FR3001143A1 - USE OF A REINFORCED SOLAR PROTECTIVE COMPOSITION IN LIGHT UVA PROTECTION TO PROTECT FROM HERPES PUSH INDUCED BY SOLAR EXPOSURE. - Google Patents

Abstract

The invention relates to a cosmetic or dermatological composition comprising in a physiologically acceptable support at least one merocyanine compound for the prevention of the reactivation of herpes simplex virus (HSV) type 1 and / or the recrudescence of herpes outbreaks and / or or the appearance of cutaneous disorders induced by said reactivation and / or said recrudescence. It also relates to a method of in vitro or ex vivo screening of active agents capable of limiting and / or inhibiting the expression modulation of at least one of the genes selected from IFIT1, IFIT2, TLR3, DDX58, or CXCL10.

Description

USE OF A REINFORCED SOLAR PROTECTIVE COMPOSITION IN LIGHT UVA PROTECTION TO PROTECT FROM HERPES PUSH INDUCED BY SOLAR EXPOSURE.

The present invention relates to the use of a cosmetic or dermatological composition comprising in a physiologically acceptable carrier at least one merocyanine compound of formula (1) or (2) defined below to prevent reactivation of the herpes simplex virus. (HSV) type 1 and / or an upsurge of herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or said recrudescence. It also relates to a non-therapeutic cosmetic method for preventing the reactivation of herpes simplex virus (HSV) type 1 and / or an upsurge of herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or or said recrudescence comprising the application, on the skin of a subject affected by HSV type 1, of a composition as defined above. It also relates to a method of in vitro or ex vivo screening of active agents that can limit and / or inhibit the expression modulation of at least one of the genes selected from IFIT1, IFIT2, TLR3, DDX58 or CXCL10. comprising at least the steps of: a) disposing said composition on a skin sample. b) exposing the skin sample obtained in step a) to long UVA c) performing a qualitative or quantitative measurement of the expression modulation of at least one gene selected from IFIT1, IFIT2, TLR3, DDX58, and / or CXCL10. d) comparing the measurement obtained in step c) with a reference measurement and concluding that this compound is effective, to prevent reactivation of herpes simplex virus (HSV) type 1 and / or recrudescence herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or said recrudescence, if this compound limits or inhibits the modulation of the expression of at least one gene selected from IFIT1, IFIT2, TLR3, DDX58 , and / or CXCL10.

Herpes simplex virus type I Herpes simplex virus (HSV) is a member of the family Herpesviridae. There are two types of Herpes simplex virus. HSV-1 typically causes orolabial infections, whereas HSV-2 infects genital mucosa. In the present application, we will be interested in Herpes simplex type I viruses. HSV is especially characterized by two of its biological properties; its ability to invade and replicate in the central nervous system (CNS) (i.e., neurovirulence), and its ability to establish a latent infection. Indeed, periodically, the virus is reactive and is transported by axonal transport to the site of the initial infection. Depending on several factors including the state of the immune system, this reactivation will lead to a symptomatic infection or not. Solar UV exposure can reactivate latent herpes virus and induce an increase in herpes outbreaks in areas exposed to solar UV. (Ichihashi et al., 2004, Norval, 2006). Flares are often localized around the mouth and nose and occur in the early days of winter sports, or early summer for example, inducing in the patient a severe discomfort related to both the visible appearance outbreaks of herpes, the burning they experience and the fact that any direct contact with the environment is to be avoided. The mechanisms underlying these herpes outbreaks related to sun exposure are not yet clearly identified. The solutions provided to date to prevent herpes outbreaks related to sun exposure are therefore not satisfactory in terms of effectiveness. There remains therefore the need to find new cosmetic compositions to prevent the reactivation of the herpes simplex virus (HSV) type 1 and / or an upsurge of herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or the said recrudescence. The applicant carried out a transcriptomic "full genome" study 6 hours after exposure of reconstructed skin with long UVA (40 J / cm 2), on reconstructed skin. It has been observed that long UVAs repress the expression of many genes encoding proteins involved in the antiviral response of innate immunity, described as having a role in the defense against Herpes infection (Nicholl et al., 2000). Yang et al., 2012, Miettinen et al., 2012, Rasmussen et al., 2009, Xing et al., 2012, Chew et al., 2009, Wuest and Carr, 2008) (Examples 1, 2, and 3). . The Applicant performs a transcriptomic study in vivo in humans, after exposure to 100 J / cm 2 long UVA delivered by a Sellamed device. Total skin biopsies are performed 24 hours after exposure. The same observations are made. The Applicant has surprisingly discovered that a solution containing a merocyanine associated with UVA and UVB filtering agents inhibits the modulation of the expression of certain innate immunity genes involved in HSV-1 anti-herpes defense. (Examples 4 and 5). This discovery is the basis of the present invention. Thus, according to one of the objects of the present invention, it is now proposed a cosmetic or dermatological composition comprising in a physiologically acceptable carrier at least one merocyanine compound of formula (1) or (2) as defined hereinafter at "Merocyanine" section to prevent reactivation of herpes simplex virus (HSV) type 1 and / or an upsurge of herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or so-called resurgence. Preferably, according to one of the objects of the present invention, it is now proposed a cosmetic or dermatological composition comprising in a physiologically acceptable carrier at least one merocyanine compound of formula (1) or (2) as defined hereinafter in the section "Merocyanine" to prevent the reactivation of herpes simplex virus (HSV) type 1 and / or an upsurge of herpes outbreaks and / or the occurrence of skin disorders induced by said reactivation and / or the so-called recrudescence during and / or after exposure to UVs and even more preferably during and / or after exposure to long UVAs. By "reactivation of the herpes simplex virus type 1" within the meaning of the invention is meant the return of the herpes simplex virus type 1 (HSV1) to a bed cycle after a latency phase where its activity is extremely limited, itself following a phase of primary infection that begins after the entry of the HSV1 viral genome into a sensory neuron and its retrograde transport to the sensory ganglion. Indeed HSV1 causes, most often in childhood, a common primary infection with intraoral lesions, painful (gingivostomatitis). The virus can remain latent for years and give many times during the life of the subject vesicular lesions and crusted lips (classic cold sore), or more extensive to the nose, chin, on the occasion of events varied (cold, sun exposure, rules or ovulation ...).

By "herpes herpes" in the sense of the invention is meant the appearance of a bouquet of transparent vesicles, herpes pimples, in the face quickly becoming yellowish and crusty. By "skin disorders" within the meaning of the invention is meant the scars and / or redness and / or temporary redness resulting from the herpes outbreak. By "physiologically acceptable" is meant compatible with the skin and / or its integuments, which has a pleasant color, smell and feel and which does not generate unacceptable discomfort (tingling, tightness, redness), which can divert the consumer to use this composition. By "between X and Y" is meant the range of values also including the X and Y terminals.

For the purposes of the invention, the term "prevention of a disorder", the reduction of the risk of occurrence of the disorder in question, especially as defined above. Merocyanines According to the present invention, the merocyanine compounds according to the invention correspond to the following formulas (1) or (2) ## STR2 ## R 1 and R 2, independently of one another other, are hydrogen; a C1-C22 alkyl group, a C2-C22 alkenyl group, a C2-C22 alkinyl group, these groups possibly being substituted by at least one hydroxyl group or interrupted by at least one -O-; or R1 and R2 together with the nitrogen atom connecting them form a - (CH2) - ring which may be optionally interrupted by -O- or -NH-; R3is a group - (C = O) OR6; or a - (CO) NHR6 group; R6 is a C1-C22 alkyl group, a C2-C22 alkenyl group, a C2-C22 alkinyl group, a C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said groups may be substituted with one or several OH; R4 and R5 are hydrogen; or R4 and R5 form a - (CH2) - ring which may be substituted with a C1-C4 alkyl group and / or interrupted by one or more -O- or -NH-; n is a number between 2 and 7; R7 and R8 independent of each other, are hydrogen; a C1-C22 alkyl group, a C2-C22 alkenyl group, a C2-C22 alkinyl group, which groups may be interrupted by one or more O and / or substituted by one or more OH; a C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said groups being capable of being interrupted by one or more -O-; or R7 and R8 together with the nitrogen which binds them a - (CH2) - ring which can be interrupted by one or more -O-; R9 and R10 are hydrogen; or R9 and R10 form a - (CH2) - ring potentially substituted by C1-C4alkyl and / or interrupted by -O- or -NH-; A is -O- or -NH; R11 is a C1-C22 alkyl group; a C2-C22 alkenyl group; a C2-C22 alkinyl group; a C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said groups being capable of being interrupted by one or more O; or a C 1 -C 22 alkyl group or a C 2 -C 22 alkenyl group which is substituted by a C 3 -C 22 cycloalkyl group or a C 3 -C 22 cycloalkenyl group, said C 3 -C 22 cycloalkyl group or a C 3 -C 22 cycloalkenyl group Can be interrupted by one or more -0-; with the proviso that: (I) at least one of R1, R2 or R6 is substituted with hydroxyl; (II) if one of R1 is hydroxyethyl, R2 is not hydrogen, methyl or ethyl or hydroxyethyl; and if R 1 is hydrogen, R 2 is not 1-hydroxy-3-methyl-but-2-yl; (III) if R 6 is substituted by one or more OH, one of R 1 or R 2 is a C 4 -C 22 alkyl group; or R1 and R2 together with the nitrogen to which they are attached form a piperidyl or morpholinyl radical; (IV) at least one of the radicals R7, R8, or R11 is interrupted by one or more -O-. Preferred compounds are those of formulas (1) or (2) wherein: R1 and R2, independent of each other, are hydrogen; a C4-C12 alkyl group; or a C3-C12 hydroxyalkyl group; or at least one of R1 or R2 is a C3-C12 hydroxyalkyl and R3, R4 and R5 have the same meanings indicated above. The preferred compounds are also those of formulas (1) wherein: R 6 is a C 1 -C 12 alkyl group, which may be which is potentially substituted by one or more hydroxyls. The most preferred compounds are also those of formula (1), wherein: R 6 is a Ci-Cu alkyl group, which may be substituted with one or more hydroxyls. One of the radicals R 1 or R 2 is a C 4 -C 22 alkyl group; or R1 and R2 together with the nitrogen connecting them form a - (CH2) n- ring which can be interrupted by -O- and / or -NH-; and R4 and R5 and n have the same meanings indicated above. Preferred compounds are those of formula (2) wherein: R 11 is - (CH 2) n -O-R 12, where R 12 is a C 1 -C 12 alkyl group; or a C1-C6 alkoxy-C1-C6 alkyl group; m is a number from 1 to 5; and R7, R8, R9, R19 and A have the same meanings indicated above.

The even more preferred compounds are those of formula (1) or (2), wherein: R1 and R2 on the one hand, and R7 and R8 on the other hand, respectively form together with the nitrogen atom to which they are respectively linked to a piperidyl radical or a morpholinyl radical. The preferred compounds are also those of formulas (1) and (2), wherein: R4 and R5 and R9 and R1 /) respectively form a carbon ring which contains 6 carbon atoms.

The most preferred compounds are those of formula (1), wherein: R1 and R2 independently of one another are hydrogen; or a C1-C22 alkyl group; or a C1-C22 hydroxyalkyl group; or R1 and R2 together with the nitrogen to which they are attached form a piperidyl or morpholinyl radical; R3 is a group - (C = O) OR6; or a - (CO) NHR6 group; R6 is a C1-C22 alkyl group, which may be substituted with one or more -OH; R4 and R5 are hydrogen; or R4 and R5 are joined together to form a carbon ring which contains 6 carbon atoms. The most preferred compounds are those of formula (1), wherein: R1 and R2 independently of one another are hydrogen; or a C1-C22 hydroxyalkyl group; wherein at least one of R1 and R2 is a C1-C22 hydroxyalkyl group; R3 is a group - (C = O) OR6; or a group - (C = O) NHR6; R6 is a C1-C22 alkyl group; and R4 and R5 are hydrogen; or R4 and R5 are bonded together to form a carbon ring which contains 6 carbon atoms. The most preferred compounds are those of formula (2), wherein: R 7 and R 8 independently of one another are hydrogen or C 1 -C 8 alkyl, which may be one or more -O-; A is -0- or -NH; R11 is C1-C22 alkyl; and R9 and R10 are hydrogen; or R9 and R10 are bonded together to form a carbon ring which contains 6 carbon atoms. The most preferred compounds are those of formula (2), wherein: R 7 and R 8 together with the nitrogen atom to which they are attached form a morpholinyl or piperidyl radical; A is -O- or -NH; R11 is a C1-C22 alkyl group which may be interrupted by one or more -O-; and R9 and R10 are hydrogen; or R9 and R10 are bonded together to form a carbon ring which contains 6 carbon atoms. Even more preferred compounds are those of formula (2), wherein: R 11 is - (CH 2) n -O-R 12, where R 12 is a C 1 -C 4 alkyl group; or a C1-C4alkoxy-C1-C4 alkyl group; m is a number from 1 to 3; R7 and R8, independently of one another, are hydrogen; a C1-C12 alkyl group which may be interrupted by one or more O; or R7 and R8 together with the nitrogen atom to which they are attached form a morpholinyl or piperidyl radical; R 9 and R 10 are hydrogen or together form a carbon ring which contains 6 carbon atoms; and A is -O- or -Na. The merocyanine compounds of the invention may be in the geometric isomeric form E / E-, E / Z- or Z / Z. The alkyl, cycloalkyl, alkenyl, alkylidene or cycloalkenyl chains may be linear or branched, monocyclic or polycyclic chains. C1-C22 alkyl group is for example methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, 2-pentyl, 3-pentyl , 2,2-dimethylpropyl, n-hexyl, n-octyl, 1,1,3,3-tetramethylbutyl, 2-ethylhexyl, nonyl, decyl, n-octadecyl, eicosyl or dodecyl.

A substituted alkyl group is, for example, methoxyethyl, ethoxypropyl, 2-ethylhexyl, hydroxyethyl, chloropropyl, N, N-diethylaminopropyl, cyanoethyl, phenethyl, benzyl, p-tert-butylphenyl, p-tert-octylphenoxyethyl, (2,4-di-tertamylphenoxy) -propyl, ethoxycarbonylmethyl-2- (2-hydroxyethoxy) ethyl or 2-furylethyl. A hydroxy-substituted alkyl group is, for example, hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxybutyl, hydroxypentyl, hydroxyhexyl, hydroxyheptyl, hydroxyoctyl, hydroxynonyl or hydroxydecyl.

A C2-C22 alkenyl group is, for example, a linear C2-C12 alkenyl chain or preferably a C3-C12 branched alkenyl radical. C2-C22 alkenyl is, for example, vinyl, allyl, 2-propen-2-yl, 2-buten-1-yl, 3-buten-1-yl, 1,3-butadien-2-yl, 2- cyclobuten- 1 -yl, 2-p-en-1-yl, 3-penten-2-yl, 2-methyl-1-buten-3-yl, 2-methyl-3-buten-2-yl, 3 -methyl-2-buten-1-yl, 1,4-pentadien-3-yl, 2-cyclopenten-1-yl, 2-cyclohexen-1-yl, 3-cyclohexen-1-yl, cyclohexadien-1-yl, 1-p-menthen-8-yl, 4 (10) -thu-yl-1-yl, 2-norbornen-1-yl, 2,5-ornadadi-1-yl, 7,7-dimethyl-2,4-norcaradi-3-yl or the different isomers of hexenyl, octenyl, noenyl, decenyl or dodecenyl. A C 3 -C 12 cycloalkyl group is, for example, a cyclopropyl, cyclobutyl, cyclopentyl, trimethylcyclohexyl or preferably a cyclohexyl. Examples of the merocyanines according to the present invention are listed in Table A: Table A Compound Structure Structure Structure I 1 I 0 2 NI 0 0) -L 1 :)) I 0C) L 0 NINI (:)) IN Table A Compound Structure Composite Structure 3 I çNOC 4 \) IN) 0 () 1 0 NO r °.) II l IN _.' - .._, ---..... z ....__. .. .. .. .., ..-... O 6 NI 0 '-NIN) - .. 0 ..-- ,,,. 0 \)) NOH \) I 0) HIIN IN 0 8 \ ## STR1 ## in which R 1 is embedded in the formula ## STR2 ## ## STR2 ## ## STR2 ## ## STR2 ## NOH. , N Table A Compound Structure Compos Structure 17 OH HN 0 0 18 HOI I 0 7 e NNN (:). "------" .-- ".. ..--) I 19 HO N = 0 0 NINOC \ 7 --- O / X \) II \) 0 NI 21 rIN 0 IO 0 y 22 NIO - () y I - "Of \ 0 ---- 0 1 \ NIN 23 \ ## STR2 ## ## EQU1 ## ...... N 01.,. Table A Compound Structure Composite Structure 31 0, IHNI 0 0 0, 0, o, 2 H (D le N N c 33 I oo 4 I., (:) 0, H ## STR5 ## wherein: ## STR2 ## wherein: ## STR1 ## 0, 0 (;),., O, NH, N, N, O, 0, 40, OH, 0, 0, 0, 0, 0, 0, 0, 1, 0, and ## STR2 ## ## STR2 ## wherein ## STR5 ## 0. ,, ..'---- .., ... ,,, N ....--- ,,. 0 .., ..'...--- N ... 'N Table A Compound Structure Composite Structure 45 oI. O 46 0, ---, 0, - 0, -,, o, HN e / HN N \\ 110 N 47 oI \ 0 .. ", ...., In a particularly preferred form of the invention, a merocyanine family having the following formula (3) will be used. as well as their isomeric geometrical forms E / E- or E / Z-: O AR IIN (3) in which A is -O- or -NH; R is a C1-C22 alkyl group, a C2-C22 alkenyl group; , a C2-C22 alkinyl group, a cycloalkyl group C3-C22 or C3-C22 cycloalkenyl, said groups may be interrupted by one or more O. The merocyanine compounds of the invention may be in their geometric isomeric forms E / E-, E / Z-.

The compounds of formula (3) which are even more preferred are those where: A is -O-; R is a C1-C22 alkyl which may be interrupted by one or more O.

Among the compounds of formula (3), use will be made more particularly of those selected from the following group as well as their isomeric E / E-, E / Z- geometric shapes. N-ethyl (2Z) -cyano {3 - [(3-methoxypropyl) amino] cyclohex-2-en-1-ylidene} ethanoate 1H n N HN n '(2Z) -2 -cyano-N- (3-methoxypropyl) -2- {3 - [(3-methoxypropyl) amino] cyclohex-2-enylideneethanamide. N- (2-ethoxyethyl (2Z) -cyano- (3 - [(3-methoxypropyl) amino] cyclohex-2-en-1-ylidene} ethanoate 7 (DIoO HN 5 2-) methylpropyl (2Z) -cyano {3 - [(3-methoxypropyl) amino] cyclohex-2-en-1-ylidene} ethanoate 9 H 0 0 0 HNN e / 31 IH 0 0 0 0 N leN 37 IH 0 0 According to a more particularly preferred embodiment of the invention, the compound 2-ethoxyethyl (2Z) -cyano {3 - [(3-methoxypropyl) -amino] cyclohex-2-en-1-ylidene} will be used. ethanoate (25) in its geometric E / E and / or E / Z configuration The E / Z form has the following structure: The E / E form has the following structure: H 0 N The filtering merocyanines according to the invention, may be present in the compositions according to the invention in a concentrati ranging from 0.1% to 10% and preferably from 0.2% to 5% by weight relative to the total weight of the composition.

The compounds of formula (1) and (2) and especially of formula (3) can be prepared according to known methods, as described for example in J.Org.Chem. USSR (English translation) 26 (8), p. 1562f (1990); J. Heterocycl. Chem. 33 (3), p. 763-766 (1996); Khimiya Geterotsiklicheskikh Soedinenii 11, p. 1537-1543 (1984); Khimiya Geterotsiklicheskikh Soedinenii 3, p. 397-404 (1982); Chem.Heterocycl.Comp. (English translation) 24 (8), 914-919 (1988) and in Synthetic Communications Vol. 33, No. 3, 2003, pp. 367-371. The synthesis of the compounds used in the present invention is also described in US2003 / 0181483A1, WO 0234710, Eur. J. Org. Chem. 2003, 2250-2253, J. Med. Chem. 1996, 39, 1112-1124 and J. Org. Chem., Vol. 37, No. 8, 1972, 1141-1145 as follows: ## STR1 ## CH-acidic vinylogenic compounds are reacted with amide acetals . In J. Heterocyclic Chem., 27, 1990, 1143-1151, aminoacrylic acid esters or aminoacrylnitriles are controlled with ethoxymethylenecyanoacetates in ethanol to form the corresponding compounds of the present invention. Compounds of formula (1) or (2) wherein R4 and R5 on the one hand, or R9 and R10 on the other hand, together form a carbocyclic ring containing 6 carbon atoms, respectively, may be prepared according to the protocols described in Pat. Appl. WO 2007/071582, in IP.com Journal (2009), 9 (5A), 29-30 under the title "Process for producing 3-amino-2-cyclohexan-1-ylidene compounds" and in US-A-4,749,643 on collar, 13, line 66 - col. 14, line 57 and the references cited in this regard. According to one preferred embodiment, the invention relates to the use of a composition in which the merocyanine compound according to the invention represents an amount of 0.1% to 50%, in particular a quantity representing from 1% to 10% by weight. total of the composition, and more particularly an amount representing from 1% to 3% of the total weight of the composition. Additive Composition The complementary organic UV filters are chosen from cinnamic compounds; anthranilate compounds; salicylic compounds, dibenzoylmethane compounds, benzylidene camphor compounds; benzophenone compounds; compounds (3, 3-diphenylacrylate, triazine compounds, benzotriazole compounds, benzalmalonate compounds including those cited in US5624663, benzimidazole derivatives, imidazoline compounds, bis-benzoazolyl compounds as described in EP669323 patents; and US 2,463,264, p-amino benzoic compounds (PABA), methylene bis (hydroxyphenyl benzotriazole) compounds as described in US5,237,071, US 5,166,355, GB2303549, DE 197 26 184 and EP893119, benzoxazole compounds such as as described in patent applications EP0832642, EP1027883, EP1300137 and DE10162844, filter and silicone screening polymers such as those described in particular in application WO-93/04665, α-alkylstyrene derived dimers such as those described in US Pat. Patent Application DE19855649, 4,4-diarylbutadiene compounds as described in Applications EP0967200, DE19746654, DE19755649, EP-A-1008586, EP1133980 and EP133981 and mixtures thereof. Examples of organic photoprotective agents are those referred to below by their INCI name: Cinnamic compounds: Ethylhexyl Methoxycinnamate sold in particular under the trade name PARSOL MCX® by DSM Nutritial Products 2 Isopropyl Methoxycinnamate Isoamyl Methoxycinnamate sold under the trade name NEO HELIOPAN E 1000® by Symrise DEA Methoxycinnamate, Diisopropyl Methylcinnamate, Glyceryl Ethylhexanoate Dimethoxycinnamate Compounds dibenzoylmethane: Butyl Methoxydibenzoylmethane sold in particular under the trade name Parsol 1789® by DSM Nutritial Products Isopropyl Dibenzoylmethane. Para-Aminobenzoic Compounds: PABA, Ethyl PABA, Ethyl Dihydroxypropyl PABA, Ethylhexyl Dimethyl PABA sold in particular under the name "ESCALOL sue" by ISP, Glyceryl PABA, PEG-25 PABA sold under the name "UVINUL P25®" by BASF, Salicylic Compounds : Homosalate sold under the name "Eusolex Elms®" by Rona / EM Industries, Ethylhexyl Salicylate sold under the name "NEO HELIOPAN Ose" by Symrise, Dipropylene Glycol Salicylate sold under the name "DIPSAL®" by SCHER, TEA Salicylate, sold under the name "NEO HELIOPAN Tse" name by Symrise, F3,13-diphenylacrylate compounds: Octocrylene sold in particular under the trade name "UVINUL N539®" by BASF, Etocrylene, sold in particular under the trademark "UVINUL N35®" by BASF, Benzophenone compounds: Benzophenone-1 sold under the trade name "UVINUL 400e" by BASF, Benzophenone-2 sold under the trade name "UVINUL Dsoe" by BASF Benzophenone-3 or Oxybenzone, sold under the trade name "UVINUL mzioe" by 25 BA SF, Benzophenone-4 sold under the trade name "UVINUL ms40e" by BASF, Benzophenone-5 Benzophenone-6 sold under the trade name "Helisorb 11®" by Norquay Benzophenone-8 sold under the trade name "Spectra-Sorb UV-24e By American Cyanamid Benzophenone-9 sold under the trade name "UVINUL DS-49®" by BASF, Benzophenone-12 2- (4-diethylamino-2-hydroxybenzoyl) -benzyl benzoate sold under the trade name " UVINUL A Plus ® "or in combination with octylmethoxycinnamate under the trade name" UVINUL A Plus B® "by BASF. 1, 1- (1,4-Piperazinediyl) bis [14244- (diethylamino) -2-hydroxybenzoyl] phenyl] methanone (CAS 919803-06-8) Benzylidenecamphor compounds: 3-Benzylidene camphor manufactured under the name "MEXORYL SD®" by CHIMEX, 4-Methylbenzylidene camphor sold under the name "EUSOLEX 6300®" by MERCK, Benzylidene Camphor Sulfonic Acid manufactured under the name "MEXORYL SL®" by CHIMEX, Camphor Benzalkonium Methosulfate manufactured under the name "MEXORYL soe By CHIMEX, Terephthalylidene Dicamphor Sulfonic Acid manufactured under the name "MEXORYL SX®" by CHIMEX, Polyacrylamidomethyl Benzylidene Camphor manufactured under the name "MEXORYL SW®" by CHIMEX, Phenylbenzimidazole compounds: Phenylbenzimidazole Sulfonic Acid sold in particular under the trade name "EUSOLEX 232®" by MERCK, bis-benzoazolyl compounds Disodium Phenyl Dibenzimidazole Tetrasulfonate sold under the trade name "NEO 25 HELIOPAN APe" by Haarmann and REIMER, Phenyl benzotriazole compounds: Drometrizole Trisil oxane sold under the name "Silatrizolee" by Rhodia Chimie, methylenebis (hydroxyphenylbenzotriazole) methylene bis-benzotriazolyltetramethylbutylphenol, especially in solid form, such as the product sold under the trade name "MIXXIM BB / 100®" by FAIRMOUNT CHEMICAL or in the form of an aqueous dispersion of micronized particles having an average particle size ranging from 0.01 to 51 μm and more preferably from 0.01 to 2 μm and more particularly from 0.020 to 2 μm with at least one surfactant. alkylpolyglycoside of structure C.H2n + 1 0 (C6H1005) H wherein n is an integer of 8 to 16 and x is the average degree of polymerization of the unit (C6H1005) and ranges from 1.4 to 1.6 such as described in GB-A-2 303 549 sold especially under the trade name "TINOSORB M®" by BASF or in the form of an aqueous dispersion of micronized particles having an average particle size which varies from 0.02 to 2! .. tm and more preferen 0.01 to 1.5 μm and more particularly 0.02 to 1 μm in the presence of at least one polyglyceryl mono- (C 8 -C 20) alkyl ester having a degree of glycerol polymerization of at least 5 such as the aqueous dispersions described in application WO2009 / 063392. Triazine compounds: - Bis-Ethylhexyloxyphenol Methoxyphenyl Triazine sold under the trade name "Tinosorb S®" by BASF, - Ethylhexyl triazone sold in particular under the trade name "Uvinul Tuoe" by BASF, - Diethylhexyl Butamido Triazone sold under the trade name "UVASORB HEB ® by SIGMA 3V, 2,4,6-tris (dineopentyl 4'-amino benzalmalonate) -s-triazine, 2,4,6-tris- (4'-amino benzalmalonate diisobutyl) -s triazine, n-butyl 2,4-bis (4-aminobenzoate) -6- (aminopropyltrisiloxane) -s-triazine, dineopentyl 2,4-bis (4'-aminobenzalmalonate) -6- ( N-butyl 4'-aminobenzoate) -s-triazine, the symmetrical triazine filters substituted with naphthalenyl groups or polyphenyl groups described in US Pat. No. 6,225,467, Application WO2004 / 085412 (see compounds 6 and 9) or "Symetrical Triazine Derivatives" IP.COM Journal, IP.COM INC. WEST HENRIETTA, NY, US (September 20, 2004) in particular 2,4,6-tris (di-phen) yl) -triazine and 2,4,6-tris- (ter-phenyl) -triazine, which is incorporated in patent applications W006 / 035000, W006 / 034982, W006 / 034991, W006 / 035007, WO2006 / 034992, WO2006 / 034985. the triazine silicones substituted with two aminobenzoate groups as described in patent EP0841341, in particular 2,4-bis (n-butyl 4'-aminobenzalmalonate) -6 - [(3- {1,3,3,3 - tetramethyl-1-trimethylsilyloxy] di (siloxanyl) propyl) amino] -s-triazine, anthranilic compounds: Menthyl anthranilate sold under the trade name "Neo Heliopan mAe" by Symrise Imidazoline Compounds: Ethylhexyl Dimethoxybenzylidene Dioxoimidazoline Propionate, Compounds Benzalmalonate: Polyorganosiloxane benzalmalonate functions such as Polysilicone-15 sold under the trade name "PARSOL SLX®" by HOFFMANN LA ROCHE Compounds 4,4-diarylbutadiene: -1,1-dicarboxy (2,2'-dimethylpropyl) -4,4- diphenylbutadiene Benzoxazole compounds: 2,4-bis- [5-1 (dimethylpropyl) benzoxazol-2-yl- (4-phenyl) imino] -6- (2-ethylhexyl) -imino1,3,5-triazine sold under the name of Uvasorb K2A® by Sigma 3V and their mixtures. The preferred organic screening agents are selected from ethylhexyl methoxycinnamate ethylhexyl salicylate, homosalate, butylmethoxydibenzoylmethane, octocrylene, phenylbenzimidazole sulfonic acid, benzophenone-3, benzophenone-4, benzophenone-5, 2- (4-diethylamino-2-hydroxybenzoyl), and ) -N-hexyl benzoate. 4-Methylbenzylidene camphor, Terephthalylidene Dicamphor Sulfonic Acid, Disodium Phenyl Dibenzimidazole Tetrasulfonate, Methylene bis-Benzotriazolyl Tetramethylbutylphenol Bis-Ethylhexyloxyphenol Methoxyphenyl Triazine Ethylhexyl triazone, Diethylhexyl Butamido Triazone, 2,4,6-Tris (4'-amino benzalmalonate Dineopentyl 2,4,6-tris- (4'-amino benzalmalonate diisobutyl) -s-triazine 2,4bis (n-butyl 4'-aminobenzoate) -6- (aminopropyltrisiloxane) -s-triazine triazine, 2,4bis (dineopentyl 4'-aminobenzalmalonate) -6- (n-butyl 4'-aminobenzoate) -s-triazine, 2,4,6-tris (bis-phenyl-4-yl) 2,4,6-tris (ter-phenyl) -1,3,5-triazine 2,4-bis (n-butyl 4'-aminobenzalmalonate) -6 - [(3-), 3,5-triazine 1,3,3,3-tetramethyl-1-trimethylsilyloxy) disiloxanylpropyl) amino] -s-triazine, 2,4-bis (n-butyl 4'-aminobenzalmalonate) -6 - [(3- {1,3 , 3,3-tetramethyl-1-trimethylsilyloxy) disiloxanylpropyl) amino] s-triazine Drometrizole Trisiloxane Polysilicone-1,1-dicarboxy (2,2'-dimethyl) propyl) -4,4-diphenylbutadiene 2,4-bis- [5-1 (dimethylpropyl) benzoxazol-2-yl- (4-phenyl) imino] -6- (2-ethylhexyl) imino-1, 3,5-triazine and mixtures thereof. Particularly preferred organic filters are selected from ethylhexyl salicylate, homosalate, butyl methoxydibenzoylmethane octocrylene, n-hexyl 2- (4-diethylamino-2-hydroxybenzoyl) benzoate. Terephthalylidene Dicamphor Sulfonic Acid, Bis-Ethylhexyloxyphenol Methoxyphenyl Triazine Ethylhexyl Triazone, Diethylhexyl Butamido Triazone, Drometrizole Trisiloxane and mixtures thereof.

The inorganic UV filters used in accordance with the present invention are metal oxide pigments. More preferably, the inorganic UV filters of the invention are metal oxide particles having an average element particle size less than or equal to 0.5 μm, more preferably between 0.005 and 0.5 μm and even more preferably between 0.01 and 0.2 .mu.m, more preferably between 0.01 and 0.1 .mu.m, and more particularly between 0.015 and 0.05 .mu.m. They may especially be chosen from titanium, zinc, iron and zirconium oxides. , cerium or their mixtures. Such metal oxide pigments, coated or uncoated, are in particular described in patent application EP-A-0 518 773. As commercial pigments mention may be made of the products sold by the companies SACHTLEBEN PIGMENTS, TAYCA, MERCK AND Degussa. The metal oxide pigments may be coated or uncoated. The coated pigments are pigments which have undergone one or more surface treatments of a chemical, electronic, mechanochemical and / or mechanical nature with compounds such as amino acids, beeswax, fatty acids, fatty alcohols , anionic surfactants, lecithins, sodium, potassium, zinc, iron or aluminum salts of fatty acids, metal alkoxides (of titanium or aluminum), polyethylene, silicones, proteins (collagen, elastin) alkanolamines, silicon oxides, metal oxides or sodium hexametaphosphate. The coated pigments are more particularly titanium oxides coated with: - silica such as the product "SUNVEIL®" from the company IKEDA, - silica and iron oxide such as the product "SUNVEIL F®" from the company IKEDA Silica and alumina, such as the products "MICROTITANIUM DIOXIDE MT 500 SA®" and "MICROTITANIUM DIOXIDE MT 100 SA" from the company TAYCA, "TIOVEIL" from the company TIOXIDE, - alumina such as products "TIPAQUE TTO-55 (B) ®" and "TIPAQUE TTO-55 (A) ®" from ISHIHARA, and "UVT 14/4" from SACHTLEBEN PIGMENTS, - alumina and aluminum stearate such as the "MICROTITANIUM DIOXIDE MT 100 T®, MT 100 TX®, MT 100 Z®, MT-01®" products from TAYCA, the "Solaveil CT-10 W®" and "Solaveil CT 100®" products from the company UNIQEMA and the product "Eusolex T-AVO®" from MERCK, - silica, alumina and alginic acid such as the product "MT-100 AQ®" from the company TAYCA, - alumina and laurate luminium such as the product "MICROTITANIUM DIOXIDE MT 100 S®" from TAYCA, - iron oxide and iron stearate such as the product "MICROTITANIUM DIOXIDE MT 100 F®" from the company TAYCA, - oxide zinc and zinc stearate such as the product "BR 351®" from TAYCA, - silica and alumina and treated with a silicone such as the products "MICROTITANIUM DIOXIDE MT 600 SAS®", "MICROTITANIUM DIOXIDE MT 500 SAS® "or 15" MICROTITANIUM DIOXIDE MT 100 SAS® "from TAYCA, - silica, alumina, aluminum stearate and treated with a silicone such as the product" STT-30-DS® "from the company TITAN KOGYO, - silica and treated with a silicone such as the product "UV-TITAN X 195®" from SACHTLEBEN PIGMENTS, 20 - alumina and treated with a silicone such as the products "TIPAQUE TTO-55 (S) ® "from the company ISHIHARA, or" UV TITAN M 262® "from the company SACHTLEBEN PIGMENTS, - triethanolamine such as the product" STT-65-S " of the company TITAN KOGYO, - stearic acid such as the product "TIPAQUE TTO-55 (C) ®" ISHIHARA company, sodium hexametaphosphate such as the product "MICROTITANIUM DIOXIDE MT 150 W®" of the TAYCA company. the TiO 2 treated with octyl trimethyl silane sold under the trade name "T 805®" by the company Degussa Silices, the TiO 2 treated with a polydimethylsiloxane sold under the trade name "70250 Cardre UF TiO2SI3e" by CARDRE, the anatase / rutile TiO 2 treated with a polydimethylhydrogensiloxane sold under the trade name "MICRO TITANIUM DIOXIDE USP GRADE HYDROPHOBIC®" by the company COLOR TECHNIQUES.

It is also possible to mention TiO 2 pigments doped with at least one transition metal such as iron, zinc, manganese and more particularly manganese. Preferably, said doped pigments are in the form of an oily dispersion. The oil present in the oily dispersion is preferably chosen from triglycerides including those of capric / caprylic acids. The oily dispersion of titanium oxide particles may additionally comprise one or more dispersing agents, for example a sorbitan ester such as sorbitan isostearate, a polyoxyalkylenated fatty acid and glycerol ester such as TRI-PPG3 MYRISTYLETHER CITRATE and POLYGLYCERYL-3 POLYRICINOLEATE. Preferably, the oily dispersion of titanium oxide particles comprises at least one dispersing agent chosen from fatty acid esters and polyoxyalkylenated glycerol. Mention may more particularly be made of the oily dispersion of manganese-doped TiO 2 particles in capric / caprylic acid triglyceride in the presence of TRI-PPG-3 MYRISTYLETHER CITRATE and POLYGLYCERYL-3-POLYRICINOLEATE and SORBITAN ISOSTERATE by INCI name: TITANIUM DIOXIDE (and) TRI-PPG-3 MYRISTYLETHER CITRATE (and) POLYGLYCERYL-3 RICINOLEATE (and) SORBITAN ISOSTEARATE as the product sold under the trade name OPTISOL TD50® by the company CRODA. Uncoated titanium oxide pigments are for example sold by TAYCA under the trade names "MICROTITANIUM DIOXIDE MT 500 B" or "MICROTITANIUM DIOXIDE MT600 Be", by DEGUSSA under the name "P 25", by the company WACKHER under the name "Transparent Titanium Oxide PW®", by the company MIYOSHI KASEI under the name "UFTRe", by the company TOMEN under the name "ITS®" and by the company TIOXIDE under the name "5" TIOVEIL AQ ". The uncoated zinc oxide pigments are, for example: those marketed under the name "Z-cote" by the company Sunsmart; Those marketed under the name "Nanox®" by Elementis; those marketed under the name "Nanogard WCD 2025®" by Nanophase Technologies; The coated zinc oxide pigments are, for example: those marketed under the name "Zinc Oxide CS-5®" by the company Toshibi (ZnO coated with polymethylhydrogenosiloxane); those marketed under the name "Nanogard Zinc Oxide FN®" by the company Nanophase Technologies (as a 40% dispersion in Finsolv TN®, benzoate of C12-C15 alcohols); those marketed under the name "DAITOPERSION ZN-30®" and "DAITOPERSION Zn-50®" by the company Daito (dispersions in cyclopolymethylsiloxane / polydimethylsiloxane oxyethylenated, containing 30% or 50% of zinc oxides coated with silica and the polymethylhydrogensiloxane); those marketed under the name "NFD Ultrafine ZnO®" by the company Daikin (ZnO coated with perfluoroalkyl phosphate and a copolymer based on perfluoroalkylethyl dispersed in cyclopentasiloxane); those marketed under the name "SPD-Z1®" by the company Shin-Etsu (ZnO coated with silicone-grafted acrylic polymer, dispersed in cyclodimethylsiloxane); those marketed under the name "Escalol Z100®" by the company ISP (ZnO treated alumina and dispersed in the mixture methoxycinnamate ethylhexyl / copolymer PVPhexadecene / methicone); those marketed under the name "Fuji ZnO-SMS-10®" by Fuji Pigment (ZnO coated with silica and polymethylsilsesquioxane); - those sold under the name "Nanox Gel TN®" by Elementis (ZnO dispersed at 55% in C12-C15 alcohols benzoate with hydroxystearic acid polycondensate). The uncoated cerium oxide pigments may be, for example, those sold under the name "COLLOIDAL CERIUM OXIDE®" by the company RHONE POULENC. Uncoated iron oxide pigments are for example sold by ARNAUD under the names "NANOGARD WCD 2002® (FE 45B®)", "NANOGARD IRON FE 45 BL AQ", "NANOGARD FE 45R AQ®," NANOGARD WCD 2006® (FE 45R®) ", or by MITSUBISHI under the name" TY-220® "The coated iron oxide pigments are for example sold by ARNAUD under the names" NANOGARD WCD 2008 ". (FE 45B FN) ® "," NANOGARD WCD 2009® (FE 45B 556®) "," NANOGARD FE 45 BL 345® "," NANOGARD FE 45 BL® ", or by BASF under the name" OXIDE IRON " TRANSPARENT®. "Mention may also be made of mixtures of metal oxides, in particular of titanium dioxide and cerium dioxide, of which the titanium dioxide / cerium dioxide-coated cerium alloy mixture is sold by IKEDA under the name of "SUNVEIL A®" and the mixture of titanium dioxide and zinc dioxide coated with alumina, silica and silic one such that the product "M 261®" sold by SACHTLEBEN PIGMENTS or coated with alumina, silica and glycerine such as the product "M 211e" sold by SACHTLEBEN PIGMENTS. According to the invention, the preferred additional UV filters are chosen from Avibenzone, octocrylene, Tinosorb S and / or Meroxyl SX and / or the combination of 2 or more of these UV filters, and even more preferred combination of Avibenzone, Octocrylene, Tinosorb S and Meroxyl. The additional UV filters according to the invention are preferably present in the compositions used according to the invention at a content ranging from 0.1% to 30% by weight and in particular from 1 to 3%, by weight, relative to the weight. total of the composition.

The present invention relates to the cosmetic use of an effective amount of at least one merocyanine agent to prevent reactivation of herpes simplex virus (HSV) type 1 and / or recrudescence of Herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or said recrudescence. Another object of the present invention is constituted by a non-therapeutic cosmetic method for preventing the reactivation of herpes simplex virus (HSV) type 1 and / or an upsurge of herpes outbreaks and / or the appearance of disorders. cutaneous induced by said reactivation and / or said recrudescence comprising the application, in an individual in need, of a composition as defined above.

Preferably, a method of the invention may comprise topically applying to at least a portion of the skin of an individual in need thereof, in particular on the skin of the face of at least one layer of a skin. topical composition of the invention. The amount of composition to be applied to obtain a layer on the face of an adult is about 1 g. A cosmetic process according to the invention may be carried out daily, for example for a single application per day, or a divided administration in two or three times a day, for example once in the morning and once. the evening. A cosmetic process according to the invention may be carried out over a period of time varying from one week to several weeks, or even several months, this period being able to be repeated after periods of non-treatment for several months or even several years. . By way of example, a cosmetic process according to the invention can be provided for applying a cosmetic composition of the invention, for example, at a rate of 1, 2 or 3 times per day, or more, and generally on a extended duration of at least 4 weeks, or even 4 to 15 weeks, with one or more periods of interruption where applicable. In a preferred manner according to the invention, the composition is applied before exposure to the sun and is renewed every 2 hours, or in case of friction or bathing. Screening method There is still a need for new screening tools for active agents to prevent reactivation of herpes simplex virus (HSV) type 1 and / or recrudescence of herpes outbreaks and / or The present invention has the object of satisfying these needs. The present invention therefore also relates to a method of in vitro or ex vivo screening of active agents capable of limiting and / or inhibiting the expression modulation of at least one of the genes selected from IFIT1, IFIT2, TLR3, DDX58, or CXCL10, comprising at least the steps of: a) disposing said composition on a skin sample. b) exposing the skin sample obtained in step a) to long UVA c) performing a qualitative or quantitative measurement of the expression modulation of at least one gene selected from IFIT1, IFIT2, TLR3, DDX58 and / or CXCL10. d) comparing the measurement obtained in step c) to a reference measurement and concluding that the compound is effective in preventing reactivation of herpes simplex virus (HSV) type 1 and / or recrudescence of herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or said recrudescence, if this compound limits or inhibits the modulation of the expression of at least one gene selected from IFIT1 (SEQ ID NO: 1), IFIT2 (SEQ ID NO: 2), TLR3 (SEQ ID NO: 4), DDX58 (SEQ ID NO: 3), and / or CXCL10 (SEQ ID NO: 5). Sampling methods The sampling of an epidermis sample can be done by any method known to those skilled in the art. These methods can be performed by so-called stripping techniques. These strippings are tacky surfaces applied to the surface of the epidermis such as 3M blenderm, D'squam (commercial adhesive of CuDERM), cyanoacrylate glue or varnish stripping method. Thanks to these strippings, the adherent corneocytes and the contents of their intercellular spaces can be removed and subsequently subjected to an extraction allowing access to the protein content. Sampling of a sample suitable for the process can also be carried out more directly by "washing" the skin surface by means of, for example, turbine-like, spiral-type accessories (as described in US Pat. patent FR 2 667 778) associated with a fluid circuit, or simply by adding / removing a drop of buffer on the surface of the skin. As an indication, other methods of sampling suitable for the implementation of the invention, methods of scraping the upper part of the stratum corneum by means of a bimetallic system may be mentioned. This technique allows the collection of scales that can then be directly analyzed by different techniques to determine the levels of minerals, amino acids or lipids. Samples can be stored in the freezer and then analyzed by techniques known to those skilled in the art, such as LC / ESI / MS analysis. Reference value A screening method according to the invention may comprise the comparison of a measurement of the expression of a nucleic acid sequence according to the invention with a reference measurement. A reference measurement may be a quantitative or qualitative value relating to the expression of said sequences determined in a sample in the absence of active agent. A comparison of the test measurement with a reference measurement, and an observation of a deviation or absence of deviation between the two measurements, makes it possible to draw information as to the effect of the active agent. the intensity and / or nature of this (negative) deviation may be informative of the effectiveness of the test compound. A reference value may be, for example, a polypeptide or nucleic acid sequence content determined on an epidermal sample taken from a skin that has not been exposed to UVs, and in particular to long UVAs. In the context of the present invention, it has been observed that the level of mRNA, transcribed with the genes IFIT1 (SEQ ID NO: 1), IFIT2 (SEQ ID NO: 2), TLR3 (SEQ ID NO: 4), DDX58 (SEQ ID NO: 3), and / or CXCL10 (SEQ ID NO: 5) is decreased after exposure of the skin to long UVA.

The expression values of these genes can be expressed in arbitrary units or calculated by establishing a calibration curve. The measurement of a reference value may be performed in parallel or sequentially to the determination of said content of a polypeptide or nucleic acid sequence.

Thus, for example, a mRNA or polypeptide content determined 1.5 to 10 times lower than a reference value obtained from skin not exposed to UVs and in particular long UVAs, may be indicative of reactivation. of the virus. Methods for Determining the Polypeptide The determination of a content of polypeptide according to the invention or nucleic acids according to the invention in an epidermis sample may be carried out by any protocol known to those skilled in the art. As a method for detecting a polypeptide, mention may be made of Western blot, blot dot, Dot blot, ELISA (Enzyme linked immuno-Sorbent Assay) methods of single or multiplex type, proteomic methods, staining polypeptides in a polyacrylamide gel with a silver dye, Coomassie blue or SYPRO, immunofluorescence, UV absorption, immunohistochemical methods in conventional electron microscopy or confocal, of FRET (fluorescence resonance energy transfer), TR-FRET methods (time resolved FRET / FRET in time resolution), fluorescence lifetime imaging microscopy (FLIM) methods fluorescence time), methods of FSPIM (fluorescence spectral imaging microscopy / fluorescence spectrum microscopy imaging), methods of FRAP (fluorescence recovery after photobleaching / recovery fluorescence after photo bleaching), reporter gene methods, atomic force microscopy (AFM) methods, surface plasmon resonance methods, microcalorimetry methods, flow cytometry methods, biosensor methods, radioimmunoassay (RIA) methods, methods using peptide chips, sugar chips, antibody chips, mass spectrometry methods, SELDI-TOF spectrometry methods (Ciphergen). More generally, immunoenzymatic assay methods from more quantitative and sensitive protein solutions can in particular be used. These ELISA-type methods combine pairs of capture and detection antibodies specific for the targeted antigen. Specifically developed commercial or polyclonal, monoclonal or recombinant antibodies can be used. High capacity multiplexed ELISA techniques can also be implemented. It is thus possible to cite the multiplexed approach of the Luminex antibody (for example Bioplex from Bio-Rad) antibody type, of the antibody-on-flat surface type ("antibodies-arrays") (for example approach proposed by Meso Scale Discovery). Nucleic acid determination methods The quantitative or qualitative determination of the expression, the maturation or the activity of an amino acid sequence or of a nucleic acid sequence of the invention may be performed by any method known to those skilled in the art. By way of example of methods that are suitable for the invention, mention may be made of the polymerase chain reaction (PCR), quantitative (Q-PCR) or not, in the presence or absence of reverse transcriptase (RT-PCR or Q-RT-PCR), Northern-blot, ribonuclease protection assay, microarray methods, transcriptomic chip methods, oligonucleotide microarray methods, hybridization methods if you.

By way of example of agents suitable for the detection of a nucleic acid sequence of the invention, and in particular of an mRNA sequence, mention may be made of labeled nucleic acid probes which can be hybridizing to a nucleic acid sequence of the invention. Such a nucleic acid probe can be easily obtained by any method known to those skilled in the art. Thus, the nucleic acid sequences according to the invention can be used to produce sense and / or antisense oligonucleotide primers, which hybridize under conditions of high stringency to at least one of the sequences SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and / or SEQ ID NO: 10, primers such as SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO : 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 , SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28.

According to one embodiment, a screening method according to the invention can be implemented in a cell-free system, i.e. in a system not comprising cells but reproducing cellular functions, or in an isolated cell sample. A screening method according to the invention may be carried out on an isolated cell sample, an acellular sample, an isolated amino acid sequence or an isolated nucleic acid sequence of the invention, obtained by cutaneous biopsy, from cells in culture, in particular from an epidermal model, or from a non-invasive skin surface sample, in particular by stratum corneum tape-stripping or by simple washing, as previously described.

Preferably, the screening of an active agent can be carried out by measuring the variation of the expression, in the presence and absence of the active agent. The active agents or the physical treatments resulting from a screening according to the invention may advantageously be used for cosmetic or therapeutic purposes.

The examples which follow serve to illustrate the invention without, however, being limiting in nature. In these examples, the amounts of the ingredients compositions are given in% by weight relative to the total weight of the composition.

FIGHTING LEGEND: FIG. 1: IFIT1 and DDX58 mRNA level in reconstructed skin fibroblasts exposed or not exposed to 40 J / cm 2 long UVA, protected or not by a solar formula. MRNA levels are expressed in arbitrary units. The rate of the unexposed sample has been reduced to 1. The error bars represent the standard error to the mean. FIG. 2: Level of IFIT1 and TLR3 mRNA in keratinocytes of reconstructed skin exposed or not exposed to 40 J / cm 2 of long UVA, protected or not by a solar formula. MRNA levels are expressed in arbitrary units. The unexposed sample rate has been reduced to 1. The error bars represent the standard error to the mean. Figure 3: Long UVA emission spectrum used for reconstructed skin experiments. Figure 4: Absorption Spectrum of Test Formulas A and B. Figure 5: Long UVA emission spectrum used for in vivo experiments. EXAMPLES: Example 1: Materials and Methods A. Reconstructed In Vitro Skin Studies Reconstructed Skin In vitro reconstructed skin comprising a stratified and differentiated epidermis with horny layers and a living equivalent dermis are made with normal human keratinocytes and fibroblasts normal human dermis. Briefly, equivalent dermas are made with bovine collagen I and one million human dermis fibroblasts. Normal keratinocytes are inoculated after contraction of the lattices at 500,000 keratinocytes and cultured in the conventional medium for 7 days. The culture is then mounted on a grid for the emergence phase (air-liquid interface, 7 days). At the end of this period, the skins have a morphology very close to normal human skin. They can then be used for different experiments by maintaining the culture medium under the skin that is nourished by capillarity. Long UVA Exposure Long UVAs are delivered with an Oriel Solar Simulator (1000Watts xenon lamp) equipped with a WG 360 / 2mm filter to cut all wavelengths below 340 nm (Figure 3). It should be noted that in order to obtain the entire UVA spectrum up to 400 nm, we can not overcome the wavelengths between 400 nm and 440 nm corresponding to visible light. For practical reasons, we will name the "long UVA" emission spectrum. The reconstructed skin is exposed to long UVA in the absence of culture medium and in the presence of PBS. After exposure, the skins are re-cultured while waiting for their collection (6h post-UVA long to study gene expression by microarray Affimetrix or quantitative PCR).

RNA extraction The equivalent dermis and reconstructed epidermis are separated using fine forceps. The epidermal keratinocytes and the dermal fibroblasts are then lysed separately and then the total tRNAs are extracted using the Qiagen kit RNeasy midi kit. Transcriptomic study by the method of Microarray Affimetrix. A full genome transcriptomic study on a Human Gene 1.0 ST Affimetrix chip was performed to study the effect of reconstructed skin exposure at 40 J / cm 2 long UVA. Hybridization on Human Gene 1.0 ST Affimetrix chips Three reconstructed skins served as unexposed control and 3 reconstructed skins were exposed to 40 J / cm2 of long UVA. Six hours after exposure, the equivalent dermis and reconstructed epidermis are separated from each reconstructed skin and the total RNAs are extracted separately from each sample. For each condition, the synthesis of the cRNAs was performed from 300 ng of total RNA. Human Gene 1.0 ST microarray hybridization was performed according to the "Whole transccript IVT kit" protocol. 5.5 ssDNA lag were used for the fragmentation and labeling steps. A total of 12 chips were thus generated, with 3 chips hybridized with each of the 3 control dermal samples (D9, D10, D11), 3 chips with each of the 3 dermal samples exposed to long UVA (D14, D15, D16), 3 chips with each of 3 epidermal control samples (E9, E10, El 1), 3 chips with each of 3 epidermal samples exposed to long UVA (E14, E15, E16) See Table 1: Name Table 1: Hybridized samples on Affimetrix D9 chips -CTRL Tissue Processing File Affymetrix D 1 0- Dermis Control 01-D9- (HuGene-1-0- st-vl). CEL CTRL Dermal Control 02-D10- (HuGene-1-0-st-v1) .CEL D1-CTRL Dermal Control 03-D11- (HuGene-1_0-st-v1) .CEL UVA D14-TT Dermal long 04- D14- (HuGene-1-0-st-v1) .CEL UVA D15-TT Dermal Long 05-D15- (HuGene-1-0-st-v1) .CEL UVA D16-TTT Long Dermal 06-D16- (HuGene) -1-0-st-v1) .CEL E9-CTRL Epidermis control L 07-E9- (HuGene-1-0-st-v1) .CEL E10-CTRL Epidermis control 08-E10- (HuGene-1-0- st-v1) .CEL E 1 1- CTRL Epidermis control 09-E11- (HuGene-1-0-st-v1) .CEL UVA E14-TTT Epidermis long 10-E14- (HuGene-1-0-st-v1) ) .CEL UVA E15-TTT Epidermis long 11-E15- (HuGene-1-0-st-v1) .CEL UVA E16-TTT Epidermis long 12-E16- (HuGene-1-0-st-v1) .CEL Normalization and statistical analyzes for the determination of ditherentially expressed genes The data were normalized by the method RMA (Robust Multichip Average).

Gene expression was therefore compared in 3 control dermal samples versus 3 dermal samples exposed to long UVA, and in 3 epidermal control versus 3 epidermal samples exposed to long UVA. The "ebayes" method was used to determine differentially expressed genes between two conditions (Smyth, 2004). In order to correct the error associated with the multiple tests, a correction of the p value was performed by the FDR method, generating an adjusted pValue (adj P. Val). A gene was considered differentially expressed between 2 conditions if the modulation rate between the control value and the long UVA value was greater than 2 or less than 0.5 and the adjusted pValue (Adj.p) was less than 0.001.

Solar compositions Constituents and characteristics of formula A and B compositions Formula% Filter Formula A 1.5% Avobenzone 5% Octocrylene 1% Tinosorb S 0.3% Mexoryl SX = reference formula Formula B = 0.8% Avobenzone 5% Octocrylene 1.1% Tinosorb S 1.5% Mexoryl SX 1.5% BC-3 Long UVA Shift Formula Absorption profiles of the formulas tested The absorption spectra of the filtering formulas A and B clearly show the net absorption gain in the long UVA for the formula D (purple curve) compared to the reference formula C (in blue) (Figure 4). Formula A absorbs UVB, short UVA and a portion of long UVA (up to about 370 nm). Formula B absorbs the same wavelengths as Formula A, plus about 30 nm in long UVAs (up to about 400 nm) (Figure 4). Application of the solar formula on reconstructed skin 2 mg / cm2 of product are spread on the surface of the epidermis of the reconstructed skin, using a glass rake. Assay of mRNA level in reconstructed skin keratinocytes and fibroblasts by the quantitative PCR method Quantification of the mRNAs by quantitative PCR A reverse transcription of 1 μg of total RNA is carried out (Advantge RT for PCR kit, Clontech) . Gene expression was studied in each cell type by real-time quantitative PCR on LigtCycler 480 (Roche), from the transcribed reverse cDNAs. The results are normalized by the mRNA levels of 5 reference genes (GAPDH, b2m, RPS9, RPL13A and RPS28), using the Genorm software (Savli et al., 2003, Vandesompele et al., 2002). The gene names and the sequences of the primers used are given in Table 2. Table 2 genebank accession no Gene name Foward Primer (3'-5 ') Reverse Primer (5'-3') 2 NM_001548 IFIT1 AGTGGTAGAAGAAACAATGCAAGAC (SEQ ID NO: 11) TCATTCATATTTCCTTCCAATTTGT (SEQ ID NO: 20) NM_001547 IFIT2 GCGTGAAGAAGGTGAAGAGG (SEQ ID NO: 12) AATTTGGCAATGCAGGTAGG (SEQ ID NO: 21) NM_003265 TLR3 CTTTCGAGAGTGCCGTCTATTTGC (SEQ ID NO: 13) CAGCATCCCAAAGGGCAAAAGG (SEQ ID NO: 22) NM_014314 DDX58 AGAGCACTTGTGGACGCTTT (SEQ ID NO: 14) TGCAATGTCAATGCCTTCAT (SEQ ID NO: 23) NM_002046 GAPDH GGCTCTCCAGAACATCATCCCTGC (SEQ ID NO: 15) GGGTGTCGCTGTTGAAGTCAGAGG (SEQ ID NO: 24) 5 February NM_001013 PSR9 GATGAGAAGGACCCACGGCGTCTGTTCG (SEQ ID NO: 16) GAGACAATCCAGCAGCCCAGGAGGGAC (SEQ ID NO: 25) NM_004048 B2M TTTCATCCATCCGACATTGA (SEQ ID NO: 17) CCTCCATGATGCTGCTTAAC (SEQ ID NO: 26) NM_012423 RPL13A TAAACAGGTACTGCTGGGCCGGAAGGTG (SEQ ID NO: 18) CACGTTCTTCTCGGCCTGTTTCCGTAGC (SEQ ID NO: 27) NM_001031 RPS28 CCGTGTGCAGCCTATCAAG (SEQ ID NO: 19 ) CAAGCTCAGCGCAACCTC (SEQ ID NO: 28) Table 2: Markers and primers used for gene expression. The 5 genes of interest are the first of the list, the 5 genes used to normalize the data appear at the end of the list. Calculation of mean gene modulation rate For each gene studied and for each condition, the average modulation rate is calculated as follows: mean gene mRNA level in the exposed samples divided by gene mRNA level in the samples controls. B. In vivo studies on human skin 40 An in vivo transcriptomic study is carried out in humans, after exposure to 100 J / cm 2 long UVA delivered by a Sellamed 2000 device on volunteers. Total skin biopsies were performed 24 h after exposure.

The emission spectrum is presented in FIG. 5. Example 2: Genes of antiviral defense modulated by long UVA in reconstructed skin Reconstructed skin, including keratinocytes and fibroblasts, was exposed to 40 J / cm 2 of long UVA. Six hours after the dermal and epidermal compartments were separated and a full genome transcriptomic study was performed using Affimetrix chips in fibroblasts (Table 1) and reconstructed skin keratinocytes (Table 2). Many genes have been found modulated by long UVAs, including genes for defense / antiviral recognition. FIBROBLASTS Interferon Inducing Genes NM_001548 IFIT1 (SEQ ID NO: 1) NM_001547 IFIT2 (SEQ ID NO: 2) RNA Receptors NMR014314 DDX58 (SEQ ID NO: 3) NM_003265 TLR3 (SEQ ID NO: 4) 3.78 interferon 1 2.82 interferon-induced protein with tetratricopeptide repeats 2 2.77 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 2.24 toll-like receptor 3 Modulation rate of expression of genes of the family "Innate Immunity" in reconstructed skin fibroblasts exposed to long UVA.

Negative values (shaded) represent gene expression suppression rates relative to unexposed control (Adj.p <0.001). For example, the IFIT1 gene is 3.78 times less expressed in the sample exposed to long UVA compared to the unexposed sample. KERATINOCYTES Interferon inducing genes NM_001548 IFIT1 (SEQ ID NO: 1) -4,09 interferon-induced protein with tetratricopeptide repeats 1 NM_001565 CXCL10 (SEQ ID NO: 5) -2.88 chemokine (CXC motif) ligand 10 RNA Receptors NM_003265 TLR3 (SEQ ID NO: 4) -2.38 toll-like receptor 3 Modulation rate of gene expression of the "Innate Immunity" family in reconstructed skin keratinocytes exposed to long UVA. Negative values (in) represent the rates of gene expression suppression relative to unexposed control (Adj.p <0.001). Example 3: Quantitative PCR Results in Reconstructed Skin - Dose and Kinetic Effect Reconstructed skin, including keratinocytes and fibroblasts, was exposed to 0, 20 or 40 J / cm 2 of long UVA. Two, six and 24 hours after the dermal and epidermal compartments were separated, the RNAs extracted and quantitative PCR experiments were performed in the fibroblasts (below) and reconstructed skin keratinocytes (below). FIBROBLASTS J / cm2 UVA long 40 J / cm2 UVA long 2h 6h 24h 2h 6h 24h Anti Viral / Bacterial Recognition / Defense IFIT1 -1.5 -2.2 1.0 -1.1 -7.3 -2.2 IFIT2 -3.4 -1.7 -1 , -2.8 -3.8 -2.5 TLR3 -1.7 -1.9 1.3 -1.4 -3.0 -1.7 DDX58 -1.5 -2.2 -1.2 -1.4 -3.8 -1, Modulation of anti-viral and antibacterial responses modulated in reconstructed skin fibroblasts exposed to long UVA. Negative values represent significant levels of gene expression suppression relative to unexposed control. In gray: significant suppression of gene expression by long UVA (Student's t-test, p <0.05).

For example, six hours after exposure to 40 J / cm 2 of long UVA, expression of the IFIT1 gene is repressed 7.3 times compared with unexposed samples. KERATINOCYTES 20 J / cm2 UVA long 40 J / cm2 UVA long 2h 6h 24h 2h 6h 24h Anti Viral / Bacterial Recognition / Defense IFIT1 -1.3 -2.8 -1.1 -1.5 -12.5 -1.4 IFIT2 -2.5 -1.4 -1.0 -4.4 -9.2 -2.0 TLR3 -1.4 -1.7 1.0 -1.3 -6.0 -1.4 Modulation of modulated anti-viral and antibacterial response genes in keratinocytes reconstructed skin exposed to long UVA. Negative values represent significant levels of gene expression suppression relative to unexposed control. In gray: significant suppression of gene expression by long UVA, (Student's t-test, p <0.05). For example, six hours after exposure to 40 J / cm 2 of long UVA, the expression of the IFIT1 gene is repressed 12.5 times compared to unexposed samples.

EXAMPLE 4 Modulation by Long UVAs of IFIT1 and DDX58 in the Rebuilt Skin Fibroblasts and Protection of these Modulations by Two Solar Formulas A and B In order to test the protective efficacy of two solar formulas (A and B), the Expression of IFIT1 and DDX58 genes, involved in defense and anti herpes recognition, was studied in reconstructed skin protected by one or other of the solar formulas (Figure 1). Reconstructed skin was exposed to 40 J / cm 2 of long UVA in the presence or absence of the sun formula (formula A or formula B). Six hours after exposure, the total RNAs were extracted from the dermal fibroblasts and the mRNA levels of IFIT1 and DDX58 were assayed under all experimental conditions by the Quantitative PCR method. FIG. 1 shows that in reconstructed skin fibroblasts not previously applied by a solar formula (control), the expression of the IFIT1 and DDX58 genes is strongly repressed by the long UVA (x 0.07 and x 0.13 respectively, by relative to the unexposed sample), confirming the results of examples 2 and 3. The formula A tends to protect slightly from these long UVA modulations (x 0.21 for IFIT1 and x 0.46 for DDX58). Formula B, which filters more long UVA than formula A (see material and methods example 1), protects better from this modulation than formula A (x 0.55 and x 0.74). The mRNA level of IFIT1 and DDX58 in the presence of formula B approximates IFIT1 and DDX58 mRNA levels of unexposed control samples.

A formula whose absorption spectrum is broadened in long UVAs makes it possible to prevent the long-term UVA-induced antiviral defense against HSV-1, more effectively than a state-of-the-art formula, in fibroblasts of reconstructed skin. Example 5: Modulation by long UVAs of IFIT1 and TLR3 in reconstructed skin keratinocytes and protection of these modulations by two solar formulas A and B In order to test the protective efficacy of the two solar formulas (A and B ), the expression of the genes IFIT1 and TLR3, involved in the defense and recognition of herpes, was studied in reconstructed skin protected by one or other of the solar formulas (Figure 2). Reconstructed skin was exposed to 40 J / cm 2 of long UVA in the presence or absence of the sun formula (formula A or formula B). Six hours after exposure, the total RNAs were extracted from the dermal fibroblasts and the mRNA levels of IFIT1 and TLR3 were assayed under all experimental conditions by the Quantitative PCR method. FIG. 2 shows that in reconstructed skin fibroblasts not previously applied by a solar formula (control), the expression of the IFIT1 and TLR3 genes is repressed by the long UVA (x 0.29 and x 0.38 respectively, relative to unexposed sample), confirming the results of Examples 2 and 3. Formula A protects slightly from these long UVA modulations (x 0.63 for IFIT1 and TLR3). Formula B, which filters more long UVA than Formula A (see Material and Methods Example 1), fully protects this modulation from the formula A (x 1.14 and x 0.93). The mRNA levels of IFIT1 and DDX58 in the presence of Formula B are similar to those of unexposed control samples. A formula whose absorption spectrum is broadened in long UVAs makes it possible to prevent the long-term UVA-induced antiviral defense against HSV-1 more effectively than a state-of-the-art formulation in the reconstructed skin keratinocytes.

Claims (17)

REVENDICATIONS1. Dermatological composition comprising in a physiologically acceptable carrier at least one merocyanine compound corresponding to one of the following formulas (1) or (2) or one of its geometric isomeric forms E / E- or E / Z-: N R4 R5 and (2) R3 (1), R1 and R2 independently of one another are hydrogen; a C1-C22 alkyl group, a C2-C22 alkenyl group, a C2-C22 alkinyl group, these groups possibly being substituted by at least one hydroxyl group or interrupted by at least one -O-; or R1 and R2 together with the nitrogen atom connecting them form a - (CH2) - ring, which may be optionally interrupted by -O- or -NH-; R3 is a group - (C = O) OR6; or a - (CO) NHR6 group; R6 is a C1-C22 alkyl group, a C2-C22 alkenyl group, a C2-C22 alkinyl group, a C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said groups may be substituted by one or more OH; R4 and R5 are hydrogen; or R4 and R5 form a - (CH2) - ring which may be substituted with C1-C4 alkyl and / or interrupted by one or more -O- or -NH-; n is a number between 2 and 7; R7 and R8 independent of each other, are hydrogen; a C1-C22 alkyl group, a C2-C22 alkenyl group, a C2-C22 alkinyl group, which groups may be interrupted by one or more O and / or substituted by one or more OH; A C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said groups being capable of being interrupted by one or more -O-; or R7 and R8 together with the nitrogen which binds them a ring - (CH2) - which can be interrupted by one or more - R9 and R10 are hydrogen; or R9 and R10 form a - (CH2) - ring - potentially substituted by C1-C4alkyl and / or interrupted by -O- or -NH-; A is -O- or -NH; RH is a C1-C22 alkyl group; a C2-C22 alkenyl group; a C2-C22 alkinyl group; a C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said groups being capable of being interrupted by one or more O; or a C1-C22 alkyl group or a C2-C22 alkenyl group which is substituted by a C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group can be -interrupted by one or more -0-; with the proviso that: (I) at least one of R1, R2 or R6 is substituted with hydroxyl; (II) if one of R1 is hydroxyethyl, R2 is not hydrogen, methyl or ethyl or hydroxyethyl; and if R 1 is hydrogen, R 2 is not 1-hydroxy-3-methyl-but-2-yl; (III) if R 6 is substituted by one or more OH, one of R 1 or R 2 is a C 4 -C 22 alkyl group; or R1 and R2 together with the nitrogen to which they are attached form a piperidyl or morpholinyl radical; (IV) at least one of R7, R8, or R11 is interrupted by one or more - 20-. for its use in the prevention of the reactivation of the herpes simplex virus (HSV) type 1 and / or the recrudescence of herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or the said resurgence. 25 2. Composition according to claim 1, wherein the compounds of formula (1) are chosen from those for which: R6 is a C1-C12 alkyl group, which may be which is potentially substituted with one or more hydroxyls. 30 3. The composition according to claim 1 or 2, wherein the compounds of the formula (1) are chosen from those for which: R6 is a C1-C12 alkyl group; may be substituted with one or more hydroxyl, one of R1 or R2 is a C4-C22 alkyl group; or R 1 and R 2 together with the nitrogen which connects them a - (CH 2) - ring which can be interrupted by -O- and / or -NH-; and R4 and R5 and n have the same meanings as in claim 1. 4. Composition according to claim 1, wherein the compounds of formula (2) are chosen from those for which: R11 is a radical - (CH2) .70-R12, where R12 is a C1-C12 alkyl group; or a C1-C6 alkoxy-C1-C6 alkyl group; m is a number from 1 to 5; and R7, R8, R9, R10 and A have the same meanings given in claim 1. 5. Composition according to any one of claims 1 to 4, wherein the compounds of formula (1) or (2) are chosen from those for which: R1 and R2 on the one hand, and R7 and R8 on the other hand, respectively form together with the nitrogen atom to which they are respectively bound a piperidyl radical or a morpholinyl radical. 6. A composition according to any one of claims 1 to 5, wherein the compounds of formula (1) or (2) are selected from those for which: R4 and R5 and R9 and R10 respectively form a carbon ring which contains 6 carbon atoms. 7. The composition of claim 1, wherein the compounds of formula (1) are selected from those for which R1 and R2 independently of one another are hydrogen; or a C1-C22 alkyl group; or a C1-C22 hydroxyalkyl group; or R1 and R2 together with the nitrogen to which they are attached form a piperidyl or morpholinyl radical; R3 is a group - (C = O) OR6; or a - (CO) NHR6 group; R6 is a C1-C22 alkyl group, which may be substituted by one or more -OH; R4 and R5 are hydrogen; or R4 and R5 are joined together to form a carbon ring which contains 6 carbon atoms. 8. Composition according to claim 1, wherein the compounds of formula (1) are chosen for which: R1 and R2 independently of one another are hydrogen; or a C1-C22 hydroxyalkyl group; wherein at least one of R 1 and R 2 is a C 1 -C 22 hydroxyalkyl group; R3 is a group - (C = O) OR6; or a group - (C = O) NHR6; R6 is a C1-C22 alkyl group; and R4 and R5 are hydrogen; or R4 and R5 are bonded together to form a carbon ring which contains 6 carbon atoms. 9. Composition according to Claim 1, in which the compounds of formula (2) are chosen from those for which: R 7 and R 8, independently of one another, are hydrogen or a C 1 -C 8 alkyl group, which may be a or more -0-; A is -O- or -NH; R11 is C1-C22 alkyl; and R9 and R10 are hydrogen; or R9 and R10 are bonded together to form a carbon ring which contains 6 carbon atoms. 10. The composition according to claim 1, wherein the compounds of formula (2) are selected from those for which: R7 and R8 together with the nitrogen atom to which they are attached form a morpholinyl or piperidyl radical; A is -0-; or -NH; R11 is a C1-C22 alkyl group which may be interrupted by one or more -O-; and R9 and R10 are hydrogen; or R9 and R10 are bonded together to form a carbon ring which contains 6 carbon atoms. 11. The composition according to claim 1, wherein the fatinule compounds (2) are selected for those for which: R11 is a radical - (CH2) n -O-R12, where R12 is a C1-C4 alkyl group ; or a C1-C4alkoxy-C1-C4 alkyl group m is a number from 1 to 3; R7 and R8, independently of one another, are hydrogen; a C1-C12 alkyl group which may be interrupted by one or more O; or R7 and R8 together with the nitrogen atom to which they are attached form a morpholinyl or piperidyl radical; R9 and R10 are hydrogen or together form a carbon ring which contains 6 carbon atoms; and A is -O- or -NH. 12. Composition according to one of the preceding claims, wherein the compounds of formula (1) or (2) are chosen from the following compounds and their geometric isomeric forms E / E- or E / Z-: Table A Composite Structure Composite Structure ## STR1 ## wherein ## STR1 ## ## EQU1 ## 1) ## EQU1 ## 1) ## EQU2 ## ## STR2 ## NN Table A Compound Structure Composite Structure ## STR1 ## ## STR2 ## ## STR2 ## ## STR1 ## ## STR2 ## where ## STR2 ## or ## STR2 ## N..OH .. '0 N / NN of 17 OH0 0, 18 HOI -'NO -'-' '' '' '' '' '' '' '' '' 0 H., _) IIN ile NN 19 HO II NOW 20 / - I NIO ---- ° /) N 0 N 0 I '0/21 rN 0 IIO 22 -. 0 ## EQU1 ## Compound A Compound Structure Composite Structure ## STR2 ## ## EQU1 ## '1 0 H, ----, ....} ... 0 --... 0 ,, - - ,. ## EQU1 ##, ## STR2 ## ## EQU2 ## ## EQU1 ##, ## STR1 ## ## EQU1 ## ## EQU1 ## ## STR5 ## wherein R 1 is embedded in the formula ## STR1 ## ,,,,. ,,,, -; ----...., 0 N e --... \ --- '"' 'N ---. Table A Compound Structure Structure Structure 37 IH 0 -, ----- ", -, --- O - 3 8 -,. NH 0 .... ', -, ...', 0 ,, , O, N, N, N, N, N, N, N, N, N, N, N, OH ...,,,,,, ## EQU1 ## ## EQU1 ## where ## STR2 ## where ## STR2 ## ## EQU1 ## where ## EQU1 ## where ## EQU1 ## 13. Composition according to one of the preceding claims, wherein the compounds of formula (1) or (2) are chosen from those corresponding to the following formula (3) and their geometric isomeric forms E / E- or E / Z- : (3) wherein A is -O- or -NH; R is a Ci-C22 alkyl group, a C2-C22 alkenyl group, a C2-C22 alkenyl group, a C3-C22 cycloalkyl group or a C3-C22 cycloalkenyl group, said groups being interruptable by one or more O. 14. A composition according to claim 13, wherein the merocyanines of formula (3) are chosen from the following compounds as well as their isomeric geometrical forms E / E-, E / Z-. ## STR2 ## ethyl (2Z) -cyano (3 - [(3-methoxypropyl) amino] cyclohex-2-en-1-ylidenel ethanoate. NOT ',,--.,. N- (2Z) -2-cyano-N- (3-methoxypropyl) -2- {3 - [(3-methoxypropyl) amino] cyclohex 2-en-1-ylidene} ethanamide ## STR5 ## wherein N is 2-ethoxyethyl (2-ethoxyethyl); Z) -cyano {3 - [(3-methoxypropyl) amino] cyclohex-2-en-1-ylidenel ethanoate [1C) ## STR2 ## (2Z) -cyano {3 - [(3-methoxypropyl) amino] cyclohex-2-en-1-ylidene} ethanoate 29 oI, o 0, .--, 0 -, ', _, H "...-- N ## EQU1 ##, ## STR1 ## wherein: ## STR2 ## I 6 N The composition of claim 14, wherein the merocyanine of formula (3) is 2-ethoxyethyl (2Z) -cyano {3 - [(3-methoxypropyl) amino] cyclohex-2-en-1-ylidene} ethanoate (25) in its E / Z geometric configuration of the following structure: 0 0 H and / or the E / E form has the following structure: 16.Composition according to any one of the preceding claims, characterized in that the merocyanine compound according to the invention represents an amount of 0.1% to 50%, in particular an amount representing from 1% to 10% of the total weight of the composition , and more particularly an amount representing from 1% to 3% of the total weight of the composition. 17. A method of in vitro or ex vivo screening of active agents capable of limiting and / or inhibiting the expression modulation of at least one of the genes selected from IFIT1, IFIT2, TLR3, DDX58, or CXCL10, comprising at least one of: least the steps of: a) arranging the composition as defined in claims 1 to 16 on a skin sample. b) exposing the skin sample obtained in step a) to long UVA c) performing a qualitative or quantitative measurement of the expression modulation of at least one gene selected from IFIT1, IFIT2, TLR3, DDX58, and / or or CXCL10. d) comparing the measurement obtained in step c) to a reference measurement and concluding that the compound is effective in preventing reactivation of herpes simplex virus (HSV) type 1 and / or recrudescence of herpes outbreaks and / or the appearance of cutaneous disorders induced by said reactivation and / or said recrudescence, if this compound limits or inhibits the modulation of the expression of at least one gene selected from IFIT1, IFIT2, TLR3, DDX58, and / or CXCL10.