FR3063657A1 - SILICA ALVEOLAR BALLS, PROCESS FOR THEIR PREPARATION, USE AS BIOCATALYSTS, BIOCATALYSIS PROCESS USING SAID BALLS, OTHER USES - Google Patents

Abstract

The invention relates to a cellular alveolar ball comprising a core containing a hierarchically porous silica foam and microorganisms having a catalytic activity (eg bacteria) dispersed in said foam, and a porous solid silica envelope surrounding said core, its method of preparation, the use of said ball as a heterogeneous biocatalyst, a biocatalyst process employing said at least one ball, a catalyst system comprising beads having different microorganisms, and the uses of said ball for the production of energy , the reduction of contaminants and the production of recombinant proteins.

Description

Holder (s): NATIONAL CENTER FOR SCIENTIFIC RESEARCH Public establishment, UNIVERSITY OF BORDEAUX Public establishment.

Extension request (s)

Agent (s): IPSILON Simplified joint-stock company.

ALVEOLAR SILICA BEADS, PREPARATION PROCESS, USE AS BIOCATALYSTS, BIOCATALYSIS PROCESS USING THE SAME, OTHER USES.

FR 3,063,657 - A1 (5d) The invention relates to a cellular silica ball comprising a core containing a silica foam with hierarchical porosity and microorganisms endowed with a catalytic activity (eg bacteria) dispersed in said foam, and an envelope solid porous silica surrounding said core, its preparation process, the use of said ball as a heterogeneous biocatalyst, a biocatalysis process using said at least one ball, a catalytic system comprising beads having different microorganisms, and the uses of said bead for energy production, reduction of contaminants and production of recombinant proteins.

i

ALVEOLAR SILICA BEADS, PREPARATION METHOD, USE AS BIOCATALYSTS, BIOCATALYSIS PROCESS USING THE SAME, OTHER USES

The invention relates to a cellular silica ball comprising a core containing a silica foam with hierarchical porosity and microorganisms endowed with a catalytic activity (eg bacteria) dispersed in said foam, and a solid porous envelope of silica surrounding said core, its preparation process, the use of said ball as a heterogeneous biocatalyst, a biocatalysis process using said at least one ball, a catalytic system comprising beads having different microorganisms, and the uses of said ball for energy production , reduction of contaminants and production of recombinant proteins.

The invention typically applies, but not exclusively to the field of biotechnology, in particular to the use of supports immobilizing microorganisms (yeasts, bacteria, microscopic fungi, algae), animal or plant cells, as biocatalysts.

It is notably known to encapsulate bacteria in organic polymers, inorganic materials or organic-inorganic hybrid materials.

As examples of inorganic materials, mention may be made of silica gels, and in particular those described in Coiffier et al. [J. Mater. Chem., 2001, 8, 2039-2044]. However, the free volume around the bacteria encapsulated in these gels is insufficient to allow them to divide and proliferate. Furthermore, silica gels are known to have insufficient mechanical properties.

In order to remedy these problems, Depardieu et al. [J. Mater. Chem. B, 2016, 4, 2290-2303] described the encapsulation and proliferation of bacteria in a silica foam obtained by polyHIPE methodology (High Internai Phase Emulsion). However, although these foams allow the colonization of bacteria, they are not adapted to allow their containment. In particular, the bacteria encapsulated in the foam diffuse outside said foam, making it difficult to use as a biocatalytic support which can in particular be recycled.

Furthermore, international application WO2014 / 206819 describes an organic-inorganic hybrid material in the form of millimeter beads containing a porous core of silica and alginate and a porous envelope containing silica and a polycationic organic polymer such as chloride poly (diallyldimethylammonium). These beads may contain entities of biological origin. International application WO2014 / 206819 also describes the use of these beads encapsulating a microalga to produce oxygen by photochemical route. These beads may be damaged and / or not be adapted to be able to maintain continuous growth of the entities of biological origin within the beads, depending on the type of entity used. In particular, bacteria can degrade the alginate of the beads and / or have limited growth due to the elasticity of the alginate.

The object of the present invention is to overcome all or part of the aforementioned drawbacks, and in particular to provide a material which can be used as a biocatalyst and which has good catalytic performance in terms of efficiency and recycling.

The first object of the invention is therefore a cellular silica ball, characterized in that it comprises:

a core containing a silica foam with hierarchical porosity and microorganisms dispersed in said foam, and

a solid porous envelope of silica surrounding said core, said microorganisms being endowed with catalytic activity.

The catalytic activity of a microorganism is the property measured by the increase in the conversion rate (i.e. the speed of the reaction multiplied by the volume) of a given chemical reaction catalyzed by the microorganism.

In one embodiment, the silica foam represents an inorganic matrix constituted by a silicon oxide or a mixed oxide of silicon and at least one metal M chosen from Ti, Zr, Th, Sn, B, Nb, Ta, Al, V and W.

In the present invention, the expression “silica foam with hierarchical porosity” means that the silica foam comprises macropores (diameter greater than about 50 nm), mesopores (diameter between 2 and 50 nm approximately (limits included)) and micropores (diameter less than about 2 nm).

According to one embodiment of the invention, the silica foam preferably comprises macropores having an average dimension d _A of 0.5 pm to 100 pm, and preferably from 1 pm to 60 pm, mesopores having an average dimension d _E from 2 to 50 nm, and preferably from 20 to 50 Å, and micropores having an average dide size 5 to 15 Å, and preferably from 7 to 10 Å, said pores being interconnected.

Macropores can be identified by scanning electron microscopy (SEM) and quantified by mercury intrusion measurements.

Mesoporosity can be identified by scanning electron microscopy (SEM). The vermicular texture of mesoporosity can be identified by X-ray diffraction (RX), this technique also used to quantify the pore-to-pore distance. Mesoporosity and microporosity can be quantified and segregated by a nitrogen adsorption-desorption technique, which is analyzed using the B.E.T. (globalizing mesoporosity and microporosity) and by the B.J.H. that segregation between microporosity and mesoporosity becomes effective.

The microorganisms encapsulated in the alveolar silica bead can be chosen from bacteria, yeasts, microalgae, viruses, spores and fungi, and preferably from bacteria.

Microorganisms, and in particular bacteria, can pass from pore to pore through the interconnections and develop colonies within the silica foam. Preferably, at the local level, the microorganisms take place on the walls of the pores and enlarge until filling all the space available in the porosity.

Microorganisms can remain confined in the foam for at least 2 weeks. They can also proliferate / colonize without losing their catalytic activity. The solid porous silica envelope is therefore suitable for preventing the diffusion of microorganisms outside the beads, while being sufficiently permeable to allow catalytic activity.

The cellular silica ball as defined in the invention, and in particular the microorganisms contained in the ball, can catalyze chemical reactions in the liquid phase.

Examples of bacteria include E. Coli bacteria with catalytic activity, in particular those overexpressing Lasparaginase or aspartate oxidase or cyanobacteria with catalytic activity.

The thickness of the solid porous silica shell is preferably between 2 and 12 μm approximately, and more preferably between 5 and 10 μm (limits included).

The solid porous silica envelope has a specific surface by the BET method ranging from approximately 60 to 70 m ² / g.

The solid porous silica envelope comprises mesopores, in particular of average size between 2 and 20 nm approximately, and preferably of average size between 2 and 10 nm approximately (limits included).

The alveolar ball of silica is preferably spherical (imprint of the shape of the drops which served them as a mold: cf. process described below).

It generally has an average diameter of between 1 and 6 mm approximately, and more preferably between 1 and 2 mm (terminals included).

The second object of the invention is a process for the preparation of cellular silica beads in accordance with the first subject of the invention (combining sol-gel chemistry and a concentrated emulsion), characterized in that it comprises the following steps:

i) an acidic aqueous solution is prepared containing a surfactant TAi and at least one silicon alkoxide precursor of the silicon oxide forming the silica foam, ii) an emulsion is prepared by introducing a first oily phase into the acidic aqueous solution of step i);

iii) the emulsion of step ii) is added dropwise in a second oily phase and the resulting mixture is left at room temperature for at least 24 hours to form a silica foam with hierarchical porosity in the form of beads, iv ) the beads are washed,

v) calcining the beads, vi) incubating microorganisms with catalytic activity in the beads of step v) and colonizing them to form a silica foam core with hierarchical porosity in which the microorganisms with a catalytic activity are dispersed, and vii) a solid porous envelope of silica is formed surrounding said core.

The acidic aqueous solution of the silicon oxide precursor of step i) contains at least one silicon alkoxide which is the precursor of the silicon oxide. When the silica foam represents an inorganic matrix constituted by a mixed silicon oxide, a mixture of precursors is used, at least one of which is a silicon alkoxide precursor of silicon oxide and the other is an alkoxide or a non-alkoxide of a metal M as defined in the invention.

As examples of silicon alkoxides, mention may be made of the compounds R'n (OR.) _M -nSi in which Si has the valence m, 0 <n <m, R represents an alkyl radical having from 1 to 5 carbon atoms , R. ' represents an alkyl radical or an aryl radical which optionally carries one or more functional groups. We can cite for example Si (OR) ₄ . The alkoxides in which R is methyl or ethyl are particularly preferred.

As examples of metal alkoxides M, mention may be made of the compounds R'n (OR) m-nM in which M represents a metal having the valence m, 0 <n <m, R represents an alkyl radical having from 1 to 5 carbon atoms, R 'represents an alkyl radical or an aryl radical which optionally carries one or more functional groups. One can quote for example Ti (OR) ₄ , Zr (OR) ₄ , Th (OR) ₄ , Nb (OR) ₅ , Ta (OR) ₅ and AI (OR) ₃ . Mention may also be made of the compounds VO (OR) ₃ and W (0R) ₆ . The alkoxides in which R is methyl or ethyl are particularly preferred.

The non-alkoxide metal precursors M can be chosen from hydroxides such as AI (OH) ₃ , oxides such as B ₂ O ₃ or V ₂ O ₅ , chlorides such as SnCI ₄ , ZrCI ₄ or TiCI ₄ , oxychlorides such as ZrOCI ₂ .2H ₂ O, and mixed oxides such as sodium metavanadate.

For example, a silica foam is obtained from an acidic aqueous solution of an alkoxide R ' _n (OR) ₄ - _n Si in which R, R' and n have the previous meaning; or from an acidic aqueous solution of a silicon alkoxide and a metal alkoxide M or a non-metal alkoxide M.

As the precursor of metal oxide M, it is preferable to use metal alkoxides M.

The TAi surfactant concentration is preferably greater than 10% by mass relative to the total amount of water. This can make it possible to obtain an initial viscous reaction medium and to promote the emulsification of the next step ii).

The concentration of silicon oxide precursor is preferably greater than 10% by mass relative to the total mass of the acidic aqueous solution. This can make it possible to obtain total mineralization and good mechanical strength.

Preferably, the pH of the acidic aqueous solution of step i) has a value less than or equal to 1.2, and more preferably still less than 1.

This pH is generally reached by adding an appropriate amount of acid such as HCl.

In step i), the alkoxide undergoes hydrolysis which gives a hydroxylated compound, said hydroxylated compound then condensing to form the silica foam. The duration of the hydrolysis is typically a few minutes. The duration of the condensation depends on the pH of the medium. When the pH of the reaction medium is less than 1, or even negative, the duration of the condensation is of the order of 2 to 3 hours. When the pH tends to 2.1 (which represents the isoelectric point of silica), the condensation is slower and typically requires at least a fortnight.

The hydrolysis / condensation step of precursors of the alkoxide type is advantageously carried out at a temperature close to room temperature (i.e. 20-25 ° C).

When the acidic aqueous solution of precursor additionally contains at least one precursor other than an alkoxide, the condensation can be carried out in two stages, the condensation of the alkoxide (s) being catalyzed by the pH of the medium, the condensation subsequent non-alkoxide precursor (s) being optionally catalyzed by heating.

The first oily phase of step ii) preferably consists of one or more compounds chosen from linear or branched alkanes having at least 12 carbon atoms. Examples include dodecane or hexadecane. The first oily phase can also consist of a silicone oil of low viscosity, that is to say less than 350 Cst approximately (at 25 ° C).

The volume fraction of the first oily phase / aqueous phase is preferably less than 0.78.

The volume fraction of the first oily phase / aqueous phase makes it possible to control the size of the macropores. An increase in said volume fraction results in an increase in the viscosity of the reaction medium, and consequently in the shear during stirring. The droplets in the emulsion become smaller. A decrease in the size of the droplets can cause a reduction in the thickness of the walls of said droplets, said walls forming the structure of silica foam with hierarchical porosity and ensuring its mechanical strength. Thus, when the volume fraction of the first oily phase / aqueous phase is less than 0.78, the mechanical resistance of the silica beads is optimized.

The viscosity of the reaction medium increases exponentially when the volume fraction increases. For low values of volume fraction (i.e. less than 0.6), the first oily phase is advantageously introduced all at once in the acidic aqueous solution of surfactant TAi and of precursor.

In this particular embodiment, the emulsification of the reaction mixture is carried out using energetic means, such as for example an Ultraturax® device.

For higher values of volume fraction (i.e. greater than 0.6), it is preferable to introduce the first oily phase dropwise or in the form of a continuous stream into the acidic aqueous solution containing the surfactant and the precursor.

In this particular embodiment, the emulsification is carried out using low energy means, such as for example a colloid mill.

According to a particularly preferred embodiment of the invention, the volume fraction of the first oily phase / aqueous phase is greater than 0.6. This promotes the interconnections between the drops.

According to a particularly preferred embodiment of the invention, the first oily phase is introduced dropwise into the acidic aqueous solution of step i).

The TAi surfactant can be a cationic surfactant chosen in particular from alkyltrimethylammonium bromides such as tetradecyltrimethylammonium bromide (TTAB) or dodecyltrimethylammonium bromide.

The emulsion from step ii), composed of an oil dispersed in an aqueous phase, gives the silica foam core its macroporosity by acting as a soft imprint.

Preferably, step ii) does not use silica nanoparticles.

During step iii), the emulsion obtained at the end of step ii) is preferably deposited dropwise in the second oily phase.

The deposit can be made using a pipette (transfer).

The second oily phase is preferably contained in a crystallizer during step iii).

During step iii), the resulting mixture is preferably left at room temperature for 2 days, and more preferably for 3 days.

The proportion by mass of emulsion from step ii) in the second oily phase during step iii) preferably varies from 1% to 50% by mass approximately, relative to the mass of the second oily phase.

The second oily phase of step iii) can be chosen from silicone oils.

The second oily phase preferably has a viscosity of at least 350 cSt approximately, and more preferably between 350 and 1000 cSt approximately (limits included) (at 25 ° C.). Consequently, the second oily phase is generally a very viscous oil.

In the present invention, the viscosity in cSt (measured at 25 ° C.) relates only to Newtonian fluids (first and second oily phase). The viscosity is therefore independent of the device used to measure said viscosity and of the shear rate.

The use of a very viscous oil makes it possible to limit the capillary forces, and thus prevent the emulsion drops from sticking together and condensing in the form of aggregates.

During step iii), the condensation of the silica takes place.

Step iii) makes it possible to shape the silica foam with hierarchical porosity in the form of beads.

At the end of step iii), the silica foam balls have an open porosity.

Preferably, step iii) does not use silica nanoparticles.

Step iv) is preferably carried out several times, for example using an equivolumic tetrahydrofuran (THF) / acetone mixture.

The silica foam obtained after step iv) has the three degrees of porosity (microporosity, mesoporosity and macroporosity).

However, the pores can be blocked by organic residues. Organic residues from the first oily phase are mainly found in macropores and can be removed by simple washing, for example using a volatile organic solvent such as acetone, THF or their mixtures. The organic residues originating from the surfactant TAi are mainly found in the mesopores and can be removed by calcination (cf. next step v)).

The calcination v) has the effect of releasing the mesoporosity (by calcination of the surfactant) and of sintering the beads, which densifies them.

Step v) can last from 1 hour to 12 hours, and preferably from 4 hours to 8 hours approximately.

The temperature of step v) generally varies from 150 to 750 ° C. approximately.

Step v) preferably comprises a first heating sub-step at a temperature varying from approximately 150 to 250 ° C., in particular for approximately 1 to 3 hours, then a second heating sub-step at a temperature varying from 550 to 750 ° C approximately, for 4 to 8 hours in particular.

The second heating substep can be carried out at a heating rate of between approximately 1 ° C / min and 10 ° C / min, and preferably between 1 ° C / min and 5 ° C / min (terminals included) .

In step vi), the beads are used as a support for the growth of microorganisms.

During step vi), the beads are preferably placed in a nutritive medium allowing the diffusion from the outside of enough culture medium to feed the bacterial growth.

The choice of nutrient medium is within the reach of the skilled person who knows the type of nutrient medium to be used according to the type of microorganisms present in the silica beads.

Unlike other methods of the prior art, the beads used allow the implantation and proliferation of microorganisms while avoiding the formation of biofilms during step vi).

During step vii), a solid porous envelope of silica is formed surrounding said core.

In particular, this porous envelope is obtained by bringing the beads of step vi) into contact with a solution at neutral pH comprising at least one alkaline silicate or at least colloidal solid particles of silica.

The alkali silicate can be a sodium silicate.

As examples of colloidal solid particles of silica, mention may be made of those sold under the reference LUDOX HS40 by the company Sigma-Aldrich.

The pH of the solution is generally adjusted after addition of the silicate or colloidal solid particles of silica, so that it is neutral (it is initially basic).

The mass concentration of the alkali silicate in the solution at neutral pH preferably varies from 20% to 30% by mass approximately.

The mass concentration of colloidal solid particles of silica in the solution at neutral pH preferably varies from 1% to 2% by mass approximately.

Step vii) can be carried out several times, in order to obtain a sufficient thickness of the envelope.

The third object of the invention is the use of at least one ball according to the first object of the invention or as obtained according to the method according to the second object, as a heterogeneous biocatalyst.

The silica beads can be easily recovered after they have been used as a biocatalyst. In addition, they have the advantage of being able to be reused several times (i.e. used during several cycles) while retaining their catalytic efficiency.

The silica beads are preferably suitable for catalyzing reactions of the hydrolysis, oxidation or reduction type.

The fourth object of the invention is a process of biocatalysis, characterized in that it comprises at least one step A) of bringing a substrate S ¹ into contact with at least one silica ball as defined in the first object of the invention or as obtained according to the process defined in the second object of the invention, in order to transform the substrate S ¹ into product P ¹ .

The microorganisms M ¹ of the bead being provided with a catalytic activity, they are suitable for catalyzing the transformation of the substrate S ¹ into product P ¹ .

Thus, in the process of the invention, the microorganisms M ¹ endowed with a catalytic activity catalyze the transformation of a substrate S ¹ into product P ¹ .

The substrate S ¹ can be L-asparagine, the microorganisms M ¹ of the ball can be bacteria E. Coli overexpressing L-asparaginase and the product P ¹ can be aspartate.

The substrate S ¹ can be aspartate, the microorganisms M ¹ can be E. coli bacteria overexpressing aspartate oxidase and the product P ¹ can be oxaloacetate.

According to a preferred embodiment of the invention, the method can also comprise a step B) of bringing a substrate S ² different from the substrate S ¹ into contact with at least one silica ball as defined in the first object of the invention or as obtained according to the process defined in the second object of the invention, in order to transform the substrate S ² into product P ² .

The microorganisms M ² of the bead being provided with a catalytic activity, they are suitable for catalyzing said transformation of the substrate S ² into product P ² .

The substrate S ² can be the product P ¹ obtained in step A), in which case, the process implements chemical reactions in cascade.

In this embodiment, the substrate S ¹ can be L-asparagine, the microorganisms M ¹ can be bacteria E. Coli overexpressing Lasparaginase, the product P ¹ and the substrate S ² can be aspartate, the microorganisms M ² can be E. Coli bacteria overexpressing aspartate oxidase and the product P ² can be oxaloacetate.

In this embodiment, preferably, step A) uses a ball containing the microorganisms M ¹ , and step B) uses two or three beads containing the microorganisms M ² .

The substrate S ² can be different from the product P ¹ obtained in step A) and for example lead to a product P ² which reacts with the product P ¹ to form a product P ³ during a step C) subsequent to B).

Thus, the process of the invention makes it possible to carry out one or more chemical reactions, possibly in cascade, with one or more identical or different beads (e.g. different microorganisms) depending on the type of chemical reaction implemented. Furthermore, the beads are easily recoverable at the end of the reaction (easier separation) and can ensure several catalytic cycles, in particular while retaining their effectiveness over several catalytic cycles. In addition, it is possible to modulate the number of beads for each of the reactions implemented. Finally, the silica beads make it possible to increase the catalytic activity of microorganisms, in particular bacteria, compared to free microorganisms (see examples below).

The silica beads have a large exchange surface between the reaction medium and the microorganisms.

The fifth object of the invention is a catalytic system comprising at least a first ball as defined in the first object of the invention or as obtained according to the method defined in the second object of the invention; and at least one second ball as defined in the first object of the invention or as obtained according to the method defined in the second object of the invention, said first ball comprising microorganisms M ¹ endowed with a catalytic activity and said second ball comprising microorganisms M ² endowed with a catalytic activity, said microorganisms M ¹ and M ² being different.

According to a preferred embodiment of the invention, the catalytic system can comprise at least a first ball as defined in the first object of the invention or as obtained according to the method defined in the second object of the invention, said first bead comprising microorganisms M ¹ suitable for catalyzing the transformation of a substrate S ¹ into product P ¹ ; and at least one second ball as defined in the first object of the invention or as obtained according to the process defined in the second object of the invention, said second ball comprising microorganisms M ² suitable for catalyzing the transformation of the product P ¹ in product P ² .

According to a particularly preferred embodiment of the invention, the catalytic system comprises a ball (first ball) as defined in the first object of the invention or as obtained according to the method defined in the second object of the invention said ball comprising E. Coli bacteria overexpressing L-asparaginase; and two or three beads (second beads) as defined in the first object of the invention or as obtained according to the process defined in the second object of the invention, said beads comprising E. Coli bacteria overexpressing aspartate oxidase.

The E. Coli bacteria overexpressing L-asparaginase catalyze the transformation of L-asparagine as substrate S ¹ into aspartate as product P ¹ .

E. Coli bacteria overexpressing aspartate oxidase catalyze the transformation of aspartate as substrate S ¹ into oxaloacetate as product P ¹ .

The sixth object of the invention is the use of at least one ball as defined in the first object of the invention or as obtained according to the process in accordance with the second object, for the production of energy such as the production hydrogen.

For example, one or more beads containing bacteria of the genus Clostridium as microorganisms with catalytic activity can be used for the production of hydrogen. Indeed, such bacteria are capable of transforming organic compounds into hydrogen and carbon dioxide (fermentation).

Other beads containing cyanobacteria can be used in the presence of an appropriate light wave to generate energy.

The seventh subject of the invention is the use of at least one ball as defined in the first subject of the invention or as obtained according to the process in accordance with the second subject, for the reduction of contaminants.

For example, one or more beads containing Paracoccus denitrificans bacteria as microorganisms with catalytic activity can be used for the depollution of water (denitrification).

The eighth object of the invention is the use of at least one bead as defined in the first object of the invention or as obtained according to the method in accordance with the second object, for the production of recombinant proteins.

Examples

The raw materials used in the following examples are listed below:

- Tetradecyl-trimethylammonium bromide (TTAB), company SigmaAldrich;

- Tetraethylorthosilane (TEOS), purity> 99%, company Sigma-Aldrich;

- dodecane, purity> 99%, company Sigma-Aldrich;

- aqueous sodium silicate solution (SiO ₂ > 27% by mass, NaOH> 10% by mass), from Sigma-Aldrich;

- hydrochloric acid solution at 37% by volume, from Sigma-Aldrich;

- polydimethylsiloxane oil, viscosity 500 cSt, Sigma-Aldrich;

- tetrahydrofuran (THF), purity> 99%, Sigma-Aldrich;

- acetone, purity> 99%, Sigma-Aldrich;

- glutaraldehyde, Grade I, 25% by volume in water, SigmaAldrich;

- Amplex® UltraRed, Thermo Fisher company;

- hexamethyldisilazane, purity 99.9%, Sigma-Aldrich.

These raw materials were used as received from the manufacturers, without further purification.

The materials obtained were characterized by several techniques described below.

Scanning electron microscopy (SEM)

The samples were rinsed in a phosphate buffered saline (PBS) and treated with 5% (v / v) of an aqueous solution of glutaraldehyde during 24h approximately at 4 ° C to fix the bacteria. They were dehydrated by placing them in an ethanol bath for 1 hour, increasingly concentrated in glutaraldehyde, ie with a volume concentration of 20% (eg 20 ml of an aqueous solution of glutaraldehyde at 25% and 80 ml of ethanol) , 40%, 60%, 80% then 96% (v / v). Then, they were dried in a hexamethyldisilazane bath for 1 hour. Finally, they were left to dry in air at room temperature for 24 hours. The observations by scanning electron microscopy were carried out with microscopes sold under the trade name HITACHI TM-1000 and HITACHI S2500 operating at 15 and 25 kV respectively.

Glucose consumption test (see example 2 below)

The silica beads were placed in a culture medium (2 ml) containing different concentrations of glucose (2 mM, 1 mM, 500 μΜ and 100 pM). The resulting medium was incubated at 37 ° C for 24 hours. The glucose level and glucose consumption were determined using two methods: a first method using a kit called "Amplex® Red Glucose Assay" (ie glucose test with Amplex® Red) from Molecular Probes and a second method using a mixture of glucose oxidase / horseradish peroxidase reagents. The Amplex® Red Glucose Assay kit was used according to the supplier's instructions. The fluorescence was determined with a device sold under the trade name Spectramax Plate Reader by the company Molecular Devices. As regards the second method, the appended FIG. 1 lists the different reactions involved. In particular, glucose oxidase (GOx) catalyzes the oxidation of glucose to gluconolactone and hydrogen peroxide by molecular oxygen. Then, hydrogen peroxide is responsible for the oxidation of the reducing agent 2,2'-azinodi- [3-ethylbenzothiazoline-6-sulfonic acid] (ABTS). Finally, the oxidized ABTS is quantified by UV measurements at 420 nm.

Asparaqinase test (see examples 3 and 4 below)

Fluorescence was used to detect the asparaginase activity of E. coli bacteria. In this reaction, bacteria overexpressing asparaginase catalyze the hydrolysis of L-asparagine to aspartate.

The aspartate is then oxidized by the aspartate oxidase and the flavin adenine dinucleotide (FAD) to oxaloacetate and hydrogen peroxide. This hydrogen peroxide is finally used by horseradish peroxidase (HRP) to oxidize Amplex® Ultra Red (AUR) into fluorescent resorufin. The different reactions are shown in Figure 2 attached.

For the preparation of a positive control, 10 ml of a culture of E. coli bacteria were centrifuged (4200 g, 15 min, 4 ° C). The cell pellets were resuspended in phosphate buffered saline (PBS IX) and centrifuged again. The washed cells were resuspended in 1 ml of PBS IX and the cell concentrations were measured. The bacterial suspension was diluted until an optical density OD ₆₀ onm = 0.1 for the test, which corresponds to 10 ⁷ cells per ml.

The fluorescence test was carried out using a 96-well plate: a silica ball colonized by E. coli bacteria with 100 μl of PBS IX or 100 μl of a suspension of E. coli bacteria (control positive) is added to 100 μΙ of a mixture of reagents in PBS IX (L-asparagine: 250 μΜ, L-aspartate oxidase: 700 pg.ml · ¹ , HRP: 0.2 U. ml · ¹ , FAD: 20 μΜ, AUR: 12.5 μΜ). The fluorescence was measured every 20 seconds for 3 h (excitation = 532 nm, emission = 581 nm) with a device sold under the trade name Spectramax Plate Reader by the company Molecular Devices.

Bacteria used in Examples 1, 3 and 4

Asparaginase was produced from Escherichia coli C41 (DE3) + EcASNase-2 in pAPEx4b * (periplasmic expression) and aspartate oxidase (AspOx) from Escherichia coli CD41 (DE3) + pET14b-Athrombin-SUMO * (cytoplasmic expression). They were all purified and the plasmids were supplied by the Max Planck Institute for Biophysical Chemistry.

Cloning of periplasmic L-AspOx:

Plasmid pET14b containing the E. coli na6B gene encoding L-AspOx was digested using restriction enzymes NdeI and BamHI. The digestion product was purified in agarose gel and ligated at 16 ° C. for

3 h in the vector pAPEx4b using the T4 DNA ligase. Competent E. coli XL-Blue cells were transformed with the ligation product. Positive clones were identified by PCR. using the following probes: Ec_AspOx_NdeI5'_Forward GGAATTCCATATGAATACTCTCCCTGAACATTC (SEQ ID N ° l) and Ec_AspOx_BamHI3'_Reverse

5'CGCGGATCCTTATCTGTTTATGTAATGATTGC (SEQ ID N ° 2). Finally, the plasma DNA was digested in order to verify the correct size of the cloned insert before sequencing (European Institute of Chemistry and Biology (IECB), Bordeaux).

Example 1 Preparation of Silicon Cellular Beads comprising a Core Containing a Silica Foam with Hierarchical Porosity and Bacteria Dispersed in Said Foam, and a Solid Porous Shell of Silica Surrounding Said Core

1.1 Preparation of a silica foam with hierarchical porosity in the form of retrop beads i), ii), iii), iv) and v) according to the second subject of the invention!

5.02 g of tetraethylorthosilane (TEOS) were added to 16.02 g of an aqueous solution of tetradecyltrimethyl ammonium bromide (TTAB) (mass concentration of TTAB in the aqueous solution of 35% by mass). Then, 5.88 g of a concentrated hydrochloric acid solution at 37% by volume was added. The resulting aqueous phase was kept stirring for 5 minutes in order to proceed with the hydrolysis of TEOS [step i)]. Then, an emulsion was prepared by adding dropwise 35 g of dodecane to the aqueous solution [step ii)]. With a 7 ml pipette, the resulting emulsion was transferred / deposited dropwise into a viscous polydimethylsiloxane oil contained in a crystallizer to form droplets and the resulting mixture was left at room temperature for 3 days to form a silica foam with hierarchical porosity in the form of beads [step iii)]. The resulting beads were washed three times with a tetrahydrofuran (THF) / acetone mixture (50/50 by volume) with removing the oils [step iv)], air dried, then calcined at 650 ° C for 6 hours (at a heating rate of 2 ° C / min with a first heating step at 180 ° C for 2 h) [step v)]. The beads were then cooled.

1.2 Encapsulation and colonization of bacteria within the silica beads retrieving vOI

The beads obtained in Example 1.1 above were sterilized in an oven at 180 ° C for 1.5 hours. Then, they were put in a container containing 1 liter of an M9 mineral medium prepared from:

- 100 ml of a salt solution (10X),

- 2 mM magnesium sulfate,

- 2 mM glucose,

- 50 ml of a solution of casaminic acids at 10% by mass (i.e. 0.5% by mass of casaminic acids relative to the total mass of the mineral medium M9,

- the rest of the water.

A solution of salts (10X) included 75.2 g / l of Na2HPO ₄ -2H ₂ O, 30 g / l of KH ₂ PO ₄ , 5 g / l of NaCl and 5 g / l of NH ₄ CI. It can be prepared by mixing 800 ml of water with the appropriate amounts of Na ₂ HPO ₄ -2H ₂ O, KH ₂ PO ₄ , NaCl and NH ₄ C, adjusting the pH of the resulting solution to 7.2 with soda (NaOH) and supplementing with water to a final volume of 1 liter.

The container containing the beads and the mineral medium M9 was placed under a dynamic vacuum of 200 mbar until the effervescence caused by the departure of the air from the beads and its replacement by the mineral medium disappeared. It was then left to stand under static vacuum for three days.

Bacteria were isolated in an LB culture medium (LuriaBertani) containing chloramphenicol (25 pg.ml ¹ ). After 24 h at 37 ° C., a colony was inoculated in an Erlenmeyer flask containing the mineral medium M9 with chloramphenicol (25 pg.ml ¹ ). The Erlenmeyer was placed in an incubator overnight at 37 ° C., with shaking at 220 rpm. After one night, an optical density subculture at 600 nm OD ₆₀₀ nm = 0.1 was carried out. Cultures were incubated at 37 ° C until the OD ₆₀₀ nm optical density was reached (exponential growth phase). When the bacteria used were E. Coli bacteria overexpressing asparaginase (EcASNase-2 in pAPEx4b for periplasmic expression) and exhibiting resistance to chloramphenicol, 1 mM isopropyl β-Dl-thiogalactopyranoside (IPTG) was added to overexpress l 'asparaginase. A similar protocol was used to prepare E. Coli bacteria overexpressing aspartate oxidase.

The silica beads were then placed in the culture medium for bacterial colonization. The incubation was maintained overnight at 37 ° C.

1.3 Formation of a solid porous silica envelope in stage viijl

The beads containing the bacteria overexpressing asparaginase were rinsed with a phosphate buffered saline (PBS) (pH = 7.4), put in a solution containing PBS and a solution of sodium silicate (200 mM) acidified with l hydrochloric acid until the pH is lowered to 7, then the beads were stirred until the formation of a silica gel. This procedure was repeated five times to produce a homogeneous envelope of silica surrounding the beads.

Figure 3 attached shows a photograph of the alveolar silica beads as obtained in Example 1 (Figure 3a), an image by scanning electron microscopy of a ball showing its porous structure which allows bacteria to be encapsulated (Figure 3b), an image by scanning electron microscopy of the surface of a ball after the treatment with sodium silicate, with an enlarged image by optical microscope of the silica envelope designated by the white arrow (FIG. 3c), image by scanning electron microscopy showing the thickness of the silica envelope designated by the white arrow which is approximately 6.5 μm (FIG. 3d), images by scanning electron microscopy of the bacteria dispersed in the silica foam from the heart of the beads (Figures 3e and 3f).

The cellular silica beads had an average diameter of the order of 4 mm and a pore volume of approximately 93%.

The bacteria can remain confined in the alveolar silica beads for at least 2 weeks.

The same procedure was used to produce honeycomb silica beads containing bacteria overexpressing aspartate oxidase.

EXAMPLE 2 Metabolic Activity of Bacteria in Honeycomb Silica Beads

The metabolic activity of the bacteria was measured by evaluating their intrinsic glucose consumption. In this example 2, non-mutated E. Coli bacteria were used.

2.1 Variation of colonization time

The alveolar silica beads were placed in a culture medium (2 ml) containing 500 μΜ of glucose.

Figure 4 attached shows the kinetics of glucose consumption by free E. Coli bacteria (ie not encapsulated in the alveolar silica beads) at different times of bacterial proliferation, the time of bacterial proliferation being directly related to the optical density at 600 nm of the culture medium; and the kinetics of glucose consumption by alveolar beads of silica encapsulating the bacteria after 24 h or 48 h of colonization.

In particular, Figure 4a shows the glucose concentration (in mmol / l) as a function of time (in hours) for free E. coli bacteria at different optical densities OD ₆₀ onm = 0.1 (curve with full squares) , OD 6oonm - 0.025 (curve with solid circles), OD ^ oonm - 0.01 (curve with solid triangles) and OD ₆₀ onm = 0.002 (curve with inverted solid triangles). FIG. 4b shows the glucose concentration (in mmol / l) as a function of time (in hours) for E. Coli bacteria encapsulated in the alveolar beads of silica after 24 h of colonization (curve with full squares) and 48 h of colonization (curve with solid circles).

The error bars correspond to the standard deviation results of three repeated measurements. The remaining unconsumed amount of glucose was quantified using a mixture of glucose oxidase / horseradish peroxidase reagents as described above (cf. second method).

Figure 4a shows that the kinetics of glucose consumption is higher when the exponential growth of bacteria is established (OD ^ oonm = 0.1). In fact, at this optical density, 70% of the glucose is consumed for 2.5 hours whereas, for an optical density OD ₆₀ onm = 0.002, it takes approximately 6 hours to consume the same amount of glucose.

Regarding FIG. 4b, it can be indicated that the consumption of glucose depends on the colonization time at which the alveolar beads are placed in the mixture of reagents. If the glucose concentration decreases, the kinetics vary according to the duration of colonization. Indeed, the kinetics of glucose consumption is related to the time of proliferation of bacteria, the kinetics being higher for the alveolar beads having undergone 48 hours of colonization compared to those having undergone 24 hours of colonization. It is therefore possible to conclude that the decrease in the glucose concentration is not guided only by the intrinsic diffusion of glucose in the heart of the alveolar beads (in such a configuration the kinetics would be constant throughout the proliferation time). Thus, FIG. 4b expresses the metabolic consumption of glucose by the bacteria encapsulated in the alveolar beads of silica. In addition, it can be noted that the efficiency of glucose consumption by the alveolar silica beads after 48 hours of bacterial proliferation is almost similar to that obtained for free bacteria at an optical density of 0.1 (see Figure 4a ), which corresponds to the case where the exponential growth of free bacteria is reached and a consumption of 70% of glucose in 3 hours. In the case of bacteria encapsulated in the alveolar beads of silica, there is a certain latency for the initiation of the kinetics of glucose consumption, certainly linked to the presence of the solid porous envelope of silica of the alveolar beads which acts as a diffusion barrier.

2.1 Change in glucose concentration

The alveolar silica beads were placed in a culture medium (2 ml) containing different concentrations of glucose (2 mM, 1 mM, 500 μΜ and 100 pM) for 24 h at 37 ° C. Then, the glucose level and the glucose consumption were determined using the first method described above (glucose test with Amplex® Red). For comparison, alveolar silica beads free of E. Coli bacteria were evaluated. These silica honeycomb beads free of E. Coli bacteria were prepared according to the same procedure as that described in Example 1, without part 1.2 concerning the encapsulation and colonization of bacteria in the honeycomb beads.

Figure 5 appended shows the fluorescence (in arbitrary units) as a function of time (in seconds) for alveolar beads of silica encapsulating E. Coli bacteria with an initial glucose concentration of 100 pM (curve with inverted solid triangles ▼) , with an initial glucose concentration of 500 pM (curve with the full solid triangles A), with an initial glucose concentration of 1 mM (curve with the solid circles), with an initial glucose concentration of 2 mM (curve with the filled squares), for a PBS buffer solution (curve with stars), and for silica alveolar beads free of E. Coli bacteria with an initial glucose concentration of 100 pM (curve with full hexagons), with a concentration initial glucose of 500 pM (curve with solid triangles in right direction ►), with an initial glucose concentration of 1 mM (curve with empty triangles in left direction <) and with a conce 2 mM initial glucose input (curve with solid diamonds).

The fluorescence translates the presence of unconsumed glucose which leads to the oxidation of Amplex® Red to fluorescent resorufin. As a control, a glucose-free PBS buffer was used. It therefore does not exhibit fluorescence. On the other hand, all the alveolar beads free from bacteria are associated with a strong fluorescence signal, showing the presence of glucose. As for the alveolar beads of silica encapsulating bacteria, they consumed all the glucose for the initial glucose concentrations of 100 μM, 500 μM and 1 mM of glucose.

When an initial glucose concentration of 2 mM is used, it is not completely consumed.

In conclusion, the bacteria encapsulated in the alveolar silica beads retain their metabolic activity.

EXAMPLE 3 Use of the Cellular Silica Beads as Biocatalysts

In this example, E. Coli bacteria overexpressing asparaginase (EcASNase-2 in pAPEx4b for periplasmic expression) and exhibiting resistance to chloramphenicol were used. This example made it possible to quantify the efficiency of the alveolar silica beads as biocatalysts.

Figure 6 attached shows the fluorescence (reflecting the activity of asparaginase) (in arbitrary units) as a function of time (in seconds or minutes).

In particular, FIG. 6a shows the activity of asparaginase (hydrolysis of L-asparagine to aspartate) of a PBS buffer (curve with the inverted solid triangles), of silica alveolar beads free of bacteria (curve with the solid circles), alveolar beads of silica encapsulating bacteria overexpressing asparaginase (curve with solid squares) and free bacteria overexpressing asparaginase (curve with full solid triangles).

As can be seen in FIG. 6a, the alveolar beads free from bacteria do not carry out any hydrolysis reaction since the fluorescence signal remains flat. As regards the PBS buffer, a slight increase in fluorescence can be observed: this residual fluorescence is well known to those skilled in the art and is linked to the non-enzymatic deamidation of residues of L-asparagine. Concerning bacteria overexpressing asparaginase, a rapid increase in fluorescence is observed followed by a plateau for approximately 3 h. The signal provided by the alveolar silica beads encapsulating bacteria overexpressing asparaginase reaches the same plateau after a certain lag time (30 minutes), linked to the presence of the solid porous envelope of silica acting as a diffusion barrier.

According to the experimental conditions used for the free bacteria overexpressing asparaginase, the concentration of the bacteria is 10 ⁷ bacteria / ml. If we consider that the alveolar silica beads encapsulating bacteria overexpressing asparaginase have an average diameter of the order of 4 mm and that they are completely inoculated, this means that 3.116 x 10 ⁵ bacteria would be present in a volume 0.031 ml restricted. We can say that bacteria express the same amount of asparaginase but within a smaller population, leading to an activity that is 200% times higher.

These results make it possible to show that the alveolar beads of silica make it possible to increase the kinetics of bacterial proliferation but also to increase the efficiency of the intrinsic bacterial reactivity by a factor of approximately 2. Thus, the alveolar beads of encapsulating silica bacteria have improved catalytic activity compared to free bacteria.

The recycling of alveolar silica beads has also been studied. FIG. 6b shows in particular the activity of asparaginase of alveolar silica beads free of bacteria during the first cycle (curve with the empty circles), during the second cycle (curve with the empty triangles) and during the third cycle (curve with empty diamonds); and alveolar beads of silica encapsulating bacteria overexpressing asparaginase during the first cycle (curve with the solid circles), during the second cycle (curve with the solid triangles) and during the third cycle (curve with the solid diamonds ). Thus, it is observed that the efficiency of the bacteria (slope of each of the curves at the start of the cycle) is almost constant for the three cycles, ranging from 6.1 × ⁵ × ⁵ min ¹ for the first cycle, 5.8 × 10 ⁵ min ¹ for the second cycle and 5.9 × 10 ⁵ min ¹ for the third cycle. In addition, for the alveolar silica beads free of bacteria, a weak fluorescence is observed for each of the cycles, linked to the auto-oxidation of Amplex® Red over time.

EXAMPLE 4 Use of Silicon Cellular Beads as Biocatalysts (Cascade Reactions)

In this example, the activity of two types of bacteria encapsulated in different cellular silica beads was evaluated according to attached FIG. 7 (use of the Amplex® red kit). The cascade reaction begins with the hydrolysis of L-asparagine to aspartate followed by the oxidation of the aspartate to oxaloacetate.

FIG. 8 shows the fluorescence (reflecting the activity of Lasparaginase and of aspartate oxidase) (in arbitrary units) as a function of time (in hours). Bacteria overexpress asparaginase in the periplasm and bacteria overexpress aspartate oxidase in the cytoplasm (Figure 8a) or in the periplasm (Figure 8b).

In particular, FIG. 8a shows the activity of asparaginase and aspartate oxidase of an alveolar ball of silica encapsulating bacteria overexpressing asparaginase (curve with solid squares), of a catalytic system comprising a ball alveolar encapsulating bacteria overexpressing asparaginase and an alveolar ball encapsulating bacteria overexpressing aspartate oxidase (curve with solid circles), a catalytic system comprising an alveolar ball encapsulating bacteria overexpressing asparaginase and two alveolar beads encapsulating bacteria overexpressing aspartate oxidase (curve with full right triangles), a catalytic system comprising an alveolar ball encapsulating bacteria overexpressing asparaginase and three alveolar balls encapsulating bacteria overexpressing aspartate oxidase (curve with inverted solid triangles ), a mixture of free bacteria overexpressing asparagina se and aspartate oxidase with an optical density of 0.1 for the two types of bacteria (curve with solid diamonds), of a mixture of free bacteria overexpressing asparaginase and aspartate oxidase with an optical density of 0 , 1 for bacteria overexpressing asparaginase and 1 for bacteria overexpressing aspartate oxidase (curve with solid triangles in left direction ◄) and PBS buffer (curve with solid triangles in right direction ►).

As can be seen in FIG. 8a, the catalytic system comprising an alveolar ball encapsulating bacteria overexpressing asparaginase and an alveolar ball encapsulating bacteria overexpressing aspartate oxidase is as effective as a mixture of free bacteria overexpressing asparaginase and aspartate oxidase with an optical density of 0.1 for bacteria overexpressing asparaginase and 1 for bacteria overexpressing aspartate oxidase. In addition, surprisingly, the use of a catalytic system comprising an alveolar ball encapsulating bacteria overexpressing asparaginase and two or three alveolar balls encapsulating bacteria overexpressing aspartate oxidase, clearly improves the catalytic performances. It is therefore possible to provide a catalytic system comprising cellular balls catalyzing different chemical reactions and in which it is possible to modulate the number of cellular balls catalyzing each of said chemical reactions.

It is also important to note, as in Example 3 above, that the alveolar beads encapsulating bacteria are more effective than the free bacteria used in suspension. There is always a certain latency in the initial fluorescence production, in particular linked to the presence of the solid porous envelope of silica in the alveolar beads. However, after 3 hours, the fluorescence becomes higher for the alveolar beads than for the free bacteria.

FIG. 8b shows the activity of asparaginase and aspartate oxidase of an alveolar ball of silica encapsulating bacteria overexpressing asparaginase (curve with the filled squares), of a catalytic system comprising an alveolar ball encapsulating bacteria overexpressing asparaginase and an alveolar ball encapsulating bacteria overexpressing aspartate oxidase (curve with solid circles), a catalytic system comprising an alveolar ball encapsulating bacteria overexpressing asparaginase and two alveolar balls encapsulating bacteria overexpressing aspartate oxidase (curve with full solid triangles), of a catalytic system comprising an alveolar ball encapsulating bacteria overexpressing asparaginase and three alveolar balls encapsulating bacteria overexpressing aspartate oxidase (curve with inverted solid triangles) a mixture of free bacteria overexpressing asparaginase and aspartate o xydase with an optical density of 0.1 for both types of bacteria (curve with solid diamonds), of a mixture of free bacteria overexpressing asparaginase and aspartate oxidase with an optical density of 0.1 for bacteria overexpressing asparaginase and 1 for bacteria overexpressing aspartate oxidase (curve with solid triangles in left direction ◄) and PBS buffer (curve with solid triangles in right direction ►).

In the case of FIG. 8b, asparaginase and aspartate oxidase are both overexpressed in the periplasm, which allows better accessibility to the extracellular substrate and thus better catalytic efficiency. When the aspartate oxidase is overexpressed in the cytoplasm (cf. FIG. 8a), the extracellular substrate must first diffuse in the bacterial cytoplasm so that the enzymatic degradation takes place. The difference in accessibility results in a difference in reactivity between the two types of catalytic systems.

Claims (18)

1. Honeycomb silica ball, characterized in that it comprises: a core containing a silica foam with hierarchical porosity and microorganisms dispersed in said foam, and a solid porous envelope of silica surrounding said core, said microorganisms being endowed with catalytic activity. 2. Ball according to claim 1, characterized in that the silica foam comprises macropores having an average dimension d _A of 0.5 pm to 100 pm, mesopores having an average dimension d _E of 2 to 50 nm, and micropores having an average dimension di of 5 to 15 Å, said pores being interconnected. 3. Ball according to claim 1 or 2, characterized in that the microorganisms encapsulated in said alveolar ball of silica are chosen from bacteria, yeasts, microalgae, spores, viruses and fungi. 4. Ball according to any one of the preceding claims, characterized in that the thickness of the solid porous silica envelope is between 2 and 12 μm. 5. Ball according to any one of the preceding claims, characterized in that it has an average diameter between 1 and 6 mm. 6. Method for preparing beads as defined in any one of claims 1 to 5, characterized in that it comprises the following steps: i) an acidic aqueous solution is prepared containing a surfactant TAi and at least one silicon alkoxide precursor of the silicon oxide forming the silica foam, ii) an emulsion is prepared by introducing a first oily phase into the acidic aqueous solution of step i); iii) the emulsion of step ii) is added dropwise in a second oily phase and the resulting mixture is left at room temperature for at least 24 hours to form a silica foam with hierarchical porosity in the form of beads, iv ) the beads are washed, v) calcining the beads, vi) incubating microorganisms with catalytic activity in the beads of step v) and colonizing them to form a silica foam core with hierarchical porosity in which the microorganisms with a catalytic activity are dispersed, and vii) a solid porous envelope of silica is formed surrounding said core. 7. Method according to claim 6, characterized in that the mass proportion of emulsion in the second oily phase during step iii) varies from 1% to 50% by mass, relative to the mass of the second oily phase . 8. Method according to claim 6 or 7, characterized in that the second oily phase has a viscosity of at least 350 cSt. 9. Method according to any one of claims 6 to 8, characterized in that the porous envelope is obtained by bringing the beads of step vi) into contact with a solution at neutral pH comprising at least one alkaline silicate or colloidal solid particles of silica. 10. Use of at least one cellular silica ball as defined in any one of claims 1 to 5 or obtained according to the process as defined in any one of claims 6 to 9, as a heterogeneous biocatalyst. 11. Biocatalysis method, characterized in that it comprises at least one step A) of bringing a substrate S ¹ into contact with at least one cellular silica ball as defined in any one of claims 1 to 5 or obtained according to the method as defined in any one of claims 6 to 9, in order to transform the substrate S ¹ into product P ¹ . 12. Method according to claim 11, characterized in that the substrate S ¹ is L-asparagine, the microorganisms M ¹ of the ball are E. Coli bacteria overexpressing L-asparaginase and the product P ¹ is aspartate. 13. The method of claim 11, characterized in that the substrate S ¹ is aspartate, the microorganisms M ¹ are bacteria E. Coli overexpressing aspartate oxidase and the product P ¹ is oxaloacetate. 14. Catalytic system comprising at least a first ball as defined in any one of claims 1 to 5 or obtained according to the process as defined in any one of claims 6 to 9; and at least one second ball as defined in any one of claims 1 to 5 or obtained according to the method as defined in any one of claims 6 to 9, said first ball comprising microorganisms M ¹ provided with a catalytic activity and said second ball comprising microorganisms M ² endowed with catalytic activity, said microorganisms M ¹ and M ² being different. 15. Catalytic system according to claim 14, characterized in that it comprises a ball as defined in any one of claims 1 to 5 or obtained according to the process as defined in any one of claims 6 to 9, said ball comprising E. Coli bacteria overexpressing L-asparaginase and two or three balls as defined in any one of claims 1 to 5 or obtained according to the process as defined in any one of claims 6 to 9, said beads comprising E. Coli bacteria overexpressing aspartate oxidase. 16. Use of at least one ball as defined in any one of claims 1 to 5 or obtained according to the method as defined in any one of claims 6 to 9, for the production of energy. 17. Use of at least one ball as defined in any one of claims 1 to 5 or obtained according to the method as defined in any one of claims 6 to 9, for the reduction of contaminants. 18. Use of at least one bead as defined in any one of claims 1 to 5 or obtained according to the process as defined in any one of claims 6 to 9, for the production of recombinant proteins. 1/6 Glucose Oxidized ABTS Glucose oxidase <"W) .f Horseradish peroxidase (HRP) UV detection at 420 nm Gluconolactor.e Oj HjO