FR2978048A1

FR2978048A1 - VACCINE COMPOSITION AGAINST MALARIA

Info

Publication number: FR2978048A1
Application number: FR1156571A
Authority: FR
Inventors: Catherine Vaquero; Sylvie Briquet; Hogban Nadou Essenia Lawson; Salaheddine Mecheri; Robert Menard
Original assignee: Universite Pierre et Marie Curie Paris 6
Current assignee: Universite Pierre et Marie Curie Paris 6
Priority date: 2011-07-20
Filing date: 2011-07-20
Publication date: 2013-01-25
Anticipated expiration: 2031-07-20
Also published as: MX2014000727A; FR2978048B1; JP2014520563A; CA2841164A1; CN103842029A; BR112014001039A2; AU2012285600A1; WO2013011247A1; EP2734270A1; US20140154289A1

Abstract

La présente invention concerne de nouvelles compositions et méthodes pour immuniser un hôte contre le paludisme en utilisant un parasite Plasmodium génétiquement atténué par l'inactivation de la fonction du gène hmgb2.The present invention relates to novel compositions and methods for immunizing a host against malaria using a Plasmodium parasite genetically attenuated by inactivating hmgb2 gene function.

Description

La présente invention relève du domaine de la médecine, et plus particulièrement de celui de la lutte contre le paludisme. Arrière-plan technologique de l'invention Le paludisme est une maladie infectieuse causée par un parasite unicellulaire eucaryote du genre Plasmodium. Le paludisme est une maladie parasitaire mondialement présente et engendre de graves problèmes économiques et sanitaires dans les pays en développement. P. falciparum est l'espèce la plus délétère des cinq types de Plasmodium infectant l'homme. Selon l'Organisation Mondiale de la Santé (OMS), P. falciparum est responsable de 250 à 500 millions de cas de maladie aiguë et d'environ 1 million de décès chaque année (surtout les enfants de moins de 5 ans et les femmes enceintes). Le neuropaludisme est une complication neurologique sévère du paludisme responsable de la grande majorité des cas mortels de la maladie. Même si l'individu survit, le neuropaludisme peut entraîner des séquelles neurologiques graves, notamment chez les jeunes enfants dont le système immunitaire est en cours de formation. La pathogénèse du neuropaludisme est complexe et encore loin d'être complètement élucidée. A l'heure actuelle, il est admis que la pathologie cérébrale est vraisemblablement la résultante de la séquestration des globules rouges parasités dans les micro-vaisseaux des principaux organes (rate, poumons, coeur, intestins, reins, foie et cerveau) et de la production de cytokines pro-inflammatoires dans ces mêmes organes, conduisant à un syndrome et état systémiques pouvant entraîner la mort de l' individu. La lutte contre le paludisme est un des grands enjeux de l'OMS, mais à ce jour, tous les efforts visant à maîtriser cette maladie ont échoué. Durant ces trente dernières années, la situation s'est même détériorée en raison de l'apparition de la résistance des anophèles aux insecticides et de la chimiorésistance grandissante de P. falciparum aux médicaments antipaludéens (même utilisés en combinaisons). La lutte contre le paludisme est rendue difficile par l'absence d'un vaccin réellement efficace contre la maladie. Les premières tentatives de développer un vaccin datent des années 70. Depuis, les essais vaccinaux se sont multipliés mais font face à la complexité du développement du parasite chez ses deux hôtes successifs, l'homme et le moustique ainsi qu'à un mécanisme d'échappement au système immunitaire extrêmement compliqué impliquant une importante variation antigénique du parasite. The present invention relates to the field of medicine, and more particularly that of the fight against malaria. BACKGROUND OF THE INVENTION Malaria is an infectious disease caused by a eukaryotic unicellular parasite of the genus Plasmodium. Malaria is a worldwide parasitic disease and causes serious economic and health problems in developing countries. P. falciparum is the most deleterious species of the five types of Plasmodium that infect humans. According to the World Health Organization (WHO), P. falciparum is responsible for 250 to 500 million cases of acute illness and about 1 million deaths each year (mostly children under 5 and pregnant women). ). The cerebral malaria is a severe neurological complication of malaria responsible for the vast majority of fatal cases of the disease. Even if the individual survives, cerebral malaria can lead to severe neurological sequelae, especially in young children whose immune systems are being formed. The pathogenesis of cerebral malaria is complex and still far from being fully elucidated. At present, it is accepted that cerebral pathology is probably the result of the sequestration of parasitized red blood cells in the micro-vessels of the main organs (spleen, lungs, heart, intestines, kidneys, liver and brain) and the production of pro-inflammatory cytokines in these same organs, leading to a systemic syndrome and condition that can lead to the death of the individual. Malaria control is a major challenge for WHO, but to date, all efforts to control the disease have failed. During the last 30 years, the situation has even deteriorated due to the emergence of anopheline resistance to insecticides and the increasing chemoresistance of P. falciparum to antimalarial drugs (even when used in combinations). The fight against malaria is made difficult by the absence of a truly effective vaccine against the disease. The first attempts to develop a vaccine date back to the 1970s. Since then, vaccine trials have multiplied but face the complexity of parasite development in its two successive hosts, man and mosquito, as well as a mechanism for Extremely complicated immune system escape involving significant antigenic variation of the parasite.

Cette variation lors de la phase érythrocytaire du parasite rend la vaccination préventive classique à l'aide de complexes de protéines-peptides de Plasmodium extrêmement difficile. L'obtention d'un vaccin efficace contre les formes érythrocytaires du parasite est pourtant un enjeu majeur dans le cadre de l'éradication de la maladie étant donné qu'un tel vaccin permettrait à la fois de réduire les symptômes mais également la charge parasitaire et la quantité de gamétocytes dans le sang donc de diminuer la transmission du parasite. Une étude récente a montré que l'administration répétée de très faibles doses de globules rouges parasités par P. falciparum 3D7 associée à la prise simultanée de médicaments antipaludéens induisait une immunité susceptible de protéger les patients contre la phase érythrocytaire d'une souche homologue (Pombo et al. 2002). Il a donc a été envisagé d'utiliser des parasites vivants génétiquement atténués (ou GAP « Genetically Attenuated Parasites ») pour induire une protection stérile de longue durée. Plusieurs GAP ont ainsi été décrits. Cependant, la majorité de ces GAP cible le stade hépatocytaire via les sporozoïtes des parasites atténués. Deux GAP ciblant le stade érythrocytaire ont également été décrits: des parasites de rongeurs P. yoelii dans lesquels la purine nucléoside phosphorylase (PNP) (Ting et al., 2008) ou le transporteur nucléosidique 1 (NT1) (Aly et al., 2010) a été inactivé. Il a été montré que ces GAP confèrent une immunité vis-à-vis d'une souche homologue, mais également dans une moindre mesure, vis-à-vis de souches hétérologues. Un vaccin contre le paludisme est actuellement en phase III des essais cliniques (RTS,S de G1axoSmithKline Biologicals'). Cependant, les résultats obtenus durant la phase II montrent que ce vaccin ne réduit l'occurrence de paludisme clinique que de 35% et de 49% celui de paludisme sévère. This variation during the erythrocyte phase of the parasite makes conventional preventive vaccination using Plasmodium protein-peptide complexes extremely difficult. Obtaining an effective vaccine against erythrocyte parasites is a major issue in the eradication of the disease since such a vaccine would reduce both symptoms but also parasite load and the amount of gametocytes in the blood therefore to reduce the transmission of the parasite. A recent study has shown that the repeated administration of very low doses of P. falciparum 3D7-infected red blood cells associated with the simultaneous administration of antimalarial drugs induces an immunity likely to protect patients against the erythrocyte phase of a homologous strain (Pombo et al 2002). It has therefore been envisaged to use genetically attenuated live parasites (GAPs) to induce long-term sterile protection. Several GAPs have been described. However, the majority of these GAP targets the hepatocyte stage via sporozoites of attenuated parasites. Two GAP targeting the erythrocyte stage have also been described: P. yoelii rodent parasites in which purine nucleoside phosphorylase (PNP) (Ting et al., 2008) or nucleoside transporter 1 (NT1) (Aly et al., 2010 ) has been inactivated. These GAPs have been shown to confer immunity against a homologous strain, but also to a lesser extent against heterologous strains. A malaria vaccine is currently in phase III clinical trials (RTS, G1axoSmithKline Biologicals'). However, the results obtained during phase II show that this vaccine reduces the occurrence of clinical malaria by only 35% and 49% that of severe malaria.

A ce jour, il demeure donc crucial de développer de nouvelles stratégies qui permettraient notamment d'enrayer l'apparition d'accès graves tels que le neuropaludisme mais également de diminuer la charge parasitaire et la quantité de gamétocytes dans le sang périphérique et ainsi réduire les risques de transmission de la maladie. To date, it remains crucial to develop new strategies that would in particular prevent the appearance of serious attacks such as cerebral malaria but also reduce the parasite load and the amount of gametocytes in the peripheral blood and thus reduce risk of transmission of the disease.

Résumé de l'invention L'objectif de la présente invention est de fournir de nouvelles compositions vaccinales pour prévenir le paludisme, et plus particulièrement l'apparition d'accès graves du paludisme tels que le neuropaludisme. SUMMARY OF THE INVENTION The objective of the present invention is to provide novel vaccine compositions for preventing malaria, and more particularly the appearance of severe malaria infections such as cerebral malaria.

Les inventeurs ont démontré qu'un parasite vivant appartenant au genre Plasmodium et dans lequel la fonction du gène hmgb2 a été inactivée pouvait être utilisé comme immunogène dans un vaccin contre le paludisme. Ils ont en effet observé, que l'administration d'un tel parasite induisait une réaction immunitaire chez l'hôte qui permettait d'obtenir à la fois la clairance du parasite (charge parasitaire en dessous du seuil de détection dans le sang périphérique) mais également une protection efficace et de longue durée contre une infection par un Plasmodium, notamment par une souche très pathogène, et plus particulièrement contre la phase érythrocytaire du parasite qui est responsable de la symptomatologie de la maladie et de sa transmission. Ainsi, la présente invention concerne tout d'abord un parasite vivant appartenant au genre Plasmodium dans lequel la fonction du gène hmgb2 est inactivée pour une utilisation dans la prévention du paludisme, et plus particulièrement dans la prévention du neuropaludisme qui est une complication neurologique sévère de la maladie. Le parasite peut être sélectionné dans le groupe constitué de Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. De préférence, le parasite sous sa forme sauvage ne provoque pas de neuropaludisme. Dans un second aspect, la présente invention concerne une composition immunogène comprenant, en tant qu'immunogène, une quantité immunologiquement efficace d'un parasite selon l'invention, et un ou plusieurs excipients ou supports pharmaceutiquement acceptables. La présente invention concerne également un vaccin contre le paludisme comprenant, en tant qu'immunogène, un parasite selon l'invention, et un ou plusieurs excipients ou supports pharmaceutiquement acceptables. La composition immunogène ou le vaccin peut être formulé pour être administré par voie parentérale. De manière préférée, la composition ou le vaccin comprend entre 102 et 105 parasites par dose d'injection. 3 Dans un autre aspect, la présente invention concerne l'utilisation d'un parasite selon l'invention, pour la préparation d'une composition vaccinale contre le paludisme ou le neuropaludisme. Dans un autre aspect, la présente invention concerne également une méthode 5 pour immuniser un sujet contre le paludisme, comprenant l'administration d'une composition immunogène ou d'un vaccin selon l'invention audit sujet. Brève description des dessins Figure 1: Parasitémie des souris C57B1/6 infectées par des globules rouges parasités (GRP) avec PbNK65 sauvage et muté PbNK65 Ohmgb2 (105 et 106 par 10 injection intraveineuse, respectivement). La parasitémie est analysée par comptage au microscope des GRP dans des frottis colorés et présentée comme le pourcentage des GRP (moyenne ± écart-type). L'expérience a été faite avec 5 souris et répétée plusieurs fois. La valeur p est de 0,008. Figure 2: Etude de la survie des souris primo-infectées avec PbNK65 Ohmgb2 15 et infectées ensuite trois fois avec les deux parasites sauvages pathogènes PbNK65 et PbANKA. La première épreuve a été faite à J19, le deuxième à J71 et enfin la troisième à J162. A chaque épreuve, la pathogénicité des deux préparations de GRP infectés avec PbNK65 et PbANKA a été vérifiée avec des souris de même âge pour le devenir et mort des souris par hyperparasitémie et neuropaludisme. Cinq souris ont été analysées 20 pour chacune des expériences. Description détaillée de l'invention Le séquençage du génome de P. falciparum s'est achevé en 2002. Ce génome comprend environ 5500 gènes dont 60% ont une fonction totalement inconnue. En étudiant les facteurs impliqués dans la régulation transcriptionnelle chez P. falciparum, 25 les inventeurs ont annoté quatre HMGB (PfHMGB 1 à 4; High Mobility Group Box proteins). Ce sont des protéines nucléaires non histone très abondantes qui ont la particularité d'être à la fois des facteurs nucléaires et des médiateurs extracellulaires. Chez l'homme, où elles ont été particulièrement étudiées, elles sont présentes dans le noyau des cellules et jouent le rôle de facteurs architecturaux, participant à la 30 régulation de la transcription via le remodelage de la chromatine. Dans des situations de danger pour la cellule (corps étranger, inflammation), ces protéines sont sécrétées activement dans le milieu cellulaire et/ou passivement en cas de nécrose cellulaire, et agissent en tant que véritables signaux de danger (alarmines) en activant les macrophages et autres cellules compétentes du système immunitaire. L'implication de la protéine HMGB 1 humaine a été démontrée dans les maladies provoquant une inflammation systémique telles que le lupus érythémateux, le choc septique ou la polyarthrite rhumatoïde, et dans certains cancers. Enfin, l'augmentation de la protéine HMGB 1 humaine, dans les sera de patients, a été corrélée avec la sévérité de ces maladies. Chez P. falciparum, les inventeurs ont plus particulièrement étudié PfHMGB 1 et PfHMGB2, petites protéines de moins de 100 acides aminés. Ces deux protéines, comme leurs homologues humaines sont capables de courber l'ADN et d'interagir avec des structures particulières de l'ADN (Briquet et al. 2006). Elles sont également sécrétées et retrouvées dans les surnageants de culture de P. falciparum. Les protéines HMGB1 et 2 de P. falciparum sont capables d'activer et d'induire l'expression de TNFa dans des lignées monocytaires de souris (Kumar et al. 2008). Dans la présente demande, les inventeurs ont utilisé comme modèle animal de neuropaludisme, des souris C57B1/6 infectées par le parasite de P. berghei ANKA (PbANKA). Ce modèle animal reproduit les principales caractéristiques de la pathologie humaine telles que l'ataxie, la désorientation dans l'espace, les convulsions et le coma. Ces symptômes cliniques peuvent conduire à la mort de l'animal. Comme chez l'homme, on observe dans ce modèle, la séquestration des globules rouges parasités, les hémorragies et lésions cérébrales, la production de cytokines pro-inflammatoires et la destruction de la barrière hémato-encéphalique. Dans ce modèle, la totalité des souris C57BL/6 infectées par l'isolat PbANKA meurent en 7 jours environ de neuropaludisme. En revanche, les inventeurs ont observés que 60% des souris infectées par le parasite PbANKA Ohmgb2 ne développaient pas de neuropaludisme. Les inventeurs ont inactivé le gène hmgb2 d'un autre isolat de P. berghei, l'isolat NK65, qui induit la mort des souris C57BL/6 par hyper-parasitémie en 20 à 25 jours après infection mais ne provoque pas de neuropaludisme. Ils ont tout d'abord observé que l'inactivation de ce gène entrave le développement de PbNK65 Ohmgb2 dans la souris avec une clairance du parasite obtenue 10 à 15 jours après l'infection. Les inventeurs ont ensuite démontré que la réponse immunitaire conduisant à la clairance du parasite était suffisante pour induire une immunité stérile de plus de six mois, non seulement vis-à-vis de la souche sauvage homologue PbNK65 mais également vis-à-vis de la souche hétérologue hautement pathogène PbANKA qui est capable d'induire un neuropaludisme. The inventors have demonstrated that a living parasite belonging to the genus Plasmodium and in which the function of the hmgb2 gene has been inactivated could be used as an immunogen in a vaccine against malaria. They have observed that the administration of such a parasite induces an immune reaction in the host which makes it possible to obtain at the same time the clearance of the parasite (parasite load below the detection threshold in the peripheral blood) but also an effective and long-term protection against infection by Plasmodium, particularly by a highly pathogenic strain, and more particularly against the erythrocyte phase of the parasite which is responsible for the symptomatology of the disease and its transmission. Thus, the present invention relates first of all to a living parasite belonging to the genus Plasmodium in which the function of the hmgb2 gene is inactivated for use in the prevention of malaria, and more particularly in the prevention of neuropaludism which is a severe neurological complication of disease. The parasite may be selected from the group consisting of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. Preferably, the parasite in its wild form does not cause neuropaludism. In a second aspect, the present invention relates to an immunogenic composition comprising, as an immunogen, an immunologically effective amount of a parasite according to the invention, and one or more pharmaceutically acceptable excipients or carriers. The present invention also relates to a vaccine against malaria comprising, as an immunogen, a parasite according to the invention, and one or more pharmaceutically acceptable excipients or carriers. The immunogenic composition or vaccine may be formulated for parenteral administration. Preferably, the composition or the vaccine comprises between 102 and 105 parasites per injection dose. In another aspect, the present invention relates to the use of a parasite according to the invention for the preparation of a vaccine composition against malaria or cerebral malaria. In another aspect, the present invention also relates to a method for immunizing a subject against malaria, comprising administering an immunogenic composition or vaccine according to the invention to said subject. Brief Description of the Drawings Figure 1: Parasitaemia of C57B1 / 6 infected parasitized red cell (GRP) mice with wild-type PbNK65 and mutated PbNK65 Ohmgb2 (105 and 106 per intravenous injection, respectively). Parasitaemia is analyzed by microscopic counting of GRP in stained smears and presented as the percentage of GRP (mean ± standard deviation). The experiment was done with 5 mice and repeated several times. The p value is 0.008. Figure 2: Study of the survival of the primo-infected mice with PbNK65 Ohmgb2 and then infected three times with the two wild pathogenic parasites PbNK65 and PbANKA. The first test was made at J19, the second at J71 and finally the third at J162. At each challenge, the pathogenicity of the two GRP preparations infected with PbNK65 and PbANKA was verified with mice of the same age to become and died of mice by hyperparasitaemia and neuropaludism. Five mice were analyzed for each experiment. DETAILED DESCRIPTION OF THE INVENTION Sequencing of the P. falciparum genome was completed in 2002. This genome comprises about 5,500 genes, 60% of which have a totally unknown function. In studying the factors involved in transcriptional regulation in P. falciparum, the inventors annotated four HMGBs (PfHMGB 1-4, High Mobility Group Box proteins). They are very abundant non-histone nuclear proteins that have the distinction of being both nuclear factors and extracellular mediators. In humans, where they have been particularly studied, they are present in the nucleus of cells and play the role of architectural factors, participating in the regulation of transcription via remodeling of chromatin. In situations of danger for the cell (foreign body, inflammation), these proteins are secreted actively in the cellular medium and / or passively in case of cell necrosis, and act as real danger signals (alarmins) by activating macrophages and other competent cells of the immune system. The involvement of human HMGB1 protein has been demonstrated in diseases causing systemic inflammation such as lupus erythematosus, septic shock or rheumatoid arthritis, and in some cancers. Finally, the increase in human HMGB1 protein in patients' sera has been correlated with the severity of these diseases. In P. falciparum, the inventors have more particularly studied PfHMGB 1 and PfHMGB2, small proteins of less than 100 amino acids. These two proteins, like their human counterparts, are capable of bending DNA and interacting with particular DNA structures (Briquet et al., 2006). They are also secreted and found in culture supernatants of P. falciparum. The HMGB1 and 2 proteins of P. falciparum are capable of activating and inducing TNFa expression in mouse monocyte lines (Kumar et al., 2008). In the present application, the inventors used C57B1 / 6 mice infected with the P. berghei ANKA parasite (PbANKA) as an animal model of cystic neuroma. This animal model reproduces the main characteristics of human pathology such as ataxia, disorientation in space, convulsions and coma. These clinical symptoms can lead to the death of the animal. As in humans, we observe in this model the sequestration of parasitized red blood cells, haemorrhages and brain lesions, the production of pro-inflammatory cytokines and the destruction of the blood-brain barrier. In this model, all C57BL / 6 mice infected with the PbANKA isolate die within 7 days of cerebral malaria. On the other hand, the inventors have observed that 60% of the mice infected with the PbANKA Ohmgb2 parasite do not develop neuropaludism. The inventors inactivated the hmgb2 gene of another P. berghei isolate, the NK65 isolate, which induces the death of C57BL / 6 mice by hyper-parasitaemia within 20 to 25 days after infection but does not cause neuropaludism. They first observed that the inactivation of this gene hampers the development of PbNK65 Ohmgb2 in the mouse with a clearance of the parasite obtained 10 to 15 days after infection. The inventors have then demonstrated that the immune response leading to the clearance of the parasite was sufficient to induce sterile immunity for more than six months, not only vis-à-vis the homologous wild-type PbNK65 but also against the highly pathogenic heterologous strain PbANKA that is able to induce a cerebral malaria.

Ainsi, dans un premier aspect, la présente invention concerne un parasite vivant appartenant au genre Plasmodium dans lequel la fonction du gène hmgb2 est inactivée pour une utilisation dans la prévention du paludisme ou du neuropaludisme. Le parasite est, de préférence, capable de se développer chez les vertébrés, et plus particulièrement chez les mammifères, et appartient au sous-genre sélectionné dans le groupe constitué de Plasmodium vinckeia, Plasmodium plasmodium et Plasmodium laverania. Selon un mode de réalisation, le parasite est capable de se développer chez un hôte humain et appartient au sous-genre Plasmodium plasmodium ou Plasmodium laverania. De préférence, le parasite appartient à une espèce responsable du paludisme chez l'homme, plus particulièrement à une espèce sélectionnée dans le groupe constitué de Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae et Plasmodium knowlesi. Bien que Plasmodium knowlesi soit un parasite infectant essentiellement les primates, de plus en plus de cas d'infections humaines par ce parasite sont rapportés. De manière plus particulièrement préférée, le parasite appartient à une espèce sélectionnée dans le groupe constitué de Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale et Plasmodium malariae. Selon un autre mode de réalisation, le parasite appartient à une espèce qui est capable d'induire une réaction immunitaire mais n'est pas capable de provoquer les symptômes du paludisme chez l'humain. De préférence, ce parasite est un parasite de rongeurs appartenant au sous-genre Plasmodium vinckeia. L'utilisation de parasites de rongeurs dans le cadre de la vaccination chez l'homme permet de réduire considérablement les risques liés à l'administration de parasites vivants chez le sujet. Le parasite de rongeur peut être modifié de façon à exprimer une ou plusieurs protéines d'un Plasmodium infectant l'homme, tel que P. falciparum, qui est ou sont nécessaires à l'invasion des globules rouges humains. De telles protéines sont par exemple décrites dans l'article de Triglia et al., 2000. De manière préférée, le parasite appartient à l'espèce Plasmodium berghei ou Plasmodium yoelii. De manière plus particulièrement préférée, le parasite appartient à l'espèce Plasmodium berghei. Selon un mode de réalisation préféré, le parasite est l'isolat NK65 de l'espèce Plasmodium berghei. Selon un mode de réalisation particulier, le parasite est sélectionné dans le groupe constitué de Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae et Plasmodium knowlesi. Selon un mode de réalisation préféré, la souche sauvage du parasite, c'est-à-dire le parasite dans lequel le gène hmgb2 est actif, ne provoque pas de neuropaludisme. Cette souche peut être par exemple choisie dans le groupe constitué de Plasmodium berghei NK65, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae et Plasmodium knowlesi. Cette souche peut également être une souche de Plasmodium falciparum ayant perdu sa capacité de cyto-adhérence lors de passages en culture ex vivo. Dans le parasite utilisé selon l'invention, la fonction du gène hmgb2 est inactivée. Cela signifie que l'activité de la protéine HMGB2 codée par ce gène est totalement ou partiellement inhibée, de préférence totalement inhibée. Cette inhibition peut être obtenue par de nombreuses méthodes bien connues de l'homme du métier. Il est ainsi possible de bloquer la fonction du gène au niveau transcriptionnel, traductionnel ou au niveau protéique, par exemple en bloquant ou diminuant la transcription ou la traduction du gène hmgb2 ou en perturbant le repliement correct de la protéine ou son activité. La fonction du gène hmbg2 peut notamment être inactivée par la délétion totale ou partielle de ce gène, ou l'insertion ou la substitution d'un ou plusieurs nucléotides de telle sorte à rendre ce gène inactif. Selon un mode de réalisation particulier, la fonction du gène hmbg2 est inactivée par délétion totale ou partielle de ce gène, de préférence par délétion totale. De manière préférée, la délétion du gène hmbg2 est obtenue par recombinaison homologue. Cette méthode est bien connue de l'homme du métier et a été appliquée de nombreuses fois aux parasites du genre Plasmodium (voir par exemple Thathy and Ménard, 2002). Selon un mode de réalisation particulier, la région codante du gène hmbg2 est remplacée par recombinaison homologue par un marqueur permettant de sélectionner les parasites dans lesquels la recombinaison a eu lieu. Le marqueur de sélection peut être, par exemple, le gène humain de la dihydrofolate réductase (dhfr) qui confère au parasite la résistance à la pyriméthamine. L'obtention de parasites dans lesquels le gène hmbg2 est délété, est exemplifiée dans la partie expérimentale. Selon un mode très particulier de l'invention, le parasite est un Plasmodium berghei, de préférence l'isolat NK65, dans lequel le gène hmgb2 a été remplacé par un marqueur de sélection, de préférence par le gène humain dhfr. Thus, in a first aspect, the present invention relates to a living parasite belonging to the genus Plasmodium in which the function of the hmgb2 gene is inactivated for use in the prevention of malaria or cerebral malaria. The parasite is preferably capable of developing in vertebrates, and more particularly in mammals, and belongs to the subgenus selected from the group consisting of Plasmodium vinckeia, Plasmodium plasmodium and Plasmodium laverania. According to one embodiment, the parasite is capable of developing in a human host and belongs to the subgenus Plasmodium plasmodium or Plasmodium laverania. Preferably, the parasite belongs to a species responsible for malaria in humans, more particularly to a species selected from the group consisting of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. Although Plasmodium knowlesi is a parasite that mainly infects primates, more and more cases of human infections with this parasite are reported. More preferably, the parasite belongs to a species selected from the group consisting of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale and Plasmodium malariae. In another embodiment, the parasite belongs to a species that is capable of inducing an immune response but is not capable of causing the symptoms of malaria in humans. Preferably, this parasite is a parasite of rodents belonging to the subgenus Plasmodium vinckeia. The use of rodent parasites in the context of vaccination in humans considerably reduces the risks associated with the administration of live parasites in the subject. The rodent parasite may be modified to express one or more proteins of a human-infective Plasmodium, such as P. falciparum, which is or is necessary for the invasion of human red blood cells. Such proteins are for example described in the article by Triglia et al., 2000. Preferably, the parasite belongs to the species Plasmodium berghei or Plasmodium yoelii. More preferably, the parasite belongs to the species Plasmodium berghei. According to a preferred embodiment, the parasite is the NK65 isolate of the Plasmodium berghei species. According to a particular embodiment, the parasite is selected from the group consisting of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. According to a preferred embodiment, the wild strain of the parasite, that is to say the parasite in which the hmgb2 gene is active, does not cause neuropaludism. This strain may be, for example, chosen from the group consisting of Plasmodium berghei NK65, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi. This strain may also be a strain of Plasmodium falciparum having lost its cyto-adhesion capacity during ex vivo culture passages. In the parasite used according to the invention, the function of the hmgb2 gene is inactivated. This means that the activity of the HMGB2 protein encoded by this gene is totally or partially inhibited, preferably totally inhibited. This inhibition can be obtained by many methods well known to those skilled in the art. It is thus possible to block the function of the gene at the transcriptional, translational or protein level, for example by blocking or decreasing the transcription or translation of the hmgb2 gene or by disrupting the correct folding of the protein or its activity. The function of the hmbg2 gene can in particular be inactivated by the total or partial deletion of this gene, or the insertion or substitution of one or more nucleotides so as to render this gene inactive. According to a particular embodiment, the function of the hmbg2 gene is inactivated by total or partial deletion of this gene, preferably by total deletion. Preferably, the deletion of the hmbg2 gene is obtained by homologous recombination. This method is well known to those skilled in the art and has been applied many times to parasites of the genus Plasmodium (see for example Thathy and Ménard, 2002). According to a particular embodiment, the coding region of the hmbg2 gene is replaced by homologous recombination by a marker making it possible to select the parasites in which the recombination has taken place. The selection marker may be, for example, the human dihydrofolate reductase (dhfr) gene which confers resistance to pyrimethamine on the parasite. The obtaining of parasites in which the hmbg2 gene is deleted is exemplified in the experimental part. According to a very particular embodiment of the invention, the parasite is a Plasmodium berghei, preferably the NK65 isolate, in which the hmgb2 gene has been replaced by a selection marker, preferably by the human dhfr gene.

La fonction du gène hmbg2 peut également être inactivée en bloquant ou diminuant la traduction de l' ARNm de ce gène. L'interférence par l' ARN, qui permet d'inhiber de manière spécifique l'expression du gène cible, est un phénomène bien connu de l'homme du métier qui a déjà été utilisé pour inhiber l'expression de gènes de Plasmodium (voir, par exemple, McRobert and McConkey, 2002; Mohmmed et al., 2003 ; Gissot et al. 2004). De préférence, l'ARN interférent utilisé est un petit ARN interférent (ARNsi). Les références GenBank des séquences de gènes hmgb2 de différentes espèces de Plasmodium séquencées ainsi que celles des séquences protéiques correspondantes sont présentées dans le tableau 1 ci-dessous. The function of the hmbg2 gene can also be inactivated by blocking or decreasing the translation of the mRNA of this gene. RNA interference, which specifically inhibits the expression of the target gene, is a phenomenon well known to those skilled in the art which has already been used to inhibit the expression of Plasmodium genes (see FIG. for example, McRobert and McConkey, 2002, Mohmmed et al., 2003 and Gissot et al., 2004). Preferably, the interfering RNA used is a small interfering RNA (siRNA). The GenBank references of the hmgb2 gene sequences of various sequenced Plasmodium species as well as those of the corresponding protein sequences are presented in Table 1 below.

Tableau 1. Référence GenBank des séquences nucléotidiques et protéiques de HMGB2 de différentes espèces de Plasmodium qui ont été séquencés à ce jour. Espèces Gène hmgb2 Protéine HMGB2 Plasmodium falciparum 3D7 XM_001349310 XP_001349346 (SEQ (SEQ ID No.l) ID No.2) Plasmodium vivax Sal-1 XM_001614943.1 XP_001614993.1 (SEQ (SEQ ID No.3) ID No.4) Plasmodium berghei str. ANKA XM_667771 (SEQ XP_672863 (SEQ ID ID No.5) No.6) Plasmodium knowlesi XM_002258117 XP_002258153 (SEQ (SEQ ID No.7) ID No.8) Plasmodium yoelii XM_722771 (SEQ XP_727864 (SEQ ID ID No.9) No.10) Les gènes hmgb2 des espèces de Plasmodium non encore séquencées sont 20 aisément identifiables par des méthodes bien connues de l'homme du métier, notamment par hybridation ou PCR. Table 1. GenBank reference of nucleotide and protein sequences of HMGB2 from different Plasmodium species that have been sequenced to date. Species Gene hmgb2 Protein HMGB2 Plasmodium falciparum 3D7 XM_001349310 XP_001349346 (SEQ ID No. 1) ID No.2) Plasmodium vivax Sal-1 XM_001614943.1 XP_001614993.1 (SEQ ID NO.3) ID No.4) Plasmodium berghei str. ANKA XM_667771 (SEQ XP_672863 (SEQ ID ID No.5) No.6) Plasmodium knowlesi XM_002258117 XP_002258153 (SEQ ID NO.7) ID No.8) Plasmodium yoeli XM_722771 (SEQ ID NO: 7) SEQ ID NO: 9 The hmgb2 genes of Plasmodium species not yet sequenced are readily identifiable by methods well known to those skilled in the art, in particular by hybridization or PCR.

Dans le parasite selon l'invention, la fonction d'un ou plusieurs gènes, autres que hmgb2, peut également être inactivée. Le gène additionnel dont la fonction est inactivée, peut être un gène participant à la survie du parasite chez un hôte mammifère, en particulier chez l'homme. De préférence, l'inactivation de ce gène additionnel permet d'atténuer la virulence du parasite tout en préservant son caractère immunogène. Ce gène additionnel peut être choisi dans le groupe constitué de la purine nucléoside phosphorylase (PNP; PFE0660c), le transporteur de nucléoside 1 (NT1; PF13_0252), UIS3 (PF13_0012), UIS4 (PF10_0164 transcrit précoce), p52 (PFD0215c protéine avec motif à 6 cystéines) et p36 (PFD0210c), ainsi que les combinaisons de ceux-ci (les références entre parenthèse sont les numéros d'entrée de la banque PlasmoDB des séquences de Plasmodium falciparum 3D7, données ici à titre d'exemple). Les méthodes pour cultiver les parasites selon l'invention ainsi que les méthodes de préservation, en particulier de cryopréservation, des parasites ont été précédemment décrites et sont bien connues de l'homme du métier (voir par exemple Leef et al., 1979; Orjih et al., 1980). Ces parasites peuvent être cultivés ex vivo à l'aide de cultures cellulaires ou in vivo chez un animal, par exemple une souris. Selon un mode de réalisation, les parasites selon l'invention sont utilisés sous une forme érythrocytaire, plus particulièrement sous forme de mérozoïtes, de trophozoïtes ou de schizontes intra-érythrocytaires. Les globules rouges parasités peuvent être obtenus par introduction du parasite chez un hôte, de préférence un humain, et récupération des globules rouges de l'hôte infecté lorsque la parasitémie atteint au minimum 1 %, de préférence entre 5 et 10 %. Selon un mode de réalisation préféré, les globules rouges parasités sont récupérés à partir d'un hôte humain du groupe sanguin O et de Rhésus négatif. Des anti-coagulants, tels que l'héparine, peuvent être ajoutés aux globules rouges ainsi prélevés. Les globules rouges parasités peuvent être conservés par congélation en présence d'un ou plusieurs cryoprotecteurs compatibles avec une utilisation in vivo, tels que par exemple le glycérol ou le diméthylsulfoxyde (DMSO). Les globules rouges parasités peuvent également être conservés par réfrigération à 4°C dans un milieu de conservation adapté, par exemple du milieu SAGM (« Saline Adénine Glucose Mannitol ») ou une solution CPD (Citrate Phosphate Dextrose), mais pour une durée n'excédant pas environ 45 jours. Selon un autre mode de réalisation, les parasites selon l'invention sont utilisés sous la forme de sporozoïtes. Les sporozoïtes peuvent être obtenus par introduction du parasite dans un hôte moustique où il va se multiplier. Les sporozoïtes sont alors récupérés à partir des glandes salivaires des moustiques infectés. Les sporozoïtes ainsi obtenus peuvent être conservés par congélation, par exemple dans l'azote liquide, avant d'être décongelés pour être injectés vivants dans un hôte. De manière alternative, après récupération à partir des glandes salivaires des moustiques, les sporozoïtes peuvent être conservés par lyophilisation ou réfrigération avant administration. L'administration du parasite selon l'invention chez un sujet permet, malgré une clairance parasitaire rapide, d'induire chez le sujet une immunité de plusieurs mois vis-à-vis d'une infection par un Plasmodium. Cette immunité peut notamment être une immunité croisée vis-à-vis d'une infection par une souche de Plasmodium différente de celle du parasite utilisé. En particulier, l'administration d'un parasite selon l'invention appartenant à une souche ne provoquant pas de neuropaludisme peut aboutir à une immunité croisée vis-à-vis d'une infection par une souche de Plasmodium capable de provoquer cette complication neurologique sévère. Le parasite selon l'invention peut donc être utilisé pour la prévention du paludisme ou du neuropaludisme. Le terme «prévention » tel qu'utilisé dans ce document, se réfère à une absence de symptômes ou à la présence de symptômes atténués de la maladie après contact avec le parasite. En particulier, le terme « prévention du paludisme » se réfère à une absence de symptômes ou à la présence de symptômes atténués chez le sujet traité après contact avec un Plasmodium responsable du paludisme. Le terme «prévention du neuropaludisme » se réfère à une absence de symptômes ou à la présence de symptômes atténués chez le sujet traité après contact avec un Plasmodium responsable du paludisme et capable d'induire un neuropaludisme. Ce terme peut également se référer à l'absence de développement d'un neuropaludisme ou au développement d'un neuropaludisme peu sévère ou atténué chez un sujet infecté par un Plasmodium responsable du paludisme et capable d'induire un neuropaludisme. In the parasite according to the invention, the function of one or more genes, other than hmgb2, can also be inactivated. The additional gene whose function is inactivated may be a gene involved in parasite survival in a mammalian host, particularly in humans. Preferably, the inactivation of this additional gene makes it possible to attenuate the virulence of the parasite while preserving its immunogenic nature. This additional gene may be selected from the group consisting of purine nucleoside phosphorylase (PNP; PFE0660c), nucleoside transporter 1 (NT1; PF13_0252), UIS3 (PF13_0012), UIS4 (PF10_0164 early transcript), p52 (PFD0215c protein with motif to 6 cysteines) and p36 (PFD0210c), as well as combinations thereof (references in parentheses are PlasmodBB library entry numbers of Plasmodium falciparum 3D7 sequences, given here as an example). The methods for cultivating the parasites according to the invention as well as the methods for preserving, in particular cryopreservation, parasites have previously been described and are well known to those skilled in the art (see, for example, Leef et al., 1979; et al., 1980). These parasites can be cultured ex vivo using cell cultures or in vivo in an animal, for example a mouse. According to one embodiment, the parasites according to the invention are used in erythrocyte form, more particularly in the form of merozoites, trophozoites or intra-erythrocytic schizonts. The parasitized red blood cells can be obtained by introducing the parasite into a host, preferably a human, and recovering red blood cells from the infected host when the parasitaemia reaches at least 1%, preferably between 5 and 10%. According to a preferred embodiment, the parasitized red blood cells are recovered from a human host of blood group O and negative Rh. Anti-coagulants, such as heparin, may be added to the red blood cells thus collected. The parasitized red blood cells can be preserved by freezing in the presence of one or more cryoprotectants compatible with an in vivo use, such as, for example, glycerol or dimethylsulfoxide (DMSO). The parasitized red blood cells can also be preserved by refrigeration at 4 ° C. in a suitable preservation medium, for example SAGM medium ("Saline Adenine Glucose Mannitol") or a CPD solution (Citrate Phosphate Dextrose), but for a period of time. not exceeding approximately 45 days. According to another embodiment, the parasites according to the invention are used in the form of sporozoites. Sporozoites can be obtained by introducing the parasite into a mosquito host where it will multiply. The sporozoites are then recovered from the salivary glands of infected mosquitoes. The sporozoites thus obtained can be stored by freezing, for example in liquid nitrogen, before being thawed for live injection into a host. Alternatively, after recovery from the salivary glands of the mosquitoes, the sporozoites can be preserved by lyophilization or refrigeration before administration. The administration of the parasite according to the invention in a subject makes it possible, despite rapid parasite clearance, to induce in the subject an immunity of several months vis-à-vis infection with a Plasmodium. This immunity may especially be a cross-immunity to infection with a strain of Plasmodium different from that of the parasite used. In particular, the administration of a parasite according to the invention belonging to a strain which does not cause neuropaludism can lead to cross-immunity with respect to an infection with a Plasmodium strain capable of causing this severe neurological complication. . The parasite according to the invention can therefore be used for the prevention of malaria or cerebral malaria. The term "prevention" as used herein refers to an absence of symptoms or the presence of attenuated symptoms of the disease after contact with the parasite. In particular, the term "malaria prevention" refers to an absence of symptoms or to the presence of attenuated symptoms in the subject treated after contact with a Plasmodium responsible for malaria. The term "prevention of cerebral malaria" refers to an absence of symptoms or to the presence of attenuated symptoms in the subject treated after contact with a Plasmodium responsible for malaria and capable of inducing a cerebral malaria. This term can also refer to the absence of development of a cerebral malaria or the development of a mild or attenuated neuropaludism in a subject infected with a Plasmodium responsible for malaria and capable of inducing a cerebral malaria.

Dans un second aspect, la présente invention concerne une composition immunogène comprenant une quantité immunologiquement efficace d'un parasite selon l'invention, et un ou plusieurs excipients ou supports pharmaceutiquement acceptables. Le parasite compris dans la composition est tel que décrit ci-dessus. Selon un mode de réalisation, la composition comprend un parasite selon l'invention sous une forme érythrocytaire, plus particulièrement sous la forme de mérozoïtes, de trophozoïtes ou de schizontes intra-érythrocytaires. Selon un mode particulier de réalisation, la composition comprend des globules rouges parasités avec le parasite selon l'invention et qui peuvent être obtenus selon la méthode décrite ci-dessus et dans la partie expérimentale. In a second aspect, the present invention relates to an immunogenic composition comprising an immunologically effective amount of a parasite according to the invention, and one or more pharmaceutically acceptable excipients or carriers. The parasite included in the composition is as described above. According to one embodiment, the composition comprises a parasite according to the invention in erythrocyte form, more particularly in the form of merozoites, trophozoites or intra-erythrocytic schizonts. According to a particular embodiment, the composition comprises red blood cells parasitized with the parasite according to the invention and which can be obtained according to the method described above and in the experimental part.

Selon un autre mode de réalisation, le parasite compris dans la composition est sous la forme de sporozoïtes tels que décrits ci-dessus. La composition immunogène est capable d'induire chez le sujet auquel elle est administrée, une réponse du système immunitaire à l'encontre du parasite qu'elle contient. Le terme « quantité immunologiquement efficace » tel qu'utilisé ici, se réfère à une quantité de parasites qui est suffisante pour déclencher une réponse immunitaire chez le sujet. De préférence, la composition immunogène est un vaccin contre le paludisme. Selon un mode de réalisation, la composition selon l'invention est obtenue en mettant en suspension des globules rouges parasités ou des sporozoïtes tels que définis ci-dessus, dans un ou plusieurs excipients pharmaceutiquement acceptables. Ces excipients peuvent notamment être choisis dans le groupe constitué d'eau stérile, de sérum physiologique stérile et de tampon phosphate. D'autres excipients bien connus de l'homme du métier peuvent également être utilisés. De préférence, dans le cas où la composition comprend des globules rouges parasités, l'excipient utilisé sera une solution isotonique assurant l'intégrité des globules rouges jusqu'à l'administration de la composition au sujet. La composition peut également être obtenue en mélangeant des sporozoïtes de parasites tels que définis ci-dessus, avec un support pharmaceutiquement acceptable tel que, par exemple, des liposomes. According to another embodiment, the parasite included in the composition is in the form of sporozoites as described above. The immunogenic composition is capable of inducing in the subject to which it is administered, a response of the immune system against the parasite it contains. The term "immunologically effective amount" as used herein refers to an amount of parasites that is sufficient to elicit an immune response in the subject. Preferably, the immunogenic composition is a vaccine against malaria. According to one embodiment, the composition according to the invention is obtained by suspending parasitized red blood cells or sporozoites as defined above, in one or more pharmaceutically acceptable excipients. These excipients may especially be selected from the group consisting of sterile water, sterile saline and phosphate buffer. Other excipients well known to those skilled in the art can also be used. Preferably, in the case where the composition comprises parasitized red blood cells, the excipient used will be an isotonic solution ensuring the integrity of red blood cells until administration of the composition to the subject. The composition may also be obtained by mixing sporozoites of parasites as defined above with a pharmaceutically acceptable carrier such as, for example, liposomes.

Les excipients ou supports utilisés devront être choisis de façon à permettre d'assurer l'intégrité des globules rouges parasités ou la survie des sporozoïtes, Les excipients ou supports utilisés devront être choisis de sorte à assurer la survie des parasites de l'invention, quelle que soit la forme utilisée (sporozoïtes ou formes intraérythrocytaires), jusqu'à l'administration de la composition au sujet à immuniser. The excipients or carriers used must be chosen in such a way as to ensure the integrity of parasitized red blood cells or the survival of sporozoites. The excipients or supports used must be chosen in such a way as to ensure the survival of the parasites of the invention. whatever the form used (sporozoites or intra-erythrocytic forms), until the administration of the composition to the subject to be immunized.

Selon un mode de réalisation préféré, le sujet à immuniser est un mammifère, de préférence un humain. La composition selon l'invention peut être administrée, par exemple, par voie parentérale, cutanée, muqueuse, trans-muqueuse ou épidermique. De préférence, la composition est formulée pour être administrée par voie parentérale, par exemple par voie sous-cutanée, intramusculaire, intraveineuse ou intradermique. Selon un mode de réalisation particulier, le parasite est sous une forme érythrocytaire, de préférence compris dans des globules rouges, et la composition est 5 formulée pour être administrée par voie parentérale. Selon un autre mode de réalisation particulier, le parasite est sous forme de sporozoïtes et la composition est formulée pour être administrée par voie intramusculaire. Les méthodes d'administration de compositions comprenant des sporozoïtes vivants sont bien connues de l'homme du métier (voir par exemple la 10 demande internationale de brevet WO 2004/045559). Selon un mode de réalisation, la composition selon l'invention comprend entre 100 et 106 globules rouges parasités (GRP) par unité de dose, de préférence entre 100 et 105 GRP, de manière particulièrement préférée entre 100 et 104 GRP par unité de dose. Selon un autre mode de réalisation, la composition selon l'invention comprend 15 entre 103 et 107 sporozoïtes par unité de dose, de préférence entre 104 et 105 sporozoïtes par unité de dose. La dose à administrer peut être aisément déterminée par l'homme du métier en tenant compte des données physiologiques du sujet à immuniser telles que son âge ou son état immunitaire, du degré d'immunité recherché et du nombre de doses 20 administrées. La composition selon l'invention peut comprendre une ou plusieurs souches de parasites selon l'invention. Selon un mode de réalisation, la composition comprend au moins une souche de Plasmodium falciparum et une souche de Plasmodium vivax dans lesquelles la fonction du gène hmgb2 est inactivée. 25 La composition selon l'invention peut également comprendre d'autres parasites génétiquement atténués. Ces parasites peuvent, par exemple, présenter un altération ou une inactivation de la fonction du gène de la purine nucléoside phosphorylase, du transporteur de nucléoside 1, UIS3, UIS4, p52 ou p36, ou être des parasites atténués obtenus par irradiation. 30 La composition selon l'invention peut également comprendre un ou plusieurs adjuvants immunologiques qui stimulent le système immunitaire et renforcent ainsi la réponse immunitaire obtenue vis-à-vis du parasite selon l'invention. Ces adjuvants immunologiques comprennent, sans y être limités, des adjuvants de type muramylpeptide tels que la N-acétylmuramyl-L-alanyl-D-isoglutamine (MDP) et ses dérivés ; le tréhalose dimycolate (TDM) ; le lipopolysaccharide (LPS) ; le monophosphoryl lipide A (MPL) ; la carboxy-méthylcellulose ; l'adjuvant complet de Freund ; l'adjuvant incomplet de Freund ; des adjuvants de type émulsions «huile dans eau » éventuellement additionnés de squalène ou squalane ; les adjuvants minéraux tels que l'hydroxyde d'aluminium, le phosphate d'aluminium, de potassium ou de calcium ; des toxines bactériennes telles que la sous-unité B de la toxine cholérique, la forme inactivée de la toxine pertussique ou la lymphotoxine thermolabile d'Escherichia coli ; des oligodésoxynucléotides CpG ; des saponines; des copolymères synthétiques tels que des copolymères de polyoxyéthylène (POE) et polyoxypropylène (POP); des cytokines ; ou des imidazoquinolones. Des combinaisons d'adjuvants peuvent être utilisées. Ces différents types d'adjuvants sont bien connus de l'homme du métier. According to a preferred embodiment, the subject to be immunized is a mammal, preferably a human. The composition according to the invention can be administered, for example, parenterally, cutaneously, mucosa, transmucosal or epidermal. Preferably, the composition is formulated to be administered parenterally, for example subcutaneously, intramuscularly, intravenously or intradermally. According to a particular embodiment, the parasite is in erythrocyte form, preferably included in red blood cells, and the composition is formulated for parenteral administration. According to another particular embodiment, the parasite is in the form of sporozoites and the composition is formulated to be administered intramuscularly. Methods of administering compositions comprising live sporozoites are well known to those skilled in the art (see, for example, International Patent Application WO 2004/045559). According to one embodiment, the composition according to the invention comprises between 100 and 106 parasitized red blood cells (GRP) per unit dose, preferably between 100 and 105 GRP, particularly preferably between 100 and 104 GRP per dose unit. According to another embodiment, the composition according to the invention comprises between 103 and 107 sporozoites per unit of dose, preferably between 104 and 105 sporozoites per unit of dose. The dose to be administered can be readily determined by those skilled in the art taking into account the physiological data of the subject to be immunized such as its age or immune status, the degree of immunity sought and the number of doses administered. The composition according to the invention may comprise one or more strains of parasites according to the invention. According to one embodiment, the composition comprises at least one strain of Plasmodium falciparum and a strain of Plasmodium vivax in which the function of the hmgb2 gene is inactivated. The composition according to the invention may also comprise other genetically attenuated parasites. These parasites may, for example, exhibit alteration or inactivation of purine nucleoside phosphorylase, nucleoside transporter 1, UIS3, UIS4, p52 or p36, or may be attenuated parasites obtained by irradiation. The composition according to the invention may also comprise one or more immunological adjuvants which stimulate the immune system and thus strengthen the immune response obtained with respect to the parasite according to the invention. Such immunological adjuvants include, but are not limited to, muramyl peptide adjuvants such as N-acetylmuramyl-L-alanyl-D-isoglutamine (MDP) and its derivatives; trehalose dimycolate (TDM); lipopolysaccharide (LPS); monophosphoryl lipid A (MPL); carboxymethylcellulose; the complete adjuvant of Freund; incomplete Freund's adjuvant; adjuvants of "oil-in-water" emulsion type optionally added with squalene or squalane; inorganic adjuvants such as aluminum hydroxide, aluminum phosphate, potassium phosphate or calcium phosphate; bacterial toxins such as the cholera toxin subunit B, the inactivated form of the pertussis toxin or the heat-labile lymphotoxin of Escherichia coli; CpG oligodeoxynucleotides; saponins; synthetic copolymers such as polyoxyethylene (POE) and polyoxypropylene (POP) copolymers; cytokines; or imidazoquinolones. Combinations of adjuvants may be used. These different types of adjuvants are well known to those skilled in the art.

Selon un autre aspect, l'invention concerne l'utilisation d'un parasite vivant appartenant au genre Plasmodium dans lequel la fonction du gène hmgb2 est inactivée pour la préparation d'une composition vaccinale contre le paludisme ou le neuropaludisme. L'invention concerne également une méthode pour produire une composition vaccinale contre le paludisme ou le neuropaludisme. According to another aspect, the invention relates to the use of a living parasite belonging to the genus Plasmodium in which the function of the hmgb2 gene is inactivated for the preparation of a vaccine composition against malaria or cerebral malaria. The invention also relates to a method for producing a vaccine composition against malaria or cerebral malaria.

Selon un mode de réalisation, la méthode comprend l'étape consistant à mélanger des globules rouges parasités avec un parasite vivant selon l'invention, avec un excipient ou support pharmaceutiquement acceptable. Selon un autre mode de réalisation, la méthode comprend l'étape consistant à mélanger des sporozoïtes vivants d'un parasite selon l'invention avec un excipient ou 25 support pharmaceutiquement acceptable. La méthode peut en outre comprendre une étape préalable comprenant l'obtention desdits globules rouges parasités ou desdits sporozoïtes, par exemple à l'aide des méthodes décrites ci-dessus. La composition ou le vaccin obtenu peut être conservé avant administration, par 30 exemple congelé ou réfrigéré s'il contient des globules rouges parasités, ou congelé, réfrigéré ou lyophilisé s'il contient des sporozoïtes. De préférence, la composition ou le vaccin obtenu est conservé congelé avant administration. Dans le cas d'une lyophilisation, un diluant approprié sera ajouté au lyophilisat avant administration, de préférence de l'eau stérile ou du sérum physiologique stérile. Les différents modes de réalisation concernant le parasite et la composition selon l'invention sont également envisagés dans cet aspect. According to one embodiment, the method comprises the step of mixing parasitized red blood cells with a live parasite according to the invention, with a pharmaceutically acceptable excipient or carrier. In another embodiment, the method comprises the step of mixing live sporozoites of a parasite according to the invention with a pharmaceutically acceptable excipient or carrier. The method may further comprise a prior step comprising obtaining said parasitized red blood cells or said sporozoites, for example using the methods described above. The composition or vaccine obtained can be stored before administration, for example frozen or refrigerated if it contains parasitized red blood cells, or frozen, chilled or lyophilized if it contains sporozoites. Preferably, the composition or the vaccine obtained is stored frozen before administration. In the case of lyophilization, a suitable diluent will be added to the lyophilizate before administration, preferably sterile water or sterile saline. The various embodiments relating to the parasite and the composition according to the invention are also envisaged in this aspect.

Selon un autre aspect, l'invention concerne une méthode pour immuniser un sujet contre le paludisme, comprenant l'administration d'une composition immunogène ou d'un vaccin selon l'invention audit sujet. De préférence, le sujet est un mammifère, plus particulièrement un humain. In another aspect, the invention relates to a method for immunizing a subject against malaria, comprising administering an immunogenic composition or vaccine according to the invention to said subject. Preferably, the subject is a mammal, more particularly a human.

Selon un mode de réalisation préférée, la méthode comprend l'administration d'un vaccin selon l'invention audit sujet. Selon un mode de réalisation, la méthode comprend l'administration d'une dose unique de la composition immunogène ou du vaccin selon l'invention. Selon un autre mode de réalisation, la méthode comprend l'administration d'une pluralité de doses de la composition immunogène ou du vaccin selon l'invention. L'immunisation du sujet peut être obtenue après l'administration de 2 à 6 doses. De préférence, un délai d'environ 6 à 8 semaines est observé entre chaque administration. Les inventeurs ont démontré que l'administration d'une seule dose comprenant 105 globules rouges parasités avec un parasite selon l'invention permettait d'obtenir une immunité stérile d'au moins 6 mois chez un mammifère. Selon un mode préféré de réalisation, la méthode comprend l'administration d'une première dose de la composition immunogène ou du vaccin selon l'invention suivi de l'administration d'une seconde dose environ six mois à un an plus tard. De préférence, les doses comprennent entre 100 et 106 globules rouges parasités ou entre 103 et 10' sporozoïtes. Selon un mode de réalisation préférée, les doses comprennent environ 103 globules rouges parasités. L'immunité du sujet vis-à-vis du paludisme ou du neuropaludisme peut être totale ou incomplète. Dans le cas d'une immunité incomplète, la gravité des symptômes de la maladie déclarée chez un sujet immunisé sera réduite par comparaison à ceux observés chez un sujet non immunisé. Selon un mode de réalisation préféré, l'immunité obtenue par administration de la composition selon l'invention est une immunité stérile. Cela signifie que le développement des parasites administrés est très altéré et qu'environ 2 à 4 semaines après l'administration, les parasites ne sont plus détectés dans le sang du sujet. Les exemples qui suivent sont présentés dans un but illustratif et non limitatif. Exemples En étudiant la fonction des protéines HMGB, les inventeurs ont récemment montré que la protéine HMGB2 de P. berghei est impliquée dans l'établissement du neuropaludisme expérimental (NPE) dans un modèle de souris C57B1/6 infectées par le parasite de P. berghei ANKA (PbANKA). L'inactivation du gène hmgb2 chez PbANKA, sans entraver le développement du parasite chez les souris C57B1/6, induit néanmoins un retard dans l'établissement du NPE voire son abolition complète dans 65% des cas. De plus, il a été montré que l'administration de protéines recombinantes HMGB2 à des souris préalablement infectées par PbANKA Ohmgb2 permettait de restaurer le développement du neuropaludisme. Matériels et méthodes Souris Les souris utilisées sont des souris C57BL/6 (Charles River Laboratories). Ces souris sont sensibles au neuropaludisme expérimental (NP-S). Parasites sauvages Le parasite P. berghei ANKA (PbANKA) (MRA-867) induit la mort de souris C57BL/6 20 par neuropaludisme en 7 jours +/- 1. Ce parasite possède une étiquette GFP sous le contrôle du promoteur eefl (Thaty and Ménard, 2002). Le parasite P. berghei NK65 (PbNK65) (MRA-268) (de Sa et al. 2009) induit la mort des souris C57BL/6 par hyper-parasitémie en 20 à 25 jours après infection. En revanche, ce parasite ne provoque pas de neuropaludisme. 25 Obtention du parasite PbNK65 Ohmgb2 Construction du vecteur de clonage: les régions qui flanquent la phase ouverte de lecture en 5'UTR et 3'UTR du gène hmgb2, respectivement nommées ci-dessous RH1 et RH2 (et d'une longueur d'environ 500 pb), ont été amplifiées à l'aide d'amorces spécifiques, par PCR à partir de l'ADN génomique du parasite PbNK65 (Tableau 2) clonées dans le vecteur pCR~II-TOPO (Invitrogen). Des bactéries Escherichia coli One Shot® TOP10 électro-compétentes ont ensuite été transformées avec ces constructions et sélectionnées sur milieu LB contenant de l'ampicilline et de la kanamycine. Tableau 2 : Amorces d'amplification des régions d'homologies RH1 et RH2 RH1 sens 5'CGATGCGGGCCCAAAAAGGTAAATATGAAAAAGAAAG GTT3' (SEQ ID No : 11) RH1 anti- sens 5'CGATGCCCCGGGTTTGCAATGGAAACATATCAGTT3' (SEQ ID No : 12) RH2 sens 5'CCAGTGAGTGCGGCCGCGGAGCCTTTTGTATGTGCTTTT TG3' (SEQ ID No : 13) RH2 anti- sens 5' AGCTGGCGCGCCAAGTATTGCAGTAGCATTTTCTTTAAA T3' (SEQ ID No : 14) Les amorces servant à l'amplification ont été dessinées de sorte à adjoindre pour - RH1 : un site de restriction ApaI en 5' UTR et un site de restriction SmaI en 3'UTR, et - RH2 : un site de restriction NotI en 5' UTR et un site de restriction AscI en 3'UTR de la séquence. Ces sites de restrictions permettent l'insertion des fragments 10 PCR dans le vecteur. Les régions 5' et 3' non traduites RH1 et RH2 ont ensuite été insérées dans un vecteur pBC SK-Hudhfr (Stratagene) contenant le gène de la dihydrofolate réductase humaine (hudhfr) sous le contrôle du promoteur efla en 5'UTR et de la dhfr/ts (dhfr/thymidilate synthase) en 3'UTR. RH1 a été insérée en 5'UTR de la cassette 15 Hudhfr et RH2 en 3'UTR. Lors de la recombinaison homologue, les 2 régions RH1 et RH2 se sont appariées avec les séquences complémentaires du gène hmgb2 dans le génome de P. berghei, permettre une double recombinaison homologue au niveau de ce gène et, de ce fait, sa délétion. La Hudhfr confère la résistance à la pyriméthamine et les parasites mutants ont été sélectionnés à l' aide de cette drogue. 20 Transfection des parasites et sélection des parasites mutants: les mérozoïtes de P. berghei ont été transfectés en suivant le protocole décrit par de Koning-Ward et al, 2000. Toutes les infections ont été réalisées par injection intra veineuse. Deux souris Swiss de 3 semaines ont été infectées avec 2,6.106 GRPs PbANKA ou PbNK65. Lorsque la parasitémie atteignait entre 2 et 3 % (stades jeunes majoritaires), le sang a été prélevé sous héparine par ponction intra cardiaque (1,5 à 2 ml de sang). Le sang a été lavé brièvement dans 5 ml de milieu de culture complet constitué de 4 vol de RPMI 1640 (Invitrogen) additionné de 1 vol de sérum de veau foetal (InVitrogen). Après centrifugation 8 min à 450 g, les GRPs ont été repris dans 50 ml de milieu de culture complet. La suspension cellulaire, à laquelle ont été ajoutés 50 ml supplémentaires de milieu de culture complet, a alors été mise en culture toute la nuit, dans un Erlen Meyer de 500 ml, à 36,5 °C, sous agitation à 70 rpm et sous une pression de 1,5 à 2 bars. Le lendemain, après vérification par frottis de la présence majoritaire de schizontes matures la culture de GRPs a été centrifugée 10 min à 1500 rpm puis le culot a été repris dans 35 ml de milieu de culture complet dans un tube à fond conique de 50 ml. Dix millilitres de Nycodenz 50 % (Lucron Bioproducts, dilution dans du PBS 1 X) ont ensuite été tout doucement additionnés à la culture de GRPs de manière à créer un gradient de densité au fond du tube. Vingt minutes de centrifugation à 450 g, TA, sans frein, ont entraîné la purification des GRPs qui forment alors un anneau brun au milieu du tube. L'anneau brun de GRPs a été prélevé (-20 ml) puis lavé avec 20 ml de milieu de culture complet. Après 8 min de centrifugation à 450 g, le culot de schizontes matures a été finalement repris dans 3 ml de milieu de culture complet qui ont ensuite été distribués dans 3 tubes Eppendorf de 1,5 ml. Cette opération a du être réalisée de manière très délicate car les schizontes sont fragiles. À cette étape, la quantité de schizontes obtenus a été suffisante pour réaliser jusqu'à 10 transfections indépendantes. Après un dernier «spin» 5 sec à 16000 g, le culot de schizontes dans chaque tube a été alors repris dans 100 µl du tampon d'électroporation (Nucleofector Solution 88A6, AMAXA) avec 5 µg de chacune des constructions plasmidiques obtenues (pBC- 5'RH1Hudhfr3'RH2 pour pbhmgbl ou pbhmgb2), digérées au préalable par ApaI et AscI. Les parasites ont été transfectés en utilisant le programme U33 de l'électroporateur, Nucleofector AMAXA. Le choc électrique induit la rupture de la membrane des schizontes matures et les mérozoïtes ainsi libérés peuvent internaliser les plasmides linéarisés. Cinquante microlitres de milieu de culture complet ont été additionnés tout de suite au contenu de la cuvette et deux souris Swiss de 3 semaines ont été immédiatement infectées avec 100 µl, chacune, de mérozoïtes transfectés. À J1 après l'infection, la drogue de sélection, la pyriméthamine a été administrée dans l'eau de boisson et des frottis ont été réalisés tous les jours. La solution de pyriméthamine a été préparée de la manière suivante: 70 mg de pyriméthamine (Sigma Aldrich), 10 ml DMSO, qsp 1 L eau, pH 3,5-5,5. Lorsque les souris sont devenues positives pour la présence de parasites (environ J6 après l'infection) et que la parasitémie a atteint entre 2 et 10 %, leur sang a été prélevé par ponction intra cardiaque. According to a preferred embodiment, the method comprises administering a vaccine according to the invention to said subject. According to one embodiment, the method comprises the administration of a single dose of the immunogenic composition or of the vaccine according to the invention. According to another embodiment, the method comprises the administration of a plurality of doses of the immunogenic composition or of the vaccine according to the invention. Immunization of the subject can be obtained after administration of 2 to 6 doses. Preferably, a delay of about 6 to 8 weeks is observed between each administration. The inventors have demonstrated that the administration of a single dose comprising 105 red cells parasitized with a parasite according to the invention made it possible to obtain a sterile immunity of at least 6 months in a mammal. According to a preferred embodiment, the method comprises the administration of a first dose of the immunogenic composition or of the vaccine according to the invention followed by the administration of a second dose about six months to one year later. Preferably, the doses comprise between 100 and 106 parasitized red blood cells or between 103 and 10 'sporozoites. According to a preferred embodiment, the doses comprise about 103 parasitized red blood cells. The subject's immunity to malaria or cerebral malaria may be complete or incomplete. In the case of incomplete immunity, the severity of the symptoms of the disease reported in an immunized subject will be reduced compared to those observed in a non-immune subject. According to a preferred embodiment, the immunity obtained by administering the composition according to the invention is a sterile immunity. This means that the development of the administered parasites is very altered and that about 2 to 4 weeks after administration, the parasites are no longer detected in the blood of the subject. The following examples are presented for illustrative and non-limiting purposes. EXAMPLES By studying the function of the HMGB proteins, the inventors have recently shown that the P. hergGBi protein of P. berghei is involved in the establishment of experimental neuropaludism (NPE) in a model of C57B1 / 6 mice infected with the P. berghei parasite. ANKA (PbANKA). The inactivation of the hmgb2 gene in PbANKA, without hindering the development of the parasite in C57B1 / 6 mice, nevertheless causes a delay in the establishment of the NPE or even its complete abolition in 65% of cases. Moreover, it has been shown that the administration of recombinant HMGB2 proteins to mice previously infected with PbANKA Ohmgb2 made it possible to restore the development of neuropaludism. Materials and Methods Mouse The mice used are C57BL / 6 mice (Charles River Laboratories). These mice are sensitive to experimental neuropaludism (NP-S). Wild Parasites The P. berghei ANKA parasite (PbANKA) (MRA-867) induced death of C57BL / 6 mice by neuropaludism in 7 days +/- 1. This parasite has a GFP tag under the control of the eefl promoter (Thaty and Ménard, 2002). The parasite P. berghei NK65 (PbNK65) (MRA-268) (from Sa et al., 2009) induces the death of C57BL / 6 mice by hyper-parasitaemia within 20 to 25 days after infection. On the other hand, this parasite does not cause neuropaludism. Obtaining the parasite PbNK65 Ohmgb2 Construction of the cloning vector: the regions which flank the 5'UTR and 3'UTR open reading phase of the hmgb2 gene, respectively named below RH1 and RH2 (and of a length of approximately 500 bp), were amplified using specific primers, by PCR from the genomic DNA of the PbNK65 parasite (Table 2) cloned in the vector pCR ~ II-TOPO (Invitrogen). Electro-competent Escherichia coli One Shot® TOP10 bacteria were then transformed with these constructs and selected on LB medium containing ampicillin and kanamycin. TABLE 2 Amplification primers of homology regions RH1 and RH2 RH1 sense 5'CGATGCGGGCCCAAAAAGGTAAATATGAAAAAGAAAG GTT3 '(SEQ ID No: 11) RH1 antisense 5'CGATGCCCCGGGTTTGCAATGGAAACATATCAGTT3' (SEQ ID No: 12) RH2 sense 5'CCAGTGAGTGCGGCCGCGGAGCCTTTTGTATGTGCTTTT TG3 (SEQ ID NO: 13) RH2 antisense 5 'AGCTGGCGCGCCAAGTATTGCAGTAGCATTTTCTTTAAA T3' (SEQ ID NO: 14) The primers for amplification were designed to add for - RH1: a 5 'ApaI restriction site UTR and a SmaI restriction site at 3'UTR, and - RH2: a NotI restriction site at 5 'UTR and an AscI restriction site at 3'UTR of the sequence. These restriction sites allow the insertion of PCR fragments into the vector. The 5 'and 3' untranslated regions RH1 and RH2 were then inserted into a pBC SK-Hudhfr vector (Stratagene) containing the human dihydrofolate reductase gene (hudhfr) under the control of the 5'UTR efla promoter and the dhfr / ts (dhfr / thymidilate synthase) at 3'UTR. RH1 was inserted in 5'UTR of the Hudhfr cassette and RH2 in 3'UTR. During homologous recombination, the 2 RH1 and RH2 regions matched with the complementary sequences of the hmgb2 gene in the P. berghei genome, allow a double homologous recombination at this gene and, therefore, its deletion. Hudhfr confers resistance to pyrimethamine and mutant parasites were selected with this drug. Transfection of parasites and selection of mutant parasites: The merozoites of P. berghei were transfected following the protocol described by de Koning-Ward et al, 2000. All infections were performed by intravenous injection. Two 3 week old Swiss mice were infected with 2.6.106 GRPs PbANKA or PbNK65. When parasitaemia reached 2% to 3% (mostly young stages), the blood was taken by heparin by cardiac puncture (1.5 to 2 ml of blood). The blood was washed briefly in 5 ml of complete culture medium consisting of 4 vol of RPMI 1640 (Invitrogen) supplemented with 1 vol of fetal calf serum (InVitrogen). After centrifugation for 8 min at 450 g, the GRPs were taken up in 50 ml of complete culture medium. The cell suspension, to which an additional 50 ml of complete culture medium was added, was then cultured overnight in a 500 ml Erlen Meyer at 36.5 ° C. with shaking at 70 rpm and a pressure of 1.5 to 2 bars. The following day, after smear verification of the majority presence of mature schizonts, the GRPs culture was centrifuged for 10 min at 1500 rpm and the pellet was then taken up in 35 ml of complete culture medium in a 50 ml conical bottom tube. Ten milliliters of 50% Nycodenz (Lucron Bioproducts, dilution in 1X PBS) were then gently added to the GRPs culture to create a density gradient at the bottom of the tube. Twenty minutes of centrifugation at 450 g, TA, without brake, resulted in the purification of GRPs which then form a brown ring in the middle of the tube. The brown ring of GRPs was removed (-20 ml) then washed with 20 ml of complete culture medium. After 8 min of centrifugation at 450 g, the pellet of mature schizonts was finally taken up in 3 ml of complete culture medium which was then distributed in 3 1.5 ml Eppendorf tubes. This operation had to be done in a very delicate way because the schizonts are fragile. At this stage, the amount of schizonts obtained was sufficient to achieve up to 10 independent transfections. After a last "spin" 5 sec at 16000 g, the pellet of schizonts in each tube was then taken up in 100 μl of the electroporation buffer (Nucleofector Solution 88A6, AMAXA) with 5 μg of each of the plasmid constructs obtained (pBC- 5'RH1Hudhfr3'RH2 for pbhmgbl or pbhmgb2), digested beforehand with ApaI and AscI. The parasites were transfected using the U33 program of the electroporator, Nucleofector AMAXA. The electric shock induces the rupture of the mature schizont membrane and the merozoites thus released can internalize the linearized plasmids. Fifty microliters of complete culture medium were added immediately to the contents of the cuvette and two 3-week-old Swiss mice were immediately infected with 100 μl each of transfected merozoites. At day 1 after infection, the selection drug, pyrimethamine was administered into the drinking water and smears were performed daily. The pyrimethamine solution was prepared as follows: 70 mg pyrimethamine (Sigma Aldrich), 10 ml DMSO, qsp 1 L water, pH 3.5-5.5. When the mice became positive for the presence of parasites (about 6 days after infection) and the parasitaemia reached between 2 and 10%, their blood was taken by intracardiac puncture.

Conditions de culture des parasites et inoculation Les souris C57BL/6 ont été infectées, en intra-péritonéale avec 200 µl chacune, d'une ampoule contenant 10' GRPs/200 pl. Lorsque la parasitémie a atteint entre 1 et 5 % (5-6 jours après infection), environ 100 µl de sang ont été prélevés à la joue de l'animal dans un tube contenant de l'héparine. Ce sang a été lavé 2 fois avec 1 ml de PBS froid et centrifugé 5 min à 3800 rpm. Après dilution au 1/1000 et comptage des cellules, les souris C57BL/6 ont été infectées avec 105 GRPs. Mesure de la parasitémie La parasitémie est analysée par comptage au microscope des globules rouges parasités (GRP) dans des frottis colorés. Culture conditions of the parasites and inoculation The C57BL / 6 mice were infected, intraperitoneally with 200 .mu.l each, with one ampoule containing 10 'GRPs / 200 .mu.l. When parasitaemia reached 1-5% (5-6 days after infection), approximately 100 μl of blood was collected from the animal's cheek in a tube containing heparin. This blood was washed twice with 1 ml of cold PBS and centrifuged for 5 min at 3800 rpm. After dilution to 1/1000 and counting of cells, C57BL / 6 mice were infected with 105 GRPs. Measurement of parasitaemia Parasitaemia is analyzed by microscopic counting of parasitized red blood cells (RBCs) in stained smears.

Préparations des globules rouges parasités et congélation des GRP Les souris C57BL/6 sont infectées, en intra-péritonéale avec 200 µl chacune, d'une ampoule contenant 10' GRPs/200 µl. Deux types de stocks de parasites sont réalisés. Stabilats: le sang est prélevé chez des souris infectées, par ponction intracardiaque (animal anesthésié) lorsque la parasitémie atteint entre 3 et 10 % (5 à 6 jours après infection à l'aide de 107 globules rouges parasités) dans un tube contenant de l'héparine et toujours conservé dans la glace jusqu'à la congélation dans l'azote liquide dans le mélange cryopréservant suivant: 1 vol Glycérol pur (Sigma Aldrich) + 9 vol d'Alsever's Solution (Sigma Aldrich). Les stabilats sont réalisés avec 1 vol du sang prélevé auquel sont additionnés 2 vol du mélange cryopréservant. Les parties aliquotes sont congelées dans l'azote liquide (environ 3001a.1 par souris) et conservés ensuite à -80 °C. Ampoules: comme précédemment, le sang est prélevé par ponction intracardiaque mais, lorsque la parasitémie atteint entre 1 et 5 %. Ce sang est lavé plusieurs fois avec du PBS froid et centrifugé 5 min à 3800 rpm. Puis des ampoules de 107 GRPs/200 µl sont réalisées dans un mélange cryopréservant voir paragraphe précédent après comptage du nombre des globules rouges parasités. Résultats Rôle de la protéine HMGB2 dans le développement du parasite PbNK65 Les inventeurs ont démontré que l'inactivation du gène hmgb2 entravait le développement de PbNK65 Ahmgb2 dans la souris C57B1/6 (NP-S) avec une clairance du parasite 10 à 15 jours après l'infection (J10-J15) en fonction de la dose infectante de parasites. La figure 1 représente la moyenne de 3 expériences (souris n=5 par expérience) au cours desquelles les souris C57B1/6 ont été infectées à l'aide de globules rouges parasités avec PbNK65 sauvage ou PbNK65 Ahmgb2. Cette clairance du parasite muté a été observée environ 15 jours après infection. Le parasite muté n'était plus détecté dans les frottis sanguins alors que le développement du parasite sauvage se poursuivait jusqu'à la mort par hyper-parasitémie environ 25 jours après infection. En effet, alors que le parasite sauvage continue à se développer, l'infection avec PbNK65 Ahmgb2 induit une réponse immunitaire chez la souris C57B1/6 qui altère le développement de ce parasite. Plusieurs clones mutés indépendants ont été obtenus montrant la même cinétique de clairance lors de leur développement dans les souris C57B1/6. Protection stérile induite par une primo-infection avec PbNK65 Ahmgb2 Plusieurs expériences ont été réalisées avec de une à trois épreuves d'infection successives dans des souris C57B1/6 primo-infectées avec le parasite muté PbNK65 Ahmgb2 (105 GRP par voie intrapéritonéale ou intraveineuse). Lorsque le parasite n'était plus détecté dans le sang des souris C57B1/6 (vers J19), les inventeurs procédaient à la première épreuve d'infection (J19), puis la seconde à J71 et la troisième à J162 avec deux parasites sauvages hautement pathogènes: 1. le parasite homologue sauvage PbNK65 conduisant à la mort des souris par hyperparasitémie et 2. le parasite hétérologue PbANKA sauvage qui induit la mort des souris par neuropaludisme. Preparations of parasitized red blood cells and freezing of the GRP The C57BL / 6 mice are infected, intraperitoneally with 200 .mu.l each, with one ampoule containing 10 'GRPs / 200 .mu.l. Two types of parasite stocks are made. Stabilities: the blood is taken from infected mice, by intracardiac puncture (anesthetized animal) when the parasitaemia reaches between 3 and 10% (5 to 6 days after infection with 107 parasitized red blood cells) in a tube containing heparin and still stored in ice until freezing in liquid nitrogen in the following cryopreservant mixture: 1 vol. Pure glycerol (Sigma Aldrich) + 9 vol Alsever's Solution (Sigma Aldrich). The stabilates are carried out with 1 volume of the collected blood to which 2 volumes of the cryopreservant mixture are added. The aliquots are frozen in liquid nitrogen (about 3001a.1 per mouse) and then stored at -80 ° C. Ampoules: as previously, the blood is collected by intracardiac puncture but, when the parasitaemia reaches between 1 and 5%. This blood is washed several times with cold PBS and centrifuged for 5 min at 3800 rpm. Then ampoules of 107 GRPs / 200 μl are made in a cryopreservant mixture see previous paragraph after counting the number of parasitized red blood cells. Results Role of the HMGB2 Protein in the Development of the PbNK65 Parasite The inventors have demonstrated that the inactivation of the hmgb2 gene hampers the development of PbNK65 Ahmgb2 in the C57B1 / 6 (NP-S) mouse with clearance of the parasite 10 to 15 days later. infection (D10-J15) depending on the infective dose of parasites. FIG. 1 represents the average of 3 experiments (mice n = 5 per experiment) during which the C57B1 / 6 mice were infected with red blood cells parasitized with wild-type PbNK65 or PbNK65 Ahmgb2. This clearance of the mutated parasite was observed about 15 days after infection. The mutated parasite was no longer detected in blood smears, whereas the development of the wild-type parasite continued until death by hyper-parasitaemia about 25 days after infection. Indeed, while the wild parasite continues to develop, infection with PbNK65 Ahmgb2 induces an immune response in the C57B1 / 6 mouse that alters the development of this parasite. Several independent mutated clones were obtained showing the same clearance kinetics during their development in C57B1 / 6 mice. Sterile Protection Induced by Primary Infection with PbNK65 Ahmgb2 Several experiments were performed with one to three successive infection tests in C57B1 / 6 mice primed with the mutated PbNK65 Ahmgb2 mice (105 GRP intraperitoneally or intravenously) . When the parasite was no longer detected in the blood of C57B1 / 6 mice (around J19), the inventors carried out the first test of infection (J19), then the second on J71 and the third on J162 with two wild parasites highly. pathogens: 1. the wild homologous parasite PbNK65 leading to the death of the mice by hyperparasitaemia and 2. the wild-type PbANKA heterologous parasite which induces the death of the mice by neuropaludism.

La figure 2 présente les résultats d'une expérience avec trois épreuves d'infection successives. Toutes les souris primo-infectées avec PbNK65 Ahmgb2 ont survécu aux trois épreuves d'infection avec maintien d'une protection stérile pendant au moins 7 mois. A chaque épreuve, les inventeurs ont vérifié que le développement du parasite sauvage PbNK65 dans les souris naïves se poursuit jusqu'à environ 25 jours où les souris commencent à mourir d'hyper-parasitémie et que le développement du parasite PbANKA sauvage dans les souris naïves se poursuit jusqu'à environ 7 jours où les souris meurent de neuropaludisme (les témoins de la pathogénicité des parasites et de l'âge des souris). Afin de déterminer la plus petite dose de globules rouges infectés par PbNK65 Ohmgb2 nécessaire et suffisante pour promouvoir la protection stérile, des épreuves d'infection ont été menées sur des souris primo-infectées avec 105 à 10' GRP. Ces expériences ont montré que l'injection de seulement 100 GRP permettait d'induire une protection stérile lors d'une épreuve d'infection menée par injection intraveineuse de 105 GRP de PbNK65 ou PbANKA sauvage. Conclusion Ces résultats montrent qu'une immunité stérile (les parasites ne sont plus détectés dans le sang périphérique) peut être induite après une primo-infection avec le parasite PbNK65 Ohmgb2, Cette protection s'étend non seulement au parasite homologue sauvage PbNK65 mais également au parasite hétérologue PbANKA capable d'induire un neuropaludisme. Figure 2 shows the results of an experiment with three successive infection tests. All mice primed with PbNK65 Ahmgb2 survived the three infection tests with continued sterile protection for at least 7 months. At each challenge, the inventors verified that the development of the wild-type parasite PbNK65 in naive mice continues until about 25 days when the mice begin to die from hyper-parasitaemia and that the development of the wild-type PbANKA parasite in naive mice continues until about 7 days when the mice die of cerebral malaria (the witnesses of the pathogenicity of the parasites and the age of the mice). In order to determine the smallest dose of PbNK65 Ohmgb2-infected red blood cells necessary and sufficient to promote sterile protection, infection assays were conducted on primo-infected mice with 105-10% GRP. These experiments showed that the injection of only 100 GRP allowed to induce sterile protection during an infection test conducted by intravenous injection of 105 GRP of wild-type PbNK65 or PbANKA. Conclusion These results show that sterile immunity (parasites are no longer detected in the peripheral blood) can be induced after primary infection with the parasite PbNK65 Ohmgb2, This protection extends not only to the wild homologous parasite PbNK65 but also to heterologous parasite PbANKA capable of inducing a cerebral malaria.

Références bibliographiques Aly et al. Cell Microbiol.References Aly et al. Cell Microbiol.

2010 Ju1;12(7):930-8, Briquet et al. Eukaryotic Cell, 2006, 5: 672-82, de Koning-Ward et al. Annu Rev Microbiol, 2000. 54: 157-85, De Sa et al. Parasitology Research, 2009, 105: 275-279, Gissot et al. J Mol Biol. 2005, 346(1):29-42, Kumar et al. Parasitology International, 2008, 57: 150-157, Leef et al. Bull World Health Organ. 1979;57 Suppl 1:87-91, McRobert and McConkey. Mol Biochem Parasitol.2010 Ju1; 12 (7): 930-8, Briquet et al. Eukaryotic Cell, 2006, 5: 672-82, Koning-Ward et al. Annu Rev Microbiol, 2000. 54: 157-85, De Sa et al. Parasitology Research, 2009, 105: 275-279, Gissot et al. J Mol Biol. 2005, 346 (1): 29-42, Kumar et al. Parasitology International, 2008, 57: 150-157, Leef et al. Bull World Health Organ. 1979; 57 Suppl 1: 87-91, McRobert and McConkey. Mol Biochem Parasitol.

2002 Feb;119(2):273-8, Mohmmed et al. Biochem Biophys Res Commun.2002 Feb; 119 (2): 273-8, Mohmmed et al. Biochem Biophys Res Commun.

2003 Sep 26;309(3):506-11, Orjih et al. Am J Trop Med Hyg.2003 Sep 26; 309 (3): 506-11, Orjih et al. Am J Trop Med Hyg.

1980 May;29(3):343-7, Pombo et al. Lancet.1980 May; 29 (3): 343-7, Pombo et al. Lancet.

2002 Aug 24;360(9333):610-7, Triglia et al. Mol. Microbiol. 2000, 38:706-718. Ting et al. Nat. Med., 2008, 14 (9) : 954-958 Thathy and Ménard. Methods Mol Med. 2002;72:317-31.5 2002 Aug 24; 360 (9333): 610-7, Triglia et al. Mol. Microbiol. 2000, 38: 706-718. Ting et al. Nat. Med., 2008, 14 (9): 954-958 Thathy and Ménard. Methods Mol Med. 2002; 72: 317-31.5

Claims

REVENDICATIONS1. Live parasite belonging to the genus Plasmodium in which the function of the hmgb2 gene is inactivated for use in the prevention of malaria or neuropaludism in a mammal.

2. Parasite according to claim 1, wherein the parasite strain is selected from the group consisting of Plasmodium berghei, Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, Plasmodium malariae and Plasmodium knowlesi.

3. Parasite according to claim 1 or 2, wherein the strain of the parasite is selected from the group consisting of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale and Plasmodium malariae. 15

4. Parasite according to any one of claims 1 to 3, wherein the parasite in its wild form does not cause cerebral malaria.

5. Parasite according to any one of claims 1, 2 and 4, wherein the strain of the parasite is Plasmodium berghei NK65.

6. Parasite according to any one of claims 1 to 4, wherein the parasite strain is a strain of Plasmodium falciparum having lost its cytoadherence capacity. 25

7. Parasite according to any one of claims 1 to 6, wherein the parasite is in an intra-erythrocyte form.

8. Parasite according to any one of claims 1 to 6, wherein the parasite is in the form of sporozoites.

An immunogenic composition comprising, as an immunogen, an immunologically effective amount of a parasite as defined in any one of Claims 1 to 8, and one or more pharmaceutically acceptable excipients or carriers.

10. A malaria vaccine comprising, as an immunogen, a parasite as defined in any one of claims 1 to 8, and one or more pharmaceutically acceptable excipients or carriers.

The immunogenic composition of claim 9 or the vaccine of claim 10 further comprising one or more immunological adjuvants.

The immunogenic composition of claim 9 or 11 or the vaccine of claim 10 or 11, formulated for parenteral administration.

13. An immunogenic composition or vaccine according to claim 12, comprising between 10 'and 10 6 parasites as defined in claim 7, per unit dose.

14. immunogenic composition or vaccine according to claim 12, comprising between 103 and 10 'parasites as defined in claim 8, per unit dose. 20

15. Use of a parasite as defined in any one of claims 1 to 8, for the preparation of a vaccine composition against malaria or cerebral malaria. 10