FR3068363A1 - USE OF SARCOCYSTIDAE STRAINS IN THE PREVENTION OF INFECTIOUS DISEASES OF POULTRY - Google Patents

Abstract

The present invention relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of infectious diseases in poultry.

Description

USE OF SARCOCYSTIDAE STRAINS IN THE PREVENTION OF

INFECTIOUS DISEASES OF POULTRY

The present invention relates to the use of attenuated strains of parasites for the prevention and treatment of pathologies in poultry and in particular in young birds of grain-eating species such as domestic hen, turkey and guinea fowl.

Apicomplexa are predominantly obligate intracellular parasites that have a life cycle that can involve several hosts. The phylum of these parasites is subdivided into several families.

Toxoplasma gondii (T gondii) belongs to the family of Sarcocystidae. The cat, the final host, excretes the parasite into the environment in the form of oocysts. Intermediate (i.e. all homeotherms) and final hosts can become infected by ingesting oocysts present on food. The parasite then turns into tachyzoites which spread throughout the body and which, under pressure from the immune system, become encysted with a preferential tropism for the central nervous system, the retina or the muscles. Ingestion of encysted tissue is the second cause of contamination of final and intermediate hosts. The strains of T gondii are classified according to their degree of virulence in vivo: the type I strains (ie the RH strain) are highly virulent while the type II strains (ie the ME49, 76K or Pru strains) and III (ie the CEP or M7741 strains) are less virulent and generally establish chronic infections. In addition, many atypical strains not traceable to the first three types are identified, especially in Africa and South America (Howe & Sibley, 1995, J. Infect. Dis., 172 (6): 1561-6; Rajendran et al. , 2012, Infect. Genet Evol, 12 (2): 359-68). Recently, a live attenuated strain of Toxoplasma gondii, the parasite responsible for toxoplasmosis, was developed by knocking out two genes coding for the proteins TgMICl and TgMIC3 (Cérède et al., 2005, J. Exp. Med., 201 ( 3): 453-63). This strain, called Toxo tgmicf3 KO, generates a strong and specific immune response against Toxoplasma gondii and makes it possible to prevent the effects of a subsequent infection in mice (Ismael et al., 2006, J. Infect. Dis., 194 (8) : 1176-83) and in sheep (Mévelec et al., 2010, Vet. Res., 41 (4): 49).

Neospora caninum (N. caninum) is an intracellular parasite responsible for neosporosis. It also belongs to the family of Sarcocystidae. The life cycle of Neospora caninum is very close to that of T. gondii with two distinct phases: a sexual phase in the final host (ie canids and dogs in particular) which leads to the production of oocysts eliminated in the faeces and an asexual phase in an intermediate host (ie sheep, goats, cattle, horses, etc.) which leads to the production of tachyzoites and then cysts containing bradyzoites.

More recently, a live attenuated strain of Neospora caninum has been obtained, the Neo ncmicl-3 KO strain, which has been invalidated for the ncmicl and ncmic3 genes by homologous recombination. This mutant strain has been shown to have infectious and immunogenic properties which give mammals vaccine protection against the deleterious effects of neosporosis.

Toxoplasma gondii and Neospora caninum have in common a specific process of invasion of host cells in several stages leading to the formation of a parasitophore vacuole in which the parasite multiplies and develops.

The immunostimulatory properties of T. gondii have been known for many years and recently, new studies have confirmed the interest in using T. gondii as an immunostimulant and have provided answers on the mechanisms involved. In mice, infection with T. gondii or stimulation with a parasitic extract provides resistance to infection by Listeria monocytogenes (Neal and Knoll, 2014, PLoS, Pathog., 10 (6): el004203) by the H5N1 flu (O'Brien et al., 2011, J. Virol., 85 (17): 8680-8), or cerebral malaria caused by Plasmodium berghei (Settles et al., 2014, Infect. Immun., 82 (3): 1343-53). In the case of Plasmodium berghei, the effect observed depends on IL-12 and protection is potentially linked to the early production of IFN-γ (Settles et al., 2014). In the case of the influenza virus, the effect observed depends on the IFN-γ produced by the NK cells activated by the parasite extract. Finally, for Lysteria monocytogenes, the administration of T. gondii profilin before or after infection with Lysteria monocytogenes reproduces the protective effect. This protection, dependent on TLR11, on IFNγ, but independent of IL-12, involves inflammatory monocytes recruited at the site of infection strongly induced by profilin (Neal et al., 2014).

A non-replicative (gps) strain of T. gondii has also been used in the treatment of tumors (Baird et al., 2013, Cancer Res., 73 (13): 3842-51; Baird et al., 2013, J. Immunol., 190 (1): 469-78; Sanders et al., 2015, Oncoimmunology, 5 (4): el 104447). The living parasite by activating the innate immune system, disrupts immunosuppression which leads to a reactivation of the tumor-specific adaptive immunity, however some differences exist in the cells and the mechanisms involved.

About ten factors play a role in regulating the response of the host cell following infection with T. gondii.

The protein R0P16 is one of the best studied modulators of the host immune response (Saeij et al., 2007, Nature, 445 (7126): 324-7. This rhoptin protein is a protein kinase that interacts with the cascade signaling JAK / STAT by phosphorylating STAT3 via Tyr 705 and STAT6 via Tyr 641 and thus conferring on the parasite a role of suppressor of inflammation and control of the infection by the host cell. In parasites type I, II and III, ROP16 is capable of phosphorylating STAT3 and STAT6 but it is only in its type I and III form that it maintains in a constitutive and lasting manner, the phospohorylation of STATs 3 and 6 (Saeij et al., 2007, Yamamoto et al., 2009, J. Exp. Med., 206 (12): 2747-60) The immunosuppressive effect of ROP16 was notably demonstrated on a line of raw264.7 murine macrophages infected with different strains of Toxoplasma gondii ( type I, II, III, II ROP16 ΚΙ, II ROP16KI-NLS deficient) A decrease in the secretion of IL-12p40 after 24 hours is observed when the raw264.7 are infected with the strains expressing ROPI61. (Saeij et al., 2007). Furthermore, in vivo, in mice inoculated intraperitoneally with a type I strain ROPI61KO, an increase in the replication of the parasite in the liver, spleen, lungs and brain compared to a type IWT strain is observed (Butcher et al., 2011, PLoS Pathogen, 7 (9).: e1002236)

GRAI5 granule protein is also a protein capable of modifying the host response. The GRAI5 type II form (GRA15n) has a protein of 635 amino acids unlike the type I strain which has a truncated protein of 312 amino acids due to a mutation in the coding sequence which has produced a premature stop codon (Rosowski and al., 2011, J. Exp. Med., 208 (1): 195-212). Only GRA15n allows activation of the NF-κΒ signaling pathway independently of the MyD88 and Trif pathways (Rosowski et al., 2011) and allows classic activation of macrophages in Ml which express pro-inflammatory cytokines such as IL-12 / 23p40, IL-6 and other costimulators, CD40 and CD8; thus allowing the establishment of a protective Th1 response of the infected host (Jensen et al., 2011, CellHostMicrobe, 9 (6): 462-83).

In synergy with GRA15n, ROPI61 would also activate STAT5 to modulate the expression of genes in the host cell: Jensen and his team (2013) through the use of a variety of transgenic parasites and KO, have demonstrated that GRA15n and ROPI61 limit the replication of the parasite in the intestines of an orally infected mouse and improve the resistance to infection of macrophages stimulated by TNFa and IFN-γ. These mechanisms seem to be independent of STAT3 and STAT6, but dependent on STAT5.ROP16 induces a lasting phosphorylation of STAT5 as well as its nuclear translocation (Jensen et al., 2013, Infect. Immun., 81 (6): 2156-67).

Surprisingly, the inventors have found that the suppression of the function of the two proteins MIC3 and MIC1, in a strain of Sarcocystidae, leads to a mutant strain which has infectious and immunogenic properties conferring on birds and in particular poultry a vaccine protection vis -to the effects of infectious diseases.

The present invention therefore relates to a mutant strain of Sarcocystidae in which the function of the protein MIC1 and the function of the protein MIC3 are suppressed, for its use in the prevention of infectious diseases in poultry, said mutant strain of Sarcocystidae being formulated for administration in ovo or in a chick 0 to 72 hours old.

The term “poultry” designates hens, turkeys, guinea fowl, ducks, geese, quail, pigeons, pheasants, partridges, ostriches, rheas, emus and kiwis bred or kept in captivity for the purpose of their reproduction, production meat or eggs for consumption or the supply of restocking game.

According to the present invention, the mutant strain of Sarcocystidae can be administered in ovo, that is to say either in the amotic fluid or in the embryo, after the laying of the egg.

The development of a fertilized egg begins, by cell division, as soon as it crosses the oviduct of the poultry which is going to lay it. When poultry lays the egg, the embryo cools and development is halted.

The development of the embryo begins when the temperature of the egg exceeds 26.6 ° C.

According to the present invention, the mutant strain of Sarcocystidae can also be administered to a chick.

The term "chick" according to the present invention designates any poultry aged from 0 to 72 hours and not yet fed. However Muscovy ducks (Cairina moschata) or their crosses can be fed.

The use of the mutant strains of Sarcocystidae according to the present invention by these methods of administration will make it possible to prevent infectious diseases in poultry during its development and throughout its life.

For the purposes of the invention, the term "infectious disease" means a disease caused by an infectious agent chosen from: a virus, a parasite or a bacterium.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of infectious diseases in poultry, said infectious disease being a disease of 'viral origin.

Viral disease is a disease caused by a virus which can be:

- a myxovirus, in particular the Influenza virus, or

- a coronavirus, in particular the avian infectious bronchitis virus, or

- a reovirus, in particular the chicken viral arthritis virus, or

- a picomavirus, in particular the duckling hepatitis virus,

- a herpes virus, in particular the Mareck's disease virus,

- an adenovirus, in particular the turkey hemorrhagic enteritis virus.

According to a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of infectious diseases in poultry, said disease infectious being a disease of viral origin, the virus possibly belonging to the following groups:

• Group I, II of the Baltimore classification comprising viruses whose genome consists of DNA capable of infecting a chick, in particular a natural virus belonging to the family of Herpesviridae, and more particularly the Marek disease virus in the domestic hen, • Group III, IV and V of the Baltimore classification comprising viruses whose genome consists of single-stranded or double-stranded RNA and which are capable of affecting a chick, in particular viruses belonging to the family Orthomyxoviridae and more particularly avian influenza viruses.

• Group VI of the Baltimore classification comprising RNA viruses requiring DNA back-transcription for viral multiplication and capable of infecting a chick, in particular viruses of the family Retroviridae, • Group VII of the Baltimore classification comprising DNA virus requiring retrotranscription into RNA for viral multiplication and capable of infecting a chick, in particular the viruses of the family Hepadnaviridae, and more particularly the Peking duck hepatitis virus (DHBV).

In a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of viral origin in poultry, said viral illness being avian influenza.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of infectious diseases in poultry, said infectious disease being a disease of of bacterial origin.

Bacterial disease is a disease caused by bacteria of the genera:

Escherichia spp., In particular Escherichia coli

Clostridium spp. in particular Clostridiumperfringens

- Mycoplasma spp., In particular the species Mycoplasma gallisepticum,

Salmonella spp., In particular the species Salmonella pullorum, responsible for avian salmonellosis.

Pasteurella spp., In particular the species Pasteurella multocida

Ornithobacterium spp., In particular the species Ornithobacterium rhinotracheale

According to a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of infectious diseases in poultry, said disease infectious being a disease of bacterial origin (or caused by a toxin originating from a bacterium), said bacterium being able to belong to the following groups:

• GRAM positive shells which are likely to affect a chick directly or through one of these by-products, in particular bacteria belonging to the genus Staphylococcus, Streptococcus or Enteroccoccus;

• GRAM negative shells which are likely to affect a chick directly or through one of these by-products, in particular bacteria belonging to the genus Neisseria;

• GRAM positive bacilli which are likely to affect a chick directly or through one of these by-products, in particular bacteria belonging to the genus Listeria, Erysipelothryx, Corynebacterium or Bacillus;

• GRAM negative bacilli which can affect a chick directly or through one of these by-products, in particular bacteria belonging to the Enterobacteriacae family. Pseudomonaceae, Vibrionaceae or belonging to the genera Escherichia, Brucella, Haemophilus, Pasteurella, Bordetella, Légionella, Ornithobacterium or Salmonella;

• Positive or negative GRAM spiral-shaped bacteria which may affect a chick directly or through one of these by-products, in particular bacteria belonging to the genus Treponema, Leptospira or Borrelia;

• Mycoplasma type bacteria which are capable of affecting a chick directly or through one of these by-products, in particular bacteria belonging to the genera Mycoplasma and Ureaplasma;

• Bacteria not mentioned above having the capacity to invade a chick cell, in particular bacteria belonging to the genus Chlamydia, Rickettsia or Micobacterium.

Salmonella Enteritidis is responsible for foodborne illness and gastroenteritis. People get infected through contaminated poultry meat or eggs. The domestic hen is one of the most important vectors of salmonella. It is infected orally. The bacteria then colonize the digestive tract and can be permanently implanted in the ovaries during a transient phase of systemic dissemination.

Long-term babywearing in the digestive tract, especially in cæca, is responsible for the contamination of meat during slaughter and the contamination of the eggshell during passage through the cloaca. Carrying salmonella into the ovaries may be responsible for the vertical transfer of salmonella into the egg. This mode of contamination is less frequent but potentially more dangerous because it is difficult to detect and there is no possible corrective measure.

In a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of bacterial origin in poultry, said disease of bacterial origin being avian salmonellosis.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of infectious diseases in poultry, said infectious disease being a disease of parasitic origin.

Parasitic disease is a disease caused by a parasite which can be:

Eimeria spp., In particular the species Eimeria acervulina responsible for coccidiosis

- Echinuria spp., In particular the species Echimiria uncinata responsible for spirurosis

Trichostrongylus spp. in particular the species Trichostrongylus tenuis

Ascaris spp., In particular 1 species Ascaridia galli

Cestoda spp. in particular the Choanotaenia infundibulum species

Leishmania spp., In particular the species Leishmania infantum.

According to a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of infectious diseases in poultry, said disease infectious being a disease of parasitic origin, said parasite possibly belonging to the following groups:

• Protozoa likely to directly affect a chick, in particular protozoa belonging to the sporozoan, Rhizoflagellate, ciliate or belonging to the genera Encephalitozoon, Enterocytozoon or blastocystis;

• Nemathelminths likely to directly affect a chick, in particular Nemathelminths belonging to the genus Trichuris, Ascaris, Anisakis, Necator, Strongyloïdes, Toxocara, Ancylostoma, Trichinella, Loa, Onchocerca, Wichereria, or Enterobius;

• Plathelminths likely to directly affect a chick, in particular Plathelminths belonging to the genus Fasciola, Paragonimus, Opisthorchis, Sasciolopsis, Dicrocoelium, Clonorchis, Taenia, Diphyllobothrium, Echinococcus, Multiceps, Hymenolepsis and Shistosoma;

• Arthropods likely to be responsible for a disease or vectorization of an infectious agent vis-à-vis a chick, in particular arthropods belonging to the order of Anoploures of heteroptera, Shiphonaptera, Diptera, Brachycera or Mites.

Parasites of the genus Eimeria are responsible for avian coccidiosis and significant economic losses in poultry farming. They have intestinal tropism, ranging from the duodenum to the caeca and induce more or less severe diarrhea. For example, Eimeria tenella is weakly prevalent and highly virulent. This parasite affects caeca and induces necrotic haemorrhagic enteritis in chicken, responsible for very high morbidity and mortality rates. Conversely, Eimeria acervulina invades the duodenum and causes moderate enteritis. It is responsible for mortality below 10% and moderate morbidity which results in weight loss in industrial broiler farms between 1 and 3 weeks post-hatching. This weight loss can be responsible for a downgrading of carcasses and significant economic losses.

In a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of parasitic origin in poultry, said parasitic disease being coccidiosis.

The family of Sarcocystidae, in the Apicomplexes, includes in particular the genera Toxoplasma spp. and Neospora spp., which include the species Toxoplasma gondii and Neospora caninum, respectively.

In a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain of Toxoplasma spp., in particular of Toxoplasma gondii.

In a particular embodiment, the present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain of Neospora spp., in particular of Neospora caninum.

In the strains used in the present invention, the function of the proteins MIC1 and MIC3 has been suppressed.

Proteins are the effectors of cellular activity. The suppression of the function of a protein can result from its lack of biosynthesis or its non-functionality. The origin of this dysfunction can be linked to disturbances occurring during the transcription of the gene encoding the protein, during its translation or even occurring during the process of maturation of the protein (post-translational modifications). The deletion of the gene also explains why no protein can be synthesized.

The MIC1 and MIC3 proteins are proteins of micronemes, secretory organelles of Apicomplexes which play a central role in recognition and adhesion to host cells. They are respectively coded by the honey and mic3 genes.

In the present invention, the term “the function of the MIC1 protein is suppressed” means either the absence of expression of the MIC1 protein, or the expression of a non-functional MIC1 protein, for example the expression of a protein not having the function of the MIC1 protein and having a certain amino acid sequence identity with that of the MIC1 protein.

The expression “the function of the MIC3 protein is suppressed” means either the absence of the expression of MIC3 or the expression of a non-functional MIC3 protein, for example a protein lacking the function of the MIC3 protein. and having a certain amino acid sequence identity with that of the MIC3 protein.

The absence of the expression of the MIC1 protein and of the MIC3 protein can result from the deletion of all of the honey and mic3 genes coding respectively for the MIC1 and MIC3 proteins, or from its coding region, or from a mutation, deletion or insertion of one or more nucleotides in the coding region of the honey and mic3 genes resulting in the absence of expression of proteins or proteins with little amino acid sequence identity with the MIC1 proteins and MIC3, or a dysfunction of the promoter region or of the cis or trans regulatory region of the honey and mic3 genes, or of a dysfunction of one or more transcription factors capable of binding to said promoter region, or a dysfunction in the translation of messenger RNA, or some epigenetic modifications well known to those skilled in the art.

Thus, the function of a protein can be suppressed by inhibiting the expression of genes.

The expression “inhibition of the expression of the honey and mie3 genes” means all the mechanisms which disturb the transcription of the honey and mic3 genes into a messenger RNA or all the mechanisms which disturb the translation of the messenger RNA into proteins MIC1 and

MIC3, these two steps being necessary for the synthesis of a functional MIC1 and MIC3 protein.

A non-functional MIC1 protein or a non-functional MIC3 protein is a protein that does not have the ability to recognize host cells or that does not allow adhesion of the parasite to said host cells. A non-functional protein can result from a deletion or insertion of one or more amino acids or from a shift in the reading frame. In this case, the modification of the nucleic acid of the coding region does not block the expression mechanism of the protein which can possibly retain a certain amino acid sequence identity with that of the MIC1 protein or that of the MIC1 protein. protein MIC3, but changes the reading frame of the corresponding mRNA during the translation of the protein. The non-functionality of the MIC3 protein and of the MIC1 protein, can also be the consequence of inoperative or insufficient post-translational modifications (ie glycosylation, isoprenylation, phosphorylation, sulfation, amidation, acetylation, alkylation, etc.) and which enabled it to perform its function.

The function of the proteins MIC3 and MIC1, can also be suppressed indirectly, in particular by altering or suppressing the expression of one or more other proteins (in particular other adhesins) which bind to the proteins MIC3 and MIC1, to form a functional complex. The destructuring of such a complex leads to a loss of function of the proteins MIC3 and MIC1.

The function of a protein can be suppressed by:

- a mutation, a deletion or an insertion of one or more nucleotides in the nucleotide sequence of the gene coding for said protein, or

- the total deletion of the gene coding for said protein, or

the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence, or

- destabilization of the messenger RNA resulting from the transcription of the gene coding for said protein, or

- an inhibition of the translation of the messenger RNA of the gene coding for said protein.

By "mutation of one or more nucleotides" is meant the substitution, permutation or replacement of one or more nucleotides of a nucleotide sequence with one or more nucleotides not present in the wild-type sequence. The term wild sequence denotes the nucleotide sequence found in the natural state in the wild strain of the parasite. The wild sequence is by definition devoid of any human intervention through genetic engineering.

"Deletion of one or more nucleotides" means the deletion of one or more nucleotides from a nucleotide sequence.

By "insertion of one or more nucleotides" is meant the addition, addition or integration of one or more nucleotides into a nucleotide sequence.

The mutation, deletion or insertion of one or more nucleotides can take place inside one or more exons of the corresponding gene and consequently modify the coding region of said gene, or else take place inside d '' one or more introns and modify the splicing site of an intron concerned. This modification of the splicing site consequently changes the reading framework of the mRNA and results in the translation of a new protein whose amino acid sequence differs from the sequence of the so-called wild protein.

The term “total gene deletion” is understood to mean the deletion of the entire coding sequence (introns and exons), the deletion of the promoter region and the deletion of the 5 'and 3' untranscribed transcribed regions, called 5 'and 3'UTR , the term "gene" designating the promoter region (also called promoter), the coding sequence and the 5 'and 3' UTR regions.

The term “total deletion of the promoter region” is understood to mean the suppression of the total promoter sequence, that is to say the deletion of the nucleotide sequence located upstream of the 5 'untranscribed transcribed UTR region which serves as a regulatory unit. of gene expression.

The partial deletion of the promoter region or the partial deletion of the coding sequence corresponds to a partial deletion of the gene.

By partial deletion of the coding sequence is meant the deletion of part of the exons from the coding sequence, sufficient to alter the function of the expressed protein, or the deletion of part of the introns resulting in an alteration of splicing.

The term "partial deletion of the promoter region" means the deletion of part of the promoter sequence, that is to say of part of the nucleotide sequence located upstream of the 5 'UTR region transcribed untranslated which serves as a regulator of gene expression.

By "destabilization of the messenger RNA" is meant a reduction in its half-life, that is to say the period of time during which a messenger RNA is available to allow its translation into a protein. The stabilization of messenger RNAs is ensured by cis elements (the 5 ’and 3’ UTR sequences bordering the coding sequences of a gene) and trans elements, in particular proteins capable of binding to the cis elements. The half-life of a messenger RNA can vary in response to various stimuli such as environmental factors, growth factors or hormones. A modification, carried out in vitro by genetic engineering, of the nucleotide sequences of the cis elements is capable of modifying the half-life of messenger RNA.

By "inhibiting the translation of the messenger RNA of a gene" is meant blocking the translation of the messenger RNA into the corresponding protein. In this case, the messenger RNA of a gene is present in the cell, while the corresponding protein is absent. The inhibition of the translation of the messenger RNA of a gene can result from the dysfunction of an element of the translational machinery, in particular ribosomes, ribosomal RNAs (rRNA) or transfer RNAs (tRNA), or aminoacyl -RNA synthetases.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, in which the function of the MIC3 protein is deleted by:

- a mutation, a deletion or an insertion of one or more nucleotides in the nucleotide sequence of the mic3 gene coding for the MIC3 protein or

- the total deletion of the mic3 gene, or

the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the mic3 gene, or

- a destabilization of the messenger RNA resulting from the transcription of the mic3 gene or

- inhibition of the translation of the messenger RNA of the mic3 gene and the function of the MIC1 protein is suppressed by:

- a mutation, deletion or insertion of one or more nucleotides in the nucleotide sequence of the honey gene coding for the MIC1 protein or

- the total deletion of the honey gene, or

- the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the honey gene, or

- destabilization of the messenger RNA resulting from the transcription of the honey gene or

- inhibition of the translation of the messenger RNA of the honey gene.

In a particular embodiment, the present invention relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said strain comprising a total deletion of the honey and mic 3 genes.

In a particular embodiment, the present invention relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma spp., In which the function of the MIC1 protein and the function of the MIC3 protein are deleted, for its use in the prevention of diseases of infectious origin in poultry, in which the function of the protein R0P16I is also suppressed and / or said strain comprises at least one nucleic acid coding for the protein GRA15II as well as the means necessary for the expression of said protein.

The expression "means necessary for the expression" of a protein (the term protein being used for any amino acid molecule, such as protein, fusion protein, protein fragment, peptide, polyprotein, polypeptide, ... ) means any means which makes it possible to obtain the protein, in particular a promoter, a transcription terminator, an origin of replication and preferably a selection marker. The means necessary for the expression of a peptide are operably linked to the nucleic acid sequence encoding said peptide (of interest).

The means necessary for the expression of a peptide can be homologous means, that is to say included in the genome of the vector used, or else be heterologous. In the latter case, said means are cloned with the peptide of interest to be expressed.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma spp., In which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, and in which the function of the protein R0P16I coded by the roplôl gene, is suppressed by:

- a mutation, deletion or insertion of one or more nucleotides in the nucleotide sequence of the roplôl gene coding for the protein R0P16I or

- the total deletion of the roplôl gene, or

- the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the roplôl gene, or

- a destabilization of the messenger RNA resulting from the transcription of the roplôl gene or

- inhibition of the translation of the messenger RNA of the roplôl gene.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma spp., In which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, and in which said strain comprises at least one nucleic acid coding for the protein GRA15II as well as the means necessary for the expression of said protein.

In a particular embodiment, the present invention relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma spp., In which the function of the MIC1 protein and the function of the MIC3 protein are deleted, for its use in the prevention of diseases of infectious origin in poultry, in which the function of the protein R0P16I coded by the roplôl gene, is also suppressed and said strain comprises at least one nucleic acid coding for the protein GRA15II as well as the means necessary for expression of said protein.

In a particular embodiment, the present invention relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma spp., In which the function of the MIC1 protein and the function of the MIC3 protein are deleted, for its use in the prevention of diseases of infectious origin in poultry, in which the function of the protein R0P16I coded by the roplôl gene, is also suppressed and said strain comprises at least one nucleic acid coding for the protein GRA15II, as well as the means necessary to the expression of said protein, at a locus different from the locus of said roplôl gene.

When a gene heterologous to the initial strain is introduced into the genome of said strain by recombination, this recombination may be random or targeted so as to control the place of the genome where said gene will be inserted.

The term "locus" defines a precise and invariable physical location on a chromosome. Within the meaning of the present application, a locus defines a place on the chromosome where a gene is located.

Thus, a heterologous gene can be inserted randomly and thus at a locus different from a known gene, or it can be inserted in a targeted manner at the locus of a known gene, which may have been previously deleted.

In a particular embodiment, the present invention relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma spp., In which the function of the MIC1 protein and the function of the MIC3 protein are deleted, for its use in the prevention of diseases of infectious origin in poultry, in which the function of the protein ROP16I coded by the roplôl gene, is also suppressed and said strain comprises at least one nucleic acid coding for the protein GRA15II, as well as the means necessary to the expression of said protein, to the locus of said roplôl gene.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain mutant of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene and the function of the MIC1 protein is suppressed by a total deletion of the honey gene.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain mutant of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, and said strain comprises at least one nucleic acid encoding the GRA15II protein, as well as the means necessary for the expression of said protein, at a locus different from the locus of the roplôl gene coding for the protein ROP 161.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain mutant of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, the function of the protein ROP 161 encoded by the rop gene 161 is deleted by a total deletion of said rop 161 gene.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain mutant of Toxoplasma gondii, in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, the function of the ROP 161 protein encoded by the gene rop 161 is deleted by a total deletion of said roplôl gene and said strain comprises at least one nucleic acid coding for the GRA15II protein, as well as the means necessary for the expression of said protein.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain mutant of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, the function of the protein ROP 161 encoded by the roplôl gene is deleted by a complete deletion of said roplôl gene and said strain comprises at least one nucleic acid coding for the GRA15II protein, as well as the means necessary for the expression of said protein, at a locus different from the locus of said roplôl gene.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a strain mutant of Toxoplasma gondii, in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, the function of the protein R0P16I encoded by the roplôl gene is deleted by a complete deletion of said roplôl gene and said strain comprises at least one nucleic acid coding for the GRA15II protein, as well as the means necessary for the expression of said protein, at the locus of said roplôl gene.

The present invention also relates to a mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use in the prevention of diseases of infectious origin in poultry, said mutant strain being a mutant strain of Neospora caninum in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene and the function of the MIC1 protein is suppressed by a total deletion of the honey gene.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma gondii, in which the function of the protein MIC1, the function of the protein MIC 3 are deleted, and in which the function of the protein R0P16I is also deleted and / or said strain comprises a nucleic acid coding for the protein GRA15II as well as the means necessary for the expression of said protein.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma gondii, in which the function of the MIC1 protein, the function of the MIC 3 protein and the function of the R0P16I protein are deleted.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma gondii, in which the function of the MIC1 protein, the function of the MIC 3 protein are deleted, and said strain comprises a nucleic acid encoding the GRA15II protein, as well as the means necessary for the expression of said protein, at a locus different from the locus of said roplôl gene coding for the protein ROP16I.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain being a mutant strain of Toxoplasma gondii, in which the function of the protein MIC1, the function of the protein MIC 3 and the function of the protein ROP16I encoded by the roplôl gene are deleted and said strain comprises a nucleic acid coding for the GRA15II protein, as well as the means necessary for the expression of said protein, at a locus different from the locus of said roplôl gene.

The present invention also relates to a mutant strain in which said strain of Sarcocystidae is a strain of Toxoplasma spp., In particular a strain of Toxoplasma gondii.

The present invention also relates to a mutant strain in which said strain of Sarcocystidae is a strain of Neospora spp., In particular a strain of Neospora caninum.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain of Sarcocystidae being a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by:

a mutation, a deletion or an insertion of one or more nucleotides in the nucleotide sequence of the mic3 gene coding for the MIC3 protein or the total deletion of the mic3 gene, or the total or partial deletion of the promoter region and / or the total deletion or partial of the coding sequence of the mic3 gene, or

- destabilization of the messenger RNA resulting from the transcription of the mic3 gene, or

- inhibition of the translation of the messenger RNA of the mic3 gene, the function of the MIC1 protein is suppressed by:

- a mutation, deletion or insertion of one or more nucleotides in the nucleotide sequence of the honey gene coding for the MIC1 protein, or

- the total deletion of the honey gene, or

- the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the honey gene, or

- destabilization of the messenger RNA resulting from the transcription of the honey gene, or

- an inhibition of the translation of the messenger RNA of the honey gene, and in which the function of the protein R0P16I is suppressed by:

- a mutation, deletion or insertion of one or more nucleotides in the nucleotide sequence of the roplôl gene coding for the protein R0P16I, or

- the total deletion of the roplôl gene, or

- the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the roplôl gene, or

- a destabilization of the messenger RNA resulting from the transcription of the roplôl gene, or

an inhibition of the translation of the messenger RNA of the roplôl gene and / or said strain comprises a nucleic acid coding for the GRA15II protein, as well as the means necessary for the expression of said protein.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain of Sarcocystidae being a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene the function of the MIC1 protein is suppressed by a total deletion of the honey gene and the function of the protein R0P16I is suppressed by a total deletion of the roplôl gene.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain of Sarcocystidae being a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by total deletion of the mic3 gene the function of the MIC1 protein is suppressed by total deletion of the honey gene and said strain comprises a nucleic acid coding for the protein GRA15II, as well as the means necessary for the expression of said protein.

The present invention also relates to a mutant strain of Sarcocystidae, said mutant strain of Sarcocystidae being a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by total deletion of the mic3 gene the function of the MIC1 protein is suppressed by total deletion of the honey gene the function of the protein R0P16I is suppressed by total deletion of the roplôl gene and said strain comprises a nucleic acid coding for the protein GRA15II, as well as the means necessary for the expression of said protein, at a locus different from the locus of said roplôl gene coding for the protein R0P16I.

The present invention also relates to a pharmaceutical composition comprising at least one of the mutant strains of Sarcocystidae as defined above.

The present invention also relates to a composition comprising at least one of the mutant strains of Sarcocystidae as defined above, for its use as a medicament.

DESCRIPTIONS OF FIGURES

Figure 1-A: this figure is a schematic representation of the plasmid pTgMIC3-K0-CATGFP loxP. This 9,931 base pair plasmid comprises the selection gene encoding the chimeric protein CAT-GFP placed under the control of the opl’α-tubulin promoter of Toxoplasma gondii to allow expression of the gene in the parasite. This selection cassette is surrounded by two identical loxP sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the tgmic3 gene.

Figure 1-B: this figure is a schematic representation of the plasmid pTgMICl-KO-CATGFP loxN. This 10,285 base pair plasmid comprises the selection gene coding for the chimeric protein CAT-GFP placed under the control of the asma’α-tubulin promoter of Toxoplasma gondii to allow expression of the gene in the parasite. This selection cassette is surrounded by two identical loxN sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the tgmicl gene.

Figure 1-C: this figure is a schematic representation of the plasmid pTSAG1-Cre recombinase. This 4,694 base pair plasmid includes the gene encoding the CRE-Recombinase protein placed under the control of the promoter of the Toxoplasma gondii sag1 gene to allow expression of the gene in the parasite. Downstream of the gene encoding Cre Recombinase, the 3’UTR sequence of the sagl gene of Toxoplasma gondii is inserted to stabilize the mRNA encoding the Cre Recombinase protein.

Figure 2-A: this figure illustrates the 4 steps to obtain the Toxo tgmicl-3 KO 2G strain. The first stage of homologous recombination allows the integration of the gene coding for the enzyme CAT-GFP at the locus of the mic3 gene. Selection by chloramphenicol makes it possible to amplify the single mutant strain Toxo tgmic3 KO. In a second step, the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase. The third step allows the integration of the gene encoding the enzyme CAT-GFP into the locus of the honey gene. Selection with chloramphenicol amplifies the single mutant strain

Toxo tgmicl-3 KO. Finally, in a last step, the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase.

Figure 2-B: this figure represents the electrophoretic profiles of the PCR products obtained respectively with the wild RH strain of Toxoplasma gondii, the Toxo tgmiedKO strain, the Toxo tgmied KO 2G strain, the Toxo tgmic7-3 KO strain and the final Toxo tgmicl strain -3 KO 2G using the PCR primer sets in Table 3.

Figure 2-C: this figure represents the results of the sequencing obtained on the Toxo tgmicl-3 KO 2G strain and confirms that the honey and mie 3 genes have been deleted and replaced respectively by LoxN and LoxP scars.

Figure 2-D: This figure illustrates the position of the nucleic primers used in the present invention to detect the presence of the three genes tgmic3, tgmicl, cat-gfp in wild strains and / or mutant strains of Toxo tgmic3 KO and / or Toxo tgmic3 KO 2G and / or Toxo tgmicl-3 KO and / or Toxo tgmicl-3 KO 2G of Toxoplasma gondii. The figures represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.

FIG. 3 A and B: this figure illustrates the analysis by immunofluorescence of the detection of the proteins MIC1, MIC3 or CAT-GFP obtained respectively with the wild RH strain of Toxoplasma gondii, the Toxo tgmicJ KO strain, the Toxo tgmied KO 2G strain, the Toxo tgmic7-3 KO strain and the Toxo tgmic7-3 KO 2G strain using an antibody specifically directed against the protein MIC1 (FIG. 3 A), MIC3 (FIG. 3B) or directly with the intrinsic fluorescent properties of the protein CAT-GFP .

Figure 4: this figure is a schematic representation of the plasmid pTgROP16-KO-CATtdTomato. This 9,443 base pair plasmid comprises the selection gene encoding the chimeric protein CAT-tdTomato placed under the control of the Toxoplasma gondii Τα-tubulin promoter to allow expression of the gene in the parasite. On either side of the cassette were inserted the homologous regions flanking the tgroplô gene.

Figure 5-In this figure illustrates the step to obtain the Toxo tgmicl-3 KO 2G roplôKO strain. This homologous recombination step allows the integration of the gene coding for the enzyme CAT-tdTomato at the locus of the roplô gene. Selection by chloramphenicol makes it possible to amplify the simple mutant strain Toxo tgmicl-3 KO 2G roplôKO.

Figure 5-B: this figure represents the electrophoretic profiles of the PCR products obtained respectively with the Toxo tgmicl-3 KO 2G strain and the Toxo tgmic3 KO 2G strain and the Toxo tgmicl-3 KO - 2G / ROP 16 KO strain using the sets PCR table primers from Table 6.

Figure 5-C: this figure illustrates the position of the nucleic primers used in the present invention to detect the presence of the two genes tgroplô and cat-tdtomato in the wild strain and / or the mutant strain of Toxo tgmicl-3 KO roplô KO of Toxoplasma gondii. The figures represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.

Figure 6: this figure represents the plasmid pT230-2G GRA15n. This 8108 base pair plasmid comprises the Ble selection gene under the control of the tubαtubulin promoter from Toxoplasma gondii to allow the expression of a protein for resistance to phleomycin. Downstream of this cassette was integrated the expression cassette for coding the Gral5HAII protein.

Figure 7-A: this figure represents the electrophoretic profiles of the PCR products obtained respectively with the strains Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO 2G GRA15n Kl and the wild strain ME49, using the sets of primers of the PCR of the Table 9.

Figure 7-B: this figure illustrates the position of the nucleic primers used in the present invention to detect the presence of the genes gra! 5 and gra! 5II in the strains Toxo tgmicl3 KO 2G, Toxo tgmicl-3 KO 2G GRA15n Kl and the strain wild ME49 (type II) of Toxoplasmagondii. The figures represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.

Figure 8: this figure illustrates the immunofluorescence analysis of the detection of the GRA I5 protein (via the HA tag) obtained respectively with the strains Toxo tgmicl-3 KO 2G and Toxo tgmicl-3 KO 2G GRA15 _n Kl.

Figure 9: this figure represents the electrophoretic profiles of the PCR products obtained respectively with the strains Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO 2G roplôKO

GRA15n Kl and wild strain ME49, using the PCR primer sets from Table

9.

Figure 10: this figure illustrates the immunofluorescence analysis of the detection of the GRA15 protein (via the HA tag) obtained respectively with the strains Toxo tgmicl3 KO 2G, Toxo tgmicl-3 KO 2G roplôKO and Toxo tgmicl-3 KO 2G roplôKO GRA15 _n Kl.

Figure 11: this figure is a schematic representation of the plasmid pTgRoplôKOGral5IIKI-CAT-GFP lox2272. This 12,721 base pair plasmid comprises the selection gene encoding the chimeric protein CAT-GFP placed under the control of the Toxoplasma gondii Τα-tubulin promoter to allow expression of the gene in the parasite. This selection cassette is surrounded by two identical lox2272 sites of the same orientation, added by PCR. Downstream of this cassette was integrated the expression cassette for coding the Gral5HAII protein. Then on either side of these cassettes were inserted the homologous regions flanking the tgroplô gene.

Figure 12-A: this figure illustrates the 2 steps to obtain the Toxo tgmicl-3 KO roplô KO GRA15II KI-2G strain. The first step in homologous recombination allows the integration of the gene coding for the enzyme CAT-GFP and the gralSIIHA gene at the locus of the roplô gene. Selection by chloramphenicol makes it possible to amplify the mutant strain Toxo tgmicl-3 KO roplô KO GRA15II Kl. In a second step, the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase to obtain the Toxo tgmicl-3 KO roplô KO GRA15IIKI-2G strain.

Figure 12- B: this figure represents the electrophoretic profiles of the PCR products obtained respectively with the strains Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO roplô KO GRA15II Kl and Toxo tgmicl-3 KO roplô KO GRA15II Kl 2G

Figure 12-C: this figure illustrates the position of the nucleic primers used in the present invention to detect the presence of the three genes tgroplô, gralSII, cat-gfp in wild strains and / or mutant strains of Toxo tgmicl-3 KO roplô KO Gral5II Kl of Toxoplasmagondii. The figures represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.

Figure 12-D: this figure represents the results of the sequencing obtained on the Toxo tgmicl-3 KO roplô KO GRA15II Kl 2G strain and confirms that the roplô and cat-gfp genes have been deleted and replaced by the scar Lox2272 and the gralSHAII gene.

Figure 13: this figure illustrates the immunofluorescence analysis of the detection of the GRA15 protein (via the HA tag) obtained respectively with the strains Toxo tgmicl-3 KO roplô KO GRA15II Kl and Toxo tgmicl-3 KO roplô KO GRA15II KI-2G using an antibody specifically directed against the HA tag. This figure also illustrates the deletion of the CATGFP cassette with the disappearance of the GFP fluorescence for the Toxo tgmicl-3 KO roplô KO GRA15IIKI-2G strain.

Figure 14-A: this figure is a schematic representation of the plasmid pNcMIC3-K0CAT-GFP loxN. This 10,063 base pair plasmid includes the selection gene encoding the chimeric protein CAT-GFP placed under the control of the Toxoplasma gondii Ι’-tubulin promoter to allow expression of the gene in the parasite. This selection cassette is surrounded by two identical loxN sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the ncmic 3 gene.

Figure 14-B: this figure is a schematic representation of the plasmid pNcMICl-KOCAT-GFP loxP. This 10069 base pair plasmid comprises the selection gene encoding the chimeric protein CAT-GFP placed under the control of the opl’α-tubulin promoter of Toxoplasma gondii to allow expression of the gene in the parasite. This selection cassette is surrounded by two identical loxP sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the ncmicl gene.

Figure 15-A: this figure illustrates the 4 steps to obtain the Neo ncmicl-3 KO 2G strain. The first stage of homologous recombination allows the integration of the gene coding for the enzyme CAT-GFP at the locus of the mic3 gene. Selection by chloramphenicol makes it possible to amplify the single mutant strain Neo ncmic3 KO. In a second step, the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase. The third step allows the integration of the gene encoding the enzyme CAT-GFP into the locus of the honey gene. Selection by chloramphenicol makes it possible to amplify the single mutant strain Neo ncmicl-3 KO. Finally, in a last step, the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase.

Figure 15-B: this figure illustrates the position of the nucleic primers used in the present invention to detect the presence of the three genes ncmic3, ncmicl, cat-gfp in wild strains and / or mutant strains of Neo ncmic3 KO and / or Neo ncmic3 KO 2G and / or Neo ncmicl-3 KO and / or Neo ncmicl-3 KO 2G of Neospora caninum. The figures represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.

Figure 15-C: this figure represents the electrophoretic profiles of the PCR products obtained respectively with the wild strain NC-1 of Neospora caninum, the strain Neo ncmic3 KO, the strain Neo ncmic3 KO 2G, the strain Neo ncmicl-3 KO and the strain Neo ncmicl-3 KO 2G using the PCR primer sets in Table 16.

Figure 15-D: this figure represents the results of the sequencing obtained on the Neo ncmicl-3 KO 2G strain and confirms that the honey and mic3 genes have been deleted and replaced respectively by LoxP and LoxN scars.

Figure 16-A: this figure illustrates the immunofluorescence analysis of the detection of the MIC3 protein obtained respectively with the wild strain NC-1 of Neospora caninum and Neo strain ncmicl-3 KO 2G using an antibody specifically directed against the MIC3 protein .

Figure 16-B: this figure illustrates the immunofluorescence analysis of the detection of the CATGFP protein obtained respectively with the wild strain NC-1 of Neospora caninum and the mutant strains of Neospora caninum using the intrinsic fluorescence of the CATGFP protein. This figure highlights the presence of the CATGFP protein or the absence of the CATGFP protein following the action of Cre Recombinase.

Figure 17: this figure illustrates the growth of chicks between D4 and D27 after immunization (AB) by in ovo route at a dose of ΙΟ ³ , 10 ⁴ or 10 ⁵ tachyzoites per animal inoculated either in the amniotic fluid (A) or in the embryo (B). (C) Immunostimulation performed subcutaneously at 1 day of age at a dose of ΙΟ ⁴ , 10 ⁵ or 10 ⁶ tachyzoites per animal. (DF) Corresponding statistical analysis. Two-way ANOVA with Dunnett post-hoc test. The animals having been sacrificed in series, the number of animals remaining per group is indicated above the curves. Average +/- SEM.

Figure 18: this figure illustrates the titer of antibodies directed against Toxo-KO + 2G after immunization (AB) by in ovo route at a dose of ΙΟ ³ , 10 ⁴ or 10 ⁵ tachyzoites per animal inoculated either in the amniotic fluid (A) or in the embryo (B). (C) Immunostimulation performed subcutaneously at 1 day of age at a dose of ΙΟ ⁴ , 10 ⁵ or 10 ⁶ tachyzoites per animal. (DF)

Corresponding statistical analysis. Two-way ANOVA with post-hoc Bonferroni test.

N = 5 per group. Average +/- SEM.

Figure 19: this figure illustrates the Weight and the average daily gain of the animals. A-B Weight of animals infected on D14 or not infected at the time of slaughter. C-D Weight of animals sacrificed on D35, infected on D7 on the left or infected on D14 on the right. E-F Average daily gain of animals sacrificed on D35, infected on D7 on the left or infected on D14 on the right. Two-way ANOVA with post-hoc Tukey test. Complete statistical analyzes are available in the Appendix on page 16. n = 9-12 per group.

Figure 20: this figure illustrates the score for gross intestinal lesion measured seven days after infection with Eimeria acervulina. Results obtained for groups infected at 7 days or 14 days of life. A frequency test (χ2) was used to compare the groups. There is no significant difference between the immunostimulated animals and the control animals. N = 15-18 / group.

Figure 21A: This figure illustrates the expression of IgY directed against Toxoplasma gondii measured in the serum of chickens sacrificed on D21 (infected on D14) and on D35 (infected on D7 and D14). No antibody titer could be determined in animals infected on D7 and sacrificed on D14 (data not shown). Two-way ANOVA with post-hoc Tukey test. n = 918 / group.

Figure 21B: this figure illustrates the expression of IgY directed against Toxoplasma gondii measured in the serum of chickens sacrificed on D35. The animals were immunostimulated with 10 ³ or 10 ⁵ tachyzoites of the Toxo tgmicl-3 KO roplôKO gral5II Kl strain. DMEM (Dulbecco's modified eagle's medium) was used as a control. The animals were then infected or not with 2.10 ⁵ oocysts of Eimeria acervulina on D7 or D14 post immunostimulation. Two-way ANOVA with post-hoc Tukey test. n = 9-12 / group.

Figure 22: this figure illustrates the weight gain of chickens immunostimulated with fresh (AB) or freeze-dried (CD) tachyzoites. (AB) Immunostimulation performed on D1 at a dose of 10 ⁵ tachyzoites (sc), DMEM (Dulbecco's modified eagle's medium) alone was used as a control. (CD) Immunostimulation performed on D1 at a dose of 10 ⁷ tachyzoites (sc), the F4 solution was used as a control. Animals infected 7 days post

Immunostimulation (A and C) or 14 days post-immunostimulation (B and D) with 2.27.10 ⁴ bacteria of strain Salmonella Enteritidis by the oral route. The animals were sacrificed in series, the number of animals remaining per group is shown under the curves. Average + / SEM. The differences are smaller than the characters representing the curve points and are therefore not always visible. Two-way ANOVA with post-hoc Tukey test. Ns p value>0.05; ** p value <0.001; *** p value <0.0005; **** p value <0.0001.

Figure 23: this figure represents the carrying of salmonella in the caes of immunostimulated chickens with fresh (A-B) or freeze-dried (C-D) tachyzoites. (A-B)

Immunostimulation performed on D1 at a dose of 10 ⁵ tachyzoites (sc), DMEM alone was used as a control. (CD) Immunostimulation carried out on D1 at the dose of 10 ⁷ lyophilized tachyzoites (sc), the F4 solution was used as a control. Animals infected 7 days post-immunostimulation (A and C) or 14 days post-immunostimulation (B and D) with 2.27.10 ⁴ Salmonella Enteritidis orally. The data were transformed by the logarithm function before statistical analysis and graphical representation. Average +/- SEM. When the number of dimensions exceeds 2, a two-way ANOVA with a post-hoc Bonferroni test was performed. Otherwise, the t student test was used, ns p value>0.05; ** p value <0.001; *** p value <0.0005; **** p value <0.0001.

Figure 24: Antibody titer measured in ELISA from serum from immunostimulated chickens with fresh (AB) or lyophilized (CD) tachyzoites. (AB) Immunostimulation performed at one day of age at a dose of 10 ⁵ tachyzoites (sc), DMEM alone was used as a control. (CD) Immunostimulation performed at one day of age at a dose of 10 ⁷ tachyzoites (sc), the F4 solution was used as a control. Animals infected 7 days post-immunostimulation (A and C) or 14 days post-immunostimulation (B and D) with 2.27.10 ⁴ bacteria of strain Salmonella Enteritidis orally. Average +/- SEM. When the number of dimensions exceeds 2, a two-way ANOVA with a post-hoc Bonferroni test was performed. Otherwise, the t student test was used, ns p value>0.05; ** p value <0.001; *** p value <0.0005; **** p value <0.0001.

Figure 25: Effect of immunostimulation by Toxo-KO + 2G on viral load. Viral titers measured by RT-qPCR in the lungs, orotracheal secretions and in the kidneys of chickens infected on D6, D13 or D20 by the H7N1 virus intratracheally (Dose shown in the graph). Prior to this infection, the animals were immunized with ToxoKO + 2G at 1 day of age (10 ⁵ tachyzoites per animal, 100 μL, sc) or were inoculated with a control solution (100 μL of DMEM, sc). The values of the viral titles were converted by the logarithm function before the graphic representation and before the statistical calculations.

Average +/- SEM. Two-way ANOVA with post-hoc Sidack post-hoc test. ns p value>

0.05; * p <0.05. EID50: eggs infectious doses 50.

Figure 26: Expression of IFN-beta (A) and MDA5 (B) mRNAs in chicken lung parenchyma previously immunostimulated on D1 or having received a control dose (DMEM). The chickens were infected on D6, D13 and D20 with the H7N1 virus or received a control dose (PBS). They were sacrificed respectively on D10, D17 and D23 to carry out the analyzes. n = 6 per group, average +/- SEM.

Example 1: Construction of the Toxo Tgmicl-3 KO - 2G strain (denoted Toxo KO 2G)

The haploidy of the Toxoplasma gondii genome during the proliferative phase allows the invalidation of a gene in a single homologous recombination.

Culture of parasites

All the tachyzoites of the Toxoplasma gondii strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634)) cultured in minimal medium from Dulbecco (DMEM) supplemented with 10% fetal calf serum (SVF), 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.

Construction of plasmids • pTgMIC3-KO-CAT-GFP loxP plasmid

The plasmid pTgMIC3-KO-CAT-GFP Lox P SEQ ID NO: 34 (Figure IA) was constructed to suppress the gene coding for the protein TgMIC3 of Toxoplasma gondii (ATCC reference: RH strain Pra310) by homologous recombination.

The plasmid pTgMic3K0-CAT-GFP loxP SEQ ID NO: 34 contains a selection cassette CAT-GFP SEQ ID NO: 6 comprising a selection gene cat-gfp SEQ ID NO: 2 coding for a fusion protein CAT-GFP allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP: Green Fluorescent Protein), under the control of the Tox'α-tubulin promoter of Toxoplasma gondii SEQ ID NO: 3. Downstream of the cat-gfp gene SEQ ID NO: 2, the 3'UTR sequence of the Toxoplasma gondii sagl gene SEQ ID NO: 4 is inserted. SEQ ID NO: 6 was amplified from plasmid pT230 CAT-GFP SEQ ID NO: 9 using the primers SEQ ID NO: 35 and SEQ ID NO: 36 which allow the addition of loxP sites (SEQ ID NO: 12) and HindlII and Spel restriction sites. The nucleotide sequence amplified by PCR (2389 bp) was then cloned into the plasmid pT230TUB Ble SEQ ID NO: 37 by enzymatic digestion with the restriction enzymes HindIII and Spel. The plasmid obtained is called pCATGFP loxP SEQ ID NO: 38.

The 3'HR region of the Tgmic3 gene SEQ ID NO: 39 was obtained by double enzymatic digestion of the plasmid pmic3KO-2 SEQ ID NO: 40 with the restriction enzymes Kpnl and HindlII (2145pb), then cloned into the plasmid pCATGFP loxP SEQ ID NO: 38 digested with Kpnl and HindIII (5238pb). The plasmid obtained is called p3'UTRmic3-CATGFP loxP SEQIDNO: 41.

The 5’HR region of the Tgmic3 gene SEQ ID NO: 42 was amplified by PCR from the genomic DNA of the RH strain of T gondii. For amplification, the primers SEQ ID NO: 43 and SEQ ID NO: 44 allow the amplification of the 5’UTR region of the Tgmic3 gene and the creation of two restriction sites (2568pb / Spel and Xbal sites). These restriction sites were used to clone the 5HR fragment digested with Spel and Xbal (2548bp) into the plasmid p3'UTRmic3-CATGFP loxP SEQ ID NO: 38 downstream of the selection cassette CAT-GFP SEQ ID NO: 6 to level of the Spel site of the plasmid previously described (7383 bp) to obtain the plasmid pTgMic3KO-CAT-GFP loxP SEQ ID NO: 34.

The sequences of the primers are shown in Table 1 below.

Table 1: Sequences of the primers used for the construction of the plasmid pTgMIC3-KOCAT-GFP loxP.

Construction duplasmidepTgmic3KO CAT-GFPloxP SEQ ID NO: 35 GCGGC’C A AGCTT. 1T AA CTTCGTA TAA TGTA TGCTA TA CGA HindIII. loxP AGrL4rGATATGCATGTCCGCgttcgtgaaatctctgatcaagcgg SEQ ID NO: 36 cgacgcacgctgtcactcaacttgctGCTAGA4CL4GrGGATCCArA4 CTTCGTA TAGCA TACA TTATACGAAGTTA TCCCTCGG Spel, Bam HI. loxP SEQ ID NO: 43 GGGATCCACTAGTTTACGTATCGCGACTAGCAGCAAG TTGAGTGACAGCG BamHI, Spel, SnaBI, NruI SEQ ID NO: 44 GCTGCAGTCTAGAGATATCCACGTGGAATTCCTCTTGG GAAGAACAAT PstI, Xbal, EcoRV Pmll

• pTgMIC 1 -KO-CAT-GFP loxN plasmid

The plasmid pTgMIC 1-KO-CAT-GFP loxN SEQ ID NO: 45 (Figure 1-B) was constructed to suppress the gene coding for the protein TgMIC1 of Toxoplasma gondii by homologous recombination.

The plasmid pTgMiclKO-CAT-GFP loxN SEQ ID NO: 45 contains a selection cassette CAT-GFP SEQ ID NO: 6 comprising the selection gene cat-gfp SEQ ID NO: 2 coding for the fusion protein CAT-GFP allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP: Green Fluorescent Protein), under the control of the Tox'α-tubulin promoter of Toxoplasma gondii SEQ ID NO: 3. Downstream of the cat-gfp gene SEQ ID NO: 2, the 3'UTR sequence of the Toxoplasmagondii SEQ ID NO: 4 sag1 gene has been inserted.

SEQ ID NO: 6 was amplified from the plasmid pT230 CAT-GFP SEQ ID NO: 9 using the primers SEQ ID NO: 46 and SEQ ID NO: 47 which allow the addition of loxN sites (SEQ ID NO: 5) and Clal and Xbal restriction sites. The PCR-amplified nucleotide sequence was then cloned into the plasmid pNcMic3K0-DHFR SEQ ID NO: 10 digested with Clal and Xbal (7715 bp) by enzymatic digestion with the restriction enzymes Clal and Xbal.

The plasmid obtained is called pNCmic3KO CATGFP LoxN SEQ ID NO: 48.

The 5HR tgmicl SEQ ID NO: 49 fragment was amplified by PCR with the primers SEQ ID NO: 50 and SEQ ID NO: 51 (2364pb), the restriction sites Kpn1 and ClaI were added by PCR. The amplified fragment is digested with the restriction enzymes Kpnl and Clal (2337pb) and cloned into the plasmid pNCmic3KO CATGFP LoxN SEQ ID NO: 48 (see example 6 for obtaining the plasmid pNCmic3KO CATGFP LoxN) digested with Kpnl and Clal (7740pb ) to replace the 5HR ncmic3 fragment (fragment digested with Kpnl and ClaI). The plasmid obtained is called pTgmiclKO5HR-NCmic3KO3HR CATGFP LoxN SEQ ID NO: 111

Then the 3HR fragment tgmicl SEQ ID NO: 52 was amplified by PCR with the primers SEQ ID NO: 53 and SEQ ID NO: 54 (2750bp), the restriction sites Xbal and NotI were added by PCR. The amplified fragment is digested with the restriction enzymes Xbal and Notl (2720 bp) then cloned into the plasmid pTgmiclKO5HR-NCmic3KO3HR CATGFP LoxN SEQ ID NO: 11 l digested by the restriction enzymes Xbal and Notl (7565 bp) to replace the fragment 3HR ncmic3 (fragment digested with Xbal and NotI). The plasmid obtained is called pTgmiclKO CAT-GFP LoxN SEQ ID NO: 45

The primers used for the PCRs are detailed in Table 2 below.

Table 2: Primers allowing the construction of the plasmid pTgmic3KO CAT-GFP loxP

Construction duplasmidepTgmic3KO CAT-GFPloxP SEQ ID NO: 46 TCCGCTCTCAGAGAATCGATGAAGCTTATAACTTCGTA TAGTATACCTTATACGAAGTTATGATATGCATGTCCGCG Clal LoxN TTCGTGAAATCTC SEQ ID NO: 47 ATACGTAAACTTCTAGATCCATAACTTCGTATAAGGTA TACTATACGAAGTTATCCCTCGGGGGGGCAAGAATTGT Xbal loxN GTTAACCGGTTCGA SEQ ID NO: 50 GTAGCAAGGTACCACAAGCTAAAGAAACTAGTGCCTCT TCTAAA 5HR tgmiclFor Kpnl SEQ ID NO: 51 TAAACGGGCTGATCGATGCAGGTAAATTCTATAGCCGG GT 5HR tgmicl Rev Clal SEQ ID NO: 53 TAAACGGGCTGATCGATGCAGGTAAATTCTATAGCCGG GT 3HR tgmiclFor Xbal SEQ ID NO: 54 AAAAACTCGGTGGCGGCCGCATAAAGAAGAGCAAGGA AAA 3 HR tgmicl rev Notl

• pTSAGl- Cre Recombinase Plasmid

The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 was constructed to transiently express in the parasite Toxoplasma gondii and its genetically modified derivatives the gene encoding the Cre Recombinase protein derived from bacteriophage PI (Brecht et al., 1999 , same reference as above).

The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 is derived from the plasmid pUC18 (commercial plasmid) which contains an expression cassette for the Cre Recombinase of bacteriophage PI. In the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15, the gene encoding Cre Recombinase SEQ ID NO: 16 is placed under the control of the promoter of the sagl gene of Toxoplasma gondii SEQ ID NO: 17, which allows expression of the Cre Recombinase protein in the transfected Toxoplasma gondii parasites. Downstream of the gene encoding Cre Recombinase SEQ ID NO: 16, the 3’UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the Cre Recombinase protein.

The absence of a specific selection cassette does not allow stable integration of the transfected genetic material but only a transient expression of Cre Recombinase.

Construction of the Toxo Tgmicl-3 KO - 2G strain

The construction of the second generation attenuated living strain, called Toxo tgmicl-3 KO - 2G, is done in 4 distinct steps (Figure 2-A):

1. Deletion by homologous recombination of the Tgmic3 gene and its replacement by the selection cassette CAT-GFP SEQ ID NO: 6 framed by LoxP sequences SEQ IDNO: 12.

To obtain this strain, the wild strain of Toxoplasma gondii RH (reference ATCC: PRA-310) is electroporated with the plasmid pTgMIC3-KO-CAT-GFP loxP SEQ ID NO: 34. 20 μg of plasmid purified then linearized with Kpnl are added to 10 ⁷ parasites suspended in the CYTOMIX electroporation medium containing ATP (3 mM) and Glutathione (3 mM) (Van den Hoff et al., Nucleic Acid Research, Jun 11; 20 (11): 2902), and Telectroporation was carried out in a 4 mm gap cuvette, in a volume of 800 pL on a BioRad device (Parameters: 2000V, 50 ohms, 25 pF, with two electric shock). After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 μΜ), 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA with DNAzol from the clones of interest. The strain obtained is called Toxo tgmic3 KO.

In this strain, the mic3 gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing the CATGFP selection cassette is SEQ ID NO: 103. Since the honey gene is not deleted, the sequence of the honey gene SEQ ID NO: 108 is present in the genome of strain.

2. Deletion of the selection cassette SEQ ID NO: 6: the Toxo tgmic3 KO strain obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15.

The transiently expressed enzyme will allow excision of the selection cassette CAT-GFP SEQ ID NO: 6. The electroporation protocol is similar to the previous protocol. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA with DNAzol from the clones of interest . The strain obtained is called Toxo tgmic3 KO - 2G.

3. In this strain, the mic3 gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19. The honey gene not being deleted, the sequence of the honey gene SEQ ID NO: 108 is present in the genome of the strain. Deletion by homologous recombination of the tgmicl gene and its replacement by the selection cassette CAT-GFP SEQ ID NO: 6 framed by Lox N sequences SEQ ID NO: 5. To obtain this strain, the Toxo tgmic3 KO - 2G strain is electroporated with the plasmid pTgMICl-KO-CAT-GFP lox N SEQ ID NO: 45 linearized by Pcil, according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 μΜ), 24 hours after the electroporation.

15 days after selection, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA from the clones of interest. The strain obtained is called Toxo tgmicl-3 KO.

4. In this strain, the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19.

In this strain, the honey gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6. Thus, the theoretical sequence at the locus of the deleted honey gene containing the CATGFP selection cassette is SEQ ID NO: 104.

5. Deletion of the selection cassette SEQ ID NO: 6: the Toxo tgmicl-3 KO strain obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15. The transiently expressed enzyme will allow excision of the selection cassette CAT-GFP SEQ ID NO: 6. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA with DNAzol from the clones of interest . The strain obtained is called Toxo tgmicl-3 KO - 2G.

In this strain, the mic3 gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19.

In this strain, the honey gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted honey gene containing a single lox site N SEQ ID NO: 5, is SEQ ID NO: 92.

Validation of the Toxo tgmicl-3 KO - 2G strain by PCR

To validate the Toxo tgmicl-3 KO - 2G strain, PCR analyzes are carried out using genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 ⁷ parasites. The primers used for the PCRs are described in Figure 2-D and are detailed in Table 3 below. The PCR products are analyzed by electrophoresis on agarose gel (Figure 2-B). Their expected size and their observed size are also described in the

Table 4 below. For clarity on the figure 2-B, only the 3 stages of the realization are represented (tgmic3, tgmic3K0 CATGFP and tgmic3K0 loxP (2G) or tgmicl, tgmiclKO

CATGFP and tgmiclKO loxN (2G)), the results obtained are in accordance with the expected sizes.

Table 3: list of primers used for validating the strains.

bait Sequence Tgmic3 (mixl) 5 TgMIC3 For SEQ ID NO 61: CCTCCGATGTGACTTTTGGT 6 TgMIC3 Rev SEQ ID NO 62: GATCCTCGGAGCAAGTCAAC 5'Tgmic3 KO validation (Mix2) 13 CN58 SEQ ID NO 63: ATACGAAGGGATTCGACGTG j ORF CATGFP R SEQ ID NO 25: CCGTTTGGTGGATGTCTTCT Validation KO 3 ’Tgmic3 (mix3) k ORF CATGFP F SEQ ID NO 26: GCATCGACTTCAAGGAGGAC 14 HR Mic3 RL SEQ ID NO 64 ATATGCGGATGAGTGCTCGAATT Scar Tgmic3 (mix4) 9 Tgmic3 loxN F SEQ ID NO 65: GTGTGGAGACTTTTTACTTCGTGTTAC 10 Tgmic3 loxN R SEQ ID NO 66: CCTCCGATGTGACTTTTGGT Tgmicl (Mix5) 3 TgMICl For SEQ ID NO 55: ATGCGCGCTATAAAGAATCG 4 TgMICIRev SEQ ID NO 56: AGAAACAACGCCTGGCCCAT 5'Tgmicl KO validation (Mix6) 11 tgmiclKO integF SEQ ID NO 57: GTGCGATGACGTGGCTTCTCTATCATGTGT j ORF CATGFP R SEQ ID NO 25: CCGTTTGGTGGATGTCTTCT Validation KO 3 ’Tgmicl (Mix 7) k ORF CATGFP F SEQ ID NO 26: GCATCGACTTCAAGGAGGAC 12 tgmiclKO integR SEQ ID NO 58: GATTCGCTTCGTCACTTCTGGTACGGATGC Tgmicl scar (mix8) 7 Tgmic 1 loxN F SEQ ID NO 59: CCCGTCTAGCAAGACCTCAA 8 Tgmic 1 loxN R SEQ ID NO 60: TCGGTGCTGCTCAGTAATTG

Table 4: Expected size of the amplicons (in base pairs) of the different PCRs for validation of the construction of the KO strains of Toxoplasma gondii

HR Toxo tgmic3 KO Toxo tgmic3 KO -2G Toxo tgmicl-3 KO Toxo tgmicl-3 KO - 2G Tgmic3 (mixl) 808 - - - - KO validation 5'Tgmic3 (mix2) 3253 Validation KO 3 ’Tgmic3 (Mix3) 3309 Scar Tgmic3 (mix4) 1596 2525 226 226 226 Tgmic l (mix5) 608 608 608 - - 5'Tgmicl KO validation (Mix6) 3040 3'Tgmicl KO validation (Mix 7) 3593 Tgmicl scar (mix8) 4198 4198 4198 3129 830

The electrophoresis of the PCR products carried out with the primers 5 SEQ ID NO: 61 and 6 SEQ ID NO: 62 (mix 1) make it possible to demonstrate a band at 808 base pairs for the RH strain, in accordance with the expected band size and confirming the presence of the Tgmic 3 gene in this strain. This band is not detected in the Toxo tgmic3 KO, Toxo tgmic3 KO - 2G, Toxo tgmicl-3 KO and Toxo tgmicl-3 KO - 2G strains confirming the suppression of the gene in these strains.

The electrophoresis of the PCR products carried out with the primers 13 SEQ ID NO: 63 and j SEQ ID NO: 25, and the primers k SEQ ID NO: 26 and 14 SEQ ID NO: 64 (mix 2 and 3) make it possible to highlight respectively a band at 3253 and 3537 base pairs for the strain Toxo tgmic3 KO, in accordance with the expected band size and confirming the presence of the selection gene cat-gfp SEQ ID NO: 2 in this strain in place of the gene Tgmic3 SEQ ID NO: 107. This band is not detected in the RH, Toxo tgmic3 KO - 2G, Toxo tgmicl-3 KO and Toxo tgmicl-3 KO - 2G strains confirming the absence of the selection gene cat-gfp SEQ ID NO: 2 at the Tgmic locus 3 in these strains.

The electrophoresis of the PCR products carried out with the primers 9 SEQ ID NO: 65 and 10 SEQ ID NO: 66 (mix 4) make it possible to highlight different bands in accordance with the expected band size. A band at 1596 base pairs for the RH strain confirms the presence of the Tgmic3 gene SEQ ID NO: 107 in this strain. A band of 2525 base pairs is demonstrated for the Toxo tgmic3 KO strain confirming the presence of the selection cassette CATGFP SEQ ID NO: 6 in place of the Tgmic3 gene. Finally, a band of 226 base pairs is highlighted for the strains Toxo tgmic3 KO - 2G, Toxo tgmicl-3 KO and Toxo tgmicl-3 KO - 2G confirming the deletion of the selection gene catgfp SEQ ID NO: 2 in these strains , leaving a loxP scar SEQ ID NO: 12 in the genome.

The electrophoreses of the PCR products carried out with the primers 3 SEQ ID NO: 55 and 4 SEQ ID NO: 56 (mix 5) make it possible to demonstrate a band at 608 base pairs for the RH, Toxo tgmic3 KO and Toxo tgmic3 KO strains - 2G, in accordance with the expected band sizes and confirming the presence of the Tgmicl SEQ ID NO: 108 gene in these strains. These bands are not detected in the Toxo tgmicl-3 KO and Toxo tgmicl-3 KO - 2G strains confirming the suppression of the gene in these strains.

The electrophoresis of the PCR products carried out with the primers 11 SEQ ID NO: 57 and j SEQ ID NO: 25, and the primers k SEQ ID NO: 26 and 12 SEQ ID NO: 58 (mix 6 and 7) make it possible to highlight respectively a band at 3040 and 3593 base pairs for the strain Toxo tgmicl-3 KO, in accordance with the expected band size and confirming the presence of the selection gene cat-gfp SEQ ID NO: 2 in this strain in place of the gene tgmic3 SEQ ID NO: 107. This band is not detected in wild RH strains of T. gondii (ATCC reference: PRA-310), Toxo tgmic3 KO, Toxo tgmic3 KO - 2G, and Toxo tgmicl-3 KO - 2G confirming the absence of the gene. cat-gfp selection SEQ ID NO: 2 at the Tgmicl locus in these strains.

The electrophoresis of the PCR products carried out with the primers 7 SEQ ID NO: 59 and 8 SEQ ID NO: 60 (mix 8) make it possible to highlight different bands in accordance with the expected band size. A band at 4198 base pairs for the RH, Toxo tgmic3 KO and Toxo tgmic3 KO - 2G strains confirms the presence of the Tgmicl SEQ ID NO: 108 gene in these strains. A band of 3129 base pairs is demonstrated for the Toxo tgmicl-3 KO strain confirming the presence of the selection cassette CATGFP SEQ ID NO: 6 in place of the Tgmicl gene. Finally, a band of 830 base pairs is demonstrated for the Toxo tgmicl-3 KO - 2G strain confirming the suppression of the selection gene cat-gfp SEQ ID NO: 2 in this strain, leaving a loxN scar SEQ ID NO: 5 in the genome.

The “scar” PCR products (mix 4 and 8) were sequenced and the sequencing confirmed that:

• the Tgmic3 SEQ ID NO: 107 gene has been deleted and the CATGFP SEQ ID NO: 6 selection cassette has been deleted by action of Cre-Recombinase leaving a LoxP scar SEQ ID NO: 12 in accordance with the expected sequence ( Figure 2-C).

• the Tgmicl SEQ ID NO: 108 gene has been deleted and the CATGFP SEQ ID NO: 6 selection cassette has been deleted by CRE-Recombinase action leaving a LoxN SEQ ID NO: 5 scar conforming to the expected sequence ( Figure 2-C).

Validation of the Toxo tgmicl-3 KO - 2G strain by immunofluorescence

The tachyzoites are cultured for 24 hours on glass coverslips coated with a monolayer of HFF cells. The infected cells were washed twice in PB SIX, and fixed with 4% formaldehyde for 30 min. After 3 washes in PBS1X, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1X for 5 min. After washing with PBS IX, a saturation step is carried out with a solution of PBS 1X / 10% SVF for 30 min. The cells were then incubated with the primary antibody diluted in 2% FCS for 1 hour, washed 3 times with PBS1X then incubated with secondary antibody diluted in a solution of PBS / SVF 2% for 1 hour. After 2 washes with PBSIX, the glass slides are mounted on a slide with Immu-Mount ™ and observed under a fluorescence microscope.

The primary antibody Tgmic3 used is an antibody which makes it possible to detect the expression of the protein TgMIC3 SEQ ID NO: 121 in the parasite (rabbit anti-mic3 antibody: rnAb antiMIC3 s3) and the commercial secondary antibody used is Alexa fluor® 594 anti-rabbit goat (Life technologies ref. Al 1012).

The primary antibody Tgmicl used is an antibody which makes it possible to detect the expression of the protein TgMfCl SEQ ID NO: 122 in the parasite (mouse anti-honey antibody: anti-MfCl mAb T104F8E12) and the commercial secondary antibody used is the Alexa fluor® 594 goat anti-mouse, Life technologies ref. A-l 1005).

The results show that no fluorescence is detectable at the apical pole of the parasite revealing the absence of the proteins MfCl and MÎC3 in tachyzoites Toxo tgmicl-3 KO - 2G whereas fluorescence at the apical pole of the parasite of the wild strain demonstrates Expression of the proteins MfCl and MÎC3 (Figures 3 A and 3B).

The results show that the parasites express a green fluorescent reflecting the expression of the protein CATGFP SEQ ID NO: 120 following the completion of gene deletions (Toxo tgmic3 KO and Toxo tgmicl-3 KO) while after action of Cre recombinase, the strains Toxo tgmic3 KO - 2G and Toxo tgmicl-3 KO - 2G are no longer fluorescent (deletion of the CATGFP cassette) (Figures 3A and 3B).

Example 2: Construction of the Toxo Tgmicl-3 KO - 2G / ROP 16 KO strain (denoted Toxo Rop 16)

The haploidy of the Toxoplasma gondii genome during the proliferative phase allows the invalidation of a gene in a single homologous recombination.

Culture of parasites

All the tachyzoites of the Toxoplasma gondii strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634)) cultured in minimal medium from Dulbecco (DMEM) supplemented with 10% fetal calf serum (SVF), 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.

Construction of the plasmid

Plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 (Figure 4) was constructed to suppress the gene encoding the TgROP16 protein of Toxoplasma gondii by homologous recombination.

The plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 is derived from the plasmid pNcMIC3KO-CAT-GFP lox N SEQ ID NO: 1. The tdTomato SEQ ID NO: 128 gene was amplified by PCR with the primers AGD F-AvrIIdTomato SEQ ID NO: 129 and AGD RdTomatoBglII SEQ ID NO: 130 (1459 bp) from the synthesized fragment SEQ ID NO: 12131 cloned into the plasmid commercial pRSET-B SEQ ID NO: 132. After digestion with the enzymes Avril and BglII (1439pb), the gene was then cloned into the plasmid pGEMT SEQ ID NO: 133 (commercial reference pGEM®-T Vector - Promega) and then amplified . The plasmid was then digested with Avril and BglII and cloned at the Avril and BglII sites of the plasmid pNcMIC3-KO-CAT-GFP lox N SEQ ID NO: 1. The new selection cassette cattdTomato SEQ ID NO: 125 coding for the chimeric protein CAT / tdTOMATO SEQ ID NO: 141 allowing both resistance to chloramphenicol and red fluorescence, is placed under the control of the promoter of Ι'α-tubulin of Toxoplasma gondii SEQ ID NO: 3. Downstream from the CAT tdTOMATO SEQ ID NO: 125 cassette, the 3’UTR sequence of the Toxoplasma gondii sagl gene is inserted SEQ ID NO: 4. The objective of this sequence is to stabilize the mRNA encoding the CAT fusion protein tdTOMATO.

The upstream non-coding region flanking the tgroplô gene SEQ ID NO: 134 (1899 bp) is amplified by PCR from the genomic DNA of T gondii with the primers AGD-F5'ROP16KpnI SEQ ID NO: 135 and AGD-R- 5'ROP16BclI SEQ ID NO: 136 then is integrated after digestion with the enzymes Kpnl and Bell (1885pb) in the plasmid upstream of the selection cassette CAT-tdTomato SEQ ID NO: 125 at the restriction sites Kpnl and Bell.

The downstream non-coding region flanking the tgroplô gene SEQ ID NO: 137 (1790 bpd) is amplified by PCR from the genomic DNA of T. gondii ûnqc, the primers AGD-F3'HpaIROP16 SEQ ID NO: 138 and AGD- R-3'ROP16NotI SEQ ID NO: 134 then is integrated after digestion with the enzymes Hpal and NotI (1782pb) in the plasmid downstream of the selection cassette CAT-tdTomato SEQ ID NO: 125 at the restriction sites Hpal and NOTL. The primers used for the construction of this plasmid are listed in Table 5 below.

The plasmid obtained is called pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73.

Table 5: Primers used for the construction of the plasmid pTgroplô KO CATtdTomato

Construction duplasmidepTgroplôKO CAT-tdTomato

AGD-F 5'ROP16KpnI SEQ ID NO: 135 GGGGTACCCCAGAAACCAGGTGTTGTT AGD-R5'ROP16BclI SEQ ID NO: 136 GCTGATCAATAACTTCGTATAAAGTATCCTATACGA AGTTATCCAGTGGTGCATTGACAAA AGD-F 3'HpaIROP16 SEQ ID NO: 138 CCGGTTAACACAATTCTTGCCCCCCCGAGGGATAACT TCGTATAGTATACCTTATACGAAGTTATGAACTCCC GAAATTCGTCAA AGD-R3'ROP16NotI SEQ ID NO: 139 ATAAGAATGCGGCCGCAGATTTTGCTTGGCGTCACT AGD F- AvrlIdTomato SEQIDNO: 129 TTATATTCGCCCTAGGATGGTGA AGD RdTomatoBglII SEQIDNO: 130 AGAGCTCGAGATCTGATTACTTGTACAGC

Construction of the Toxo tgmicl-3 KO - 2G roplô KO strain

The construction of the attenuated living strain, called Toxo tgmicl-3 KO - 2G / ROP 16 KO is obtained by deletion by homologous recombination of the tgroplô SEQ ID NO: 140 gene and its replacement by the selection cassette CAT-tdTomato SEQ ID NO : 125.

To obtain this strain, the Toxo tgmicl-3 KO-2G strain, as obtained in Example 1, is electroporated with the plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73. 50 μg of plasmid purified then linearized by SacII are added to 10 ⁷ parasites suspended in the CYTOMIX electroporation medium containing ATP (3 mM) and Glutathione (3 mM) prepared according to the Van den Hoff protocol and al., (van den Hoff MJ, Moorman AF, Lamers WH. Electroporation in 'intracellular' buffer increases cell survival, Nucleic Acid Research, 1992 Jun 11; 20 (11): 2902), and Telectroporation was carried out in a cuvette gap 4 mm, in a volume of 800 pL on a BioRad device (Parameters: 2000V, 50 ohms, 25 pF, with two electric shocks). After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 μΜ), 24 hours after the electroporation. 10 to 15 days after selection, the parasites are subcloned into a 96-well plate and the clones of interest are identified by PCR. The strain obtained is called Toxo tgmicl-3 KO - 2G / ROP 16 KO.

Validation of the Toxo tgmicl-3 KO - 2G roplô KO strain by PCR

The genomic DNA of the Toxo tgmicl-3 KO - 2G and Toxo tgmicl-3 KO - 2G strains roplô KO was purified by extraction with DNAzol then different PCRs were carried out to verify the specific deletion of the roplô gene SEQ ID NO: 140 ( Figure 5-B). Agarose gel electrophoresis analyzes confirm the absence of the roplô gene and its replacement by the selection cassette cat-tdTomato SEQ ID NO: 125.

To validate the Toxo tgmicl-3 KO - 2G roplô KO strain, PCR analyzes are carried out using genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 ⁷ parasites. The primers used for the PCRs are described in Figure 5-C and are detailed in Table 6 below. The PCR products are analyzed by electrophoresis on agarose gel (Figure 5-B). Their expected size and their observed size are also described in Table 7 below.

Table 6: list of primers used for the validation of the Toxo tgmicl-3 KO 2G roplô KO strain

bait Sequence Tgroplô (mixl) Rgl AGD rop 16CDS F SEQ Π) NO: 83 GTTTGAGGAAGCGCAAAAAG Rg2 AGD rop 16CDS R SEQ ID NO: 84 TGCTGTGATTTCGCAAGTTC Upstream KO validation (mix2) Rg3 Rop 16KOvalid5Fl SEQ ID NO: 85 ACCCCCTGACCCCITGTCTG Rg4 Upstream ropl6R SEQ ID NO: 86 TCGTCGTGGTATTCACTCCA Downstream KO validation (mix3) RI Downstream 16F SEQ ID NO: 142 ACATGGCCGTCATCAAAGA rg6 Downstream ropl6R SEQ ID NO: 88 AAAACGAATGCGAAGGAAGA

Table 7: Expected size of amplicons (in base pairs) of the different PCRs for validation of the construction of the Toxo tgmicl-3 KO - 2G roplô KO strain

Toxo tgmicl-3 KO - 2G Toxo tgmicl-3 KO - 2G roplô KO Tgroplô (mixl) 1682 - 5'Tgropl6 KO validation (Mix2) 2759 Validation KO 3 ’Tgroplô (mix 3) 3317

The electrophoreses of the PCR products carried out with the primers rgl SEQ ID NO: 83 and rg2 SEQ ID NO: 84 (mix 1) make it possible to demonstrate a band at 1682 base pairs for the strain Toxo tgmicl-3 KO - 2G, in accordance at the expected band size and confirming the presence of the Tgroplô gene in this strain. This band is not detected in the Toxo tgmicl-3 KO - 2G roplô KO strain confirming the suppression of the gene in this strain.

The electrophoresis of the PCR products carried out with the primers rg3 SEQ ID NO: 85 and rg4 SEQ ID NO: 86 (mix 2) make it possible to demonstrate a band at 2759 base pairs for the strain Toxo tgmicl-3 KO - 2G roplô KO , in accordance with the size of the expected bands and confirming the suppression of the Tgroplô gene in this strain and the insertion of the selection gene CATtdTomato in place of the Tgroplô gene. This band is not detected in the Toxo tgmicl-3 KO - 2G strain.

The electrophoresis of the PCR products carried out with the primers RI SEQ ID NO: 142 and rg6 SEQ ID NO: 88 (mix 3) make it possible to demonstrate a band at 3317 base pairs for the strain Toxo tgmicl-3 KO - 2G roplô KO , in accordance with the size of the expected bands and confirming the suppression of the Tgroplô gene in this strain and the insertion of the CATtdTomato gene in place of the Tgroplô gene. This band is not detected in the Toxo tgmicl-3 KO - 2G strain.

Example 3: Construction of the Toxo Tgmicl-3 KO Gral5II Kl strain (noted Toxo Gral5 Kl)

Culture of parasites

All the tachyzoites of the Toxoplasma gondii strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634)) cultured in minimal medium from Dulbecco (DMEM) supplemented with 10% fetal calf serum (SVF), 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.

Construction duplasmid pT230-2G GRA15n (Figure 6)

The construction of the plasmid pT230-2G GRA15n SEQ ID NO: 76 was developed from the plasmid pT230 2G SEQ ID NO: 143 derived from the plasmid pT230-TUB5 / BLE SEQ ID NO: 37. The promoter of the gral5n SEQ ID NO: 71 gene, as well as the coding sequence of gral5n SEQ ID NO: 144 were amplified from the gDNA of the ME49 strain by nested PCR (PCR 1 then 2) including an HA tag in 3 'SEQ ID NO: 72 to facilitate localization.

A first PCR SEQ ID NO: 145 (PCR 1: 4202 base pairs) with the primers For0GRA15 SEQ ID NO: 146 and rev4GRA15 SEQ ID NO: 147 on the gDNA of the strain ME49 allows amplification of the gral5II locus. A second PCR SEQ ID NO: 143 (PCR2: 3882 base pairs) with the primers F GRAI5 BamHl Spel SEQ ID NO: 149 and R GRAI5 HAtag SEQ ID NO: 150 on PCR 1 SEQ ID NO: 145 allows amplification of the promoter SEQ ID NO: 71 and of the coding phase of gral5II SEQ ID NO: 144 coupled to a tagHA SEQ ID NO: 72. This second PCR SEQ ID NO: 148 was inserted by enzymatic digestion (BamHI and blunt end) in the plasmid pT230 2G SEQ ID NO: 143 digested with BamHI and Pmel (4470 bp). The plasmid pT230 2G GRA15n SEQ ID NO: 76 thus obtained also contains a ble cassette SEQ ID NO: 151 making it possible to code a BLE protein SEQ ID NO: 152 allowing resistance to phleomycin. The primers used for the construction of this plasmid are listed in Table 8 below.

Table 8: Construction of the plasmid pT230 2G Gral5II

For0GRA15 SEQ ID NO: 146 GAACTGCGTCGTCGTGAGTA PCR 1 rev4GRA15 SEQ ID NO: 147 TGCCAATTGAGTCGTCTCTTC F GRA15 SEQIDNO: 149 BamHl Spel GGATCCACTAGTTGACTGCCACGTGTAGTATCC SEQIDNO: 150 TTACGCTAGTCCGGGACGTCGTACGGGTATGGAG PCR 2 RGRA15 HAtag TTACCGCTGATTGTGT

Construction of the Toxo Tgmicl-3 KO - 2G GRA15n Kl pg plasmid pT230-2G GRA15n SEQ ID NO: 76 strain purified then linearized by Apal were added to 10 ⁷ parasites of the Toxo tgmic7-3 KO 2G strain (obtained at 1 'example 1) suspended in the CYTOMIX electroporation medium containing ATP (3 mM) and Glutathione (3 mM) prepared according to the protocol of Van den Hoff et al., previously referenced, and the electroporation was performed in a 4 mm gap cuvette, in a volume of 800 pL on a BioRad device (Parameters: 2000V, 50 ohms, 25 pF, with two electric shocks). After electroporation, the tachyzoites were deposited on a monolayer of HFF cells in culture. For the selection of mutants, the culture medium is replaced and supplemented with the selection agent (phleomycin 20 pM), 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned into a 96-well plate and the clones of interest are identified by PCR. The strain obtained is called Toxo tgmicl-3 KO - 2G GRA15IIKI.

Validation of the Toxo tgmicl-3 KO - 2G GRA15KI strain by PCR

To validate the Toxo tgmicl-3 KO - 2G GRA15KI strain, PCR analyzes are carried out using genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 ⁷ parasites. The primers used for the PCRs are described in Figure 7-B and are detailed in Table 9 below. The PCR products are analyzed by electrophoresis on agarose gel (Figure 7-A). Their expected size and their observed size are also described in Table 10 below. The expected size of the PCR with the primers AGD F GRA15I / II SEQ ID NO: 109 and AGD R GRA15I / II SEQ ID NO: 110 (Table 9) makes it possible to distinguish the presence of the sequence coding for GRA15n SEQ ID NO: 144 (308 bp) and that of endogenous GRA15i SEQ ID NO: 153 (560 bp).

Table 9: Primers used for the PCRs for validation of Toxo tgmicl-3 KO 2GGRA15KI strains

PCR validation of strains Toxo tgmicl-3 KO - 2G GRA15KI AGD F GRA15I / II SEQ ID NO: 109 GTGCAAAGCCAACTTCCACT PCR3 AGD R GRA15I / II SEQ ID NO: 110 GGACCTGGATCAGAGATCGT

Table 10: Expected size of the amplicons (in base pairs) of the different PCRs for validating the construction of the KO strains of Toxoplasma gondii

Toxo tgmicl-3 KO - 2G Toxo tgmicl-3 KO - 2G GRA15KI PCR3 560 560/308

The electrophoresis of the PCR products carried out with the primers AGD F GRA15I / II SEQ ID NO: 109 and AGD R GRA15I / II SEQ ID NO: 110 (Table 9) make it possible to highlight a band at 560 and 308 base pairs respectively. the Toxo tgmicl3 KO - 2G GRA15KI strain while a single band at 560 base pairs for the Toxo tgmicl-3 KO - 2G strain, which confirms the insertion of plasmid pT230-2G GRA15n SEQ ID NO: 76 into the strain Toxo tgmicl-3 KO - 2G GRA15KI.

Validation of the Toxo tgmicl-3 KO - 2G GRA15KI strain by immunofluorescence

The tachyzoites are cultured for 24 hours on glass coverslips coated with a monolayer of HFF cells. The infected cells were washed twice in PB SIX, and fixed with 4% formaldehyde for 30 min. After 3 washes in PBS1X, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1X for 5 min. After 3 washes with PBS IX, a saturation step is carried out with a solution of PBS 1X / SVF 10% for 30 min. The cells were then incubated with the primary antibody diluted in 2% FCS for 1 hour, washed 3 times with PBS1X then incubated with secondary antibody diluted in a solution of PBS / SVF 2% for 1 hour. After 2 washes with PBSIX, the glass slides are mounted on a slide with Immu-Mount ™ and observed under a fluorescence microscope.

The primary antibody used is the anti-HA mouse antibody which detects the expression of the GRA15n-HA protein SEQ ID NO: 123 in the parasite. The secondary antibody is the commercial secondary antibody: Alexa fluor® 594 goat anti rabbit (Life Technologies A-11012). The antibodies are diluted 1/1000 in PBS SVF 2%.

For the wild strain Toxo tgmicl-3 KO 2G, no green fluorescence is observed at the apical pole of the parasite thus revealing the absence of the protein GRA15n-HA. On the contrary, for the Toxo tgmicl-3 KO - 2G GRA15KI strain, a green fluorescence is observed demonstrating the expression of the GRA15n-HA protein (FIG. 8).

Example 4: Construction of the Toxo tgmicl-3 KO roplôKO Gral5II Kl strain (denoted Toxo KO +)

Culture of parasites

All the tachyzoites of the Toxoplasma gondii strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634)) cultured in minimal medium from Dulbecco (DMEM) supplemented with 10% fetal calf serum (SVF), 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.

Construction of plasmid pT230-2G GRA15n SEQ ID NO: 76 (Figure 6)

See Example 3, page 45

Construction of the Toxo tgmicl-3 KO - 2G roplô KO GRA15n Kl (: ToxoKO +) pg plasmid pT230-2G GRA15n SEQ ID NO: 76 strain purified then linearized by Apal were added to 10 ⁷ parasites of the Toxo tgmic7- strain 3 KO 2G rop 16 KO (obtained in Example 2) suspended in the CYTOMIX electroporation medium containing ATP (3 mM) and Glutathione (3 mM) prepared according to the protocol of Van den Hoff et al. , previously referenced, and the electroporation was carried out in a 4 mm gap cuvette, in a volume of 800 pL on a BioRad device (Parameters: 2000V, 50 ohms, 25 pF, with two electric shocks). After electroporation, the tachyzoites were deposited on a monolayer of HFF cells in culture. For the selection of mutants, the culture medium is replaced and supplemented with the selection agent (phleomycin 20 pM), 24 hours after electroporation. 10 to 15 days after selection, the parasites are subcloned into a 96-well plate and the clones of interest are identified by PCR. The strain obtained is called Toxo tgmicl-3 KO roplôKO - 2G GRA15IIKI.

Validation of the Toxo tgmicl-3 KO - 2G rop 16 KO GRA15π Kl strain by PCR

To validate the Toxo tgmicl-3 KO - 2G rop 16 KO GRA15n Kl strain, PCR analyzes are carried out using genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 ⁷ parasites. The primers used for the PCRs are described in Figure 12B and are detailed in Table 9 below. The PCR products are analyzed by agarose gel electrophoresis (Figure 9). Their expected size and their observed size are also described in Table 10 below. The expected size of the PCR with the primers AGD F GRA15I / II SEQ ID NO: 109 and AGD R GRA15I / II SEQ ID NO: 110 (Table 9) makes it possible to distinguish the presence of the sequence coding for GRA15n SEQ ID NO: 144 (308 bp) and that of endogenous GRA15i SEQ ID NO: 153 (560 bp).

The electrophoresis of the PCR products carried out with the primers AGD F GRA15I / II SEQ ID NO: 109 and AGD R GRA15I / II SEQ ID NO: 110 (Table 9) make it possible to highlight a band at 560 and 308 base pairs respectively. the Toxo tgmicl 3 KO - 2G rop 16 KO GRA15n Kl strain while a single band at 560 base pairs for the Toxo tgmicl-3 KO - 2G strain, which confirms the insertion of plasmid pT230-2G GRA15n SEQ ID NO : 76 in the Toxo tgmicl-3 KO - 2G roplô KO GRA15n Kl strain.

Validation of the Toxo tgmicl-3 KO - 2G rop 16 KO GRA15II Kl strain by immunofluorescence

The tachyzoites are cultured for 24 hours on glass coverslips coated with a monolayer of HFF cells. The infected cells were washed twice in PB SIX, and fixed with 4% formaldehyde for 30 min. After 3 washes in PBS1X, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1X for 5 min. After 3 washes with PBS IX, a saturation step is carried out with a solution of PBS 1X / SVF 10% for 30 min. The cells were then incubated with the primary antibody diluted in 2% FCS for 1 hour, washed 3 times with PBS1X then incubated with secondary antibody diluted in a solution of PBS / SVF 2% for 1 hour. After 2 washes with PBSIX, the glass slides are mounted on a slide with Immu-Mount ™ and observed under a fluorescence microscope.

The primary antibody used is the anti-HA mouse antibody which detects the expression of the GRA15n-HA protein SEQ ID NO: 123 in the parasite. The secondary antibody is the commercial secondary antibody: Alexa fluor® 594 goat anti rabbit (Life Technologies A-l 1012). The antibodies are diluted 1/1000 in PBS SVF 2%.

For the wild strain Toxo tgmicl-3 KO 2G, no green fluorescence is observed at the apical pole of the parasite thus revealing the absence of the protein GRA15n-HA. On the contrary, for the Toxo tgmicl-3 KO - 2G roplô KO GRA15II Kl strain, a green fluorescence is observed demonstrating the expression of the GRA15n-HA protein (FIG. 10).

Example 5: Construction of the Toxo Tgmicl-3 KO roplô KO Gral5II Kl strain (noted ToxoKO + 2G).

The haploidy of the Toxoplasma gondii genome during the proliferative phase allows the invalidation of a gene in a single homologous recombination.

Culture of parasites

All the tachyzoites of the Toxoplasma gondii strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634)) cultured in minimal medium from Dulbecco (DMEM) supplemented with 10% fetal calf serum (SVF), 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.

Construction of the plasmid

The plasmid pTgRopl6KO-Gral5 _n KI-CAT-GFP lox2272 SEQ ID NO: 67 (Figure 11) contains the selection cassette CAT-GFP SEQ ID NO: 6 comprising the selection gene cat-gfp SEQ ID NO: 2, coding for the fusion protein CAT-GFP conferring resistance to chloramphenicol (CAT) and green fluorescence (GFP), under the control of the promoter of Ι'α-tubulin of Toxoplasma gondii SEQ ID NO: 3 to allow the expression of the gene in the parasite. Downstream of the selection gene SEQ ID NO: 2, the 3'UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The aim of this sequence is to stabilize the mRNA encoding the CAT-GFP fusion protein.

The SEQ ID NO: 6 selection cassette is surrounded by two Lox2272 SEQ ID NO: 68 sites, recognition sites specifically recognized by Cre Recombinase and which will be used subsequently to delete the CAT-GFP selection cassette.

Downstream of the second Lox2272 site, an expression cassette for the gral5n gene SEQ ID NO: 69 was cloned. This expression cassette consists of the gral5n promoter amplified from the genomic DNA of the strain ME49 and the gral5n gene SEQ ID NO: 70 amplified from the genomic DNA of the strain ME49, including an HA tag in 3 'SEQ ID NO: 72 to facilitate the localization and the 3'UTR sequence of the sagl gene of T. gondii SEQ ID NO: 4 amplified from the genomic DNA of the RH strain. This plasmid therefore allows the simultaneous production of a roplôKO mutant lox2272 CATGFP lox2272 and the insertion of gral5IIHA at the roplô locus.

The plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 contains a cassette CATtdTomato SEQ ID NO: 125 framed by a 5'HR sequence of the Tgroplô SEQ ID NO: 99 gene and a 3'HR sequence of the Tgroplô SEQ ID NO gene : 100.

Cloning was carried out from the plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 digested with the enzymes SphI and Agel (6073bp). This cloning required 4 independent PCRs.

The first PCR enabled the amplification, from the plasmid pCATGFP lox P SEQ ID NO: 38, of a selection cassette CAT-GFP SEQ ID NO: 6 comprising the promoter aTubulin, the selection gene cat-gfp and the region 3 'UTR of T. gondii sagl, with addition of the site lox2272 SEQ ID NO: 68 with the tubers F Agel SEQ ID NO: 74 and 3 UTR lox2272 R SEQ ID NO: 75 (2090bp).

The second PCR allowed the amplification from the plasmid pT230 2G gral5II SEQ ID NO: 76, of the promoter gral5II SEQ ID NO: 71 with addition in 5 ′ of the site lox2272 SEQ ID NO: 68 with the primers pGral5 F lox2272 SEQ ID NO: 77 and P Gral5 R SEQ ID NO: 78 (I975pb).

The third PCR allowed amplification from the plasmid pT230 2G gral5II SEQ ID NO: 76, of the gral5II HA gene with the 3'UTR of sagl SEQ ID NO: 79 (2092 bp) with the primers Gral5F SEQ ID NO 126 and UTR sagl roplô R SEQ ID NO 127.

The last PCR allowed the amplification of part of 3'Ropl6 SEQ ID NO: 80 with the primers Ropl6F SEQ ID NO: 81 and Ropl6R SphI SEQ ID NO: 82 (570pb) on the plasmid pTgroplôKO CAT-tdTomato SEQ ID NO: 73 as a matrix.

The primers used for the construction of this plasmid are listed in Table 11 below.

Table 11: Primers used for the construction of the plasmid pT230 2G Gral5II

tub F Agel SEQ ID NO: 74: GTGATCCTGGTTGGACCGGT 3 UTR lox2272 R SEQ ID NO: 75: ATAACTTCGTATAAAGTATCCTATACGAAGTTATCGGTTCGACTAGAACAACTG pGral5 F lox2272 SEQ ID NO: 77: CTTTATACGAAGTTATGGATCCACTAGTTGACTGCC PGral5R SEQ ID NO: 78: GTCACCATTGTTGAATGC Gral5F SEQ ID NO 126: GCATTCAACAATGGTGAC UTR sagl ropl6 R SEQ ID NO 127: CGAATTTCGGGAGTTCTCGGGGGGGCAAGAATTGTG Ropl6F SEQ ID NO: 81: GAACTCCCGAAATTCGTCAA Ropl6R SphI SEQ ID NO: 82: AATACACGCGACCGCATGC

The 4 amplified PCR fragments were directly cloned into the vector pTgroplô KO CAT-tdTomato SEQ ID NO: 73 digested with Agel and SphI using the In-Fusion® kit from Ozyme (In-Fusion® HD Cloning Kit - Clonetech). In-Fusion® cloning technology allows one-step cloning without purification or digestion of one or more PCR products in a linearized vector. Ends complementary to the ends of the adjacent fragments are added by PCR. The reaction is done according to the manufacturer's recommendations. The plasmid obtained is called pTgRopl6KO-Gral5nKI-CAT-GFP lox2272 SEQ ID NO: 67. The plasmid called pTgRopl6KO-Gral5 _n KI-CAT-GFP lox2272 SEQ ID NO: 67 therefore contains a cassette CAT-GFP SEQ ID NO: 6 and a gralSHAII SEQ ID NO: 69 expression cassette, framed by a 5'HR sequence of the Tgroplô SEQ ID NO: 99 gene and a 3'HR sequence of the Tgroplô SEQ ID NO: 100 gene.

Construction of the Toxo tgmicl-3 KO rop! 6 KO Gral5II Kl -2G strain

The construction of the second generation attenuated living strain, called Toxo tgmicl-3 KO ropl6 KO Gral5II Kl -2G, is done in 2 distinct stages (figure 12-A):

1. Deletion by homologous recombination of the roplô gene and its replacement by the selection cassette CAT-GFP SEQ ID NO: 6 framed by sequences Lox2272 SEQ ID NO: 38 and the cassette gral5IISEQ ID NO: 69.

To obtain this strain, the Toxo tgmic3 KO-2G strain is electroporated with the plasmid pTgRopl6KO-Gral5 _n KI-CAT-GFP lox 2272 SEQ ID NO: 67 (20 pg) linearized by Pcil, according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 pM), 24 hours after the electroporation. 10 to 15 days after selection, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA from the clones of interest. The strain obtained is called Toxo tgmicl-3 KO roplô KO Gral5II Kl.

In this strain, the roplô gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6 and the expression cassette for gra! 5HAII SEQ ID NO: 69. Thus, the theoretical sequence at the locus of the deleted roplô gene containing the CATGFP selection cassette and the gral5HAII expression cassette is SEQ ID NO: 112.

In this strain, the mie 3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19.

In this strain, the honey gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted honey gene containing a single lox site N SEQ ID NO: 5, is SEQ ID NO: 92.

2. Deletion of the selection cassette: the Toxo tgmicl-3 KO roplô KO Gral5II Kl strain obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15 (Figure 1-C). The transiently expressed enzyme will allow excision of the CAT-GFP selection cassette. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA with DNAzol from the clones of interest . The strain obtained is called Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G.

In this strain, the roplô gene was deleted and replaced by the gral5HAII SEQ ID NO: 69 expression cassette and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted roplô gene containing the cassette with a single site lox 2272 SEQ ID NO: 68 and the expression cassette for gral5HAII is SEQ ID NO: 93.

In this strain, the mic3 gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19.

In this strain, the honey gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted honey gene containing a single lox site N SEQ ID NO: 5, is SEQ ID NO: 92.

Validation of the Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G strain by PCR

To validate the Toxo tgmicl-3 KO roplô KO Gral5II Kl 2G strain, PCR analyzes are carried out using genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 ⁷ parasites. The primers used for the PCRs are described in Figure 1 ΙΟ and are detailed in Table 12 below. The PCR products are analyzed by electrophoresis on agarose gel (Figure 12-C). Their expected size and their observed size are also described in Table 13 below.

Table 12: list of primers used for the validation of the Toxo tgmicl-3 KO roplôKO Gral5IIKI 2G strain.

Primer F Sequence Tgroplô (mixl) Rgl AGD rop 16CDS F SEQ ID NO: 83 GTTTGAGGAAGCGCAAAAAG Rg2 AGD rop 16CDS R SEQ ID NO: 84 TGCTGTGATTTCGCAAGTTC Upstream KO validation (mix2) Rg3 Rop 16KO valid 5F1 SEQ ID NO: 85 ACCCCCTGACCCCTTGTCTG Rg4 Upstream ropl6R SEQ ID NO: 86 TCGTCGTGGTATTCACTCCA Downstream KO validation (mix3) Rg5 Gral5 qPCR 2F SEQ ID NO: 87 CACGTACACAACCCATCTCG rg6 Downstream ropl6R SEQ ID NO: 88 AAAACGAATGCGAAGGAAGA RoplôKO gral5 loxP scar (mix4) Rg7 cicroplô loxF SEQ ID NO: 89 CAGTACCAGCCACGTTAGCA Kg8 cicroplô loxGraR SEQ ID NO: 90 CAAGCAATCTGTGGCAAAAA Gral5I / II (mix5) Gral5I / IIF SEQ ID NO: 109 GTGCAAAGCCAACTTCCACT Gral5I / IIF SEQ ID NO: 110 GGACCTGGATCAGAGATCGT

Table 13: Expected size of amplicons (in base pairs) of the different PCRs for validation of the construction of the Toxo tgmicl-3 KO rop 16 KO Gral5II Kl 2G strain

Toxo tgmicl-3 KO - 2G Toxo tgmicl-3 KO roplô KO Gral5IIKI Toxo tgmicl-3 KO roplôKO Gral5IIKI 2G Tgroplô (mixl) 1682 - - 5'Tgropl6 KO validation (mix2) - 2759 - ValidationKO 3 ’Tgroplô (mix3) - 2870 2870 RoplôKO gral51oxP scar (Mix4) 2550 321 Gral5I / II (mix5) 560 560 and 308 560 and 308

The electrophoreses of the PCR products carried out with the primers rgl SEQ ID NO: 83 and rg2 SEQ ID NO: 84 (mix 1) make it possible to demonstrate a band at 1682 base pairs for the strain Toxo tgmicl-3 KO - 2G, in accordance at the expected band size and confirming the presence of the Tgroplô gene in this strain. This band is not detected in the Toxo tgmicl-3 KO rop 16 KO Gral5II Kl and Toxo tgmicl-3 KO rop 16 KO Gral5II Kl -2G strains confirming the suppression of the gene in these strains.

The electrophoresis of the PCR products carried out with the primers rg3 SEQ ID NO: 85 and rg4 SEQ ID NO: 86 (mix 2) make it possible to demonstrate a band at 2759 base pairs for the strain Toxo tgmicl-3 KO rop 16 KO Gral5II Kl , in accordance with the size of the expected bands and confirming the suppression of the Tgroplô gene in this strain and the insertion of the selection gene CATGFP and gral5II in place of the Tgroplô gene. This band is not detected in the Toxo tgmicl-3 KO - 2G and Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G strains.

The electrophoresis of the PCR products carried out with the primers rg5 SEQ ID NO: 87 and rg6 SEQ ID NO: 88 (mix 3) make it possible to demonstrate a band at 2870 base pairs for the strains Toxo tgmicl-3 KO rop 16 KO Gral5II Kl and Toxo tgmicl-3 KO rop 16 KO Gral5II Kl -2G, in accordance with the size of the expected bands and confirming the suppression of the Tgroplô gene in this strain and the insertion of the gral5II gene in place of the Tgroplô gene. This band is not detected in the Toxo tgmicl-3 KO - 2G strain.

The electrophoresis of the PCR products carried out with the primers rg7 SEQ ID NO: 89 and rg8 SEQ ID NO: 90 (mix 4) make it possible to demonstrate a band of 2550 base pairs for the strain Toxo tgmicl-3 KO roplô KO Gral5II Kl confirming the presence of the selection cassette CATGFP SEQ ID NO: 6 in place of the Tgroplô gene. Finally, a band of 321 base pairs is demonstrated for the Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G strain confirming the suppression of the selection gene cat-gfp SEQ ID NO: 2 in this strain, leaving a scar lox2272 SEQ ID NO: 68 in the genome. No band was detected in the Toxo tgmicl-3 KO - 2G strain.

The “scar” PCR product obtained for the Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G (321 base pairs) strain was sequenced and the sequencing confirmed that:

• the Tgroplô gene has been deleted and the CAT-GFP SEQ ID NO: 6 selection cassette has been deleted by action of Cre-Recombinase leaving a scar Lox2272 SEQ ID NO: 68 in accordance with the expected sequence (Figure 12- D).

The electrophoreses of the PCR products carried out with the primers SEQ ID NO: 109 and SEQ ID NO: 110 (mix 5) make it possible to demonstrate a band at 560 base pairs for the strains Toxo tgmicl-3 KO - 2G, in accordance with the expected band size confirming the presence of the TggralS gene in this strain. An additional band at 308 base pairs is detected in the strains Toxo tgmicl-3 KO roplô KO Gral5II Kl and Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G confirming the presence of the gralSHAII gene in these strains.

Validation of the Toxo tgmicl-3 KO roplô KO Gral5II Kl -2G strain by immunofluorescence

The tachyzoites are cultured for 24 hours on glass coverslips coated with a monolayer of HFF cells. The infected cells were washed twice in PB SIX, and fixed with 4% formaldehyde for 30 min. After 3 washes in PBS1X, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1X for 5 min. After 3 washes with PBS IX, a saturation step is carried out with a solution of PBS 1X / SVF 10% for 30 min. The cells were then incubated with the primary antibody diluted in 2% FCS for 1 hour, washed 3 times with PBS1X then incubated with secondary antibody diluted in a solution of PBS / SVF 2% for 1 hour. After 2 washes with PBSIX, the glass slides are mounted on a slide with Immu-Mount ™ and observed under a fluorescence microscope.

The primary antibody used is the anti-HA mouse antibody which detects the expression of the GRA15n-HA protein SEQ ID NO: 123 in the parasite. The secondary antibody is the commercial secondary antibody: Alexa fluor® 594 goat anti rabbit (Life

Technologies A-11012). The antibodies are diluted 1/1000 in PBS SVF 2%.

For the wild strain Toxo tgmicl-3 KO 2G, no red fluorescence is observed at the apical pole of the parasite thus revealing the absence of the protein GRA15n-HA. On the contrary, for the Toxo tgmicl-3 KO roplô KO gral5II Kl strain, a red fluorescence is observed demonstrating the GRA15n-HA protein. The Toxo tgmicl-3 KO roplô KO gral5II Kl strain expresses a green fluorescent reflecting the expression of the CATGFP protein SEQ ID NO: 120 whereas after action of Cre recombinase, the Toxo tgmicl-3 KO roplô KO gra! 5II strain Kl lox2272 is no longer fluorescent (Figure 13).

Example 6: Construction of the Neo ncmicl-3 KO - 2G strain (noted Neo KO 2G)

The haploidy of the genome of Neospora caninum during the proliferative phase allows the invalidation of a gene in a single homologous recombination.

Culture of parasites

All the tachyzoites of the Neospora caninum strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634)) cultured in minimal medium from Dulbecco (DMEM) supplemented with 10% fetal calf serum (SVF), 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.

Construction of the plasmids • Plasmid pNcMIC3-KO-CAT-GFP loxN

The plasmid pNcMic3KO-CAT-GFP loxN SEQ ID NO: 1 contains a selection cassette CAT-GFP SEQ ID NO: 6 comprising the selection gene cat-gfp SEQ ID NO: 2 coding for the fusion protein CAT-GFP allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP: Green Fluorescent Protein), under the control of the opl'α-tubulin promoter from Toxoplasma gondii SEQ ID NO: 3 to allow expression of the gene in the parasite . Downstream of the cat-gfp gene SEQ ID: 2, the 3’UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the CAT / GFP fusion protein. This SEQ ID NO: 6 selection cassette is surrounded by two identical loxN SEQ ID NO: 5 sites with the same orientation.

To obtain this plasmid, the selection cassette CAT-GFP SEQ ID NO: 6 was amplified by PCR on the plasmid pT230 CAT-GFP SEQ ID NO: 9 with the primers cat-gfp LoxN For SEQ ID NO: 7 and catgfp loxN rev SEQ ID NO: 8 (2380 bp), digested with the restriction enzymes Clal and Xbal (2348 bp) and cloned into the plasmid pNcMic3K0-DHFR SEQ ID NO: 10 digested with Clal and Xbal (7715 bp).

The plasmid then obtained is the plasmid pNcMic3KO-CAT-GFP loxN SEQ ID NO: 1.

The primer sequences are shown in Table 14 below. The plasmid pNcMic3K0CAT-GFP loxN therefore contains a CAT-GFP cassette SEQ ID NO: 6 framed by a 5’HR sequence of the Ncmic3 SEQ ID NO: 98 gene and a 3’HR sequence of the Ncmic3 SEQ ID NO: 97 gene.

Table 14: list of primers used for the construction of the plasmid pNcMIC3-K0CAT-GFP loxN catgfp loxN For catgfp loxN rev

SEQ ID NO: 7

TCCGCTCTCAGAGAATCGATGAAGCTTATAACTTCGTATAGT

ATACCTTATACGAAGTTATGATATGCATGTCCGCGTTCGTGA

AATCTC Clal LoxN

SEQ ID NO: 8

ATACGTAAACTTCTAGATCCATAACTTCGTATAAGGTATACT _{xbaI loxN} ATACGAAGTTATCCCTCGGGGGGGCAAGAATTGTGTTAACCG

GTTCGA • pNcMIC 1 Plasmid -KO-CAT-GFP lox

The plasmid pNcMiclKO-CAT-GFP loxP SEQ ID NO: 11 contains a selection cassette CAT-GFP SEQ ID NO: 6 comprising the selection gene cat-gfp SEQ ID NO: 2 coding for a fusion protein CAT-GFP allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP: Green Fluorescent Protein), under the control of the opl'α-tubulin promoter from Toxoplasma gondii SEQ ID NO: 3 to allow expression of the gene in the parasite . Downstream of the CAT-GFP coding sequence, the 3’UTR sequence of the Toxoplasma gondii SEQ ID NO: 4 sagl gene is inserted. The objective of this sequence is to stabilize the mRNA encoding the CAT / GFP fusion protein. This SEQ selection cassette

ID NO: 6 is surrounded by two identical loxP SEQ ID NO: 12 sites with the same orientation.

To obtain this plasmid, the selection cassette CAT-GFP SEQ ID NO: 6 was amplified by PCR on the plasmid pT230 CAT-GFP SEQ ID NO: 9 with the primers CN10 SEQ ID NO: 13 and CN11 SEQ ID NO: 14 allowing the addition of the loxP sites SEQ ID NO: 12 (2394 bp), digested with the restriction enzymes HindIII and BamHI (2339 bp) and cloned into the plasmid pT230-ble SEQ ID NO: 37 digested with HindIII and BamHI (293 lpb). The plasmid then obtained is the plasmid pT230 CAT-GFP loxP SEQ ID NO: 113.

The 3 HR region of the ncmicl gene was amplified by PCR from the genomic DNA of the NC-1 strain of Neospora caninum. For amplification, the primers 3 HR NCmicl F Kpnl and 3 HR NCmicl R HindlII (SEQ ID NO: 114 and SEQ ID NO: 115) allow the amplification of the 3 HR region of the ncmicl gene and the creation of two sites of restrictions which were used to clone the 3HR fragment upstream of the CAT-GFP selection cassette into pT230 CAT-GFP loxP SEQ ID NO: 113. The plasmid obtained is called pNcmicl-3HR CATGFP loxP SEQ ID NO: 118.

The 5 HR region of the ncmicl gene was amplified by PCR from the genomic DNA of the NC-1 strain of Neospora caninum. For amplification, the primers 5 HR NCmicl F BamHI and 5 HR NCmicl R Notl (SEQ ID NO: 116 and SEQ ID NO: 117) allow the amplification of the 5'UTR region of the ncmicl gene and the creation of two sites. restrictions which were used to clone the 5HR fragment downstream of the CAT-GFP selection cassette into the plasmid pNcmicl-3HR CATGFP loxP SEQ ID NO: 118 (BamHI -Notl).

The plasmid then obtained is the plasmid pNcMiclKO-CAT-GFP loxP SEQ ID NO: 11. The plasmid pNcMiclKO-CAT-GFP loxP therefore contains a CAT-GFP cassette SEQ ID NO: 6 framed by a 5′HR sequence of the Ncmicl SEQ gene ID NO: 96 and a 3'HR sequence of the Ncmicl gene SEQ ID NO: 95.

The primer sequences are shown in Table 15 below.

Table 15: List of primers used for the construction of the plasmid pNcmicl KO

CATGFP loxP

Construction duplasmidepNcmicl KO CATGFPloxP

CN10 SEQIDNO: 13 GCGGCCAAGCTT4 TAA CTTCGTA TAA TGTA TGCTA TA CG A . IG77H7GATATGCATGTCCGCgttcgtgaaatctctgatcaagcgg HindIII. loxP CN11 SEQ ID NO: 14 cgacgcacgctgtcactcaacttgctGCT AGA4 CTA 67 GG ATCC 1 TAA CTTCGTA TAGCA TACA TTATACGAAGTTA / CCCTCGGGGG GGCAAGAATT Spel, BamHI, loxP 3 HR KpnI NCmicl F SEQIDNO: 114 CGCGGTACCAGGCAGAAGTAAAGAAGGTTCCTC KpnI 3 HR HindIII NCmicl R SEQIDNO: 115 CGCAAGCTTTGATCACGCAAGAAAAGAAGC HindIII 5 HR Bam NCmicl F SEQIDNO: 116 CGCGGATCCCATTTGTAGATACGGTTGCACAC Bam 5 HR NOTL NCmicl R SEQIDNO: 117 CGCGCGGCCGCACATTCAGACGGCAGAACTCTG NOTL

• pTSAGl- Cre Recombinase Plasmid

The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 was constructed to transiently express in the parasite Toxoplasma gondii and its genetically modified derivatives the gene encoding the Cre Recombinase protein derived from bacteriophage PI (Brecht et al., 1999 , same reference as above).

The plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 is derived from the plasmid pUC18 (commercial plasmid), which contains an expression cassette for the Cre Recombinase from bacteriophage PI.

In the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15, the gene encoding Cre Recombinase SEQ ID NO: 16 is placed under the control of the promoter of the sagl gene of Toxoplasma gondii SEQ ID NO: 17, which allows the expression of the Cre Recombinase protein in transfected Toxoplasma gondii parasites. Downstream of the gene encoding Cre Recombinase, the 3’UTR sequence of the Toxoplasma gondii sagl gene SEQ ID NO: 4 is inserted. The objective of this sequence is to stabilize the mRNA encoding the Cre Recombinase protein.

The absence of a specific selection cassette does not allow stable integration of the transfected genetic material but only a transient expression of Cre Recombinase.

Construction of the Neo ncmicl-3 KO - 2G strain

The construction of the second generation attenuated living strain, called Neo ncrnic / 3 KO - 2G, is done in 4 distinct stages:

1. Deletion by homologous recombination of the Ncmic3 gene and its replacement by the selection cassette CAT-GFP SEQ ID NO: 6 framed by sequences LoxN SEQ IDNO: 5.

To obtain this strain, the wild strain NC-1 of Neospora caninum is electroporated with the plasmid pNcMIC3-KO-CAT-GFP lox N SEQ ID NO: 1. 20 μg of plasmid purified then linearized with Kpnl are added to 10 ⁷ parasites suspended in the CYTOMIX electroporation medium containing ATP (3 mM) and Glutathione (3 mM) (Van den Hoff et al., Nucleic Acid Research, Junll; 20 (11): 2902), and electroporation was carried out in a 4 mm gap cuvette, in a volume of 800 pL on a BioRad device (Parameters: 2000V, 50 ohms, 25 pF, with two electric shock). After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 pM), 24 hours after Telectroporation. 10 to 15 days after selection, the parasites are subcloned in a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA with DNAzol from the clones of interest. The strain obtained is called Neo ncmic3 KO.

In this strain, the mic3 gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing the CATGFP selection cassette is SEQ ID NO: 101. Since the honey gene is not deleted, the sequence of the honey gene SEQ ID NO: 106 is present in the genome of strain.

2. Deletion of the selection cassette SEQ ID NO: 6: the Neo ncmic3 KO strain obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15.

The transiently expressed enzyme will allow excision of the selection cassette CAT-GFP SEQ ID NO: 6. The electroporation protocol is similar to the previous protocol. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA with DNAzol from the clones of interest . The strain obtained is called Neo ttcmic3 KO - 2G.

In this strain, the mic3 gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 18. The honey gene not being deleted, the sequence of the honey gene SEQ ID NO: 106 is present in the genome of the strain.

3. Deletion by homologous recombination of the ncmicl gene and its replacement by the selection cassette CAT-GFP SEQ ID NO: 6 framed by LoxP sequences SEQ IDNO: 12.

To obtain this strain, the Neo ncmic3 KO-2G strain is electroporated with the plasmid pNcMICl-KO-CAT-GFP lox P SEQ ID NO: 11 linearized by Kpnl, according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 μΜ), 24 hours after the electroporation. 10 to 15 days after selection, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA from the clones of interest. The strain obtained is called Neo ncmicl-3 KO

In this strain, the mic3 gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 18. In this strain, the honey gene has been deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6. Thus, the theoretical sequence at the locus of the deleted honey gene containing the CATGFP selection cassette is SEQ ID NO: 102.

4. Deletion of the selection cassette SEQ ID NO: 6: the Neo Ncmicl-3 KO strain obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID

NO: 15.

The transiently expressed enzyme will allow excision of the selection cassette CAT-GFP SEQ ID NO: 6. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after having carried out an extraction of genomic DNA with DNAzol from the clones of interest . The strain obtained is called Neo ncmicl-3 KO - 2G.

In this strain, the mic3 gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 18.

In this strain, the honey gene was deleted and the CATGFP SEQ ID NO: 6 selection cassette was excised. Thus, the theoretical sequence at the locus of the deleted honey gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 91.

Validation of the Neo ncmicl-3 KO - 2G strain by PCR

To validate the Neo ncmicl-3 KO - 2G strain, PCR analyzes are carried out using genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 ⁷ parasites. The primers used for the PCRs are described in Figure 15-B and are detailed in Table 16 below. The PCR products are analyzed by agarose gel electrophoresis (Figure 15-C). Their expected size and their observed size are also described in Table 17 below. For clarity in Figure 15-C, only the 3 stages of production are shown (ncmic3, ncmic3K0 CATGFP and ncmic3K0 loxN (2G) or ncmicl, ncmiclKO CATGFP and ncmiclKO loxP (2G)), the results obtained are in accordance with expected sizes

Table 16: list of primers used for validating the strains.

bait Sequence Ncmic3 (mixl) VS Do mic3 F SEQ ID NO: 22 TTTCCCTTCTAAACACAGTCG d Do mic3 R SEQ ID NO: 23 CCTTCAGTGGTTCTCCATGAGT KO validation 5'Ncmic3 (mix2) i Integ NCmic3 F SEQ ID NO: 24 GAAAGTGTCAGTGGTAGAGACTGC j ORF CATGFP R SEQ ID NO: 25 CCGTTTGGTGGATGTCTTCT KO validation 3’Ncmic3 (mix3) k ORF CATGFP F SEQ ID NO: 26 GCATCGACTTCAAGGAGGAC 1 Integ NCmic3 R SEQ ID NO: 27 TGTTTACAGGTGATCCAGAAAAGG Scar Ncmic3 (mix4) g AF3 SEQ ID NO: 32 GTCATCGACCGCCGGAACTAGTAGT h AF4 SEQ ID NO: 33 GCAGAGGTTCTGCGTATCTAACACGG Ncmicl (mix5) at Do mic 1 F SEQ ID NO: 20 ACCCGGAGAATTATCGCCTA b Do mic 1 R SEQ ID NO: 21 TTCTCCAGGCACTCACCT KO validation 5'Ncmicl (mix6) m Integ NCmicl F SEQ ID NO: 28 CCGAGCAAGTTAGCAAGTCC j ORF CATGFP R SEQ ID NO: 25 CCGTTTGGTGGATGTCTTCT KO validation 3'Ncmicl (Mix 7) k ORF CATGFP F SEQ ID NO: 26 GCATCGACTTCAAGGAGGAC not Integ NCmicl R SEQ ID NO: 29 CTTGTCCGTCACATCGTTTG Scar Ncmicl (mix8) e ncmiclcrelox F B SEQ ID NO: 30 GGCGACATACTGCATTGGAT f ncmiclcreloxRB SEQ ID NO: 31 GATCGGAGTCTGTCCCTCAA

Table 17: Expected size of the amplicons (in base pairs) of the different PCRs for validation of the construction of the KO strains of Neospora caninum

NC-1 Neo mic3 KO Neo ncmic3 KO loxN Neo ncmicl- 3 KB loxP Neo ncmicl-3 KO 2G Ncmic3 (mixl) 850 - - - - KO validation 5'Ncmic3 (mix2) 2960 3'Ncmic3 KO validation (Mix3) 3668 Ncmic3 scar (mix4) 2163 2575 276 276 276 Ncmicl (mix5) 701 701 701 - - 5'Ncmicl KO validation (Mix6) 3359 3'Ncmicl KO validation (Mix 7) 3421 Ncmicl scar (mix8) 3161 3161 3161 2560 261

The electrophoreses of the PCR products produced with the primers c SEQ ID NO: 22 and d SEQ ID NO: 23 (mix 1) make it possible to demonstrate a band at 850 base pairs for the strain NC-1, in accordance with the size of expected band confirming the presence of the Ncmic3 gene SEQ ID NO: 105 in this strain. This band is not detected in the Neo Ncmic3 KO, Neo Ncmic3 KO - 2G, Neo Ncmicl-3 KO and Neo 7Vcmicl-3 KO - 2G strains confirming the suppression of the gene in these strains.

The electrophoresis of the PCR products carried out with the primers i SEQ ID NO: 24 and j SEQ ID NO: 25 and the primers k SEQ ID NO: 26 and 1 SEQ ID NO: 27 (mix Ncmic3) respectively make it possible to highlight a band at 2960 and 3668 base pairs for the Neo Ncmic3 KO strain, in accordance with the expected band size and confirming the presence of the cat-gfp selection gene in this strain in place of the Ncmic3 gene. This band is not detected in the NC-1, Neo Ncmic3 KO - 2G, Neo Ncmicl-3 KO and Neo Acmicl-3 KO - 2G strains confirming the absence of the selection gene cat-gfp SEQ ID NO: 2 at Ncmic 3 locus in these strains.

The electrophoresis of the PCR products carried out with the primers primers g SEQ ID NO: 32 and h SEQ ID NO: 33 (scar Ncmic3) make it possible to highlight different bands in accordance with the expected band size. A band at 2163 base pairs for the strain NC-1, confirms the presence of the gene Ncmic3 SEQ ID NO: 105 in this strain. A band of 2575 base pairs is demonstrated for the Neo Ncmic3 KO strain confirming the presence of the selection cassette CATGFP SEQ ID NO: 6 in place of the Ncmic3 gene. Finally, a band of 276 base pairs is demonstrated for the Neo Ncmic3 KO - 2G strains Neo Ncmicl-3 KO and Neo Acmicl-3 KO - 2G confirming the deletion of the selection gene cat-gfp SEQ ID NO: 2 in these strains, leaving a loxN scar SEQ ID NO: 5 in the genome.

The electrophoresis of the PCR products carried out with the primers a SEQ ID NO: 20 and b SEQ ID NO: 21 (mix Ncmicl) make it possible to demonstrate a band at 644 base pairs for the strains NC-1, Neo Ncmic3 KO, Neo Ncmic3 KO - 2G, in accordance with the expected band sizes and confirming the presence of the Ncmicl SEQ ID NO: 106 gene in these strains. These bands are not detected in the Neo Ncmicl-3 KO and Neo Acmicl-3 KO - 2G strains confirming the suppression of the gene in these strains.

The electrophoresis of the PCR products carried out with the primers m SEQ ID NO: 28 and j SEQ ID NO: 25 and the primers k SEQ ID NO: 26 and n SEQ ID NO: 29 (mix Ncmicl) respectively make it possible to highlight a band at 3359 and 3421 base pairs for the Neo Ncmicl-3 KO strain, in accordance with the expected band size and confirming the presence of the cat-gfp selection gene SEQ ID NO: 2 in this strain in place of the Ncmicl gene. This band is not detected in wild-type NC-1 strains of N. caninum, Neo Ncmic3 KO, Neo Ncmic3 KO - 2G, and Neo Ncmicl-3 KO - 2G confirming the absence of the selection gene at-gfp SEQ ID NO: 2 at locus Ncmic 1 in these strains.

The electrophoresis of the PCR products carried out with the primers SEQ ID NO: 30 and f SEQ ID NO: 31 (scar Ncmicl) make it possible to highlight different bands in accordance with the expected band size. A band at 2182 base pairs for the strains NC-1, Neo Ncmic3 KO, Neo Ncmic3 KO - 2G confirms the presence of the Ncmicl gene in these strains. A band of 2560 base pairs is demonstrated for the Neo Ncmicl-3 KO strain confirming the presence of the selection cassette CATGFP SEQ ID NO: 6 in place of the Ncmicl gene. Finally a band of 261 base pairs is demonstrated for the Neo Ncmicl-3 KO - 2G strain confirming the suppression of the selection gene cat-gfp SEQ ID NO: 2 in this strain, leaving a loxP scar SEQ ID NO: 12 in the genome.

The “scar” PCR products (mix 4 and 8) were sequenced and the sequencing confirmed that:

• the ncmic3 gene SEQ ID NO: 105 has been deleted and the selection cassette CATGFP SEQ ID NO: 6 has been deleted by action of Cre-Recombinase leaving a LoxN scar SEQ ID NO: 5 in accordance with the expected sequence ( Figure 15-D).

• the ncmicl SEQ ID NO: 106 gene has been deleted and the CATGFP SEQ ID NO: 6 selection cassette has been deleted by action of Cre-Recombinase leaving a LoxP scar SEQ ID NO: 12 in accordance with the expected sequence ( Figure 15-D).

Validation of the Neo ncmicl-3 KO - 2G strain by immunofluorescence

The tachyzoites cultivated 24 hours on glass coverslips coated with a monolayer of HFF cells. The infected cells were washed twice with PBSIX, and fixed with 4% formaldehyde for 30 min. After 3 washes in PBS1X, the infected HFF cells were permeabilized with 0.1% Triton X-100 in PBSIX for 5 min. After 3 washes with PBS IX, a saturation step is carried out with a solution of PBS 1X / SVF 10% for 30 min. The cells were then incubated with the primary antibody diluted in 2% SVF for 1 hour, washed 3 times with PBS1X then incubated with a secondary antibody diluted in a solution of PBS / SVF 2% for 1 hour. After 2 washes with PBS1X, the glass slides are mounted on a slide with Immu-Mount ™ and observed under the fluorescence microscope.

The primary antibody Tgmic3 allows recognition of the protein Ncmic3, it makes it possible to detect the expression of the protein NcMIC3 SEQ ID NO: 118 in the parasite (rabbit anti-mic3 antibody: rnAb anti-MIC3 s3) and the antibody secondary commercial used is Alexa fluor® 594 anti-rabbit goat (Life technologies ref. Al 1012).

The results show that no fluorescence is detectable at the apical pole of the parasite revealing the absence of the MIC3 proteins (Figure 16-A).

The primary antibody Tgmicl does not allow recognition of the protein NcMICl SEQ IDNO: 119.

The results show that the parasites express a green fluorescent reflecting the expression of the protein CATGFP SEQ ID NO: 120 following the completion of gene deletions (Neo ncmic3 KO and Neo ncmicl-3 KO) while after action of Cre recombinase, the Neo ncmic3 KO - 2G and Neo ncmicl-3 KO - 2G strains are no longer fluorescent (deletion of the CATGFP cassette SEQ ID NO: 6) (Figure 16-B).

Example 7 Immunostimulation Ex Vivo of Primary Avian Macrophages or Under HD11 Type Macrophage Lines

The objective of this experiment is to define what is the activation potential of chicken immune cells by each of these strains in the living, inactivated or total extract form.

Material and methods

Chicken primary cells

The splenocytes are isolated from chicken spleen with SPF status (free of specific pathogens) supplied directly by the INRA animal testing platform (PFIE, Nouzilly, France). Briefly, the spleens are ground on a cell sieve with a porosity of 100 μm (CellStrainer, Becton Dickinson, France). The immune cells are isolated by density gradient in accordance with the manufacturer's instructions (Histopaque 1119, Sigma). They are then washed three times in culture medium, counted in flow cytometry and diluted to 2.10 ⁶ live cells per milliliter in culture medium. The primary chicken cells are cultured in RPMI medium supplemented with 12% hen serum (Commercial reference 16110082, Life Technology), 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin.

Primary chicken macrophages are isolated from 10 mL of chicken blood. After dilution to a third, the diluted blood is deposited on a density gradient of 1119 (Histopaque 1119, Sigma) and centrifuged at 1200g for 30 minutes without brake. The ring of mononuclear cells is recovered, washed three times in culture medium. The immune cells are quantified by flow cytometry and the cell concentration will be adjusted to 5.10 ⁶ living cells per milliliter. They are distributed at the rate of 200 μL per well in a 96-well plate with a flat bottom (bottle, Corning) and maintained for three hours at 37 ° C. Non-adherent cells are washed three times in PBS (phosphate buffered saline, 70011036, ThermoFisher Scientific). Each well is completed with 200 μL of fresh culture medium. After an additional 48 hours of incubation at 37 ° C., the non-adherent cells and in particular the platelet debris are eliminated by two washes in PBS. Purity is measured by flow cytometry by counting the number of cells carrying the membrane antigen KUL1 (ab25441, Abcam), the macrophages obtained in this experiment are at a level of purity greater than or equal to 92%. The HD11 chicken macrophage line is cultivated in DMEM medium (11885-084, Thermofisher scientific) to which is added 5% of decomplemented fetal calf serum and 5% of 2mM glutamine hen serum, 100 U / ml of penicillin and 100 U / mL streptomycin.

Production of parasites derived from Toxoplasma gondii and Neospora caninum

The Toxo-KO +, Toxo tgmic 1-3 KO 2G, Toxo KO + 2G, Neo ncmic 1-3 KO 2G, Toxoplasma gondii RH and Neospora caninum NCI strains are maintained by successive passages on a line of human foreskin fibroblasts (HFF) cultured in DMEM medium to which 10% fetal calf serum (FCS), 2 mM glutamine, 100 U / ml of penicillin and 100 U / ml of streptomycin are added. The extra-cellular tachyzoites obtained after three days of culture are used in this study. They are concentrated and washed by centrifugation at 900 g for 5 minutes at room temperature. After resuspension in a DMEM solution, the tachyzoites are counted by flow cytometry and their viability is evaluated by the proportion of the number of tachyzoites not incorporating propidium iodide (P4864-10mL, Sigma-Aldrich) relative to the total number of tachyzoites. The viability of the tachyzoites used in this experiment is greater than 85% when using fresh tachyzoites.

Production of inactivated parasites

To produce the inactivated parasites for each of the strains, 10 ⁹ tachyzoites are produced and centrifuged at 900 g for 5 minutes. They are resuspended in a PBS solution supplemented with 4% formaldehyde (Commercial reference 252549, Sigma) and are left for 30 minutes at 4 ° C. After four washes with PBS, the inactivated parasites are recounted in the Malassez cell and adjusted to 10 ⁹ parasites per milliliter.

Production of total extracts

To produce the total extracts for each of the lines, 10 ⁹ parasites are produced and centrifuged at 900 g for 5 minutes. They are resuspended in distilled water devoid of endotoxin (Commercial reference 10977035, Gibco). Cell lysis is carried out by two sonication periods of 10 minutes at 60W in ice. The insoluble debris is filtered on a PVDF (polyvinylidene fluoride) membrane of 45 μm low absorbance and sterile (SLHV033RS, Merck-Millipore). The quantity of total proteins extracted is quantified according to the BCA method (assay with bicinchronic acid) in accordance with the manufacturer's instructions (Commercial reference Sigma B-9643 and C-2284). The different extracts produced from the different strains are standardized to 1 mg / mL and stored at -80 ° C.

Cell stimulation

For each of the strains and cell types studied, the cells are stimulated for 4 hours and 24 hours by the total extracts from each of the strains produced, by the tachyzoites inactivated for each of the strains and by fresh tachyzoites at the doses indicated.

Extraction of messenger RNAs and reverse transcription

After 4 or 24 hours of stimulation, the cells are lysed with the cell lysis buffer

RLT + (Qiagen), containing a high concentration of guanidine isothiocycanate, and the messenger RNAs are extracted by strictly respecting the procedure of the RNeasy micro kit plus Kit (74034, Qiagen). The mRNAs are quantified by spectrophotometry (Nanodrop ™) and diluted in RNAse / DNAse free distilled water at a concentration of 200 ng / pL.

Complementary DNAs are produced by following the instructions in the iScript ™ Reverse Transcription Supermix kit (1708841, Bio-Rad) and from 2 pg of messenger RNA.

Measurement of cytokinary expression

The expression of IL-8, IL-Ιβ, IL-6, LITAF, IFN-γ, IFN-α, IL-12 and GAPDH is measured in RT-qPCR respecting the method recommended by the manufacturer (SsoAdvanced ™ Universal SYBR® Green Supermix, 1725270, Bio-Rad). The PCR conditions, the primers (primers) are described in Table 18 below. The expression of each of the cytokines is related to the expression of GAPDH using the standard curve method.

Table 18: Description of primers and PCR conditions

Uncomfortable Primer meaning Anti-sense primer Hybridization GAPDH SEQIDNO: 154 GAGATGGTGAAAGTCGGAGTC SEQ ID NO: 155TTTCCCGTTCTCAGCCTTGAC 60 ° C IL12B SEQIDNO: 156 TACTTTCCTTTGCTGCCCTTCT SEQIDNO: 157 TGGTGTCTCATCGTTCCACT 60 ° C IFN- gamma SEQIDNO: 158 CTGAAGAACTGGACAGAGAGAAA SEQ ID NO: 15 9GTTTGATGTGCGGCTTTGACT 60 ° C LITAF SEQIDNO: 160 CTGTGTATGTGCAGCAACCC SEQIDNO: 161 AACAACCAGCTATGCACCCCA 60 ° C IFNalpha SEQIDNO: 162 CCTTGCTCCTTAACGACA SEQ ID NO: 163 CGCTGAGGATACTAGAAGAGGT 58 ° C IL-lbeta SEQ ID NO: 164CTTCCTCCAGCCAGAAAGT SEQ ID NO: 165 CAGCGTTGTAGCCCTTGAT 60 ° C IL-6 SEQIDNO: 166 CAACCTCAACCTGCCCAA SEQIDNO: 167 GGAGAGCTTCCTCAGGCATT 53 ° C IL-8 SEQ ID NO: 168CTGAGGTGCCAGTGCATTAG SEQ ID NO: 169AGC ACACCTCTCTTCCATCC 58 ° C IL-12a SEQ ID NO: 170AAGACCTGAAAACCTACAAGGC SEQIDNO: 171 GGCTTGCATCATGTCATCAA 60 ° C

Statistical analysis

The statistical analyzes were calculated using GraphPad Prism 7 software.

Two-way ANOVA followed by a post-hoc Tukey or Bonferroni test was used to perform the multiple comparisons taking into account data matching, duration of stimulation and type of stimulation.

Results

Expression of pro-inflammatory cytokines

The expression of IL-8, IL-6, ZL-Ιβ and IFN-α reflects an active inflammatory response, as conventionally observed during a bacterial, viral or parasitic infection. The expression of these cytokines is strong in primary cells after stimulation of the PMA / Ionomycin type used here as a positive control in macrophages. The HD 11 line, although receptive to pro-inflammatory stimuli, does not express these cytokines at a high level.

The expression of each of these cytokines is respectively stronger after stimulation with the living strains of Toxo-KO + and Toxo-KO + 2G, as obtained respectively in Examples 4 and 5, compared with the stimulations carried out with the strains, Toxo tgmicl -3 KO 2G, Toxoplasma gondii RH, Neospora caninum NCI and Neo ncmicl-3 KO 2G. these differences in expression of proinflammatory cytokines between groups are smaller when the strains are tested in the form of total extracts or inactivated parasites.

Expression of pro-cytotoxic cytokines

Parasites of the genus Apicomplexa, such as Toxoplasma spp. and Neospora spp., are obligate intracellular parasites. The cytotoxic response is directly related to the production of IFN-γ and IL-12, which is why the level of expression of these two cytokines was also quantified to compare the activation capacity of the immune system of each. strains derived from Toxoplasma gondii or Neospora caninum

The expression of IFN-γ and ZL-12 is greatly increased by stimulation with PMA / Ionomycin which is used here as a positive control. The level of expression of IL-12 and IFN-γ by splenocytes is also high. In contrast, primary macrophages and

HD11 produce little IFN-γ and are more prone to produce IL-12.

These two cytokines are expressed to a large extent in response to stimulation by living parasites of the Toxo-KO + and Toxo-KO + 2G strains, as obtained respectively in Examples 4 and 5. To a lesser extent, the expression of these two cytokines is increased compared to the control condition after stimulation with other strains derived from Toxoplasma gondii and Neospora caninum, including wild strains.

As for the expression of pro-inflammatory cytokines, the difference in expression of IFN-γ and IL-12 is reduced when stimulation is carried out with inactivated parasites and to a greater extent with total extracts parasites. However, the expression is significantly stronger in response to stimulation by the ToxoKO + and Toxo-KO + 2G strains compared to stimulation by the other strains.

Conclusion

The effect of each strain on the activation of the immune response is evaluated in vitro and in the form of live tachyzoites, inactivated tachyzoites or total extracts of parasites. The results show a significant increase in the expression of pro-inflammatory cytokines and cytokines promoting the cytotoxic response after stimulation with the Toxo-KO + and Toxo-KO + 2G strains. However, each of the strains can be used to modulate the activity of the immune system, either strongly with the Toxo-KO + and Toxo-KO + 2G strains, or more moderately with the other strains.

EXAMPLE 8 Safety of the Toxo tgmicl-3 KO rop! 6 KO Gral5II Kl strain (denoted Toxo KO + 2G) inoculated subcutaneously with the day-old chick

The objective of the experiment is to validate the safety of the Toxo KO + 2G strain, as obtained in Example 5, in newborn poultry and to verify that the Toxo KO + 2G strain induces a response. immune.

Material and method

Toxo KO + 2G parasite production

The mutant strain of Toxoplasma gondii Toxo KO + 2G, obtained in Example 5, is maintained by successive passages on a line of human foreskin fibroblasts (HFF) cultured in DMEM medium to which is added 10% fetal calf serum, 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin.

Animals

One hundred 1-day-old chicks were included in the study.

The chicks were divided into 4 separate lots:

o Lot A: composed of 25 immunostimulated chicks with 1.10 ³ tachyzoites of the Toxo KO + 2G strain at one day of age, o Lot B: composed of 25 immunostimulated chicks with 1.10 ⁴ tachyzoites of the Toxo KO + 2G strain at one day of age, o Lot C: composed of 25 immunostimulated chicks with 1.10 ⁵ tachyzoites of the Toxo KO + 2G strain at one day of age, o Lot D: composed of 25 control chicks inoculated with PBS at one day of age .

All of the injections were made subcutaneously at the base of the neck in a volume of 100 µL.

All the animals are sacrificed 28 days after the start of the experiment.

Results

No clinical signs were observed during the experiment and the weight gain of the immunostimulated chicks is generally similar to the weight gain of the control chicks, regardless of the dose of immunostimulant.

EXAMPLE 9 Safety of the Toxo tgmicl-3 KO rop! 6 KO Gral5II Kl strain (denoted Toxo KO + 2G) inoculated subcutaneously with the day-old chick or by in ovo route in the amniotic fluid or in the embryo

The objective of the experiment is to validate the safety of the Toxo KO + 2G strain in broiler chicken, as obtained in Example 5, in newborn poultry and to verify that the Toxo KO strain + 2G induces an immune response after inoculation by the in-ovo or subcutaneous route.

Material and methods

Toxo KO + 2G parasite production

The mutant strain of Toxoplasma gondii Toxo KO + 2G, as obtained in Example 5, is maintained by successive passage over a line of human foreskin fibroblasts (HFF) cultivated in DMEM medium to which fetal calf serum is added. 10%, 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin.

Animals

Three hundred chicks were included in the study.

The chicks were divided into 12 separate lots:

o Lot A: composed of 25 immunostimulated chicks with 1.10 ³ tachyzoites of the Toxo KO + 2G strain by in ovo route three days before hatching (amniotic fluid), o Lot B: composed of 25 immunostimulated chicks with 1.10 ⁴ tachyzoites of the Toxo strain KO + 2G by in ovo route three days before hatching (amniotic fluid), o Lot C: composed of 25 immunostimulated chicks with 1.10 ⁵ tachyzoites of the Toxo KO + 2G route by in ovo route three days before hatching (amniotic fluid), o Lot D: composed of 25 immunostimulated chicks with 1.10 ³ tachyzoites of the Toxo KO + 2G strain by in ovo route two days before hatching (embryo), o Lot E: composed of 25 immunostimulated chicks with 1.10 ⁴ tachyzoites of the strain

Toxo KO + 2G by in ovo route two days before hatching (embryo), o Lot F: composed of 25 immunostimulated chicks with 1.10 ⁵ tachyzoites of the strain

Toxo KO + 2G by in ovo route two days before hatching (embryo), o Lot G: composed of 25 immunostimulated chicks with 1.10 ⁴ tachyzoites of the strain

Toxo KO + 2G subcutaneously one day after hatching, o Lot H: composed of 25 chicks immunostimulated with 1.10 ⁵ tachyzoites of the Toxo KO + 2G strain subcutaneously one day after hatching o Lot I: composed of 25 immunostimulated chicks with 1.10 ⁶ tachyzoites of the Toxo KO + 2G strain subcutaneously one day after hatching.

o Lot J: composed of 25 control chicks inoculated with 50 pL of DMEM by in ovo route three days before hatching (amniotic fluid), o Lot K: composed of 25 control chicks inoculated with 50 pL of DMEM by in ovo route two days before hatching (embryo), o Lot L: composed of 25 control chicks inoculated with 200 μL of DMEM subcutaneously one day after hatching.

Each week, 5 animals per group are sacrificed to study the kinetics of appearance of antibodies.

Results

Clinical effect and mortality

Whatever the dose and the route of inoculation tested, no mortality or specific clinical effect was observed in comparison with the respective control groups. After autopsy, no evidence of acute or chronic lesion was observed in animals sacrificed between 2 and 27 days post-immunostimulation, that is, throughout the duration of the experiment. These results suggest the absence of a major toxic effect of ToxoKO + 2G when used at doses between 10 ³ and 10 ⁵ tachyzoites per animal injected in ovo or between 10 ⁴ and 10 ⁶ tachyzoites per animal injected subcutaneously .

Animal growth

The growth of the control animals, having received only DMEM (group J, K, L) by in ovo or subcutaneous route is in line with expectations and similar between the three groups tested, which suggests a good homogeneity of the breeding conditions between the various containment units.

The mean weight of the animals at the time of slaughter in the immunostimulated groups is significantly lower than the means observed in the respective control groups (Figures 17 A-C). This decrease in weight is observed intermittently between DT 1 and D27 regardless of the dose used. In addition, for the same route of inoculation, the differences in mean weight during the experiment are small, which suggests that the dose would have a minor impact on the weight loss induced by Toxo-KO + 2G. Similarly, the route of inoculation has little or no influence on this differential growth profile.

Taken as a whole, these results suggest that Toxo-KO + 2G induces a small but significant reduction in the weight of the animals whatever the route of inoculation and the dose tested.

Influence on the immune response

The effect of Toxo-KO + 2G on the activation of the immune response was evaluated by the quantification of the humoral response directed against Toxo-KO + 2G (Figures 18 A-C). The presence of anti-Toxo-KO + 2G antibodies reflects a necessarily successful activation of the immune system. The production of specific antibodies can only appear after activation of cells of the innate immune system, such as certain antigen-presenting cells, CD4 helper T lymphocytes and activation and then maturation of B lymphocytes. The latter to produce antibodies IgY type (IgG in chicken) necessarily switched class and were therefore fully activated.

Antibodies of the IgY subclass directed against Toxo-KO + 2G are expressed from 20 days post-hatching whatever the immunostimulated groups considered. On D28, a clear and significant dose dependent effect is observed, demonstrating that a weak dose activates the immune system less strongly than a strong dose (FIGS. 18 AC). The maximum antibody titer was observed in the immunostimulated subcutaneous group at a dose of 10 ⁶ tachyzoites per animal. Nevertheless, at equal dose, the antibody titers in the groups immunized by subcutaneous route are overall lower than those observed in the groups immunized by in ovo route (FIGS. 18 AC). Immunization by the ovo route in amniotic fluid shows better efficacy in activating the immune response, in particular at a dose of 10 ⁵ tachyzoites per animal (FIGS. 18 AC). These results show that the inoculation of Toxo-KO + 2G induces a dose-dependent activation of the immune response whatever the route of inoculation tested.

Conclusion

The effect of an in ovo or subcutaneous inoculation with Toxo-KO + 2G has been evaluated in chicken. In a dose-dependent manner, an activating effect on the immune response of Toxo-KO + 2G was demonstrated regardless of the inoculation routes tested. At the various doses and inoculation routes tested, a slight decrease in growth was observed after immunostimulation. This reduction in weight is not accompanied by acute or chronic toxicity visible macroscopically on the live animal or after autopsy.

Taken together, these results show that the inoculation of Toxo-KO + 2G activates the immune response and that the maximum admissible dose in the absence of any apparent clinical manifestation is 10 ⁶ tachyzoites per animal.

EXAMPLE 10 Efficacy of the Toxo tgmicl-3 KO roplô KO Gral5II Kl strain (denoted Toxo KO + 2G) in the prevention of avian coccidiosis

Material and method

Toxo KO + 2G parasite production

The mutant strain of Toxo KO + 2G as obtained in Example 5 is maintained by successive passage over a line of human foreskin fibroblasts (HFF) cultivated in DMEM medium to which is added 10% fetal calf serum, 2mM glutamine, lOOU / mL penicillin and lOOU / mL streptomycin. The tachyzoites were concentrated and washed by centrifugation at 900 G for 5 minutes at room temperature. After resuspension in a DMEM solution, they were counted in a Malassez cell and diluted either to 1.10 ⁴ or to 1.10 ⁶ tachyzoites per milliliter. Their viability was assessed by flow cytometry (MACS Quant 10, Miltenyi) and was calculated as the frequency of the number of tachyzoites not incorporating propidium iodide (commercial reference P4864-10ML, Sigma79

Aldrich) relative to the total number of tachyzoites. The viability of the tachyzoites is greater than 82%.

Production of Eimeria acervulina

The strain of Eimeria acervulina used in this study comes from a French farm. The parasites were amplified by successive passages on chickens SPF (Free of specific pathogens) Oocysts of E. acervulina were purified from faeces from infected chickens 5 days ago.

As described in previous work (Cloning and expression of cDNA encoding an Eimeria acervulina 70 kDa sporozoite protein which is related to the 70 kDa heat-shock protein family. Laurent F. et al., Mol Biochem Parasitol. 1994 Aug; 66 (2 ): 349-52) (Effects of whole wheat feeding on the development of coccidian infection in broiler chickens. Gabriel I, et al., Poult Sci. 2003 Nov; 82 (l 1): 1668-76), the purification involves a process of flotation in a solution of magnesium sulfate, washes in water and decontamination with bleach. After purification, the oocysts are stored in a sterile PBS solution at 4 ° C. The animals were inoculated per os with 2.10 ⁵ sporulated oocysts previously diluted in 0.5 ml of sterile drinking water.

Animals

263 1-day-old ROSS PM3 chicks were purchased from the Boyé-accouvage hatchery (La Boissière-en-Gâtine, France). The animals were housed in a class II containment room

The animals were then divided into different groups presented in Table 19 below. On day 1 of the experiment, the chicks were immunostimulated by 1 (P (Dose 1) or 10 $ (Dose 2) tachyzoites of Toxo KO + 2G Fees administered subcutaneously The control animals received an equivalent volume of DMEM At 7 or 14 days after hatching, the animals were infected with 2 × 10 oocysts of Eimeria acervulina per os. A solution of sterile drinking water was administered to the control groups.

Table 19: Distribution of animals and description of the groups

Name of the group AT B VS D E F G H I immunostimulatory "" Dose 1 Dose 2 "" Dose 1 Dose 2 "" Dose 1 Dose 2 Infection "" "" "" E. acervulina infection J7 E. acervulina infection J14 Number of animals n = 22 22 22 25 25 25 25 25 25 Sacrifice J14 6 6 6 15 15 15 Sacrifice J21 6 6 6 15 15 15 Sacrifice J35 10 10 10 10 10 10 10 10 10

The weight of each individual was measured three times a week. One week after each infection time, D7 or D14, 15 to 18 animals per group were sacrificed and a macroscopic score for lesion of the duodenal handles was assigned.

Results

Weight gain

A decrease in weight gain in non-immunostimulated animals by 24.20% and 36.33% was observed after infection with Eimeria acervulina on D7 or D14 respectively (*, p <0.05, Figure 19).

For animals infected on D7, immunostimulation at 10 ³ or 10 ⁵ tachyzoites / animal has a moderate and not statistically significant effect on the weight loss induced by Eimeria acervulina (ns, p> 0.05, FIG. 19) and on the speed growth rate of animals (p> 0.05, Figure 19E).

For the animals infected on D14 at the dose 10 ³ tachyzoites per animal, a non-significant increase in weight, reaching 13.5% on D35, was observed (ns, p> 0.05, FIG. 19 D) compared to the control group (DMEM) . The immunostimulated animals at a dose of 10 ⁵ showed a significant significant increase in weight from D28 (*, p <0.05, FIG. 19 D), reaching a 29.4% increase on D35 (****, p <0.001 , Figure 19 D) compared to infected control animals. A significant difference in weight and growth is clearly observable at D35 between the groups. Indeed, at D35, the weight of animals immunostimulated with 10 ⁵ tachyzoites is significantly increased by 13.78% compared to that of animals immunostimulated with 10 ³ tachyzoites (*, p <0.05).

The weight loss recorded in the immunostimulated 10 ⁵ tachyzoite group is only 17.46%, or a relative efficiency of 51.9%. As of D21, this clinical improvement is accompanied by a significant increase in the average daily gain which is more directly linked to the general condition of the animal (Figure 19 EF). Infection on D14 caused an average daily gain loss of 54.60% on D30 in the absence of immunostimulation and only 22.05% in immunostimulated animals, ie a relative efficacy of 59.60% (data not shown). These data show a better clinical state of the immunostimulated animals compared to the control animals.

Lesion score

In Figure 20 is shown the injury score obtained for each of the groups. The lesional severity of the infection appears to be higher in animals infected on D14 compared to animals infected on D7. At the two doses tested and at the two times tested, there was no significant difference between the immunostimulated and control groups (FIG. 20).

Immune response analysis

The objective of immunostimulation is to introduce a bias into the natural response of the host organism to maximize an inflammatory, humoral or cellular response directed against a third infectious agent, here, Eimeria acervulina.

The humoral response directed against Eimeria acervulina (tachyzoites) was estimated by the assay of antibodies of subclass IgY (IgG) in the serum. Antibodies of the IgY antiEimeria type are detectable from 28 days post-infection. The titers obtained in the animals preserved until D35 are presented in FIG. 21. No difference between the groups was observed in the animals infected on D7. In addition, the antibody titer in animals infected on D14 is not increased by immunostimulation. The effectiveness of the product is therefore not linked to a humoral response.

The immune response against Toxo KO + 2G has been evaluated to confirm an activation of an immune response induced by the administration of the immunostimulatory dose. As expected, the antibody titers are almost damaged before D21. For the animals sacrificed on D21 and D35, the production of antibodies depends on the dose and on the duration of post-immunostimulation (FIG. 21). This dose effect and the antibody titer directed against Toxo KO + 2G are not affected by inoculation with Eimeria acervulina.

Conclusion

The aim of this experiment was to verify whether immunostimulation of chicks at 1 day of age made it possible to improve the clinical condition and performance of animals subjected to an experimental infection with Eimeria acervulina, one of the agents of avian coccidiosis taken here as an example of a parasitic agent. The results clearly demonstrated a significant and significant reduction in weight loss observed during an experimental episode of avian coccidiosis. Since the immunostimulation strategy is not specific to a given pathogen, similar results can be obtained with the Toxo-KO + 2G strain vis-à-vis other parasitic agents.

EXAMPLE 11 Efficacy of the Toxo tgmicl-3 KO strain roplôKO Gral5IIKI (denoted Toxo KO + 2G) with regard to the carrying of Salmonella enteritidis in hens

The objective of this experiment is to determine whether immunostimulation with the Toxo KO + 2G strain makes it possible to limit intestinal carriage and the systemic spread of Salmonella enteritidis in chickens.

Material and method

Toxo KO + 2G parasite production

The Toxo KO + 2G strain, obtained in Example 5, is maintained by successive passages on a line of human foreskin fibroblasts (HFF) cultivated in DMEM medium to which is added 10% decomplemented fetal calf serum, 2mM glutamine, 100 U / mL of penicillin and 100 U / mL of streptomycin. The tachyzoites were concentrated and washed by centrifugation at 900 g for 5 minutes at room temperature. After resuspension in a DMEM solution, they were counted in a Malassez cell and diluted to 1.10 ⁶ tachyzoites per milliliter. Their viability was evaluated by flow cytometry (MACS Quant 10, Miltenyi) and was calculated as the frequency of the number of tachyzoites not incorporating Propidium iodide (P4864-10ML, Sigma-Aldrich) compared to the number of total tachyzoites. The viability of the tachyzoites used in this experiment is 87.2% for the tachyzoites used fresh and 86.3% for the tachyzoites intended for lyophilization.

After freeze-drying, the vials were sealed in vacuo before being returned to atmospheric pressure. The vials were then sealed via the addition of an aluminum capsule, then stored at + 4 ° C until the day of immunizations.

Production of the bacterial strain of Salmonella enteritidis

The animals were infected with 2.27 × 10 ⁴ CFU (Colony Forming Unit) of Salmonella enteritidis strain 775 resistant to 20 pg / ml of nalidixic acid and to 500 pg / ml of streptomycin. This strain is the result of a spontaneous mutation of the LA5 strain resistant only to nalidixic acid (Allen-Vercoe et al., 1997, FEMS Microbiol Lett. 153: 33). It was cultured in vitro, amplified and cryopreserved at -80 ° C (Lot of January 28, 2016, INRA Nouzilly).

Animals

A total of 170 newborn White leghom PA12 chicks are included in the study and housed in a class II containment room.

The chicks were identified individually and randomized into 8 groups. The number of animals per group, the sacrifice times and the characteristics specific to each of these groups are shown in Table 20 below. On the same day, the animals were immunostimulated with 10 ⁵ fresh tachyzoites or 10 ⁷ lyophilized tachyzoites in a volume of 100 μl of DMEM injected subcutaneously. On day 14 of the experiment, at 7 or 14 days of age, the animals were inoculated at the level of the crop (per os) with 200 μl of solution containing 2.27 × 10 ⁴ CFU of Salmonella enteritidis. They were then followed for 1 to 4 weeks post-infection, and sacrificed in kinetics at different times, as described in the table below.

Table 20: Distribution of animals, treatment and description of the groups

Fees s.c. Fees s.c. Lyoph s.c. Lyoph s.c. Name of the group AT B VS D E F G H Day 1 DMEM Toxo- KO + 2G F4 Toxo- KO + 2G Day 7 DMEM Toxo- KO + 2G F4 Toxo- KO + 2G Day 14 Salmonella infection Sacrifice J22 10 10 5 5 Sacrifice J29 10 10 10 10 5 5 Sacrifice J36 10 10 10 10 Sacrifice J43 10 10 5 5 Sacrifice J48 10 10

At the times indicated, the animals were euthanized. The caeca were removed under sterile conditions. The blood was drawn intracardiacly to obtain serum thereafter. The caeca were sterile isolated and weighed individually. After grinding, the matrices are diluted in series in PBS and spread on Salmonella / Shigella agar plates (SS medium) containing 500 μg / ml of streptomycin. After an overnight incubation at 37 ° C, the colonies were counted and the count was related to the weight of the organ to determine the value of CFU per gram of organ.

Results

Mortality and clinical signs

Salmonella enteritidis infection and immunostimulation with the Toxo tgmicl-3 strain

KO rop 16 KO gral5n Kl did not induce toxicity, major clinical sign or specific mortality in chickens.

The weight of each animal was measured once a week until euthanasia and was shown in Figures 22 A-D. Animals immunostimulated 7 days before infection with fresh parasites (group D) have a similar weight and growth to control animals of the same group (group C). In the other cases, a small but significant difference in weight is observed between the control animals (DMEM or F4) and the immunostimulated animals (Fresh or Lyophilized), in particular when the infection is carried out 14 days after the immunostimulation (Figures 22 BD ). To a lesser extent, this difference is found in animals infected with fresh or freeze-dried parasites compared to the control condition, when the infection took place 7 days after immunostimulation (Figure 22.C). Taken as a whole, the immunostimulated groups have a weight equal to or greater than the weight found in non-immunostimulated animals demonstrating the absence of a harmful effect or a positive effect on the growth of animals infected with ES.

Portage of Salmonella in caeca

Chronic carriage in the intestine is the primary endpoint of the study. It models the risk of contamination from faecal origin in meats and eggs. The carriage of salmonella was studied 1, 2, 3 and 4 weeks post-infection on immunostimulated groups in fresh or freeze-dried form and on the corresponding control groups (FIG. 23). One week after infection, no significant difference was demonstrated between the immunostimulated or control groups, whether with an Immunostimulation with fresh or lyophilized tachyzoites (Figures 23 A-C). Conversely, a significant decrease from 96 to 99.9% in the number of salmonella per gram of organ was observed in the immunostimulated groups (Fresh or Freeze-dried, groups B, D, F, H) compared to the control groups (DMEM or F4, groups A, C, E, G) from the second to the fourth week post-infection.

Titration of antibodies to Toxo KO + 2G

The serum titers of IgY type antibodies directed against Toxo KO + 2G were measured by ELISA on the sera taken on the day of the autopsies. The titrations are represented in FIG. 23. A clear difference can be observed between the control groups (DMEM) and the immunostimulated groups with fresh parasites, from the third week post-immunostimulation (FIGS. 23 AB), demonstrating an immune response directed against strain administered fresh. Conversely, the antibody titer is very low or zero, when the strain is administered in the lyophilized form. Thus, no significant difference is observable between the F4 control groups and the groups immunostimulated with lyophilized tachyzoites (FIGS. 23 C-D).

Conclusion

In this experiment, the potential of the Toxo KO + 2G strain as a preventive agent to reduce the carry of salmonella was tested in chicken. Whatever the formulation used, fresh or freeze-dried, the administration of the Toxo KO + 2G strain significantly limits the carrying of salmonella between 96 and 99.9% in caeca. Since the immunostimulation strategy is not specific to a given pathogen, similar results can be obtained with the Toxo-KO + 2G strain vis-à-vis other bacterial agents.

Example 12 Effectiveness of the Toxo tgmicl-3 KO roplô KO Gral5II Kl strain (noted Toxo KO + 2G) in preventing avian influenza

The objective of this experiment is to determine whether immunostimulation with the Toxo-KO + 2G strain as obtained in example 5 makes it possible to limit the severity of an experimental infection with the Influenza H7N1 virus in domestic hens.

Material and method

Toxo KO + 2G parasite production

The Toxo KO + 2G strain is maintained by successive passages on a line of human foreskin fibroblasts (HFF) cultivated in DMEM medium to which is added 10% of decomplemented fetal calf serum, 2mM glutamine, 100 U / ml of penicillin and 100 U / mL streptomycin. The tachyzoites were concentrated and washed by centrifugation at 900 g for 5 minutes at room temperature. After resuspension in a DMEM solution, they were counted in a Malassez cell and diluted to 1.10 ⁶ tachyzoites per milliliter. Their viability was assessed by flow cytometry (MACS Quant 10, Miltenyi) and was calculated as the frequency of the number of tachyzoites not incorporating Propidium iodide (P4864-10ML, Sigma-Aldrich) compared to the number of total tachyzoites. The viability of the tachyzoites used in this experiment was 82.7%.

Production of H7N1 Inocula

The H7N1 viral strain used in this experiment was derived from the 1999 avian flu epidemic in northern Italy (A / Turkey / Italy / 977/1999). Despite its classification among the “Low pathogenic” strains, it is admitted that it is of moderate virulence in the domestic hen, in particular in the B13 laying hen line (Deletion of the C-terminal ESEV domain of NSI does not affect the replication of a low-pathogenic avian influenza virus H7N1 in ducks and chickens. Soubies SM, et al., J Gen Virol. 2013 Jan; 94 (Pt 1): 50-8. doi: 10.1099 / vir.0.045153-0 - PMID: 23052391) (Length variations in the NA stalk of an H7N1 influenza virus hâve opposite effects on viral excrétion in chickens and ducks.

Hoffmann TW, et al., J Virol. 2012 Jan; 86 (l): 584-8. doi: 10.1128 / JVI.05474-11. PMID:

22013034), (Soubies et al, J. Gen. Virol, 2013; Hoffmann et al., J. Virol, 2012).

The batches used for the infection were prepared by successive passages on embryonated chicken eggs as described by Brauer in 2015 (Influenza virus propagation in embryonated chicken eggs. Brauer et al., J Vis Exp. 2015 Mar 19; (97). doi: 10.3791 / 52421). They were then titrated by the Reed method described in 1938 (Reed et al., Am. J. Epidemiol., 1938). The titration is calculated as the dose required to infect 50% of embryonated chicken eggs (EID50).

Animals

A total of 96 newborn White leghorn PA12 chicks were included in the study. They were housed in an isolator in order to preserve the SPF status.

The day after their arrival, the animals were identified individually. They were then immunostimulated subcutaneously at a dose of 10 ⁵ fresh tachyzoites of Toxo-KO + 2G suspended in a volume of 100 μl of DMEM. A similar volume of DMEM was used for animals from the non-immunostimulated groups. In accordance with the standard description of the model, after 20 days post-hatching, a series of animals was transferred to a category 3 containment isolator. They were then infected with the influenza virus type H7N1 intratracheally. the dose of 2.10 ⁵ EID50. PBS inoculation was used as a control. The animals were then followed for 4 days, euthanized, then autopsied. To measure whether the effect is dependent on age or postimmunostimulation duration, additional groups of animals were also infected at 6 and 13 days post-hatch.

The distribution of animals, the times of sacrifice and the characteristics specific to each of these groups are shown in Table 21.

Table 21: Distribution of animals, treatment and description of the groups

Name of the group Number of animals n = immunostimulatory Infection Day of infection Sacrifice day AT 6 - - D6 D10 B 6 - LD VS 6 - HD I 6 10 ⁵ tachyzoites - J 6 10 ⁵ tachyzoites LD K 6 10 ⁵ tachyzoites HD D 6 - - D13 D17 E 6 - LD F 6 - HD The 6 10 ⁵ tachyzoites - M 6 10 ⁵ tachyzoites LD NOT 6 10 ⁵ tachyzoites HD G 6 - - D20 D24 H 6 - LD 0 6 10 ⁵ tachyzoites - P 6 10 ⁵ tachyzoites LD

Four days after infection, a 200 μL blood sample was taken from the occipital sinus and the serum was prepared. During the autopsy, all gross lesions present on the vital organs were noted. Three lung samples were taken for histopathological pulmonary analysis. Two samples of approximately 50 mg were taken from the pulmonary and renal parenchyma.

The samples from the oropharyngeal swabs were resuspended in 1 ml PBS. The vRNA was extracted in accordance with the instructions of the QiaAmp Viral RNA mini kit (Qiagen) from 140 μL of cell suspension.

For samples from the spleen and kidney, 50 mg of tissue were transferred into 1 ml of PBS and mechanically dissociated using a grinder (Retsch). The total RNAs were extracted according to Tappendix D from the reference protocol of the RNEasy Mini Kit plus kit (Qiagen).

The quantification of the mRNAs of the M segment of the genome were assayed by RT-qPCR in a single step respecting the instructions of the kit “Superscript III platinum SYBR green” (Bio-Rad). The samples were analyzed in triplicate on a Chromo-5 thermocyler (Bio-Rad). The sequence of the primer pairs targeting the M segment as well as the qRT-PCR conditions have been described previously (A genetically engineered waterfowl influenza virus with a deletion in the stalk of the neuraminidase has increased virulence for chickens. Munier S. et al ., J Virol. 2010 Jan; 84 (2): 940-52. Doi: 10.1128 / JVI.01581-09).

Assay of pro-inflammatory cytokines

The pro-inflammatory cytokines were assayed by RT-qPCR two steps from RNAs previously extracted from the spleen and the kidney. Briefly, the RNAs were transcribed from the poly-T primer by mMLV-RT (Invitrogen) in accordance with the manufacturer's instructions. Cytokine expression was measured by qPCR according to the supplier's recommendations (Bio-Rad). The details of the primers and of the PCR cycles are described for each target studied in Table 18.

Results

Clinical signs and mortality

The general condition of the animals was monitored from hatching to sacrifice. No animal has shown any impairment or loss of weight until the time of infection with the H7N1 virus.

At the three infection ages, D6, D13 and D20, the animals were infected with the H7N1 virus and were followed for 4 days (Table 22). The animals in the control groups were inoculated with an equivalent volume of PBS. There were no clinical signs or mortality in the latter.

In the non-immunostimulated groups, infection at 20 days of age at a dose of 5.10 ⁵ EID50 induced a mortality compatible with the expectations of the model, ie approximately 67% (Table 22). However, no significant difference in mortality was observed between the immunostimulated and non-immunostimulated groups (Table 22).

At other ages of infection, on D6 and D13, no data on the sensitivity of the animals towards the H7N1 virus was available before this experiment. This is why two doses of infection were tested. The animals infected on D6 were inoculated at the dose of 2.10 ⁵ EID50 and 2.5.10 ⁶ EID50 of H7N1 virus. For the two doses tested, the acceptable level of severity of the model was not reached and no mortality was observed (Table 22). The animals infected on D13 were inoculated at doses of 2.10 ⁵ EID50 and 1.25.10 ⁷ EID50 of H7N1 virus. For low dose infected animals, 50% mortality was observed in the immunostimulated and non-immunostimulated groups. Surprisingly, animals infected at a dose 50 times higher showed less significant clinical signs. In these groups mortality remained zero regardless of the animals' immunization status (Table 22).

Table 22: Mortality of animals post-infection with the H7N1 virus

J6 J13 J20 Not immunostimulated 10 ⁵ tachyzoites Not immunostimulated 10 ⁵ tachyzoites Not immunostimulated 10 ⁵ tachyzoites Low dose infection Living 6 6 3 3 4 4 dead 0 0 3 3 2 2 Survival (%) 100% 100% 50% 50% 67% 67% High dose infection Living 6 6 6 6 dead 0 0 0 0 Survival (%) 100% 100% 100% 100%

The modeling objectives for avian influenza, in terms of mortality and the appearance of clinical signs, were achieved when the virus was inoculated in 13 and 20 day old animals at the low dose. On the other hand, an earlier infection or a higher dose infection did not induce mortality and major clinical signs demonstrating partial modeling of avian influenza and better resistance in young animals. However, this resistance is not always associated with better elimination of the virus. Viral titers were therefore determined in all animals regardless of the age of infection.

Viral titles

Viral titers were estimated in all animals by RT-qPCR in the target organ of the infection, the lung, in orotracheal excretions and at a systemic level in the renal parenchyma (Figure 25). The virus could not be detected in the uninfected control groups (data not shown).

In the groups infected on D6 and D13, no major or significant difference was observed between immunostimulated and non-immunostimulated animals at low doses (figures

25A-B). For these same infection times, viral titers were not increased by an increase in the dose of infection. Oddly enough, they are rather reduced. For animals infected on D13 at high doses, despite the lower level of infection, the viral titer in the immunostimulated groups seems slightly lower than that present in the non-immunostimulated groups. However, due to the number of animals per group, it is not possible to determine whether this difference is biologically significant or whether it is derived from random observation.

For the animals infected on D20, a clear and significant decrease in the viral titer is observed in the orotracheal excretions in the immunostimulated groups compared to the non-immunostimulated control group. This decrease is expressed by a lower number of animals shedding the virus, as well as by a quantitative decrease in viral titer in non-immunostimulated animals. In these groups, a decrease in viral load of more than 92% is observed in all the organs tested (Figure 25C). The decrease in viral titers in the lungs and kidneys therefore corroborates these observations in the swabs and supports the hypothesis of a protective effect of immunostimulation on the viral load of chickens infected on D20.

Induction of an IFN-β response by Toxo-KO + 2G

In the context of avian influenza, the aim of immunostimulation is to prepare the innate immune system to improve detection of the virus, to limit the sensitivity of host cells or ultimately to better fight the infection. During an MDA5 infection identifies viral RNAs and signals the presence of the danger. The cytokine IFN- / 3 is a major player in this signaling. It activates target cells by inducing the expression of a battery of genes involved in the antiviral response.

The expression of FIFN- / 3 and MDA5 was assessed in the lung tissue of all animals included in the study. The expression of FIFN- / 3 in immunostimulated animals is strongly induced on D17 in the absence of infection. Regardless of the age of the animals, infection with the H7N1 virus appears to induce the expression of IFN-beta (Figures 26A and 26B). This induced expression of FIFN- / 3 appears to be maximized by immunostimulation. Thus, at D10 and D23, the expression of IFN-beta in animals only infected with the H7N1 virus is relatively weak and the immunostimulation seems to increase the expression of this cytokine (FIGS. 26A and 26B). At D17, infection with H7N1 already greatly increases the expression of MDA5. In this case, immunostimulation does not alter the expression of the receptor. This was even already induced by immunostimulation alone in the absence of infection.

The same response profile is observed for the expression of the MDA5 receptor. Toxo-KO + 2G induces expression on D17 in the absence of infection (Figures 26A and 26B). In addition, the expression of MDA5 is maximized by immunostimulation from D10 and D23 in animals infected with the H7N1 virus (FIGS. 26A and 26B).

Immunostimulation with JT injection of Toxo-KO + 2G appears to activate the immune system and promote an innate antiviral response dependent on 1 ’IFN- / 3.

Conclusion

The objective of this experiment was to test whether immunostimulation with Toxo-KO + 2G could strengthen the immunity of chickens and help them to fight against an experimental infection with the avian H7N1 strain. This strain is frequently used as a standard infection model. It has the advantage of being moderately virulent, of inducing 50% mortality in chicken and of making it possible to study the effectiveness of a therapeutic solution. The aim of prophylaxis against avian influenza is not necessarily to prevent an individual clinical effect, such as mortality, but rather to limit the spread of the virus as much as possible and therefore to reduce the viral titer in the excretions of the virus. the animal. Infection on D20 with 5.10 ⁵ EID50 of virus inoculated by the intratracheal route induces a mortality of 67% in the control groups. Under these conditions, a significant difference in viral load was measured between the control and immunostimulated groups. The importance of this difference is reinforced by the presence after immunostimulation of a TIFN-Z> response, a key player in the antiviral response. Taken together, these results suggest that Toxo-KO + 2G has a protective action against the avian influenza virus H7N1, even if this protection does not seem to be effective until D20 and that it has not been possible to highlight a significant difference in mortality.

Since the immunostimulation strategy is not specific to a given pathogen, similar results can be obtained with the Toxo-KO + 2G strain vis-à-vis other viral agents.

Claims (12)

1. Mutant strain of Sarcocystidae in which the function of the protein MIC 1 and the function of the protein MIC3 are suppressed, for its use in the prevention of infectious diseases in poultry; said function of the MIC3 protein being suppressed by: a mutation, a deletion or an insertion of one or more nucleotides in the nucleotide sequence of the mic3 gene coding for the MIC3 protein, or the total deletion of the mic3 gene, or the total or partial deletion of the promoter region and / or the deletion total or partial coding sequence of the mic3 gene, or a destabilization of the messenger RNA resulting from the transcription of the mic3 gene, or an inhibition of the translation of the messenger RNA of the mic 3 gene; and said function of the MIC1 protein being suppressed by: a mutation, a deletion or an insertion of one or more nucleotides in the nucleotide sequence of the honey gene coding for the MIC1 protein, or the total deletion of the honey gene, or the total or partial deletion of the promoter region and / or the deletion total or partial of the coding sequence of the honey gene, or - a destabilization of the messenger RNA resulting from the transcription of the honey gene, or an inhibition of the translation of the messenger RNA of the honey gene. 2. Mutant strain of Sarcocystidae in which the function of the protein MIC 1 and the function of the protein MIC3 are suppressed, for its use according to claim 1, said mutant strain of Sarcocystidae being formulated for administration in ovo or in a chick of poultry aged 0 to 72 hours. 3. Mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use according to claim 1 or 2, said infectious disease being a disease of viral origin or a disease of origin bacterial or parasitic disease. 4. Mutant strain of Sarcocystidae in which the function of the protein MIC 1 and the function of the protein MIC3 are suppressed, for its use according to one of claims 1 to 3, said infectious disease being a disease of viral origin, in in particular avian flu, or a disease of bacterial origin, in particular salmonellosis, or a disease of parasitic origin, in particular coccidiosis. 5. Mutant strain of Sarcocystidae in which the function of the protein MIC1 and the function of the protein MIC3 are suppressed, for its use according to one of claims 1 to 4, said mutant strain being a strain of Toxoplasma spp., In particular of Toxoplasma gondii. 6. Mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use according to one of claims 1 to 4, said mutant strain being a strain of Neospora spp., In particular of Neospora caninum. 7. Mutant strain of Sarcocystidae in which the function of the MIC1 protein and the function of the MIC3 protein are suppressed, for its use according to one of claims 1 to 5, wherein said mutant strain is a mutant strain of Toxoplasma spp. , and in which the function of the protein ROP 161 coded by the ropl 61 gene is deleted and / or said strain comprises at least one nucleic acid coding for the protein GRA15II as well as the means necessary for the expression of said protein, said function ROP 161 protein being deleted by: - a mutation, deletion or insertion of one or more nucleotides in the nucleotide sequence of the roplôl gene coding for the protein ROP 161, or - the total deletion of the roplôl gene, or - total or partial deletion of the promoter region and / or total or partial deletion of the coding sequence of the roplôl gene, or, - destabilization of the messenger RNA resulting from transcription of the roplôZ gene, or - inhibition of the translation of the messenger RNA of the roplôl gene. 8. Mutant strain of Sarcocystidae in which the function of the protein MIC 1 and the function of the protein MIC3 are suppressed, for its use according to one of claims 1 to 5, said mutant strain being a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic 3 gene and the function of the MIC1 protein is suppressed by a total deletion of the honey gene. 9. Mutant strain of Sarcocystidae in which the function of the protein MIC 1 and the function of the protein MIC3 are suppressed, for its use according to claim 7, said mutant strain being chosen from: a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, said strain comprises a nucleic acid encoding the GRA15II protein as well as the means necessary for the expression of said protein, - a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, the function of the ROP161 protein encoded by the roplôlest gene suppressed by a complete deletion of said roplôl gene, - a mutant strain of Toxoplasma gondii in which the function of the MIC3 protein is suppressed by a total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by a total deletion of the honey gene, the function of the ROP16I protein encoded by the roplôl gene is deleted by a total deletion of said roplôl gene and said strain comprises a nucleic acid coding for the GRA15II protein as well as the means necessary for the expression of said protein. 10. Mutant strain of Sarcocystidae in which the function of the protein MIC1 and the function of the protein MIC3 are suppressed, for its use according to one of claims 1 to 4 and 6, said mutant strain being a strain of Neospora caninum in which the function of the MIC3 protein is suppressed by a total deletion of the mic 3 gene and the function of the MIC1 protein is suppressed by a total deletion of the honey gene. 11. Mutant strain of Sarcocystidae in which said mutant strain is a mutant strain of Toxoplasma gondii, in which the function of the protein MIC1, the function of the protein MIC 3 are deleted, and the function of the protein ROP161 encoded by the roplôl gene is deleted and / or said strain comprises a nucleic acid coding for the GRA15II protein as well as the means necessary for the expression of said protein, in which the function of the MIC3 protein is deleted by: a mutation, a deletion or an insertion of one or more nucleotides in the nucleotide sequence of the mic 3 gene coding for the MIC3 protein, or the total deletion of the mic3 gene, or the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the mic3 gene, or - destabilization of the messenger RNA resulting from the transcription of the mic3 gene, or - inhibition of the translation of the messenger RNA of the mic 3 gene; and the function of the MIC1 protein is suppressed by: a mutation, a deletion or an insertion of one or more nucleotides in the nucleotide sequence of the honey gene coding for the MIC1 protein, or the total deletion of the honey gene, or the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the honey gene, or - destabilization of the messenger RNA resulting from the transcription of the honey gene, or - inhibition of the translation of the messenger RNA of the honey gene; and in which the function of the protein ROP 161 is suppressed by: - a mutation, deletion or insertion of one or more nucleotides in the nucleotide sequence of the roplôl gene coding for the protein ROP16I, or - the total deletion of the roplôl gene, or - the total or partial deletion of the promoter region and / or the total or partial deletion of the coding sequence of the roplôl gene, or - a destabilization of the messenger RNA resulting from the transcription of the roplôl gene, or - inhibition of the translation of the messenger RNA of the roplôl gene. in particular said strain being a Toxoplasma gondii strain in which the function of the MIC3 protein is suppressed by total deletion of the mic3 gene, the function of the MIC1 protein is suppressed by total deletion of the honey gene, and the function of the ROP16I protein is suppressed by total deletion of the roplôl gene and said strain comprises a nucleic acid coding for the GRA15II protein, as well as the means necessary for the expression of said protein. 12. Composition comprising at least one of the mutant strains of Sarcocystidae according to claim 11, for its use as a medicament.