FR3028527A1 - IDENTIFICATION OF TRANSCRIPTION FACTORS OF YARROWIA LIPOLYTICA - Google Patents

Abstract

The present invention relates to new oleaginous yeast strains, in which the expression of transcription factors involved in the regulation of the accumulation of lipids and intermediate metabolites of their synthesis is impaired. The present invention also relates to the use of said strains to produce lipids and intermediate metabolites of their synthesis.

Description

1 Introduction Several technologies such as large-scale fermentation are applied for the industrial production of oil from microorganisms using fats or glycerol as the substrate. In these projects, the microorganisms are used as a cell factory by redirecting their cellular metabolism towards the production of compounds of industrial or food interest. Most of these technologies target the production of reserve lipids with a specific structure and / or composition. These include oils enriched in essential polyunsaturated fatty acids that can potentially be used as a dietary supplement, lipids having similarities in cocoa butter composition and non-specific oils for use in the synthesis of biofuels. As a result, there is a growing interest in improving the composition and oil content of microorganisms, particularly yeasts. Oleaginous microorganisms are organisms capable of accumulating lipid reserves that may exceed 20% of the dry matter of the cell. Yarrowia lipolytica is among these microorganisms, one of the most studied and used, because of its ability to accumulate cellular lipids up to 40% of its dry weight. In addition, it is the only known yeast capable of accumulating linoleic acid (C18: 2) in proportions exceeding 50% of total lipids. Linoleic acid is the first substrate for the production of long-chain and polyunsaturated fatty acids, which are of nutritional and biotechnological interest. In yeasts, triglyceride synthesis follows the Kennedy pathway. Free fatty acids are activated by coenzyme A (CoA) and used for the acylation of glycerol, pivot of triglyceride synthesis. Acetyl-CoA is derived from the beta-oxidation of fatty acids, the oxidation of pyruvate in the Krebs cycle and the oxidative degradation of so-called ketogenic amino acids. In the first step of assembling triglycerides, glycerol-3-phosphate (G-3-P) is acylated by the acyltransferase specific for glycerol-3-phosphate (glycerol-3-phosphate acyltransferase or SCT1) to give lysophospatidic acid, which is then acylated by the acyltransferase specific for lysophosphatidic acid (Phosphatidic acid acyltransferase or SLC1) 2 to give phosphatidic acid (PA). This is then dephosphorylated by phosphohydrolase specific for phosphatidic acid (phosphatidic acid phosphohydrolase (PAP)) to release diacylglycerol (DAG). In the last step the diacylglycerol is acyl either with a diacylglycerol acyltransferase or with a phospholipid diacylglycerol acyltransferase to produce triacylglycerols (TAG). Oleaginous yeasts, and in particular Y. lipolytica, begin to accumulate lipids when the nitrogen sources in the medium become limiting, while the carbon sources are in excess. More specifically, yeasts lacking nutrients are subjected to three growth phases: (i) cell proliferation in the exponential growth phase, (ii) a lipid accumulation phase, where growth slows due to a limitation in nutrient (eg nitrogen), but where lipid synthesis is maximal and (iii) a late phase of accumulation where lipids continue to accumulate, but the pathway of B-oxidation ( the lipid catabolism pathway) is activated in order to remobilize the stored carbon. Finally, the cells become incapable of producing essential metabolites and most of the metabolic activity ceases. This process depends on environmental factors such as temperature and pH. (Beopoulos et al., 2009). Since its genome has been completely sequenced (Dujon et al., 2004) and several genetic tools are available, Y. lipolytica has been widely used as a model organism for biosynthesis and lipid accumulation. Different oleaginous yeast strains with improved lipid accumulation capacities were constructed by manipulating several genes involved in lipid bioconversion, synthesis and mobilization (Beopoulos et al., 2008, Dulermo and Nicaud, 2011, Beopoulos et al. , 2012; Tai and Stephanopoulos, 2013; Blazeck et al., 2014; US 7,238,482; US 7,465,564; US 7,550,286; US 7,588,931; US 7,932,077; WO 2010/004141; WO 2012/001144; WO 2014/136028). However, despite the ever increasing amount of information available on the biosynthesis of triglycerides, the limiting steps in the lipid production process are still not known. In addition, the industrial utility of recombinant strains constructed to date remains unknown. Oleaginous yeasts generally do not have a high growth rate, so growth during the exponential phase can dramatically affect lipid production by the cell. The growth of such recombinant strains can be negatively affected by the genetic burden caused by conventional metabolic engineering approaches. There is therefore still a need for new oil yeast strains capable of accumulating lipids. Description The present invention relates to novel oleaginous yeast strains, in which the expression of transcription factors involved in regulating the accumulation of lipids and intermediate metabolites of their synthesis is impaired. The present inventors have for the first time demonstrated a biological function linked to the TF001, TF004, TF007, TF015, TF019, TF021, TF024, TF031, TF033, TF038, TF039, TF040, TF041, TF043, TF051, TF052, TF055 polypeptides. , TF060, TF064, TF068, TF070, TF072, TF074, TF075, TF077, TF078, TF079, TF084, TF085, TF086, TF087, TF089, TF109 and TF126. They have thus shown that the overexpression of the transcription factors of the invention results in an increase in transcription when they are overexpressed in an oleaginous yeast. This increase is in particular independent of the reporter protein used in the experimental system, thus underlining the specificity of the effect.

In addition, the overexpression of transcription factors of the invention specifically alters the accumulation of lipids and at least some intermediate metabolites of synthesis thereof in oleaginous yeasts. Indeed, oleaginous yeast strains overexpressing transcription factors TF001, TF019, TF021, TF024, TF031, TF033, TF039, TF040, TF072, TF079, TF084, TF085, TF086, TF087 and TF126 show an increased accumulation of lipids by relative to a control strain, whereas strains overexpressing transcription factors TF007, TF038, TF043, TF055, TF060, TF064, TF068, TF075, TF077 and TF109 are not able to accumulate as many lipids as the control strain. On the other hand, oleaginous yeast strains overexpressing transcription factors TF004, TF015, TF043, TF051, TF052, TF070, TF074, TF077 and TF078 show an increased accumulation of succinate compared to a control strain, while strains overexpressing the factors Transcription TF041 and TF109 are not capable of accumulating as much succinate as the control strain. Finally, the strains overexpressing TF015, TF041, TF072, TF078, TF089, and TF109 transcription factors accumulate larger quantities of citrate than a control strain; on the other hand, strains overexpressing TF068 and TF099 produce less citrate than a control strain. A "transcription factor" is a protein that binds to DNA regions, including promoter regions, and affects the expression of specific genes. Specifically, the transcription factor (alone or in complex with other proteins) affects transcription of DNA into mRNA, for example, through activation or repression of transcription initiation. A transcription factor - positively regulates lipid biosynthesis if expression of the transcription factor increases transcription of one or more genes encoding lipid biosynthesis enzymes and increases lipid production. A transcription factor - negatively regulates lipid biosynthesis if expression of the transcription factor decreases transcription of one or more genes encoding lipid biosynthesis enzymes and decreases lipid production. A transcription factor may include one or more DNA binding domains that bind to specific DNA sequences adjacent to the genes they regulate. Transcription factors are classified according to the similarity of their DNA binding domains. The presence of such a DNA binding domain thus makes it possible to identify a transcription factor in putative proteins, such as those encoded by open reading frames identified in the context of sequencing the Y. lipolytica genome. (see, for example Gabdouline et al, 2012).

In particular, the transcription factors of the invention are the transcription factors listed in Table 1. Common name Systematic name SEQ ID NO. (protein) SEQ ID NO. (Gene) TF001 YALIOA10637g January 35 TF004 YALIOB06853g February 36 TF007 YALIOB12716g March 37 TF015 YALI0007821g April 38 TF019 YALIOC13178g 5 39 TF021 YALIOC16390g June 40 3028527 5 TF024 YALI0D01353g July 41 TF031 YALI0D10681g August 42 TF033 YALI0D14520g September 43 TF038 YALI0D23045g October 44 TF039 YALI0D23749g November 45 TF040 YALI0E03410g Dec. 46 TF041 YALI0E05555g 13 47 TF043 YALI0E10681g 14 48 TF051 YALI0E31383g 15 49 TF052 YALI0E31669g 16 50 TF055 YALIOF03157g 17 51 TF060 YALIOF09361g 18 52 TF064 YALIOF16599g 19 53 TF068 YALIOE13948g 20 54 TF070 YALIOE11693g 21 55 TF072 YALI0C22682g 22 56 TF074 YALIOD09757g 23 57 TF075 YALIOF05346g 24 58 TF077 YALIOB08206g 25 59 TF078 YALIOD05005g 26 60 TF079 YALIOD12628g 27 61 TF084 YALIOB08734g 28 62 TF085 YALIOC11858g 29 63 TF086 YALIOB04510g 30 64 TF087 YALIOE01606g 31 65 TF089 YALI0006842g 32 66 TF109 YALIOE16577g 33 67 TF126 YALIOD05041g 34 68 Table 1: List of transcription factors of The skilled person will understand without any difficulty that the transcactor The invention may also be a homolog of one of the transcription factors listed above, provided that said homolog has the property of affecting lipid accumulation in oleaginous yeast when overexpressed. By "homologue" of a transcription factor of the invention herein is meant a protein whose amino acid sequence has a percent identity after optimal alignment with the given transcription factor sequence of at least 80%. preferably 85%, 90%, 95%, 96%, 97%, 98% and 99%, this percentage being purely statistical and the differences between the two amino acid sequences can be randomly distributed over their entire length.

By "percentage identity" between two nucleic acid or amino acid sequences within the meaning of the present invention, it is meant to designate a percentage of nucleotides or identical amino acid residues between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being randomly distributed over their entire length. The sequence comparisons between two nucleic acid or amino acid sequences are traditionally performed by comparing these sequences after optimally aligning them, said comparison being made by segment or by comparison window to identify and compare the regions. local sequence similarity. The optimal alignment of the sequences for comparison can be performed, besides manually, using the local homology algorithm of Smith and Waterman (1981), using the local homology algorithm of Neddleman and Wunsch ( 1970), using the similarity search method of Lipman and Pearson (1988), using computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA 25 in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science. Dr., Madison, WI, or the BLAST N or BLAST P comparison software). The percent identity between two nucleic acid or amino acid sequences is determined by comparing these two optimally aligned sequences by comparison window in which the region of the nucleic acid or amino acid sequence to compare may include additions or deletions with respect to the reference sequence for optimal alignment between these two sequences. The percent identity is calculated by determining the number of identical positions for which the nucleotide or amino acid residue is identical between the two sequences, dividing this number of identical positions by the total number of positions in the window. comparison and multiplying the result obtained by 100 to obtain the percentage identity between these two sequences.

For example, the BLAST-BLAST 2 sequence program may be used (Tatusova et al., "Blast 2 sequences - a new tool for comparing proteins and nucleotide sequences", FEMS Microbiol, Lett., 174: 247-250) available. on the site http://www.ncbi.nlnn.nih.gov/gorf/b12.htnnl, the parameters used being those given by default (in particular for the parameters - open gap penalty »: 5, and 10 - extension gap penalty ": 2, the chosen matrix being for example the matrix BLOSUM 62" proposed by the program), the percentage of identity between the two sequences to be compared being calculated directly by the program. The invention therefore relates to a yeast strain in which the expression of at least one of the transcription factors of the invention (TF001, TF004, TF007, TF015, TF019, TF021, TF024, TF031, TF033, TF038, TF039 , TF040, TF041, TF043, TF051, TF052, TF055, TF060, TF064, TF068, TF070, TF072, TF074, TF075, TF077, TF078, TF079, TF084, TF085, TF086, TF087, TF089, TF109 and TF126) is altered, said mutant strain exhibiting an altered accumulation of lipids or at least one of the intermediate metabolites of the synthesis thereof, especially succinate or citrate, relative to a control strain. Preferably, said strain has an increased accumulation of lipids with respect to said control strain. For the purposes of the present invention, the term "yeast" means yeast strains in general, that is to say that this term includes, inter alia, Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorph, Schizzosaccharomyces pombe, Yarrowia lipolytica, Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Ogataea minuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Kluyveromyces sp., Kluyveromyces lactis, Candida albicans.

The preferred yeasts in the sense of the invention are oleaginous yeasts (Ratledge, in: Ratlege C, Wilkinson SG editors, Microbial lipids, Vol 2. London: Academic press 1988). The term "oleaginous" refers to organisms that tend to store their energy source in the form of oil (Weete, In: Fungal Lipid Biochemistry, Ed. Ed., Plenum, 1980). More specifically, an oleaginous yeast according to the invention is a yeast which can make oil. In general, the cellular oil content of the oleaginous microorganisms follows a sigmoidal curve, where the lipid concentration increases to a maximum at the end of the log phase or at the beginning of the stationary phase, before gradually decreasing during the late stationary phase. or even during cell death (Yongmanitchai and Ward, 1991). It is common for oleaginous microorganisms to accumulate more than about 25% of their dry cell weight as an oil. The best known yeasts include the genera Candida, Cryptococcus, Rhodotorula, Rhizopus, Trichosporon, Lypomyces, Yarrowia. Particularly preferred yeasts within the meaning of the invention include Yarrowia lipolytica, Rhodotura glutinis and Rhodosporidium toruloides. A yeast preferred in the sense of the present invention is Yarrowia lipolytica. The present invention therefore preferably relates to an oleaginous yeast strain, preferably a Y. lipolytica strain, in which the expression of at least one of the transcription factors of the invention is impaired, said mutant strain being able to accumulate. lipids. According to the present invention, the expression of a gene is "altered" in an oleaginous yeast strain if it is increased or decreased relative to that of said gene in a reference strain, such as for example an oleaginous yeast strain. wild. The term "expression" as used herein refers to transcription and stable accumulation of meaning (mRNA) or antisense RNA. The expression also includes the translation of the mRNA into a polypeptide. The term "increased" as used herein in some embodiments means a greater amount, for example, a slightly greater amount than the original amount, or for example a large excess amount over to the original quantity, and especially all the quantities in the interval. Alternatively, increase "may refer to a quantity or activity that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11% , 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% more than the quantity or activity for which the amount or increased activity is compared . The terms - increased ", - greater than", and - increased "are used interchangeably here. According to a preferred embodiment, the transcription factor of the invention is overexpressed, that is to say that its level of expression is increased. The inventors have thus shown that the overexpression of transcription factors TF001, TF019, TF021, TF024, TF031, TF033, TF039, TF040, TF072, TF079, TF084, TF085, TF086, TF087 and TF126 in an oleaginous yeast leads to increased accumulation of lipids compared to a control strain. More preferably, the strain of the invention is an oleaginous yeast strain in which at least one of the transcription factors TF001, TF019, TF021, TF024, TF031, TF033, TF039, TF040, TF072, TF079, TF084, TF085, TF086. , TF087 and TF126 is overexpressed, and which is capable of accumulating lipids. The inventors have also shown that oleaginous yeast strains overexpressing transcription factors TF004, TF015, TF043, TF051, TF052, TF070, TF074, TF077 and TF078 produce more succinate than a control strain. According to another preferred embodiment, the subject of the invention is therefore an oleaginous yeast strain in which at least one of the transcription factors TF004, TF015, TF043, TF051, TF052, TF070, TF074, TF077 and TF078 is overexpressed, and which is able to accumulate succinate. Finally, the results obtained by the inventors show that a greater accumulation of citrate is obtained in strains overexpressing TF015, TF041, TF072, TF078, TF089, and TF109 transcription factors. Thus, according to a third preferred embodiment, the invention relates to an oleaginous yeast strain overexpressing a transcription factor selected from the group consisting of TF015, TF041, TF072, TF078, TF089, and TF109. In some embodiments, the alteration of the expression of at least one transcription factor corresponds to a decrease in the expression of said transcription factor relative to a wild-type strain. The term "decrease", as used herein in some embodiments, means a smaller amount, for example, a quantity slightly less than the original amount, or for example a much smaller amount than the amount of origin, including all quantities in the meantime. Alternatively, "decrease" may refer to a quantity or activity that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% less than the amount or activity for which the decreased amount or activity is compared. The terms diminished, "- smaller than", and - decreased "are used interchangeably here. According to a preferred embodiment, the expression of at least one transcription factor is significantly reduced compared with a wild-type strain. Thus, the inventors have shown that the expression of transcription factors TF007, TF038, TF043, TF055, TF060, TF064, TF068, TF075, TF077 and TF109 is inversely correlated with the capacity of an oleaginous yeast to accumulate lipids or the intermediate metabolites of their synthesis. Similarly, they have observed that overexpression of TF041 and TF109 transcription factors results in a decrease in the amount of succinate produced by an oleaginous yeast strain and that overexpression of TF068 transcription factor results in lower citrate accumulation. The reduction of the expression of at least one of these transcription factors can be obtained by any means known to those skilled in the art, such as, for example, the use of a regulatable promoter or an antisense . Preferably, this reduction is caused by inactivation of the gene encoding said transcription factor. By inactivation or invalidation of a gene of interest (the two terms as used in the present application are synonymous and therefore have the same meaning), is meant according to the invention, any method resulting in the non-expression of the native protein coded by said gene of interest, by modifying the sequence of nucleotides constituting said gene so that even if its translation would be effective, it would not lead to the expression of the native protein encoded by the gene of wild interest.

The alteration of expression of the transcription factor, either by overexpression or by inactivation, causes an impaired accumulation of lipids or at least one intermediate metabolite of their synthesis in the strain of the invention. Preferably, said alteration of transcription factor expression results in an increase in lipid accumulation.

According to the present invention, the accumulation of lipids or an intermediate metabolite is "altered" in an oleaginous yeast strain if it is increased or decreased relative to that of said lipids or intermediate metabolite in a reference strain, such as for example a wild oleaginous yeast strain. The term "increased" as used herein in certain embodiments means a greater amount, for example, a slightly greater amount than the original amount, or for example a large excess amount over to the original quantity, and especially all the quantities in the interval. Alternatively, "increase" may refer to a quantity that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% , 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% more than the quantity or activity for which the quantity or activity increased is compared. The terms increased, greater than, and increased are used interchangeably herein. The term "decrease", as used herein in some embodiments, means a smaller amount, for example, a quantity slightly less than the original amount, or for example a much smaller amount than the amount of origin, and in particular all quantities in the meantime. Alternatively, "decrease" may refer to an amount or activity that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20% less than the quantity or activity for which the decreased quantity or activity is compared. The terms - decreased ", smaller than", and - decreased "are used interchangeably here. By "lipids" is meant any natural liposoluble (i.e., lipophilic) molecule. Lipids are a heterogeneous group of compounds possessing many essential biological functions, these compounds thus acting both as structural components of cell membranes, as energy storage sources or as intermediate molecules in signaling pathways. The lipids may be defined as hydrophobic or amphiphilic small molecules, which originate wholly or in part from ketoacyl or isoprene groups. For an overview of all lipid classes, refer to - Lipid Metabolites and Pathways Strategy (LIPID MAPS) classification system (National Institute of General Medical Sciences, Bethesda, MD). The term "oil" refers to a lipid substance that is liquid at 25 ° C and generally polyunsaturated. In oleaginous organisms, oil constitutes the major part of total lipids and consists mainly of triglycerides. In fact, oleaginous yeasts store their lipids essentially in the form of TAG (80 to 90% of the neutral lipid fraction) and the remainder in the form of steroid esters (SE). As used herein, the term "triacylglycerols" (or "triglycerides" or "triacylglycerides" or "TAG") refers to glycerides in which the three hydroxyl groups of glycerol are esterified with fatty acids. TAGs may contain long-chain polyunsaturated fatty acids (PUFAs) and saturated fatty acids, as well as fatty acids with shorter saturated or unsaturated chains, as well as unusual fatty acids.

An "intermediate metabolite of lipid synthesis" as used herein is a metabolite produced during one of lipid biosynthesis reactions. These biosynthetic reactions in the sense of the present application include not only the Kennedy ring reactions, but also all reactions which are usually considered necessary to produce fatty acids and glycerol. In this regard, reference may be made, for example, to Beopoulos et al. (2011) or Abghari and Chen (2014). The synthesis of TAGs in yeasts, and in particular in oleaginous yeasts such as Y. lipolytica, thus interacts with other metabolic pathways. In particular, acetyl-CoA is formed during the Krebs cycle, during which many intermediate metabolites are formed, including citrate and succinate. For example, it has been shown that citric acid production leads to lipid accumulation in oleaginous yeasts (Beopoulos et al., 2009). The citrate is cleaved with ATP citrate lyase to give oxaloacetate and acyl-CoA, which is the basic unit in TAG synthesis, as explained above. In a particularly advantageous embodiment, the alteration of the expression of the transcription factor of the invention causes an increase in the production of citric acid. The inventors have thus shown that the overexpression of the transcription factors TFO19 and TF072 leads to an increased production of citrate as lipids, while the expression of TF068 is inversely correlated with the production of citrate and lipids. In a still more particularly advantageous embodiment, the strain of the invention is an oleaginous yeast strain in which the TF019 and TF072 transcription factors are overexpressed, said strain being able to accumulate more lipids while producing more citrate. compared to a control strain. In another particularly advantageous embodiment, the subject of the invention is an oleaginous yeast strain in which the expression of transcription factor TF068 is reduced, said strain being able to accumulate more lipids while producing more citrate, always in comparison with a control strain.

In contrast, accumulation of succinate in the cell is generally inversely correlated with lipid accumulation. Indeed, the accumulated succinate, that is to say taken out of the Krebs cycle, would reduce the carbon in the Krebs cycle, which would reduce the usable carbon for the production of lipids. According to another particularly advantageous embodiment, the alteration of the expression of the transcription factor of the invention causes a decrease in the production of succinate. In this regard, the production of succinate increases while the amount of accumulated lipid decreases in the strains overexpressing transcription factors TF077 and TF043. On the other hand, the overexpression of transcription factor TF019 leads to a decrease in succinate production and an increase in the amount of concomitant lipids. In a particularly advantageous embodiment, the strain of the invention is an oleaginous yeast strain in which the expression of at least one of TF077 and TF043 transcription factors is reduced, said strain being able to accumulate more than 10 lipids and less succinate than a control strain. According to another particularly advantageous embodiment, the subject of the invention is an oleaginous yeast strain in which the transcription factor TF019 is overexpressed, said strain being capable of accumulating more lipids, while producing less succinate compared to a control strain.

Finally, in a particularly advantageous embodiment, the subject of the invention is an oleaginous yeast strain in which the TF019 transcription factor is overexpressed, said strain being able to accumulate more lipids, while producing more citrate. and less succinate, compared to a control strain.

Those skilled in the art will readily appreciate that it may be advantageous to introduce additional modifications into the strain of the invention leading to changes in the nature or amount of the lipids produced. The present inventors have thus previously constructed several strains which produce very large quantities of lipids.

For example, they have shown that inactivation of the GUT2 gene results in increased lipid accumulation in yeasts, particularly in Y. lipolytica (WO 2010/004141, Beopoulos et al., 2008). The GUT2 gene encodes the Gut2p isoform of glycerol-3-phosphate dehydrogenase, which catalyzes the oxidation reaction of glycerol-3-phosphate in DHAP. In a preferred embodiment, the oleaginous yeast strain of the invention does not express Gut2p. On the other hand, the inventors have shown that it is possible to obtain lipid accumulation by overexpression of the GPD1 gene in yeasts in which the beta-oxidation of fatty acids is deficient (WO 2012/001144). The GPD1 gene encodes glycerol-3-phosphate dehydrogenase which catalyzes the glycerol-3-phosphate synthesis reaction from DHAP. Thus, in another preferred embodiment, the yeast strain of the invention overexpresses GPD1 and is deficient for beta-oxidation of fatty acids.

Beta-oxidation is the route of degradation of fatty acids. It involves 4 successive reactions during which an acyl-CoA oxidase intervenes whose 6 isoforms are coded by the 6 PDX genes (see Table 2), a multifunctional enzyme encoded by the MFE1 gene and a coded 3-oxoacyl-CoA thiolase. by the gene POT1. As noted above, beta-oxidation in yeasts occurs exclusively in the peroxisome, a cytoplasmic organelle whose biogenesis is controlled by the PEX genes (see Table 3). When the peroxisome is not properly assembled or when it is not functional, the fatty acids are not properly degraded (WO 2006/064131, Thevenieau et al., 2007). In general, the mutations affecting the beta-oxidation according to the invention are loss-of-function mutations which cause a very large decrease, or even a total absence, of beta-oxidation. Loss-of-function mutations according to the invention may correspond to point mutations, insertions, total or partial deletions, gene replacements or any other molecular cause which results in a substantial decrease in beta-oxidation. .

Yeast strains in which beta-oxidation of fatty acids is deficient comprise, within the meaning of the invention, all strains carrying at least one loss of function mutation in at least one gene encoding an enzyme directly involved in beta. -oxidation, but also all strains that carry at least one loss of function mutation which affects the beta-oxidation only indirectly, especially through the biogenesis or function of peroxisomes. It is understood that the strains according to the invention also include all the strains bearing combinations of the mutations described above. For example, also within the scope of the present invention are strains that carry at least one loss of function mutation directly affecting beta-oxidation and at least one loss-of-function mutation affecting beta-oxidation only indirect. Strains deficient in beta-oxidation of fatty acids include, according to a preferred aspect of the invention, any strain carrying a functional loss mutation in one of the PEX genes listed in Table 3. In another preferred aspect of the invention, the deficient strains in beta-oxidation of fatty acids include strains carrying at least one loss of function mutation in one of the following genes: PDX1, PDX2, PDX3, PDX4, PDX5, PDX6, MFE1, POT1 . More preferably, the strains according to the invention comprise at least one loss of function mutation in at least one of the PDX1, PDX2, PDX3, PDX4, PDX5 and PDX6 genes. Even more preferably, the strains according to the invention comprise mutations in each of the PDX1, PDX2, PDX3, PDX4, PDX5 and PDX6 genes.

According to a particular embodiment, the subject of the invention is therefore a new oleaginous yeast strain, preferably a mutant strain of Y. lipolytica, in which the expression of at least one of the transcription factors of the invention. is altered, which overexpresses the GPD1 gene and which has at least one loss of function mutation in one of the genes responsible for the beta-oxidation of the fatty acids, said yeast strain having an impaired accumulation of lipids or at least one intermediate metabolites of the synthesis thereof, especially succinate or citrate, relative to a control strain. Preferably, said strain has an increased accumulation of lipids with respect to said control strain. Advantageously, said yeast strain comprises at least one loss of function mutation in at least one of the genes selected from the PEX, PDX, MFE1 and POT1 genes. More preferably, the PDX genes are partially (PDX2 to PDX5) or totally (PDX1 to PDX6) inactivated in the mutant strain of the invention, said mutant strain having an impaired accumulation of lipids or at least one of the metabolites. intermediates in the synthesis thereof, especially succinate or citrate, relative to a control strain. Preferably, said strain has an increased accumulation of lipids with respect to said control strain. In addition to the mutations of loss of function mentioned above, which lead to a deficiency of beta-oxidation, the yeast strain according to the invention may comprise one or more additional mutations in at least one gene encoding an enzyme involved in the metabolism of acids. fat. This (these) additional mutation (s) may have the effect of further increasing the ability of the strain to accumulate lipids. Alternatively, it (s) can (wind) alter the profile of stored fatty acids.

For example, the TGL3 and TGL4 genes will encode lipases involved in fatty acid degradation (Kurat et al., 2006; WO2012 / 001144). The present inventors have shown that the inactivation of the TGL3 and / or TGL4 genes leads to a greater accumulation of lipids (Dulermo et al., 2013).

The subject of the invention is therefore also an oleaginous yeast strain, preferably a strain of Y. lipolytica, mutant, which overexpresses the GPD1 gene and which is deficient for beta-oxidation, in which the TGL3 and TGL4 genes are inactivated and the expression of at least one transcription factor according to the invention is impaired, said strain having an impaired accumulation of lipids or at least one of the intermediate metabolites of the synthesis thereof, in particular succinate or citrate , compared to a control strain. Preferably, said strain has an increased accumulation of lipids with respect to said control strain. In Y. lipolytica, the main acyl-CoA: diacylglycerol acyltransferase activity is encoded by the yIDGA2 gene (YALIOD07986g) (Beopoulos et al., 2012). This enzymatic activity catalyzes the acylation of sn-1,2-diacylglycerol, a limiting step in the formation of TAGs. The subject of the invention is therefore also an oleaginous yeast strain, preferably a strain of Y. lipolytica, in which the expression of at least one of the transcription factors according to the invention is impaired, which has an impaired accumulation of lipids or at least one of the intermediate metabolites of the synthesis thereof, especially succinate or citrate, relative to a control strain and which, in addition, overexpress the gene yIDGA2. Preferably, said strain has an increased accumulation of lipids with respect to said control strain.

It has also been shown that inactivation of the YALI0810153g gene, which encodes a fatty acid desaturase 012, makes it possible to increase the proportion of C18: 1 fatty acids (WO 2005/047485). It is therefore also an object of the present invention to provide a strain of yeast, in particular oleaginous yeast, preferentially mutant Y. lipolytica, in which the expression of at least one of the transcription factors according to the invention. the invention is altered, which has an impaired accumulation of lipids or at least one of the intermediate metabolites of the synthesis thereof, particularly succinate or citrate, relative to a control strain and which, in addition, comprises a gene YALI0810153g inactivated. Preferably, said strain has an increased accumulation of lipids with respect to said control strain.

According to another embodiment, the yeast strain of the invention, preferentially oleaginous, more preferably Y. lipolytica, mutant, deficient for beta-oxidation, which overexpresses the gene GPD1 and has an impaired accumulation, preferably an accumulation In addition, lipids or at least one of the intermediate metabolites of the synthesis thereof, especially succinate or citrate, additionally contains a gene whose expression allows the fatty acid profile of said strain to be modified. It has indeed been reported that the ectopic expression of genes encoding certain desaturases makes it possible to modify the polyunsaturated fatty acid profile in a yeast strain and in particular in Y. lipolytica. Thus, the expression of a 012 fatty acid desaturase makes it possible to obtain C18: 2 fatty acids in greater quantity (WO 2005/047485). Similarly, the expression of a, M desaturase or a desaturase leads to a change in the fatty acid profile in Y. lipolytica (WO 2005/047480; WO 2006/012325). The subject of the invention is therefore also a yeast strain, in particular an oleaginous yeast, preferably Y. lipolytica, mutant strain, in which the expression of at least one of the transcription factors according to the invention is impaired, which presents an altered accumulation of lipids or at least one of the intermediate metabolites of the synthesis thereof, especially succinate or citrate, relative to a control strain and which, in addition, expresses a gene encoding an enzyme selected from a, M desaturase, a 012 desaturase and a 015 desaturase. Preferably, said enzyme is a 012 desaturase. Even more preferably, the gene encoding said O12 desaturase is the Y. lipolytica gene whose accession number is YALIOB10153g. More and more preferably, said strain has an increased accumulation of lipids with respect to said control strain.

It will be readily apparent to those skilled in the art that the mutations described above may be combined to create strains in which the alteration of the expression of at least one of the transcription factors of the invention will result in a greater alteration of lipid accumulation and, in particular, an even greater accumulation of lipids. For example, it may be advantageous to delete all six PDX genes while overexpressing the yIDGA2 gene. Alternatively, deletion of PDX1-6 can be combined with inactivation of TLG3 and / or TLG4 genes. Of course, the PDX1-6 genes may be inactivated in a strain otherwise containing inactivation of the TLG3 and / or TLG4 genes and overexpressing the yIDGA2 gene. Advantageously, these strains further overexpress the GPD1 gene. Thus the invention more generally relates to an oleaginous yeast strain comprising any combination of modifications described above, in which the expression of at least one transcription factor selected from TF001, TF004, TF007, TF015, TF019 , TF021, TF024, TF031, TF033, TF038, TF039, TF040, TF041, TF043, TF051, TF052, TF055, TF060, TF064, TF068, TF070, TF072, TF074, TF075, TF077, TF078, TF079, TF084, TF085, TF086 TF087, TF089, TF109 and TF126 are altered, and have an impaired accumulation of lipids or at least one of the intermediate metabolites of the synthesis thereof, particularly succinate or citrate, compared to a control strain. . Preferably, said strain has an increased accumulation of lipids with respect to said control strain. The subject of the invention is also a process for obtaining a yeast strain in which the expression of at least one transcription factor selected from TF001, TF007, TF019, TF021, TF024, TF031, TF033, TF038, TF039, TF040, TF043, TF055, TF060, TF064, TF068, TF072, TF075, TF077, TF079, TF084, TF085, TF086, TF087, TF109 and TF126 is altered, said strain being capable of accumulating lipids. Preferably, said yeast is an oleaginous yeast. More preferably, this yeast is selected from R. glutinis, R. toluroides and Y. lipolytica. Even more preferentially, it is Y. lipolytica. The process of the invention thus comprises a step of transforming an oleaginous yeast strain, in particular Y. lipolytica, with at least one polynucleotide allowing the expression of a transcription factor chosen from TF001, TF004 to be altered, TF007, TF015, TF019, TF021, TF024, TF031, TF033, TF038, TF039, TF040, TF041, TF043, TF051, TF052, TF055, TF060, TF064, TF068, TF070, TF072, TF074, TF075, TF077, TF078, TF079 , TF084, TF085, TF086, TF087, TF089, TF109 and TF126. In a first embodiment, the transcription factor of the invention is overexpressed by any means known to those skilled in the art. In other words, said polynucleotide makes it possible to increase the expression of said transcription factor.

For this purpose, each copy of the open reading phase encoding said transcription factor is placed under the control of appropriate regulatory sequences. Said regulatory sequences comprise promoter sequences placed upstream (5 ') of said open reading phase, and terminator sequences placed downstream (3') of said open reading phase. Preferably, the promoter and terminator sequences used belong to different genes so as to minimize the risks of unwanted recombination in the genome of the Yarrowia strain. Such promoter sequences are well known to those skilled in the art and can correspond in particular to inducible or constitutive promoters. By way of example of promoters that can be used in the process according to the invention, mention may be made in particular of the promoter of a Y. lipolytica gene which is strongly repressed by glucose and which is inducible by fatty acids or triglycerides such as that the PDX2 promoter of the Yarrowia lipolytica acyl CoA oxidase 2 gene and the LIP2 gene promoter described in PCT application WO 01/83773. The promoter of the FBA1 gene of the fructose-bisphosphate aldolase gene (US 2005/0130280), the promoter of the phosphoglycerate GPM mutase gene (WO 2006/0019297), the promoter of the transporter gene gene YAT1 can also be used. ammonium (US 2006/0094102 A1), the GPAT gene promoter of the glycerol-3-phosphate 0-acyltransferase gene (US 2006/0057690 A1), the TEF gene promoter (Müller et al., 1998, US 2001 / 6265185), the hybrid promoter hp4d (WO 96/41889), the XPR2 hybrid promoters described in Mazdak et al. (2000) or the hybrid promoters UAS1-TEF and UAStef-TEF described in Blazeck et al. (20011, 2013). Such terminator sequences are also well known to those skilled in the art and, by way of example of terminator sequences that may be used in the process according to the invention, the terminator sequence of the PGK1 gene, the terminator sequence of the LIP2 gene, may be mentioned. described in PCT application WO 01/83773. Overexpression of the transcription factor of interest can be achieved by replacing sequences controlling the expression of the gene encoding said transcription factor with regulatory sequences allowing for stronger expression, such as those described above. Those skilled in the art can thus replace the copy of the gene encoding said transcription factor in the genome, as well as its own regulatory sequences, by transforming the mutant yeast strain with a linear polynucleotide comprising the open reading phase in question under the control of regulatory sequences such as those described above.

Advantageously, said polynucleotide is flanked by sequences that are homologous to sequences located on either side of the chromosomal gene. Since this recombination event is rare, selection markers are inserted between the sequences ensuring the recombination in order to allow, after transformation, to isolate the cells where the integration of the fragment has occurred by highlighting. corresponding markers. Preferably, the transcription factor whose expression is increased is chosen from TF001, TF004, TF015, TF019, TF021, TF024, TF031, TF033, TF039, TF040, TF041, TF043, TF051, TF052, TF070, TF072, TF074, TF077. , TF078, TF079, TF084, TF085, TF086, TF087 TF089, TF109 and TF126. According to a more preferred embodiment, said transcription factor is chosen from TF001, TF019, TF021, TF024, TF031, TF033, TF039, TF040, TF072, TF079, TF084, TF085, TF086, TF087 and TF126. In another equally preferred embodiment, the transcription factor is selected from TF004, TF015, TF043, TF051, TF052, TF070, TF074, TF077, and TF078. Finally, according to yet another most preferred embodiment, the transcription factor is selected from the group consisting of TF015, TF041, TF072, TF078, TF089, and TF109. Advantageously, the overexpression of the gene coding for said transcription factor is obtained by introducing into the yeast strain of the invention supernumerary copies of said gene under the control of regulatory sequences such as those described above. Said additional copies of said gene may be carried by an episomal vector, that is to say capable of replicating in yeast. Preferably, they are carried by an integrative vector, that is to say integrating at a given place in the genome of the yeast (Madzak et al., 2004).

In this case, the polynucleotide comprising the GPD1 gene under the control of regulatory regions is integrated by targeted integration. Targeted integration of a gene into the genome of a yeast is a frequently used molecular biology technique. In this technique, a DNA fragment is cloned into an integrative vector, introduced into the cell to be transformed, which DNA fragment then integrates by homologous recombination into a targeted region of the recipient genome (Orr-Weaver et al. , nineteen eighty one). Such transformation methods are well known to those skilled in the art and are described, in particular, in Ito et al. (1983), in Klebe et al. (1983) and in Gysler et al. (1990). Since this recombination event is rare, selection markers are inserted between the sequences ensuring the recombination in order to allow, after transformation, to isolate the cells where the integration of the fragment has occurred by putting into effect evidence of corresponding markers.

They can also be carried by PCR fragments whose ends have homology with a given yeast locus, thus allowing the integration of said copies into the yeast genome by homologous recombination. Any transfer method known from the prior art can be used to introduce the overexpression cassette of the transcription factor of the invention into the yeast strain. Preferably, the lithium acetate and polyethylene glycol method may be used (Gaillardin et al., 1987, Le Dalt et al., 1994). According to the invention, it is possible to use any known method of selection of the prior art compatible with the gene (or genes) marker (s) used, any strain expressing the selected marker gene being potentially a yeast strain. defective in ADE2, URA3 or LEU2 gene. Selection markers for the complementation of auxotrophy, also commonly referred to as auxotrophy markers, are well known to those skilled in the art. The selection marker URA3 is well known to those skilled in the art. More specifically, a strain of Y. lipolytica whose URA3 gene (said sequence is also accessible by accession number YALIOE26719g at http: //www.genolevures.org/ "), encoding orotidine-5 25-decarboxylase phosphate, is inactivated (for example by deletion), will not be able to grow on a medium not supplemented with uracil. The integration of the selection marker URA3 in this strain of Y. lipolytica will then restore the growth of this strain on a medium devoid of uracil. The selection marker LEU2 described in particular in US Pat. No. 4,937,189 is also well known to those skilled in the art. More specifically, a Y. lipolytica strain whose LEU2 gene (YALIOE26719g), encoding 8-isopropylnnalate dehydrogenase, is inactivated (eg by deletion), will not be able to grow on medium not supplemented with leucine. Like before. The integration of the selection marker LEU2 in this strain of Y. lipolytica will then restore the growth of this strain on a medium not supplemented with leucine.

The ADE2 selection marker is also well known to those skilled in the field of yeast transformation. A Yarrowia strain whose ADE2 gene (YAL10823188g), coding for phosphoribosylaminoimidazole carboxylase, is inactivated (for example by deletion), will not be able to grow on a medium not supplemented with adenine. Again, the integration of the ADE2 selection marker in this strain of Y. lipolytica will then restore the growth of this strain on a medium not supplemented with adenine. According to another embodiment of the method of the invention, the expression of said transcription factor is decreased relative to a wild-type strain. In other words, the polynucleotide introduced into the oleaginous yeast strain, in particular Y. lipolytica, leads to a decrease in the expression of the transcription factor. In this embodiment, the transcription factor will advantageously be selected from TF007, TF038, TF041, TF043, TF055, TF060, TF064, TF068, TF075, TF077, and TF109. According to a preferred embodiment, said transcription factor is chosen from TF007, TF038, TF043, TF055, TF060, TF064, TF068, TF075, TF077 and TF109.

According to another preferred embodiment, the transcription factor is TF041 or TF109. Finally, according to a third embodiment that is also preferred, the transcription factor is TF068. The reduction of the expression of said factor may be obtained by any means known to those skilled in the art suitable for this purpose. Examples include the use of promoters that can be repressed or that of antisense. Preferably, the decrease in the expression of said transcription factor will be obtained by inactivation of the gene encoding said transcription factor. Several methods for inactivating a gene of interest in yeast, and in particular in oleaginous yeast, are thus known in the prior art.

For example, the so-called POP IN / POP OUT method which has been used in yeasts, particularly in Y. lipolytica, for the deletion of the LEU2, URA3 and XPR2 genes as described in the Barth et al. (1996). It consists of integrating a vector comprising a gene of deletion interest at the locus in question, then selecting the excision of said vector and identifying a clone which, by recombination, has eliminated the wild-type gene and conserved the mutated gene. Preferably, according to the invention, a method leading to the inactivation of the gene of interest can be used.

By inactivation or invalidation of a gene of interest (the two terms as used in the present application are synonymous and therefore have the same meaning) is meant according to the invention, any method resulting in the non-expression of the gene. native protein coded by said gene of interest, by modifying the sequence of nucleotides constituting said gene so that even if its translation would be effective, it would not lead to the expression of the native protein coded by the gene of wild interest. Preferably, according to the invention, a method leading to a total extinction of the expression of the gene of interest is used. This can be achieved by a total deletion of the gene of interest, by a partial deletion of the gene of interest, by the insertion of one or more nucleotides in said gene of interest, said method used making the gene of non-functional interest (gene of interest inactivated or invalidated), at least coding a protein not having the properties of said native protein. This gives a yeast strain that does not express the gene of interest that will be named later in the present text "defective strain gene of interest". It is also possible to use the SEP method (Maftahi et al., 1996) which has been adapted from Y. lipolytica for the successive disruption of PDX genes (Wang et al., 1999). This method is faster, but still requires the use of a counter-selection marker. Advantageously, according to the invention, the SEP / Cre method developed by Fickers et al. (2003) and described in international application WO2006 / 064131. It is a fast method and does not require the use of a marker allowing against selection. This method consists in: 1) selecting the gene of interest to be deleted, 2) constructing a PCR ("Polymerase Chain Reaction") or cloning disruption cassette, 3) introducing a selection marker containing on either side of the recombination sequences (advantageously loxP and / or loxR or derived sequences) allowing recombination between them for the removal of the marker (advantageously a loxP-type sequence which allows the recombination under the action of recombinase Cre), 4) select the strains with the deleted gene of interest (transformation and selection of the transformants) and verify the deletion, 5) transform with a vector allowing the expression of the recombinase (advantageously Cre recombinase which allows recombination of the loxP / (oxR) sequences and removal of the marker) 6) isolate a clone having the deletion of the gene of interest and having lost the expression plasmid of recombinase. The insertion cassette of step 2 comprises a gene coding for a selection marker (selection gene), said gene being preferentially surrounded by the promoter and terminator regions of the gene of interest, so as to allow the complete replacement of the gene. gene of interest by homologous recombination. According to a particular embodiment, the selection gene is further flanked by one or more recombination sequences, said recombination sequences allowing recombination between them leading to the elimination of the gene coding for the selection marker. Advantageously, the recombination sequence (s) is (or is) a loxP sequence (s) or a loxR sequence (s) or (a) derivative sequence (s). ) of these recombination sequences, said (said) sequence (s) derived (s) having retained (s) the activity of the original recombination sequences. Preferably at this stage, the gene coding for the selection marker may be flanked by loxP-type sequences which, under the action of the Cre recombinase, recombine with each other allowing the excision of the sequence of the gene coding for said selection marker. . The introduction of the invalidation cassette in step 3 into the recipient yeast strain can be done by any technique known to those skilled in the art.

As noted above, reference is made to G. Barth et al. (1996). Transformants expressing the selection marker are selected in step 4. The presence of the marker can be verified by any usual method known to those skilled in the art, such as for example PCR or Southern blot hybridization.

In step 5, a plasmid allowing the expression of a recombinase is introduced into a transformant selected in the preceding step. Preferentially, the plasmid will carry the Cre recombinase gene (Sauer, 1987) which allows the recombination of the loxP / IoxR sequences and the elimination of the marker. This technique is commonly used by those skilled in the art seeking to excise a specific integrated sequence (Hoess and Abremski, 1984). Step 6 is a standard step of selecting a clone having excised the selection gene and thus having an absence phenotype of the selection marker. Each of these embodiments may be repeated as many times as necessary.

According to an even more preferred embodiment, the method of the invention makes it possible to construct strains in which the expression of several transcription factors of the invention is impaired. For example, it is possible to construct strains in which the expression of several transcription factors according to the invention is overexpressed. Similarly, it is possible to construct strains in which the expression of several transcription factors is decreased, preferably by inactivation of the genes encoding said transcription factors. Finally, it is possible to construct strains in which the expression of at least one transcription factor is increased and the expression of at least one other transcription factor is decreased.

According to yet another preferred embodiment, the method of the invention may comprise additional steps to alter the expression of at least one other gene involved in lipid accumulation. Advantageously, the method of the invention will thus comprise a step in which at least one construct making it possible to overexpress a gene selected from GPD1 and DGA2 is introduced into the strain of the invention. Preferably, a construction for overexpressing GDP1 and a construction for overexpressing DGA2 are introduced together into said strain of the invention. According to another preferred embodiment, at least one of the genes controlling beta-oxidation is inactivated in the strain of the invention. As noted above, these genes are the MFE1, POT1 and PDX genes (Table 2) and the PEX genes (Table 3).

Table 2: Genes participating in the metabolism of fatty acids in yeast, in particular Y. lipolytica. The sequence of each of the corresponding genes or proteins is available from the name of the gene or its accession number on the Genolevures website (http://www.genolevures.org/). Gene Name No. EC Function GUT1 YALIOF00484g EC 2.7.1.30 Glycerol kinase GPD1 YALIOB02948g EC 1.1.1.18 Glycerol-3-phosphate dehydrogenase (NAD (+)) GUT2 YALIOB13970g EC 1.1.99.5 Glycerol-3-phosphate dehydrogenase SCT1 YALI0000209g EC 2.3.1.15 Glycerol-3-phosphate acyltransferase SLC1 YALIOE18964g EC 2.3.1.51 1-acyl-sn-glycerol-3-phosphate acyltransferase DGA1 YALIOE32769g EC 2.3.1.20 Diacylglycerol acyltransferase LRO1 YALIOE16797g EC 2.3.1.158 Phospholipid: diacylglycerol acyltransferase TGL3 YALIOD17534g EC 3.1.1.3 Triacylglycerol lipase TGL4 YALIOF10010g EC 3.1.1.3 Triacylglycerol lipase ARE1 YALIOF06578g EC 2.3.1.26 Acyl-CoA: sterol acyltransferase DGA2 YALIOD07986g EC 2.3.1.20 Diacylglycerol acyltransferase TGL1 YALIOE32035g EC 3.1.1.13 Cholesterol esterase PDX1 YALIOE32835g EC 6.2.1.3 Acyl-coenzyme A oxidase PDX2 YALIOF10857g EC 6.2.1.3 Acyl coenzyme A oxidase PDX3 YALIOD24750g EC 6.2.1.3 Acyl coenzyme A oxidase PDX4 YALIOE27654g EC 6.2.1.3 Acyl coenzyme A o 6.2.1.3 Acyl-coenzyme A oxidase PDX6 YALIOE06567g EC 6.2.1.3 Acyl-coenzyme A oxidase MFE1 YALIOE15378g EC 4.2.1.74 Multifunctional protein for beta-oxidation POT1 YALI018568g EC 2.3.1.16 Peroxisomal Oxoacyl Thiolase Table 3: Genes participating in the metabolism of peroxisome in yeast, especially Y. lipolytica. The sequence of each of the corresponding genes or proteins is available from the gene name or accession number on the Genolevures site (http://www.genolevures.org/). Gene Accession number. this revisiae Accession number Y. lipolytica Function PEX1 YKL197c YALIOC15356g AAA-peroxin PEX2 YJL210W YALIOF01012g RING-finger peroxin working in the import of proteins into the peroxisomal matrix PEX3 YDR329c YALIOF22539g Peroxisomal membrane protein (PMP) PEX4 YGR133w YALIOE04620g Peroxisomal conjugation enzyme conjugate to ubiquitin PEX5 YDR244w YALIOF28457g membrane receptor peroxisomal PEX6 YNL329c YALIOC18689g AAA-peroxine PEX7 YDR142c YALIOF18480g receiver peroxisomal PEX8 YG R077c / Organizer intrapéroxisomal machinery importing peroxisomal 3028527 28 PEX9 / YALIOE14729g membrane integral protein peroxisomal PEX10 YDR265w YALI0001023g E3 Ligase peroxisomal membrane ubiquitin PEX11 YOL147c YALI0004092g Peroxisomal membrane protein PEX12 YMR026c YALIOD26642g Peroxisomal membrane type C3HC4 RING-finger peroxin PEX13 YLR191w YALI0005775g Integral peroxisomal membrane protein PEX14 YGL153w YALIOE9405g Peroxisomal membrane peroxisomal PEX15 YOL044w / Integral peroxisomal membrane type II protein PEX16 / YALIOE16599g Peroxin peripheral membrane Intraperoxisonal PEX17 YNL214w / Peroxisomal membrane peroxin PEX18 YHR160c / Peroxin PEX19 YDL065c YALI0822660g Import chaperone receptor PEX20 / YALIOE06831g Peroxin PEX21 YGR239c / Peroxin PEX22 YAL055w / Putative Protein PEX23 peroxisomal membrane PEX30 (YLR324w) YALIOD27302g Peroxisomal Integral Peroxisomal PEX31 Peroxin (YGROO4w) PEX32 3028527 29 (YBR168w) PEX25 YPL112c YALIOD05005g Peroxisomal Membrane Peripheral Protein PEX27 YOR193w / Peripheral Protein peroxisomal membrane PEX28 YHR150w YALIOD11858g Integral membrane peroxin YALIOF19580g peroxisomal PEX29 YDR479c YALIOF19580g Peroxisomal whole membrane peroxisomal PEX30 YLR324W YALIOD27302g Integral peroxisomal membrane protein PEX3 / YGROO4W YALIOD27302g P Integral rotin of the peroxisomal membrane PEX32 YBR168w YALIOD27302g Integral protein of the peroxisomal membrane In this particular embodiment, the method of the invention comprises in particular a step of inactivation of at least one gene controlling the beta-oxidation, characterized in that in a first step, an invalidation cassette is constructed comprising the promoter and terminator sequences of said yeast gene, particularly oleaginous yeast, more particularly Y. lipolytica, flanking a gene encoding a selection marker (selection gene ), said selection gene being itself framed on either side of its sequence by a recombination sequence (s), said recombination sequences allowing recombination between them leading to the elimination of said gene encoding the selection marker; In a second step, introducing said invalidation cassette obtained in 1, in a yeast strain, particularly an oleaginous yeast strain, more particularly Y. lipolytica; in a third step, one of the yeast strains transformed in step 2 is selected from a yeast strain, particularly an oleaginous yeast strain, more particularly a strain of Y. lipolytica, defective for the gene of interest, strain having introduced by double recombination (double cross-over) the marker gene in place of said gene of interest, thus leading to an inactivated gene; In a fourth step, the invalidation of said gene in said yeast strain selected in step 3 is verified. According to a variant of the invention, the method may also have two additional steps, namely: a fifth step during from which said strain selected in step 4 is transformed with a vector allowing the expression of a recombinase in order to obtain the elimination of the gene expressing the selection marker; a sixth step, during which isolates a defective yeast strain for the gene, and no longer expressing the marker gene.

The method of inactivating a beta-oxidation gene may then be repeated so as to inactivate another gene, if necessary. The person skilled in the art will thus be able to inactivate as many genes as necessary, by simply repeating the SEP gene inactivation process. Said person can thus construct the mutant yeast strains described above, which comprise several inactivated genes.

According to the invention, it will advantageously be possible to use a yeast strain which will not perform beta-oxidation of lipids, for example a strain which will not express the genes responsible for the beta-oxidation of lipids, such as the PDX and MFE1 genes. or POT1, advantageously a strain which does not express the PDX genes, at least the PDX2, PDX3, PDX4 and PDX5 genes, preferentially the PDX1, PDX2, PDX3, PDX4, PDX5 and PDX6 genes, for example the described strains. in the international application WO 2006/064131 published on June 22, 2006, preferably the strains: - MTLY37 (Leu ', Ura ±; epox5, toox2, toox3, toox4 :: URA3), - MTLY40 (Leu', Ura-; pox5-PT, pox2-PT, pox3-PT, pox4 :: ura3-41), - MTLY64 (Leu-, Ura-; Hyg +; toox5, toox2, toox3, toox4 :: ura3-41, leu2 :: Hyg), 5-MTLY66 (Leu-, Ura- to epox5, toox2, toox3, toox4 :: ura3-41, to leu2), MTLY82 (Leu-, Ura-Nye, toox5, toox2, toox3, toox4 :: ura3-41, at leu2, pox1 :: Hyg), MTLY86 Leu-, Ura-; àpox5; atox2, atox3, atox4 :: ura3-41, atleu2, atox1), - MTLY92 (Leu-, Ura-; Hyg +; atox5, atox2, atox3, atox4 :: ura3-41, atle2, 10 atox1, pox6 :: Hyg) - MTLY95a (Leu-, Ura-; toox5, toox2, toox3, toox4 :: ura3-41, to leu2, toox1, toox6) In another aspect of the invention, it will also be possible to use a yeast strain such as those described above. in PCT application WO 2010/004141, published on January 14, 2010. For example, it is possible to use the strains: - JMY1351 (Leu-, Lira ', atox5, atox2, atox3, atox4 :: ura3-41, atleu2, atox1, to Pox6, togut2) - JMY1393 (Leu-, Lira ', toox5, toox2, toox3, toox4 :: ura3-41, toox1, toox6, togut2).

In yet another aspect of the invention, the strains described in the publications Béopoulos et al. (2008, 2012), Dulermo et al. (2013) and Wang et al (1999). The invention also relates to the use of an oleaginous yeast strain, especially Y. lipolytica, for the synthesis of lipids, particularly free fatty acids and triacylglycerols. In a more particularly preferred aspect, the subject of the invention is the use of an oleaginous yeast strain, preferably a Y. lipolytica strain, in which the expression of at least one of the transcription factors of the invention. is altered, as described above, for the synthesis of free fatty acids and triacylglycerols.

The present invention also relates to a lipid synthesis method in which: in a first step, a yeast strain according to the invention is cultured in a suitable medium and in a second stage the lipids produced are harvested by the culture of step 1.

In addition to the foregoing, the present invention also includes other features and advantages which will become apparent from the following Examples and Figures, which should be considered as illustrating the invention without limiting its scope. Legends of the Figures 10 Figure 1: Diagram of the JMP1490 vector for the creation of a Zeta platform at the URA3 locus. It contains the upstream (Pura3_CDS) and downstream (Tura3_CDS) regions of the URA3 gene, the LEU2 selection marker for Y. lipolytica, the Zeta regions for the integration of the expression cassette and the RedStar2 fluorescence marker under the control of the pTEF promoter. It contains the ColE1 origin of replication and the selection marker for kanamycin (KanR) for selection in E. coli. Figure 2: Schematic of the acceptor vector JMP1529 for integrating a gene of interest. It contains the URA3 selection marker for Y. lipolytica, Zeta regions for integration of the expression cassette, the pTEF promoter for constitutive expression of the gene of interest as well as the selection marker for chlorannphenicol ( CmR) and the ccdB toxicity gene flanked by the recombination sequences (attR). It contains the ColE1 origin of replication and the selection marker for ampicillin (AmpR) for selection in E. coli. Figure 3: Construction of the expression vectors for the construction of the ORFeome of Y. lipolytica. Donor vectors from the cDNA library (Mekouar et al., 2010) or specific vectors containing a gene of interest (X gene) flanked by attL recombination sequences which allow in vitro recombination with the attR sequences of acceptor vector JMP1529. The expression vector obtained contains the gene of interest under the control of the constitutive pTEF promoter. It contains the selection markers AmpR for E. coli and URA3 for Y. lipolytica. Figure 4: Schematic of the expression cassette and the ura3-1490 locus. A. Diagram of the Interest Gene Expression Cassette Digested by Notl or Iceul Restriction Enzymes. It contains the Zeta regions for the integration of the expression cassette, the gene of interest under the control of the constitutive promoter pTEF as well as the selection marker URA3 for Y. lipolytica. B. Scheme of the ura3-1490 locus in the recipient strain JMY2566. It contains the zeta integration platform of the recombinantly integrated JMP1490 vector at the URA3 locus. It contains the LEU2 selection marker for Y. lipolytica, Zeta regions for integration of the expression cassette and the RedStar2 fluorescence marker under the control of the pTEF promoter. C. Scheme of the ura3 locus in the recipient strain JMY2566 after recombination integration of the expression cassette of a gene of interest into the Zeta platform. The double arrows correspond to the size of the fragments amplified by PCR with the ATTR2zetaUP / Turadown pair of primers in the case of random integration (2680bp) or integration at the locus (> 4000bp and 1052bp). Figure 5: Verification of the integration of the expression cassette. PCR product electrophoresis gel amplified with the pair of ATTR2zetaUP / Turadown primer pairs for 5 independent transformants making it possible to discriminate between an integration with the Zeta platform (1052bp fragment) and a random integration (2680bp fragment). M: 1Kb DNA ladder molecular weight marker. Figure 6: Expression of fluorescent proteins. Phenotype of the validation strains of the overexpression system. Fluorescence microscopy images of strain JMY2812 constitutively overexpressing RedStar2 and EYFP proteins; Top frame: red fluorescence of the RedStar2 (Texasred filter); middle frame: green fluorescence of EYFP (YFP filter); bottom frame: image of cells in white light with phase contrast (DIC).

Figure 7: Expression of the extracellular alkaline protease. Image of colonies showing in the form of halos, the degradation of milk proteins by the AEP protein encoded by the XPR2 gene. Wild strain W29, strain JMY2810 deleted for the XPR2 gene and the strain JMY2813 overexpressing the XPR2 gene. Figure 8: Expression of SUC2 invertase of S. cerevisiae. Growth curve in microplate of strains JMY2810 (control) and JMY2815 (overexpressing invertase SUC2) on minimal medium YNBsuc sucrose 0.5%.

3028527 34 Figure 9: Frequency of transformation and type of integration. Graphical representation of the number of transformants according to the transformation protocol used (Protocol A and Protocol B), the strain (JMY2033 and JMY2566) and the gene (1: RedStar2 gene; 2: SUC2 gene). The number of transformants with integration to the Zeta platform is shown in black. The number of transformants with random integration is shown in gray. Figure 10: Distribution of extracellular alkaline protease activity. Protease activity measured with FTC-casein for 96 transformants. Distribution of Vmax activity and number of transformants by level of activity. Casein-FTC was used to measure protease activity in microplates using a microplate reader (Bioteck), with an excitation wavelength at 494 nm and a wavelength of emission at 517 nm every minute for 1 hour. The Vmax was calculated with a sliding window of 30 points. The number of clones for each range of Vmax is indicated above each bar.

Figure 11: Lipid accumulation. Graphical representation of the percentage change in the level of intracellular total lipid accumulation as a function of the strain studied compared to the control strain JMY2810. The graph comprises 14 strains over-accumulating lipids (black bars, TF001, TF072, TF039, TF084, TF019, TF079, TF087, TF086, TF126, TF040, TF024, TF031, TF033, TF085 and TF021 in decreasing order) and 11 strains accumulating less lipids (white bars, TF060, TF007, TF043, TF038, TF055, TF075, TF077, TF109, TF064, TF068 and TF099 in descending order) Figure 12: Effect of transcription factors on the activity of the TEF promoter. A, Transformant growth curves expressing different transcription factors (OD600). B. Expression of Fluorescence at 558 / 586nm. W29 (white square): wild strain; JMY2810 (gray rhombus): JMY2566 transformed with a vector without transcription factor; Mutants of interest (white triangle, black triangle, gray square and gray round): JMY2566 transformed with transcription factors (TFxx,).

Figure 13: Typical profiles of transcription factor-dependent TEF promoter activity. A. Expression profiles of RedStar2 under the control of the constitutive pTEF type 1 promoter. Overexpression of RedStar2 in the exponential growth phase. Representative fluorescence kinetics of strains TF046, TF068 and 3028527 TF099 (black triangles), control strain JMY2810 (gray diamonds) and wild strain W29 (white squares). B. Expression profiles of RedStar2 under the control of the constitutive pTEF type 2 promoter. Overexpression of RedStar2 in stationary growth phase. Representative fluorescence kinetics of strains TF090, TF110 and TF126 (white triangles), control strain JMY2810 (gray diamonds) and wild strain W29 (white squares). C. Speed of expression of RedStar2 as a function of the different growth phases: exponential phase (phase 1); end of exponential phase (phase 2), stationary phase (phase 3). Figure 14: Production of succinate. Graphical representation of the percentage change in the level of succinate production as a function of the strain studied compared to the control strain JMY2810. The graph comprises 9 overproducing strains of succinate (black bars, TF078, TF077, TF070, TF051, TF052, TF015, TF074, TF043, and TF004 in descending order) and 3 strains sub-producing succinate (white bars, TF041, TF099 and TF019 in descending order).

EXAMPLE MATERIALS AND METHODS STRAINS AND MEDIA The Escherichia coli TOP10 and DH5α (Invitrogen) strains were used for the transformation and amplification of recombinant plasmid DNA. Cells were cultured on LB medium (Sambrook et al., 2001) at 37 ° C. Depending on the resistance marker, kanamycin (50 μg / nnL) or ampicillin (100 μg / nnL) were used for plasmid selection. The mutant strains of Y. lipolytica are derived from the auxotrophic strain Po1d (Nicaud et al., 2002), itself derived from the wild type strain W29 (genotype MatA, ATCC20460) (Barth and Gaillardin, 1996). The strains used and produced in the present invention are shown in Tables 4 and 5. Their construction is described below.

Table 4: E. coli Strains E. E. Genotype Number References Plasmid Neck JME1226 JMP1226 KanR PTura3-LEU2ex-Zeta Lazar et al.

2013 JME1490 JMP1490 JMP1426 pTEF-RedStar2 This JME1521 JMP1521 work JMP62 pTEF-URA3ex AmpR and ORI This work PBR322 JME1529 JMP1529 JMP1521-ccdB cassette Gateway This work JME1488 pDONR207 Vector Gateway Invitrogen® JME1592 JMP1592 pDONR207-XPR2 This Work JME1593 JMP1593 pDONR207-SUC2 This Work JME1594 JMP1594 pDONR207-eYFP This Work JME1595 JMP1595 pDONR207-RedStar2 This Work JME1598 JMP1598 JMP1529-SUC2 This Work JME1599 JMP1599 JMP1529-eYFP This Work JME1600 JMP1600 JMP1529-RedStar2 This Work JME1603 JMP1603 JMP1529-XPR2 This Work JMP911 JMP911 JMP62 URA3ex pPDX eYFP c-ter this work JME1394 JMP1394 JMP62 LEU2ex pTEF-RedStar2 Kabran et al.

2012 JME1469 JMP1469 JMP62 URA3ex-pTEF-SUC2 Lazar et al.

2013 JME1030 PDEST14 Destination vector Gateway Invitrogen® 5 3028527 37 Table 5: Y. lipolytica strains Y. strain Genotype References lipolytica JMY195 (Pol d) MATa ura3-302 leu2-270 xpr2-322 Barth and Gaillardin (pXPR2-SUC2 at locus URA3) (1996) JMY2566 MATa ura3 :: pTEF-RedStar2-LEU2ex-Zeta This work leu2-270 xpr2-322 JMY2810 MATa ura3 :: pTEF-RedStar2-LEU2ex-ZetaURA3ex-pTEF leu2-270 xpr2-322 This work JMY2811 MATa ura3 :: pTEF-RedStar2-LEU2ex-ZetaURA3ex-pTEF-RedStar2 leu2-270 xpr2- This work 322 JMY2812 MATa ura3 :: pTEF-RedStar2-LEU2ex-ZetaURA3ex-pTEF-eYFP leu2-270 xpr2-322 This work JMY2813 MATa ura3: : pTEF-RedStar2-LEU2ex-ZetaURA3ex-pTEF-XPR2 leu2-270 xpr2-322 This work JMY2815 MATa ura3 :: pTEF-RedStar2-LEU2ex-ZetaURA3ex-pTEF-SUC2 leu2-270 xpr2-322 This work JMY2033 MATa ura3 :: pTEF This work has been described by Barth et al. (1996). The minimum medium YNB is composed of 0.17% (w / v) yeast nitrogen base (without ammonium sulfate and amino acids, YNByvvv, Difco, Paris, France), 0.5% (w / v) NH4Cl, 1% (w / v) and 50nnM phosphate buffer (pH 6.8). This medium is supplemented with 0.5% to 3% glucose (w / v; YNBgIu) or 0.5% to 3% glycerol (v / v; YNBgIy), or 0.5% sucrose (p YNBsuc) or 0.5% to 3% oleic acid (v / v; YNBao), or 1 .6% skimmed milk (w / v; YNBsm) and supplemented with 0.01% uracil (w / v) for the 10 auxotrophic strains. Yeast cells were cultured on YPD (Barth et al., 1996) or YNBCas (YNBD with 0.2% casamino acid) media for the selection of Ura + transformants. For cultures in solid medium, the media are supplemented with 1.5% (w / v) agar. General techniques of molecular biology Conventional molecular biology techniques have been used in this study (Sambrook et al., 2001). The restriction enzymes come from OZYME (Saint-Quentin-en-Yvelynes, France). Yeasts are transformed by the lithium acetate method (Le Dalt et al., 1994). The genomic DNA of the transformants is prepared according to the method of Querol (Querol et al., 1992). The PCRs are carried out with an Eppendorf 2700 thermocycler with GoTaq polymerase (Promega), TaKaRa Ex Tag 'or PyroBest (Takara). The PCR fragments are purified either from PCR with the QIAgen Purification Kit, or from the agarose gel with the QlAquick Gel Extraction Kit (Qiagen, Courtaboeuf, France). Genomic DNA Extraction of Yarrowia lipolytica Strains of Yarrowia lipolytica (wild strain W29 or mutant strains) are grown on a plate in YPD medium 24h at 28 ° C. For each strain, a colony is removed and transferred to 200 μL PCR tube in 10 μl of 0.02N NaOH solution. Each tube is incubated in a thermal cycler for 5 minutes at 100 ° C. The tubes are then immediately placed in ice, then centrifuged briefly to recover the evaporative droplets. For each PCR, 2 μl of cell suspension is taken. Gateway cloning techniques From cDNA: The genes of interest present in the Y. lipolytica cDNA library (Mekouar et al., 2010) are transferred into the acceptor vector JMP1529 with the cloning kit LR (Invitrogen).

From PCR fragment: The genes of interest are amplified by PCR with the primers described in Table 6. The PCR fragments are introduced into the pENTIr / D-TOPOO vector (Invitrogen). The genes cloned into the pENTIr / D-TOPOO vector are transferred into the acceptor vector JMP1529 using the LR Clonase II Enzyme kit (Invitrogen). Recombinant vectors derived from recombination by LR Clonase are transformed into DH5α. Each transformant is selected on selective medium (ampicillin 100 μg / mL). The primers used to check the different strains constructed are listed in Table 6 below. Table 6: Table of primers for the construction and verification of vectors and strains of E. coli and Y. lipolytica. Name Nucleotide sequence Description F_AGE1_tefred CGCACCGGTaatcgatagagaccgggttg Meaning primer for amplification of the pTEF-RedStar2 fragment for cloning in JMP1226. Agel restriction site in upper case. R_AGEl_tefred GGTGACCGGTcgatttgtcttagaggaacg Antisense primer for amplification of the pTEF-RedStar2 fragment for cloning in JMP1226. Agel restriction site in upper case.

61TEFstart tccccgaattacctttcctc Primer for verifying the insertion direction of the pTEF-Redstar2 fragment in JMP1226 For_in_Dsred acccagctgacattccagac Primer for verifying the insertion direction of the pTEF-Redstar2 fragment in JMP1226 uraup_l 226 ggttggccgacaacaatatc Primer for verifying the insertion direction of the fragment pTEF-RedStar2 in JMP1226 leudown_l 226 gccctccaagatgaatggta Primer for verification of direction of insertion of pTEF-RedStar2 fragment in JMP1226 Puraextver cctgcgcaaaacattgtatg Primer for verification integration of LEU2 cassette pTEF-RedStar2 Zeta 3028527 at ura (upstream) location RED2_no_skl tggtgcctaggctgcttacaagaacaagtggtgtct Primer for integration integration of the LEU2 cassette pTEF-RedStar2 Zeta at the ura locus (upstream) VerZetasens cgagtaacactcgctctggagagttagtcatcc Primer for the verification integration of the LEU2 cassette pTEF-RedStar2 Zeta at the ura locus (downstream) Turaextver tgctggctttacgttgtcag Primer for integrated verification LEU2 cassette ion pTEF-RedStar2 Zeta at ura locus (downstream) PBRup cgcGCGGCCGCCGTAACTATAACGGTCC Meaning primer for amplification of TAAGGTAGCGAAcatcatcagtaacccgtatc AmpR-ori fragment of PBR322. Site of gtgagc restriction Notl and Iceul in upper case, Notl underlined PBRdown cgcGCGGCCGCTTCGCTACCTTAGGACC Antisense primer for amplification of GTTATAGTTACGgtcaggtggcacttttcgggg fragment AmpR-ori of PBR322. Site of aaat restriction Notl and Iceul in upper case, Notl underlined bgl2_gate_plus cgcAGATCTatcacaagtttgtacaaaaaa Meaning primer for the amplification of the Gateway® cassette from pDEST14 (Invitrogen). Restriction site Bel in upper case. gate_avr2_plus ggtgCCTAGGatcaccactttgtacaagaaa Antisense primer for amplification of Gateway® cassette from pDEST14 (Invitrogen). Restriction site April in capital letters. attb1_dsred GGGGACAAGTTTGTACAAAAAAGCAGGC Tatgagtgcttcttctgaaga Forward primer for amplification of the gene RedStar2 with the attB recombination sequence (capitalized) Dsred_attb2 GGGGACCACTTTGTACAAGAAAGCTGG Reverse primer for amplification of GTCttacaagaacaagtggtgtc RedStar2 gene with the sequence of 3028527 41 attB2 recombination (uppercase) Attbi -eYFP GGGGACAAGTTTGTACAAAAAAGCAGGC Tatggtgagcaagggcgagga Meaning primer for eYFP gene amplification with attbl recombination sequence (uppercase) Attb2-eYFP GGGGACCACTTTGTACAAGAAAGCTGG Antisense primer for amplification of GTCttacttgtacagctcgtccatgcc eYFP gene with attb2 recombination sequence (uppercase) Attbi -SUC2 GGGGACAAGTTTGTACAAAAAAGCAGGC Tatgcttttgcaagctttcc Primer sense for amplification of the SUC2 gene with the attbl recombination sequence (uppercase) Attb2-SUC2 GGGGACCACTTTGTACAAGAAAGCTGG Antisense primer for amplification of GTCctattttacttcccttacttgg SUC2 gene with the sequence of re attb2 combination (capitalized) Attbl -xpr2 GGGGACAAGTTTGTACAAAAAAGCAGGC Tatgaagctcgctaccgcctt Meaning primer for amplification of XPR2 gene with attbl (uppercase) recombination sequence Attb2-xpr2 GGGGACCACTTTGTACAAGAAAGCTGG Antisense primer for amplification of GTCctaaatgccaacaccgttgtag XPR2 gene with attb2 recombination sequence (capitalized) ATTR2zetaUP tgatcctagggtgtctgtgg Primer for Verification of Insertion at Zeta Turadown Locus tcttctgcctccaggaagtc Primer for Insertion Verification at Zeta Locus High-throughput 96-well microplate transformation. Transformation methods derive from lithium acetate transformation protocols (Le Dall et al., 1994, Chen et al., 1997) adapted to the 5 microplate format. Protocol A. The transformation is carried out with the YLEX kit (YLEX Expression Kit, Yeastern Biotech) in the presence of Un- (0.1 mol / L). The reaction mixture, comprising 100 μl of cells (about 10 6 cells), 3 μl of DNA trapping (0.5 to 1 μg salmon DNA, Dualsystems Biotech AG), and 3 μl of expression cassette (50 μg ), is incubated at 39 ° C, 60 min. The cells are then plated on appropriate selective medium.

Protocol B. A cell loop resuspended in 600 μl of a 0.1 M lithium acetate (LiAC) solution pH6 is incubated for 1 hour at 28 ° C. The cells are centrifuged and resuspended in 60 μl LiAC. The reaction mixture, comprising 10 .mu.l of competent cell, 3 .mu.l of entrainer DNA and 3 .mu.l of expression cassette, is incubated for 15 minutes at 28.degree. C. in a PCR tube. 66 μl of reaction buffer (40% PEG, 0.1M LiAC pH6) are then added and the whole is homogenized gently. The cells are incubated in the presence of the DNA for 1 hour at 28 ° C, followed by a thermal shock of 10 minutes at 39 ° C. The cells are then plated on appropriate selective medium. Growth in 96-well plate The precultures are carried out in 96-well microplates in YPD for 48 h. The cultures are carried out in 200 μl of YNBgIu, YNBgIy and YNBao medium at a carbon source concentration of 0.5%. The wells are inoculated at an optical density at 600 nm of about 0.1. The optical density of each well is read at 600 nm every 20 minutes for 48 hours at 28 ° C. with shaking using a Biotek Synergy MX microplate reader (http://www.biotek.com). Test of the protease activity by fluorescence measurement The protease activity is measured using the substrate Fluorescein thiocarbamoylCasein (FTC-casein Thermo-Scientific). 50 μl of culture supernatant (diluted 1/5) are incubated with 50 μl FTC-casein (5 μg / ml in 50nM phosphate buffer pH 6.8). Fluorescence and cell density were measured every 1 min for 1 h in a microplate reader (Biotek) with an excitation wavelength at 494 nm and an emission wavelength at 517 nm for fluorescence. Vmax is expressed as relative fluorescence per minute (RFU / min). Microscopy The microscopy images are made with a Zeiss Imager.M2 microscope equipped with a 120 C HXP lamp and filters to visualize the fluorescence of the eYFP protein (filter 46-YFP) and protein Redstar2 (filter 45). -Texasred; http: //www.zeiss.conn). Determination of the quantity of lipids The cells are inoculated at 0.5 OD (600 nm) in 25 ml of 3% YNB Glycerol or 3% YNB glucose medium, 72 hours at 28 ° C. with orbital shaking at 160 rpm, and then centrifuged in to recover the cell pellet. The pellet is then washed twice with 5 ml of demineralised water, taken up in 1 ml of water and then frozen at -20 ° C. before being freeze-dried. The lipids are converted to methyl esters using the method of Browse et al. (1986) from 10 to 20 mg dry weight of freeze-dried cell pellet. The esters produced are then analyzed by gas chromatography (GC). The analysis is carried out on a Varian 4300 gas chromatograph equipped with a flame ionization detector and a Varian FactorFour column vf-23 ms for which the passage / diffusion characteristics are carried out at 260 ° C at 3 pA (30 m, 25 mm, 0.25 pm). The fatty acids are identified by comparison with commercially available fatty acid profiles (FAME32; Supelco) and quantified using an internal standard, involving the addition of 50 μg of C17: 0 (Sigma) upon conversion to methyl ester. lipids. Determination of the amount of sugars and acids Citric acid, lactate, succinate, glucose and glycerol are determined by HPLC (Ultimate 3000, Dionex-Thermo Fisher Scientific, UK) using an Aminex HPX87H column coupled to UV (210 nm) and an RI detector (Lazar Z et al., 2011). The column is eluted with 0.01 N H2504 at room temperature with a flow rate of 0.6 ml / min. The different sugars and metabolites of the citrate cycle are identified and quantified using standards. Before analysis by HPLC, the culture medium is centrifuged (YNB 3% glycerol) and the supernatant is filtered through a 0.45 μm membrane and diluted 1/10. Results Construction of Strains and Vectors Y. lipolytica Specific Gateway Destination Vector Construction We used the JMP62-URA3ex-pTEF vector, which has a structure similar to JMP62 (JMP62-URA3d1-pPDXb) described by Nicaud et al. (2002), as a basic structure for the construction of the Y. lipolytica specific Gateway destination vector. This vector contains the kanamycin resistance marker (KanR), the URA3ex selection marker, the BamHI-11-AvrIl restriction sites downstream of the constitutive pTEF promoter (Muller et al., 1998) and the Zeta sequences for the integration into the genome. In order to obtain a vector expressing ampicillin resistance, the part of E. Neck of the pBR322 vector comprising the ampicillin resistance gene (AmpR) and the ORI origin of replication was amplified by PCR with the PBRup and PBRdown primers. These two primers contain the restriction sites Notl and lceul (Table 6). This PCR fragment, digested with the NotI restriction enzyme and dephosphorylated, was then ligated to the fragment corresponding to the NotI restriction enzyme digested JMP62-URA3ex-pTEF vector expression cassette, generating the JMP1521 vector. The gateway cloning cassette (attR1-ccdbchlorannphenicol-attR2) was amplified from the vector pDEST14 with the pair of primers bgl2_gate_plus and gate_Avr2_plus (Table 6) which contain the restriction sites BglII and Avril allowing the cloning of this cassette between the BamHI-11 and April sites of plasmid JMP1521, generating the vector JMP1529 (FIG. 2). Construction of the recipient strain for integration of the expression cassettes at the URA3 locus and constitutively expressing a reporter fluorescent protein.

20 Construction of the integration platform at the URA3 locus. Construction of Plasmid JMP1490 The fragment making it possible to constitutively express the RedStar2 protein (pTEF-RedStar2-terra) was amplified by PCR from the plasmid JMP1394 (Kabran et al., 2012) using the pair of primers F_AGE1_tefred and R_AGE1_tefred, each containing the Agel restriction site.

After digestion with Agel, the fragment was ligated into the JMP1226 vector allowing the integration of a Zeta platform at the URA3 genomic locus (Lazar et al., 2013), previously digested with Agel and dephosphorylated. The direction of insertion at the Agel restriction site was verified with both primer pairs 61TEFstart / leudown_1226 and uraup_1226 / For_in_Dsred (Table 6). The resulting plasmid JMP1490 (FIG. 2) contains the kanamycin resistance marker (KanR) and has a NotI fragment containing the RedStar2 gene under the control of the constitutive pTEF promoter, the LEU2 marker and the Zeta platform bordered by the upstream sequences ( Pura3_CDS) and downstream (Tura3_CDS) of the URA3 locus.

Construction of the recipient strain JMY2566. Plasmid JMP1490 was previously digested with NotI for transformation in the Pold strain by the lithium acetate method (Gaillardin et al., 1985). Leu transformants were selected on minimum medium supplemented with uracil. Integration into the URA3 locus was phenotypically verified: inability to grow on sucrose (Suc-) and constitutive red fluorescence, and by PCR: amplification of integration borders by PCR on genomic DNA with the two primer pairs Puraextver / Red2_no_SKL and VerZetasens / Turaextver (Table 6). The resulting strain JMY2566 has the ura3-1490 allele (ura3 :: pTEF-RedStar2-LEU2ex-Zeta) as a replacement for the ura3-302 allele (pXPR2-SUC2). It constitutively expresses RedStar2, it is auxotrophic for uracil and prototrophic for leucine and has a Zeta integration platform. Construction of Overexpression Control Strains Construction of overexpression control vectors The ORFs of the eYFP, Redstar2, SUC2, and XPR2 genes were amplified by PCR from the JMP911, JMP1394, JMP1462 and W29 genomic DNA vectors, respectively. using the primers described in Table 6 to introduce Gateway attb recombination sequences at each end of the PCR product. The 4 PCR fragments were then cloned into the donor vector pDONR207 (Invitrogen) by recombination using BP Clonase ™ (Invitrogen) following the instructions of the supplier. The input vectors obtained, JMP1592 (XPR2), JMP1593 (SUC2), JMP1594 (eYFP) and JMP1595 (RedStar2) were verified by sequencing. For the construction of the expression vectors, each ORF was then transferred into the acceptor vector JMP1529 by recombination using the LR Clonase ™ (Invitrogen) following the supplier's instructions (Figure 3). The resulting expression vectors JMP1599 (eYFP), JMP1600 (Redstar2), JMP1603 (XPR2) and JME1598 (SUC2) were verified by PCR and restriction profile analysis. Construction of control strains of gene overexpression.

The 4 overexpression control vectors previously obtained were digested with NotI and transformed into the recipient strain JMY2566 by the lithium acetate method. The integration of the expression cassette into the Zeta platform was verified by PCR. The 4 strains obtained are named JMY2811 (pTEF-RedStar2), JMY2812 (pTEF-eYFP), JMY2813 (pTEF-XPR2) and JMY2815 (pTEF-SUC2). A control strain, JMY2810, was also constructed by transformation of the NotI-digested JMP1046 vector containing the pTEF promoter and Lip2 terminator flanking the empty BamHI-11-AvrIl cloning site in strain JMY2566. Verification of the insertion of the expression cassettes. Integration into the zeta platform in recipient strain JMY2566 was verified by PCR using primers ATTR2zetaup and Turadown (Table 6), with the following program: 30s 98 ° C, 25 cycles (10s, 98 ° C; 60 ° C, 2min 45 ° C). In case of random integration, the zeta integration platform is not modified and a 2680 bp PCR product is expected (Figure 4B). In case of integration of the expression cassette to the platform, two PCR products are expected (Figure 4C). The ATTR2zetaup primer has 2 possible hybridization sites, the first site upstream of the LEU2 gene which would make it possible to amplify a fragment of more than 4000 base pairs, whose exact size depends on the gene cloned into the Zeta platform, and a second site that amplifies a fragment of 1052 base pairs, regardless of the size of the integration cassette. In practice, with the PCR program above, a 2680 bp amplicon is observed in the case of random integration and 1052 bp in the case of integration with the zeta platform (FIG. at 4000 base pairs that can not be amplified. For example, the analysis of the integration into five independent transformants shows that clones 1 and 5 have an integration with the zeta platform (1053 bp band) and three transformants have a random integration (2680 bp bands) (FIG. ).

Expression of control genes. The strain JMY2811 (pTEF-RedStar2) has a fluorescence which is 40% greater than the control strain, demonstrating that the pTEF promoter upstream of the aatR1 site is functional. This strain has a copy of RedStar2 under the control of the pTEF promoter and an additional copy under the control of the pTEF promoter upstream of the attR1 site. Strain JMY2812 (pTEF-eYFP) has red florescence for RedStar2 and green fluorescence for eYFP (Figure 6). The strain JMY2813 (pTEF-XPR2) has a hydrolysis halo of casein similar to the wild-type strain W29, whereas the strain JMY2810 which is deleted for the XPR2 gene does not have a hydrolysis halo (FIG. 7). . The strain JMY2815 (pTEF-SUC2) is able to grow on YNB sucrose minimum medium unlike the control strain JMY2810 (FIG. 8). All these control strains demonstrate that the gateway system developed for Yarrowia lipolytica is functional, whether for the expression of Yarrowia lipolytica proteins or for the secretion of functional proteins. Frequency of transformation and type of integration. The creation of a Gateway overexpression library requires the development of a high-throughput Y. lipolytica transformation method that is efficient in the 96-well format. Two transformation methods have been developed and miniaturized. The first method, method A, derives from the one-step transformation protocol described by Chen et al., 1997 used in the YLOSTM expression kit marketed by Yeastern (Thailand). The second method, method B, has been developed to promote integration with the zeta platform. Two strains of Y. lipolytica possessing a ZETA platform (JMY2033 and JMY2566) were created. Transformation efficiency was tested with the RedStar2 and SUC2 expression cassettes (Figure 9). With the protocol A, 82.7% of the transformants are obtained by random integration into the genome (FIG. 9A), whereas with the B protocol, 82.5% of the transformants result from an integration at the zeta locus (FIG. 9B). ). The degree of conversion depends on the recipient strain: approximately two times more transformants are obtained with strain JMY2033 than with strain JMY2566 (150- and 87- transformants against 87- and 44-transformants for methods A and B, respectively) corresponding to a transformation frequency of 103 transformants per a of DNA. Expression of extracellular alkaline protease in random transformants. In order to evaluate the variability of the protein activity levels of strains resulting from high-throughput transformation, the JMY2566 strain was transformed with the JM1592 vector expression cassette (pTEF-XPR2) following method A of high-throughput transformation described above. 96 transformants were isolated and their protease activity was evaluated kinetically by fluorescence measurement using FTC-casein as substrate. Figure 10 shows the distribution of the number of transformants as a function of the protease activity produced as a function of Vmax. Of the clones obtained, 3% show no activity, 88% have an activity of between 3.4 and 5.4 (average Vmax of 4.4 ± 1.0) and 2% show a significant increase of protease activity. These results show that the method of transformation according to protocol A, producing mainly random integration transformants, makes it possible to obtain a diversity of clones with variable levels of activity. In particular, transformants with a higher than average activity of the transformants can be obtained quickly and easily. This method is particularly relevant for obtaining improved strains for enzymatic activity without passing through mutagenesis steps, the difference in activity being due to the integration site and its genomic environment, or to the number of integrations. in the genome of the expression cassette. Identification of the set of potential transcription factors in Y. lipolytica The whole of the protein sequences of Y. lipolytica (http://gryc.inra.fr/) was screened for the presence of specific structural domains of factors. transcripts using the PFAM online tool (http://pfam.xfam.org/). By retaining all the protein sequences having at least one sequence homology with a transcription factor specific domain (default and significance of 1), 131 proteins were identified corresponding to 127 ORFS (4 ORFs encode 2 proteins). In order to obtain the most exhaustive possible list of potential transcription factors, all of these protein sequences were compared by sequence homology to the entire Y. lipolytica proteome (BLASTP) in order to identify candidates having sequence homology with potential transcription factors already identified. This approach added 17 additional proteins to the list. Construction of all Y. lipolytica strains overexpressing putative transcription factors ORFs encoding potential transcription factors were cloned into the Gateway system and the JMP1529 specific overexpression vector, either from cDNA from a collection of Y. lipolytica cDNA cloned in a donor vector (Mekouar et al), either by PCR amplification on genomic DNA and cloning in a TOPO pENTER Directional vector (Invitrogen). In total, of the 148 ORFs identified as potential transcription factor coding, 112 could be cloned into the JMP1529 overexpression vector. Of these 112 vectors obtained, 97 made it possible to obtain strains of Y. lipolytica JMY2566 transformed (transformation method B protocol) with 66 having integration at the zeta locus, verified by the PCR method. In most cases, the transformation frequency and type of integration for transcription factors correlates with the transformation results of Method A and Method B described above. However, for a minority, no transformant is obtained, whatever the method used. On 112 cassettes of integration, this result could be observed for 9 transcription factors (TF030, TF034, TF035, TF056, TF061, TF065, TF082, TF092 and TF114). This absence of transformants could be caused by the action of a determining role of the transcription factor on cell viability. Screening of the collection of Y. lipolytica overexpression strains Growth on different carbon sources The growth on glucose and glycerol of the 97 overexpression strains of transcription factors obtained was evaluated by microplate and Erlenmeyer flask by monitoring the OD (600 nm). Growth impairment is observed for some strains. In particular, the strains overexpressing transcription factors TF044, TF069, TF089 have a slow growth in glucose and glycerol. Strains overexpressing the transcription factors TF122 and TF126 have a slow growth in glucose only. Evaluation of the amount of accumulated lipids. The 97 overexpression strains of transcription factors obtained were cultured in 250 ml Erlenmeyer flasks in 3% YNBgIy. The amount of accumulated total lipids reported to the dry weight was measured after 72 hours of growth and compared to the control strain JMY2810. The rate of increase or decrease with respect to this control strain was calculated (amount of lipid per gram of cells in the strain overexpressing the transcription factor / amount of lipid per gram of cells in the control strain) and those of which alteration is greater than 9% are considered significant. In particular, the strains overexpressing transcription factors TF001, TF072, TF039, TF084, TF019, TF079, TF087, TF086, TF126, 3028527 TF040, TF024, TF031, TF033, TF085, TF021 show an increase in the amount of total lipids up to 27.3%. On the other hand, strains overexpressing transcription factors TF060, TF007, TF043, TF038, TF055, TF075, TF077, TF109, TF064, TF068, TF099 show a decrease in the amount of total lipids of up to 38.5%. Evaluation of the amount of citrate produced. In parallel, the amount of citrate produced by the 97 overexpression strains of transcription factors obtained and grown in YNBgIy 3% was evaluated and compared to the control strain JMY2810 after 72h. The rate of increase or decrease with respect to this control strain was calculated. Rates above 30% are considered significant. In particular, the strains overexpressing transcription factors TF072, TF019, TF089, TF041, TF015, TF078, show an increase in the amount of citrate product ranging from 45% to 183% relative to the control strain, whereas the strains 15 overexpressing transcription factors TF068 and TF099 show a decrease in the amount of citrate product ranging from 36 to 86% compared to the control strain. it should be noted that the strains overexpressing the TF072 and TF019 transcription factors show an increase in both the total lipid quantity and the citrate production. On the other hand, the amount of total lipids and the amount of citrate produced are both decreased in strains overexpressing transcription factors TF068 and TF099. Evaluation of the amount of succinate produced. In parallel, the amount of succinate produced by the 97 transcription factor overexpression strains obtained and grown in YNBgIy 3% was evaluated and compared to the control strain JMY2810 after 72h. The rate of increase or decrease with respect to this control strain was calculated. A variation greater than 50% is considered significant. In particular, the strains overexpressing the transcription factors TF078, TF077, TF070, TF051, TF052, TF015, TF048, TF043, TF004, show an increase in the amount of succinate produced ranging from 54% to 305% relative to the strain. witness (Fig. 14). In the strains overexpressing transcription factors TF0041, TF099 and TF019, a decrease in the amount of succinate produced is observed which ranges from 69% to 94% relative to the control strain (FIG. 14). Strains overexpressing TF078 and TF015 transcription factors show increased succinate production and related citrate production.

It should also be noted that the production of succinate increases while the amount of accumulated lipids decreases in the strains overexpressing TF077 and TF043 transcription factors. On the other hand, the overexpression of transcription factor TF019 leads to a decrease in succinate production and an increase in the amount of concomitant lipids.

10 3028527 52 References: Abghari A And ChenS. 2014 "Yarrowia lipolytica as an oleaginous cell factory platform for fatty acid-based biofuel and bioproducts" Front. Energy Res. doi: 10.3389 / fenrg.2014.00021.

5 Barth G, Gaillardin C. 1996. Yarrowia lipolytica. In: Wolf K (ed.). No, yes, yes, yes. Springer. p. 313-388. Beopoulos A, Mrozova Z, Thevenieau F, Dall MT, Hapala I, Papanikolaou S, Chardot T, Nicaud JM. 2008. Control of lipid accumulation in the yeast Y. lipolytica. Applied Environnnental Microbiology. 74: 7779-7789.

10 Beopoulos A, Cescut J, Haddouche R, Uribelarrea JL, Molina-Jouve C, Nicaud JM. 2009. Y. lipolytica as a model for bio-oil production. Progress in Lipid Research. 48: 375-387. Beopoulos A, Haddouche R, Kabran P, Dulermo T, Chardot T, Nicaud JM. 2012. Identification and characterization of DGA2, an acyltransferase of the DGAT1 acyl-CoA: diacylglycerol acyltransferase family in the oleaginous yeast Y. lipolytica. New insights into the storage of lipid metabolism of oleaginous yeasts. Applied Microbiology and Biotechnology. 93 (4): 1523-1537. Blazeck J, Liu L, Redden H, Alper H.

2011 Tuning gene expression in Yarrowia lipolytica by a hybrid promoter approach. Approximately Microbiol 77: 7905-7914.

20 Blazeck J, Reed B, Rishi Garg R, Gerstner R, Pan A, Agarwala V, Alper H.

2013 Generalizing a hybrid synthetic promoter approach in Yarrowia lipolytica. Applied Microbiol Biotechnol 97 (7) 3037-3052. Blazeck J, Hill A, Liu L, Knight R, J Miller, Pan A, Otoupal P, Alper HS. 2014. Harnessing Y. lipolytica lipogenesis to create a platform for lipid and biofuel production. Nature Communications. D01: 10.1038 / nconnnns4131. Dujon B, Sherman D, Fischer G, Durrens P, Casaregola S, Lafontaine I, De Montigny J, Marck C, Neuveglise C, Talla E, Goffard N, Frangeul L, Eagle M, Anthouard V, Babour A, Beard V, Barnay S, Blanchin S, Beckerich JM, Beyne E, Bleykasten C, Boisrame A, Boyer J, Cattolico L, Confanioleri F, Daruvar A, Despons L, Fabre E, Fairhead C, 30 Ferry-Dumazet H, Groppi A, Hantraye F , Hennequin C, Jauniaux N, Joyet P, Kachouri 3028527 53 R, Kerrest A, Koszul R, Lemaire M, Lesur I, Ma L, Muller H, Nicaud JM, Nikolski M, Oztas S, Ozier-Kalogeropoulos 0, Pellenz S, Potier S, Richard GF, Straub ML, Suleau A, Swennen D, Tekaia F, Wesolowski-Louvel M, Westhof E, Wirth B, Zeniou-Meyer M, Zivanovic I, Bolotin-Fukuhara M, Thierry A, Bouchier C, Caudron B , Scarpelli C, Gaillardin C, Weissenbach J, Wincker P, Souciet JL. 2004. Genome evolution in yeasts. Nature. 430 (6995): 35-44. Dulermo T, Nicaud JM. 2011. Involvement of the G3P shunt and 13-oxidation pathway in the control of TAG synthesis and lipid accumulation in Y. lipolytica. Metabolic engineering. 13 (5): 482-491.

Dulermo T, Treton B, Beopoulos A, Kabran Gnankon AP, Haddouche R, Nicaud JM. Characterization of the two intracellular lipases of Y. lipolytica encoded by TGL3 and TGL4 genes: new insights into the rote of intracellular lipases and lipid body organization. Biochimica and Biophysica Acta. 1831 (9): 1486-1495. Fickers P, Dall MT, Gaillardin C, Thonart P, Nicaud JM. 2003. New disruption 15 cassettes for rapid gene disruption and marker rescue in the yeast Y. lipolytica. Journal of Microbiological Methods. 55: 727-737. Gabdoulline R, Eckweiler D, Kel A, Stegmaier P. 2012.

3DTF: a web server for predicting PWMs transcription using 3D structure-based energy calculations. Nucleic Acids Res. 40 (Web Server issue): W180-5. doi: 10.1093 / n / gks551.

20 Gaillardin C, Ribet AM. 1987. LEU2 directed expression of 13-galactosidase activity and phleomycin resistance in Y. lipolytica. Current Genetics. 11: 369-375. Gysler C, Kneuss P, Niederberger P. 1990. Transformation of commercial bakers and yeast strains by electroporation. Biotechnol Tech 4: 285-290. Hoess RH, Abremski, K. 1985. Mechanism of strand cleavage and exchange in the Creolox site-specific recombination system. J Mol Biol. 181 (3): 351-362. Ito H, Fukuda Y, Murata K, Kimura A. 1983. Transformation of intact yeast cells treated with alkali cations. Journal of Bacteriololy. 153: 163-168. Kabran P, Rossignol T, Gaillardin C, Nicaud JM, Neuvéglise C. 2012. Alternative splicing regulates targeting of malate dehydrogenase in Yarrowia lipolytica. DNA Res. 19 (3): 231-44.

3028527 54 Klebe RJ, Harriss JV, Sharp ZD, Douglas MG. 1983. A general method for polyethylene glycol-induced genetic transformation of bacteria and yeast. Uncomfortable. 25 (2-3): 333-341. Kurat et al. 2006. Obese yeast: triglyceride lipolysis is functionally conserved from 5 mammals to yeast. Journal of Biological Chemistry 281: 491-500. Lazar Z, Rossignol T, Verbeke J, Crutz-The Rooster AM, Nicaud JM, Robak M. 2013. Optimized invertase expression and secretion cassette for improving Y. lipolytica growth on sucrose for industrial applications. Journal of Industrial Microbiology and Biotechnology. 40 (11): 1273-1283.

Dalt MT, Nicaud JM, Gaillardin C. 1994. Multiple-copy integration in the yeast Yarrowia lipolytica. Curr Genet. 26 (1): 38-44. Lipman, D. J. and W. R. Pearson. 1988. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. U.S.A. 85: 2444-2448. Madzak C, Treton B, Blanchin-Roland S.

2000 Strong hybrid promoters and integrative expression / secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica. J. Mol. Microbiol. Biotechnol., 2 (2): 207216. Madzak C, Gaillardin C, Beckerich JM. 2004. Heterologous protein expression and secretion in the non-conventional Yeast Yarrowia lipolytica: a review. Journal of Biotechnology, 109 (1-2): 63-81. Maftahi M, Gaillardin C, Nicaud JM.

1996 Sticky-end polymerase chain reaction method for systematic gene disruption in Saccharomyces cerevisiae. Yeast. 12 (9): 859-868. Mekouar M, Blanc-Lenfle I, Ozanne C, Da Silva C, Cruaud C, Wincker P, Gaillardin C, 25 Neuvéglise C.

2010 Detection and analysis of alternative splicing in Yarrowia lipolytica reveal structural nonsense-nnediated decay of intron-retaining transcripts. Genome Biol., 11 (6): R65. doi: 10.1186 / gb-2010-11-6-r65. Müller S, Sandal T, Kamp-Hansen P, Dalboge H. 1998. Comparison of expression systems in the yeasts S. cerevisiae, Hansenula polymorph, Kluyveromyces lactis, Schizosaccharomyces pombe and Y. lipolytica. Cloning of two novel promoters from Y. lipolytica. Yeast. 14 (14): 1267-1283. Needleman, S. B. and C. D. Wunsch. 1970. A general method applicable to the search for similarities on the amino acid sequences of two proteins. J. Molec. Biol. 48: 444-543. Nicaud JM, Madzak C, Van den Broek P, Gysler C, Duboc P, Niederberger P, Gaillardin C.

2002 Protein expression and secretion in the yeast Yarrowia lipolytica. FEMS Yeast Res. 2 (3): 371-9. Orr-Weaver TL, Szostak JW, Rothstein RJ.

1981 Yeast transformation: a model system for the study of recombination. Proc Natl Acad Sci U S A 78 (10): 6354-6358. Querol A, Barri E, Huerta T, Ramon D. 1992. Molecular monitoring of wine fermentations conducted by active dry yeast strains. Applied and Environmental Microbiology, 58: 2948-2953. Sambrook J, Russell DW. 2001. Molecular Cloning: A laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press, New York. Sauer B. 1987. Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae. Mol Cell Biol. 7 (6): 2087-2096. Smith, TF, and Waterman, MS. 1981. Identification of Common Molecular Subsequences. Journal of Molecular Biology 147: 195-197. Tai M, Stephanopoulos G. 2013. Engineering the Push and Pull of Lipid Biosynthesis in Oleaginous Yeast Y. Lipolytica for Biofuel Production. Metabolic engineering. 15: 1-9. Thevenieau F, Dalt MT, Nthangeni B, Mauersberger S, Marchai R, Nicaud JM. Characterization of Yarrowia lipolytica mutants affected in hydrophobic substrate utilization. Fungal Genet Biol. 44 (6): 531-542.

25 Wang HJ, Dall MT, Wach Y, Laroche C, Belin JM, Gaillardin C, Nicaud JM. 1999. Evaluation of acyl coenzyme A oxidase (Aox) isozyme function in the n-alkaneassimilating Yeast Yarrowia lipolytica. Journal of Bacteriology 181 (17): 5140-5148.

3028527 56 Yongmanitchai W, Ward OP, Growth of and omega-3 fatty acid production by Phaeodactylum tricornutum under different culture conditions. Apt. About. Microbiol. 57: 419-425, 1991

Claims (30)

REVENDICATIONS1. Oleaginous yeast strain in which the expression of a transcription factor selected from TF001 (YALIOA10637g), TF004 (YALIOB06853g), TF007 (YALIOB12716g), TF015 (YALI0007821g), TF019 (YALIOC13178g), TF021 (YALIOC16390g), TF024 (YALIOD01353g ), TF031 (YALIOD10681g), TF033 (YALIOD14520g), TF038 (YALIOD23045g), TF039 (YALI0D23749g), TF040 (YALIOE03410g), TF041 (YALIOE05555g), TF043 (YALIOE10681g), TF051 (YALIOE31383g), TF052 (YALIOE31669g), TF055 (YALIOF03157g) ), TF060 (YALIOF09361g), TF064 (YALIOF16599g), TF068 (YALIOE13948g), TF070 (YALIOE11693g), TF072 (YALI0C22682g), TF074 (YALIOD09757g), TF075 (YALIOF05346g), TF077 (YALIOB08206g), TF078 (YALIOD05005g), TF079 (YALIOD12628g) ), TF084 (YALIOB08734g), TF085 (YALIOC11858g), TF086 (YALIOB04510g) TF087 (YALIOE01606g), TF089 (YALI0006842g), TF109 2. The strain of claim 1, characterized in that said oleaginous yeast is Yarrowia lipolytica. 20 3. The strain of any one of claims 1 or 2, characterized in that said transcription factor is overexpressed. 4. The strain of claim 3, characterized in that said transcription factor is selected from TF001, TF004, TF015, TF019, TF021, TF024, TF031, TF033, TF039, TF040, TF041, TF043, TF051, TF052, TF070, TF072, TF074, TF077, TF078, TF079, TF084, TF085, TF086, TF087 TF089, TF109 and TF126. 5. The strain of any one of claims 1 or 2, characterized in that the expression of said transcription factor is decreased relative to a wild-type strain. The strain of claim 5 characterized in that the decrease in expression is caused by inactivation of the gene encoding said transcription factor. (YALIOE16577g) and TF126 (YALIOD05041g) is altered, said strain having an impaired accumulation of lipids or at least one of the intermediate metabolites of the synthesis thereof, especially succinate or citrate, relative to a strain. witness. 3028527 58 7. The strain of any one of claims 5 or 6, characterized in that said transcription factor is selected from TF007, TF038, TF041, TF043, TF055, TF060, TF064, TF068, TF075, TF077, and TF109. 8. The strain of any one of claims 1 to 7, characterized in that the expression of at least one transcription factor selected from TF019 and / or TF072 is increased and / or the expression of at least a transcription factor selected from TF068 is decreased. 9. The strain of any one of claims 1 to 8, characterized in that the expression of transcription factor TF019 is increased and / or the expression of at least one transcription factor selected from TF077 and / or TF043. is diminished. 10. The strain of any one of claims 1 to 9, characterized in that said strain further overexpresses the GPD1 gene and is deficient for the beta-oxidation of fatty acids. 11. The strain of any one of claims 1 to 10, characterized in that it comprises at least one loss of function mutation in at least one gene selected from the PEX genes, the PDX genes, the MFE1 gene and the POT1 gene. 12. The strain of any one of claims 1 to 11, characterized in that it comprises at least one loss of function mutation in at least one of the PDX1, PDX2, PDX3, PDX4, PDX5 and PDX6 genes. 13. The strain of any one of claims 1 to 12, characterized in that it comprises at least one loss of function mutation in each of the PDX1, PDX2, PDX3, PDX4, PDX5 and PDX6 genes. 14. The strain of any one of claims 1 to 13, characterized in that it further comprises at least one additional mutation in at least one gene encoding an enzyme involved in the metabolism of fatty acids. 15. The strain of claim 14, characterized in that it is deficient in at least one of the genes GUT2, TGL3 and TGL4. 16. The oleaginous yeast strain of claim 14, characterized in that it comprises an inactivated YALIOB10153g gene. 3028527 59 17. The strain of claim 16, characterized in that said strain further overexpresses the yDGA2 gene. 18. The oleaginous yeast strain according to any one of claims 1 to 17, characterized in that it expresses a gene coding for an enzyme chosen from an A8 desaturase, a M2 desaturase and an M5 desaturase. 19. The oleaginous yeast strain of claim 18, characterized in that said gene codes for an M2 desaturase. 20. The oleaginous yeast strain of claim 19, characterized in that said gene is the YALIOB10153g Yarrowia lipolytica gene. 10 21. Process for obtaining an oleaginous yeast strain according to any one of claims 1 to 20, characterized in that it comprises a step of transforming an oleaginous yeast strain by at least one polynucleotide allowing alter the expression of a transcription factor selected from TF001, TF004, TF007, TF015, TF019, TF021, TF024, TF031, TF033, TF038, TF039, TF040, TF041, TF043, TF051, TF052, TF055, TF060, TF064. , TF068, TF070, TF072, TF074, TF075, TF077, TF078, TF079, TF084, TF085, TF086, TF087, TF089, TF109 and TF126. 22. The method of claim 21, characterized in that said polynucleotide allows the overexpression of a transcription factor selected from TF001, TF004, TF015, TF019, TF021, TF024, TF031, TF033, TF039, TF040, TF041, TF043. , TF051, TF052, TF070, TF072, TF074, TF077, TF078, TF079, TF084, TF085, TF086, TF087 TF089, TF109 and TF126. 23. The method of claim 22, characterized in that said polynucleotide comprises a promoter sequence chosen from the PDX2 promoter, the LIP2 promoter, the FBA promoter, the GPM promoter, the YAT / promoter, the GPAT promoter and the TEF promoter. , the hybrid promoter hp4d and hybrid promoters XPR2. 24. The method of any one of claims 21 to 23, characterized in that said polynucleotide makes it possible to inactivate a transcription factor selected from TF007, TF038, TF041, TF043, TF055, TF060, TF064, TF068, TF075. TF077, and TF109. Y 3028527 60 25. The method of any one of claims 21 to 24, characterized in that it comprises an additional step in which a polynucleotide allowing the overexpression of another gene regulating lipid synthesis is introduced into the strain. 5 26. The method of claim 25, characterized in that said gene is GPD1 or yDGA2. 27. The method of any one of claims 21 to 26, characterized in that it comprises a further step wherein an additional mutation affecting the lipid synthesis is introduced into the strain. 10 28. The method of claim 25, characterized in that said mutation affects at least one of the PEX genes, one of the PDX genes, the MFE1 gene, the POT1 gene, the TLG3 and TLG4 genes, GUT2 and YALI0810153g. 29. Use of an oleaginous yeast strain according to one of claims 1 to 20 for the synthesis of lipids, especially free fatty acids and triacylglycerols. 30. Lipid synthesis process comprising steps of: (1) culturing an oleaginous yeast strain according to any one of claims 1 to 20 in a suitable medium and (2) harvesting the lipids produced by the culture of Step 1. 20