coronaviruses that infect humans (HCoV-NL63, -229E, -OC43, and -HKU1) cause mild, self-limiting upper respiratory tract infections, such as the common cold, but can cause severe lower respiratory tract infections, such as pneumonia, in infants, the elderly and immunocompromised people. These infections are seasonal: most cases occur during the winter months in temperate climates.

The other 3 coronaviruses (SARS-CoV, MERS-CoV and SARS-CoV-2) have caused major epidemics of fatal pneumonia in the 21st century.

SARS-CoV

The first of these epidemics, severe acute respiratory syndrome (SARS), appeared in November 2002 in the province of Guangdong, China, and caused an epidemic which spread in a few months to 29 countries on 6 continents. It affected more than 8,000 people and nearly 800 people died worldwide. The majority of cases have occurred in China and Hong Kong. In the United States, only 8 people presented with SARS confirmed by laboratory tests; all 8 had traveled to areas where SARS-CoV transmission was ongoing. The overall case fatality rate was 10%, but it varied by age, ranging from less than 1% in people aged 24 and under to over 50% in people aged 65 and over.

The source of SARS has been identified as the palm civet (feliform mammal) sold at local live animal markets in Guangdong. Once introduced to humans, SARS-CoV spread easily from person to person through large respiratory droplets, aerosols, and faecal-oral transmission (diarrhea is a common symptom of infection).

MERS-CoV

MERS-CoV has caused a deadly infection known as Middle East Respiratory Syndrome (MERS). The disease emerged in the Arabian Peninsula in September 2012. MERS-CoV has caused recurrent outbreaks that have affected more than 2,500 people, with a mortality rate of approximately 35%. The largest MERS outbreak reported outside the Arabian Peninsula occurred in South Korea in 2015; it is associated with a traveler returning from the Arabian Peninsula.

Like SARS-CoV, MERS-CoV is a zoonosis, which is transmitted by direct or indirect contact with camels. MERS-CoV is also transmitted from human to human through direct contact, fomites and respiratory droplets. MERS-CoV virus is detected in respiratory tract secretions, feces, serum, and urine, and the virus has been detected in survivors for a month or more after illness onset.

SARS-CoV-2 (COVID-19)

The seventh coronavirus to be discovered is SARS-CoV-2, which is responsible for the current epidemic called COVID-19. The outbreak began in Wuhan, a city of more than 11 million people located in Hubei province. In 95% of cases, the reported incubation period was around 14 days. In the state of knowledge, it is considered that SARS-CoV-2 is transmitted mainly by the following means: inhalation of large respiratory droplets containing the live virus, sprayed during coughing or sneezing, contact with surfaces contaminated with the virus, then contact with the eyes, nose or mouth and possible faecal-oral transmission.

The speed of spread is high compared to the 2003 SARS epidemic, suggesting that SARS-CoV-2 is much more easily transmitted than SARS-CoV.

Advantageously, the invention relates to the aforementioned compound for its use as defined above, said compound being at least one regioisomer of verteporfin chosen from:

(compound #64)

Or

(compound #96)

or a mixture of these.

Verteporfin is a benzoporphyrin derivative with CAS number 129497-78-5, and whose marketing is authorized by the FDA (Food and Drug Administration) under number N021119.

During synthesis two regioisomers are produced:

- 9-methyl trans-(±)-18-ethenyl-4,4a-dihydro-3,4-bis(methoxycarbonyl)-4a,8,14,19-tetramethyl-23H,25H-benzo[b]porphine- 9,13-dipropanoate, and

- 13-methyl trans-(±)-18-ethenyl-4,4a-dihydro-3,4-bis(methoxycarbonyl)-4a,8,14,19-tetramethyl-23H,25H-benzo[b]porphine- 9,13-dipropanoate.

Advantageously, the invention relates to the aforementioned compound for its use as defined above, said compound being a 1:1 mixture of the following two verteporfin regioisomers:

And

.

The mixture of the two regioisomers at about 1:1 is sold under the brand name Visudyne as a pharmaceutical compound, or as a chemical product from Sigma-Aldrich under the reference SML0534.

Also, the invention relates to Verteporfin for its use for the treatment or prevention of respiratory syndromes caused by viruses, in particular caused by coronaviruses, in particular for the treatment of COVID-19.

Advantageously, the invention relates to the aforementioned compound for its use as defined above, said compound being administered, or in a form capable of being administered, at a dose, in particular a final dose, of 1 μM to 100 μM.

An advantageous embodiment of the invention describes the use as defined above, in which said compound is administered at a dose of approximately 1 μM to approximately 100 μM, advantageously of approximately 5 μM to approximately 50 μM, in particular from around 6 μM to around 25 μM, preferably around 10 μM.

Verteporfin has a molar mass of 718.79 g.mol ^-1 . Also, for an adult individual having on average a blood volume of 5 L per 70 kg, the compound according to the invention can be administered at a dose of approximately 0.05 mg/kg to approximately 5 mg/kg, in particular of about 0.25 mg/kg to about 2.5 mg/kg, preferably about 0.3 mg/kg to about 1.25 mg/kg, more preferably about 0.5 mg/kg.

Knowing that a dose of 20 μM represents 6 mg/m ² , the composition or the compound according to the invention can be administered at a dose of approximately 0.3 mg/m ² to approximately 30 mg/m ² , advantageously d approximately 1.5 mg/m ² to approximately 15 mg/m ² , in particular from approximately 1.8 mg/m ² to approximately 7.5 mg/m ² , preferably from approximately 3 mg/m ² .

The invention advantageously relates to the aforementioned compound for its use as defined above, said compound being administered, or in a form capable of being administered, in the form of a spray, orally, by injection or by nebulization.

For example, the compound according to the invention can be administered to a subject by oral, parenteral, topical administration, by intravenous infusion.

The compound, when it is desirable to administer systemically, may be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Injection formulations may be presented in unit dosage form, for example in ampoules or in multi-dose containers, with an added preservative. The compositions can take forms such as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulants such as suspending agents, stabilizers and/or dispersants.

The compound for parenteral administration comprises aqueous solutions of the active compositions in water-soluble form. Additionally, suspensions of the active compositions can be prepared as suitable oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compositions to allow the preparation of highly concentrated solutions. Alternatively, the active compositions may be in powder form to constitute a suitable vehicle, for example pyrogen-free sterile water, before use.

For oral administration, the compound may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (eg, pregelatinized cornstarch, polyvinylpyrrolidone or hydroxypropylmethylcellulose ); fillers (eg, lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (eg magnesium stearate, talc or silica); disintegrants (eg potato starch or sodium starch glycolate); or wetting agents (eg, sodium lauryl sulfate). Tablets can be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or may be presented as a dry product for constitution with water or other suitable vehicle before use. These liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (eg, sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (eg lecithin or gum arabic); non-aqueous vehicles (eg almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (eg, methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffering salts, flavorings, colorings and sweeteners, as appropriate. The component or components can be chemically modified such that oral administration of the compound is effective. Generally, the chemical modification envisaged is the attachment of at least one molecule to the compound of the invention, said molecule allowing (a) inhibition of degradation; and (b) absorption into the bloodstream of the stomach, or intestine; or c) adsorption at the level of the pulmonary alveoli. For oral compositions, the site of release can be the stomach, the small intestine (duodenum, jejunum or ileum) or the large intestine. Those skilled in the art have formulations which will not dissolve in the stomach, but which will release the material in the duodenum or elsewhere in the intestine. Preferably, the release will avoid the deleterious effects of the gastric environment, either by protecting the antibody or by releasing the biologically active material beyond the stomach medium, for example into the intestine.

For buccal administration, the compound may take the form of conventionally formulated tablets or lozenges.

For administration by inhalation, the compound to be used according to the present invention may conveniently be delivered as an aerosol spray (or spray) from pressurized packages or a nebulizer, using a propellant suitable, for example dichlorodifluoromethane, trichlorofluo-romethane, dichlorotetrafluoroethane dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. Gelatin capsules and cartridges for use in an inhaler or insufflator can be formulated with a powdered mixture of the compositions and a suitable powdered base such as lactose or starch.

The present invention also relates to pulmonary administration. The compound can be delivered to the lungs of a mammal by inhaling and crossing the epithelial mucosa of the lung. A wide range of mechanical devices designed for pulmonary delivery of therapeutics, including, but not limited to, nebulizers, metered dose inhalers, and powder inhalers, all known to those skilled in the art, are contemplated for use in the present invention

The nasal administration of a compound according to the invention is also envisaged. The administration by nasal route allows the passage of the pharmaceutical composition according to the present invention directly into the blood stream or towards the respiratory tract and the lungs directly after the administration of the therapeutic product in the nose of the patient, without it being necessary to deposit the product in the lungs. Formulations for nasal administration include in particular dextran or cyclodextran.

Suitable liquid or solid pharmaceutical preparation forms may in particular comprise aqueous or saline solutions for inhalation, said aqueous or saline solutions being able to be microencapsulated, notched, applied to microscopic gold particles, contained in liposomes, nebulized in aerosols , applied in pellets for implantation in the skin.

Pharmaceutical formulations also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, skin or transdermal patches, drops or preparations sustained release active compositions and/or auxiliaries such as disintegrants, binders, coating agents, bulking agents, lubricants, flavors, sweeteners or solubilizers usually used as described above. The compound according to the invention is suitable for use in all types of drug delivery systems.

The invention also relates to a method for treating or preventing respiratory syndromes caused by viruses, in particular caused by coronaviruses, in particular COVID-9, or equivalent diseases, comprising a step of administering a pharmaceutically effective dose of one or more compounds of formula I above to an individual in need.

Advantageously, the invention relates to a method of treating COVID-9, or equivalent diseases, comprising a step of administering a pharmaceutically effective dose of Verteporfin or Visudyne to an individual in need.

The invention further relates to a kit comprising

- a compound as defined above, and

- an antiviral agent or an immunosuppressive agent, or a mixture thereof.

The compound according to the invention can be associated inter alia with one or more antiviral agents, or one or more immunosuppressive agents, or both.

The agents that can be associated are for example, and without being limiting, Remdesivir (nucleotide analogue marketed by Gilead), Tocilizumab or Sarilumab (anti IL-6 antibody), Avdoralimab (anti C5aR antibody), a combination of Lopinavir and Ritonavir (protease inhibitor), in association or not with interferon ß), or even azithromycin.

Also, the invention advantageously relates to a kit comprising:

- Verteporfin, and

- at least one antiviral agent, or at least one immunosuppressive agent, or both.

Advantageously, the invention relates to a kit comprising:

- Verteporfin, and

- at least one of the following compounds: Remdesivir, Tocilizumab or Sarilumab, Avdoralimab, a combination of Lopinavir and Ritonavir, in combination or not with interferon ß, or even azithromycin.

The invention further relates to the aforementioned kit, for its use for the treatment or prevention of respiratory syndromes caused by viruses, in particular caused by coronaviruses, in particular COVID-19.

The aforementioned kit is also described for its use as described above, where said compound and said at least one antiviral agent, or at least one immunosuppressive agent, or both are administered simultaneously, separately or spread out over time.

Advantageously, the invention relates to the aforementioned kit, where said compound is packaged at a dose allowing administration in order to obtain a final concentration of 1 to 100 μM.

The invention further relates to the use of the aforementioned compound, or compounds, for the in vitro or ex vivo inhibition of the entry of a coronavirus into a mammalian cell, or for the inhibition, in particular of the replication of the coronavirus viral genome in a mammalian cell.

Advantageously, the invention relates to the use of the aforementioned Verteporfin or Visudyne for the in vitro or ex vivo inhibition of the entry of a coronavirus into a mammalian cell, or for the inhibition, in particular of the replication of the coronavirus viral genome in a mammalian cell.

The invention will be better understood in the light of the following figures and example.

Brief description of figures

There represents graphs showing four independent experiments (#1, #2, #3, #4) where VeroE6 cells were treated with DMSO (A) or Verteporfin (B) for 2 hours before their infection with the SARS virus -Cov-2. 3 days after infection, the presence of viral particles in the culture supernatant was measured by quantitative PCR (RT-qPCR). Each experiment was carried out in triplicates. Error bars correspond to variability within the same experiment. The Y axis represents infection with the SARS-Cov2 virus.

There represents a graph summarizing all 4 experiments shown in . The antiviral activity of Verteporfin (B) is represented in value relative to DMSO (A). This activity represents 99.89% viral inhibition.

There is a photograph showing four Petri dishes in which VeroE6 cells were cultured in the absence (-) or in the presence of 0.01% DMSO (A), 10 μM Verteporfin (B) or 2% DMSO (C). Cell viability was analyzed by staining the cells with Crystal Violet (0.05% w/V in 20% methanol).

There represents a graph showing the quantity of viral genomic RNA relative to the quantity of cellular RNA of GAPDH of VeroE6 cells infected with SARS-CoV-2 and treated (B) or not (A; DMSO) with Verteporfin. The Y axis represents arbitrary units.

There represents a graph showing the quantity of RNA of the viral gene Spike relative to the quantity of cellular RNA of GAPDH of VeroE6 cells infected with SARS-CoV-2 and treated (B) or not (A; DMSO) with Verteporfin. The Y axis represents arbitrary units.

There represents a graph showing the quantity of RNA encoding the viral gene Spike relative to the quantity of viral genomic RNA of VeroE6 cells infected with SARS-CoV-2 and treated (B) or not (A; DMSO) with Verteporfin . The Y axis represents arbitrary units.

EXAMPLES

Current treatments for COVID-19 are limited to supportive therapy and off-label use of FDA-approved drugs. The development of potential antivirals is greatly needed. A potentially faster way to identify compounds with antiviral activity is through drug repositioning. Many drugs are already approved for use in humans with a good understanding of their cytotoxicities and potential side effects, making them easier to test in COVID-19 patients. The inventors tested, in vitro , a targeted library of FDA-approved compounds for anti-SARS-CoV-2 activity.

Results

The antiviral activity of 13 drug compounds was tested in vitro on the infection of VeroE6 cells by the SARS-Cov-2 virus according to the protocol described in the material and method section. The cells were treated with DMSO (0.01% control) or drugs at a concentration of 10 μM for 2 hours before their infection by SARS-CoV-2 for 4 hours. Viral replication was measured by searching for viral RNA in the culture supernatant 72 hours after infection. Four independent experiments were performed and showed strong inhibition of SARS-CoV-2 replication in VeroE6 cells by Verteporfin compared to DMSO control ( ). The global analysis integrating all the experiments shows that Verteporfin strongly inhibits the infection of VeroE6 cells compared to the DMSO control ( ). The inventors analyzed the effect of Verteporfin on cell viability. For this, the untreated VeroE6 cells, treated with DMSO or with Verteporfin for two hours and maintained in culture for 72 hours, were fixed and stained with Crystal Violet. The experiment shows no toxicity of Verteporfin in vitro on VeroE6 cells compared to the toxic dose of DMSO ( ).

In order to understand the mechanism of action of Verteporfin, VeroE6 cells were treated (DMSO or Verteporfin) for 2 hours before their infection by SARS-CoV-2. 3 days after infection, the presence of viral genomic RNA, viral transcripts (Spike) and the cellular GAPDH housekeeping gene was quantified by RT-qPCR. The inventors have observed a strong reduction in the viral genomic RNAs ( ) and viral transcripts ( ) in Verteporfin-treated cells compared to DMSO-treated cells. Measurement of the ratio of transcribed RNA to viral genomic RNA shows little difference between the DMSO condition and Verteporfin ( ). This shows that the activity of Verteporfin does not affect the activity of the viral RNA-dependent RNA polymerase. The antiviral activity of Verteporfin would therefore mainly take place at the level of the early stages of the viral cycle.

Material and methods

Dope

Verteporfin was dissolved in DMSO to a concentration of 100mM and stored at -20°C. Verteporfin is obtained from Sigma-Aldrich (Merck) under the reference SML0534.

Cell viability

VeroE6 cells were cultured in the presence or absence of DMSO (10 ^-4 %), DMSO (2%) or Verteporfin (10μM) for 2 hours at 37°C. The medium was replaced with fresh medium containing no drug. After 72 hours of culture, the cells were fixed in a 4% paraformaldehyde solution for 5 min and stained using a Crystal violet solution (0.05% w/V in 20% methanol) for 30 min at ambient temperature. The cells were washed in water, dried and analyzed.

Cell Line

The Vero cell line was isolated from kidney epithelial cells extracted from an African green monkey. The inventors used clone 6 (VeroE6) in the SARS-Cov-2 infection tests. The cells are cultured in DMEM medium containing 10% fetal bovine serum, antibiotics, glutamine and non-essential amino acids.

Infection of VeroE6 cells by SARS-CoV-2 :

VeroE6 cells are cultured in 24-well plates at a density of 15 cells/well. The cells were treated with DMSO or Verteporfin (10 μM) for 2 hours before infection. The cells were brought into contact with the SARS-CoV-2 virus for 4 h at 37° C. then the medium is replaced with fresh medium not containing Verteporfin. Viral replication was measured 96 hours post infection.

Measurement of SARS-Cov-2 replication by RT-qPCR :

2 μl of culture supernatant are analyzed directly by PCR to detect the presence of virus.

The kit used is Sensifast Sybr no rox one-step (ref: Bio-72005 from Bioline, marketed by Bio-Technofix), following the supplier's recommendations. The oligonucleotides used are specific for SARS-CoV-2:

- specific amplification of SARS-CoV-2 viral sequences (fragment of 112 base pairs (bp)): F: ACTGTTGGTCAACAAGACGGCA (SEQ ID NO: 1), and

A: TCAATAGTCTGAACAACTGGTGTA (SEQ ID NO: 2)

- specific amplification of SARS-CoV-2 viral transcripts (Orf S) (169 bp fragment):

F: CCAGGTAACAAACCAACCA (SEQ ID NO: 3), and

A: GGTAATAAACACCACGTGTGA (SEQ ID NO: 4)

As a control, the following oligonucleotides were used:

- specific amplification of the GAPDH cell housekeeping gene (257 bp fragment):

F: AGAAGGCTGGGGCTCATTTG (SEQ ID NO: 5), and

A: AGGGGCCATCCACAGTCTTC (SEQ ID NO: 6)

Per well:

Mix 2x: 5 µL

Primer oligonucleotide mix (50x primer): 0.2 µL (0.5µM final each)

Reverse Transcriptase: 0.1 µL

RNase inhibitor: 0.2 µL

Water: qsp 8 µL

sample: 2 µL

Amplification conditions:

1: 10 min at 45°C (reverse transcription)

2: 2 min at 95°C (activation of the polymerase)

3: 40 cycles of: 5 sec 95°C (denaturation)

10 sec 60°C (hybridization)

5 sec 72°C (extension)

4: progressive denaturation from 70°C to 95°C (measurement of Tm)

Claims (10)

Compound of the following formula I
(I)
Or
R ¹ and R ^'1 , independently of each other, are OH or O-CH ₃ ,
R ² is H or CH ₃ ,
R ³ is H, CH ₃ , CH ₂ -CH ₃ or CH=CH ₂ ,
R ⁴ is COOR ⁶ , where R ⁶ is H or CH ₃ , and
R ⁵ is H or CH ₃ ,
for its use for the treatment or prevention of respiratory syndromes caused by viruses, in particular caused by coronaviruses. A compound for its use according to claim 1, wherein said respiratory syndromes are severe acute respiratory syndromes. A compound for its use according to any one of claims 1 or 2, wherein said coronaviruses are SARS-CoV, MERS-CoV or SARS-CoV-2. Compound for its use according to any one of claims 1 to 3, said compound being at least one regioisomer of verteporfin chosen from:

Or

or a mixture of these. A compound for its use according to any one of claims 1 to 4, said compound being a 1:1 mixture of the following two regioisomers of Verteporfin:

And
. A compound for its use according to any one of claims 1 to 5, said compound being in a form suitable for administration at a dose of 1 µM to 100 µM. Compound for its use according to any one of Claims 1 to 6, the said compound being in a form suitable for being administered in the form of a spray, orally, by injection or by nebulization. Kit including
- a compound as defined in any one of claims 1 to 7, and
- an antiviral agent or an immunosuppressive agent. Kit according to claim 8, wherein said compound is packaged in a dose allowing an administration in order to obtain a final concentration of 1 to 100 µM. Use of a compound as defined in any one of claims 1 to 7, for the in vitro or ex vivo inhibition of the entry of a coronavirus into a mammalian cell, or for the in vitro or ex vivo of the replication of the coronavirus viral genome in a mammalian cell.