FR2976811A1

FR2976811A1 - USE OF A HIGH ADCC ANTI-CD20 ANTIBODY FOR THE TREATMENT OF WALDENSTROM'S DISEASE

Info

Publication number: FR2976811A1
Application number: FR1101931A
Authority: FR
Inventors: Romeuf Christophe De; Beral Helene Merle; Garff Tavernier Stephanie Le; Veronique Leblond; Vincent Vieillard
Original assignee: Universite Pierre et Marie Curie Paris 6; LFB Biotechnologies SAS
Current assignee: Universite Pierre et Marie Curie Paris 6; LFB SA
Priority date: 2011-06-22
Filing date: 2011-06-22
Publication date: 2012-12-28
Also published as: WO2012175874A1; AR086738A1; TW201309728A

Abstract

La présente invention se rapporte à un anticorps monoclonal dirigé contre l'antigène CD20, ledit anticorps ayant une cytotoxicité à médiation cellulaire dépendant des anticorps (ADCC) et/ou une capacité à activer les cellules effectrices exprimant le FcγRIII accrues, et possédant une région Fc dont au moins 60% des oligosaccharides sont non fucosylés, pour son utilisation dans le traitement de la maladie de Waldenström.The present invention relates to a monoclonal antibody directed against the CD20 antigen, said antibody having antibody-dependent cell-mediated cytotoxicity (ADCC) and / or an ability to activate enhanced FcγRIII-expressing effector cells, and having an Fc region at least 60% of the oligosaccharides are non-fucosylated, for use in the treatment of Waldenström disease.

Description

UTILISATION D'UN ANTICORPS ANTI-CD20 A HAUTE ADCC POUR LE TRAITEMENT DE LA MALADIE DE WALDENSTROM USE OF A HIGH ADCC ANTI-CD20 ANTIBODY FOR THE TREATMENT OF WALDENSTROM'S DISEASE

Domaine technique La présente invention se rapporte à un anticorps monoclonal dirigé contre l'antigène CD20, pour son utilisation dans le traitement de la maladie de Waldenstrôm (également appelée « macroglobulinémie de Waldenstrôm »). TECHNICAL FIELD The present invention relates to a monoclonal antibody directed against the CD20 antigen, for its use in the treatment of Waldenstrom's disease (also called "Waldenstrom's macroglobulinemia").

La présente invention trouve ses applications dans le domaine médical, notamment dans le domaine de l'immunothérapie. Dans la description ci-dessous, les références entre crochets ([]) renvoient à la liste des références présentée après les exemples. The present invention has applications in the medical field, particularly in the field of immunotherapy. In the description below, references in brackets ([]) refer to the list of references after the examples.

Etat de la technique La macroglobulinémie de Waldenstrbm, ou maladie de Waldenstrém, est une maladie rare, avec une incidence de 3 nouveaux cas par million d'habitants et par an. Il s'agit d'une maladie d'évolution lente (indolente) qui touche essentiellement les personnes âgées, l'âge médian étant de 63 ans (Vijay A., Gertz M.A. 2007. Waldenstrôm macroglobulinemia. Blood. 109 (12): 5096-5103, [1]). Elle est exceptionnelle avant l'âge de 40 ans. La maladie de Waldenstrôm est caractérisée comme un lymphome lymphoplasmocytaire selon l'organisation mondiale de la santé (OMS) (Harris NL, Jaffe ES et ail. J Clin Oncol 1999 ;17. 3835-49, [2]) de la moelle et la présence dans le sérum d'une immunoglobuline monoclonale de type M (IgM). Elle se définie par une infiltration médullaire par des lymphoplasmocytes et une immunoglobuline monoclonale de type IgM qu'elle qu'en soit la concentration. Cliniquement, des patients présentent souvent une asthénie généralement liée à une anémie. Le syndrome tumoral peut être présent avec polyadénopathie et splénomégalie, des signes cliniques liés à l'hyperviscosité surviennent en général lorsque le taux d'IgM est important, supérieur à 30 g/I : céphalées, troubles visuels, épistaxis, manifestations neurologiques. La paraprotéine peut aussi avoir une activité de type auto anticorps et / ou cryoglobuline, résultant d'un phénotype auto-immun avec une activité cryoglobuline mixte qui peut s'observer jusqu'à 20% des cas. Des neuropathies surviennent chez une minorité de patients et peuvent être liées à l'activité anticorps de la paraprotéine IgM dirigée contre des antigènes de la gaine de myéline soit une glycoprotéine associée à la myéline (anticorps anti-MAG). D'autres symptômes liés à des dépôts d'IgM au niveau des tissus peuvent être observés : au niveau de la peau avec présence de papules et nodules, au niveau du glomérule rénal avec une protéinurie de l'intestin avec une diarrhée. Parfois, apparaît une amylose due à des dépôts de chaines légères en particulier dans le coeur et les reins. L'origine de la cellule tumorale pourrait être un lymphocyte B arrêté dans son processus de développement après son passage dans le centre germinatif, mais avant le stade de plasmocyte. II pourrait s'agir d'une cellule mémoire IgM+ et/ou IgM+, IgD+ qui présenterait un déficit dans le processus d'initiation du switch isotypique. Le suivi de la maladie est réalisé par l'électrophorèse des protéines. Lorsque le patient ne souffre d'aucun symptôme, une simple surveillance est instaurée. A l'opposé, un traitement est proposé si le patient présente les symptômes suivants : des ganglions ou une augmentation de la taille de la rate (splénomégalie), des signes d'auto-immunité, une cryoglobuline symptomatique, des complications liées à l'hyperviscosité du sang, des neuropathies. Les analogues des purines, comme la fludarabine, ont constitué une avancée majeure dans le traitement de ces hémopathies, principalement des formes réfractaires aux chimiothérapies standards (Leblond V et al., French Cooperative Group on Chronic Lymphocytic Leukemia and Macroglobulinemia. 2001. Multicenter, randomized comparative trial of fludarabine and the combination of cyclophosphamide-doxorubicin- prednisone in 92 patients with Waldenstrôm macroglobulinemia in first relapse or with primary refractory disease. Blood. 2001 98:2640-2644, [3]; Dimopoulos MA et al., (2009A). Update on treatment recommendations from the Fourth International Workshop on Waldenstrom's Macroglobulinemia. J. Clin. Oncol. 27: 120-126, [4]; Neparidze N, Dhodapkar MV. 2009. Waldenstrom's macroglobulinemia: Recent advances in biology and therapy. Clin. Adv. Hematol. Oncol. 7: 677-681, [5]; Treon SP. 2009. How 1 treat Waldenstrdm macroglobulinemia. Blood. 114: 2375-2385, [6]). Cependant, cette pathologie reste, à ce jour, incurable en dehors des allogreffes. Actuellement, le rituximab, anticorps dirigé contre l'antigène CD20, associé à la chimiothérapie, est recommandé en première intention (Treon 2009 [6], Dimopoulos MA, Kastritis E, Roussou M, Eleutherakis-Papaiakovou E, Migkou M, Gavriatopoulou M, Tassidou A, Terpos E. (2009B). Rituximabbased treatments in Waldenstrôm's macroglobulinemia. Clin. Lymphoma Myeloma. 9: 59-61, [7]). L'antigène CD20 est une protéine transmembranaire hydrophobe d'un poids moléculaire de 35-37 kDa présente à la surface des lymphocytes B matures (Valentine et al. (1987) Proc Natl Acad Sci U S A. 84 (22) : 8085-9 [8]; Valentine et al. (1989) J.Biol. Chem. 264 (19) : 11282-11287 [9]). Il est exprimé au cours du développement des lymphocytes B dès le stade pré-B précoce et ce jusqu'à la différenciation en plasmocyte, stade où cette expression disparaît. L'antigène CD20 est présent à la fois sur les lymphocytes B normaux et sur les cellules B malignes. Plus particulièrement, l'antigène CD20 est exprimé sur la plupart des lymphomes de phénotype B (80% des lymphomes) : il est exprimé par exemple sur plus de 90% des LNH de lymphocytes B. La fonction du CD20 n'est pas encore totalement élucidée, mais il pourrait agir comme un canal calcique et intervenir dans la régulation des premières étapes de la différenciation (Golay et al. (1985) J. Immunol.; 135(6) :3795-801 [10]) et de la prolifération des lymphocytes B (Tedder et al. (1986) Sur J. Immunol . 1986 Aug;16(8) :881-7 [1 1]). Ainsi, bien qu'il subsiste des incertitudes quant à son rôle dans l'activation et la prolifération des lymphocytes B, l'antigène CD20 est, de par sa localisation, une cible importante pour le traitement des pathologies impliquant des lymphocytes B tumoraux, comme par exemple les LNH ou la LLC-B (leucémie lymphoïde chronique B) par des anticorps reconnaissant spécifiquement le CD20. De plus, cet antigène est une cible idéale en immunothérapie car il s'agit d'une protéine membranaire pour laquelle on ne connaît pas de modulation d'expression ou de polymorphisme. STATE OF THE ART Waldenstrbm's macroglobulinemia, or Waldenstrem's disease, is a rare disease, with an incidence of 3 new cases per million inhabitants per year. It is a slow-onset (indolent) disease that primarily affects the elderly, with a median age of 63 years (Vijay A., Gertz MA, 2007. Waldenstrom macroglobulinemia, Blood 109 (12): 5096 -5103, [1]). She is exceptional before the age of 40 years. Waldenstrom's disease is characterized as a lymphoplasmocytic lymphoma according to the World Health Organization (WHO) (Harris NL, Jaffe ES et al., J Clin Oncol 1999, 17, 3835-49, [2]) of the marrow and the presence in the serum of a monoclonal immunoglobulin type M (IgM). It is defined by medullary infiltration by lymphoplasmocytes and IgM monoclonal immunoglobulin, regardless of its concentration. Clinically, patients often have asthenia usually associated with anemia. The tumor syndrome may be present with polyadenopathy and splenomegaly, clinical signs related to hyperviscosity generally occur when the IgM is high, greater than 30 g / I: headache, visual disturbances, epistaxis, neurological manifestations. Paraprotein may also have an autoantibody and / or cryoglobulin-like activity resulting from an autoimmune phenotype with mixed cryoglobulin activity that can be observed up to 20% of cases. Neuropathies occur in a minority of patients and may be related to the antibody activity of the IgM paraprotein directed against antigens of the myelin sheath or a myelin-associated glycoprotein (anti-MAG antibody). Other symptoms related to IgM deposition in the tissues can be observed: in the skin with presence of papules and nodules, in the renal glomerulus with proteinuria of the intestine with diarrhea. Sometimes, amyloidosis occurs due to light chain deposits especially in the heart and kidneys. The origin of the tumor cell could be arrested B cell in its development process after its passage in the germinal center, but before the plasmocyte stage. It could be an IgM + and / or IgM +, IgD + memory cell which would have a deficit in the process of initiation of the isotypic switch. Monitoring of the disease is done by electrophoresis of proteins. When the patient does not have any symptoms, a simple surveillance is instituted. In contrast, a treatment is proposed if the patient has the following symptoms: lymph nodes or an increase in the size of the spleen (splenomegaly), signs of autoimmunity, symptomatic cryoglobulin, complications related to hyperviscosity of blood, neuropathies. Purine analogues, such as fludarabine, have been a major breakthrough in the treatment of these hematologic diseases, mainly forms refractory to standard chemotherapy (Leblond V et al., French Cooperative Group on Chronic Lymphocytic Leukemia and Macroglobulinemia, 2001. Multicenter, randomized comparative trial of fludarabine and the combination of cyclophosphamide-doxorubicin-prednisone in 92 patients with Waldenstrom macroglobulinemia in first relapse or with primary refractory disease, Blood, 2001 98: 2640-2644, [3] and Dimopoulos MA et al., (2009A) Fourth International Workshop on Waldenstrom's Macroglobulinemia, J. Clin., Oncol., 27: 120-126, [4], Neparidze N, Dhodapkar MV, 2009. Waldenstrom's Macroglobulinemia: Recent Advances in Biology and Therapy, Clin. Adv, Hematol, Oncol, 7: 677-681, [5], Treon SP, 2009. How 1 treat Waldenstrm macroglobulinemia, Blood 114: 2375-2385, [6]). However, this pathology remains, to date, incurable outside allografts. Currently, rituximab, an antibody directed against the CD20 antigen, associated with chemotherapy, is recommended as first-line therapy (Treon 2009 [6], Dimopoulos MA, Kastritis E, Roussou M, Eleutherakis-Papaiakovou E, Migkou M, Gavriatopoulou M, Tassidou A, Terpos E. (2009B) Rituximabbased treatments in Waldenstrom's macroglobulinemia, Clin Lymphoma Myeloma, 9: 59-61, [7]). The CD20 antigen is a hydrophobic transmembrane protein of 35-37 kDa molecular weight present on the surface of mature B cells (Valentine et al (1987) Proc Natl Acad Sci US A. 84 (22): 8085-9 [8] Valentine et al (1989) J. Biol Chem 264 (19): 11282-11287 [9]). It is expressed during the development of B lymphocytes from the early pre-B stage to differentiation into a plasmocyte, a stage in which this expression disappears. The CD20 antigen is present on both normal B cells and malignant B cells. More particularly, the CD20 antigen is expressed on most B-cell lymphomas (80% of lymphomas): it is expressed for example on more than 90% of B-lymphocyte NHL. The function of CD20 is not yet fully known. elucidated, but it could act as a calcium channel and intervene in the regulation of the first stages of differentiation (Golay et al (1985) J. Immunol .; 135 (6): 3795-801 [10]) and proliferation B lymphocytes (Tedder et al (1986) J. Immunol 1986 Aug; 16 (8): 881-7 [11]). Thus, although there is still uncertainty as to its role in the activation and proliferation of B lymphocytes, the CD20 antigen is, by its location, an important target for the treatment of pathologies involving tumor B cells, such as for example, NHL or B-CLL (chronic lymphocytic leukemia B) with antibodies specifically recognizing CD20. In addition, this antigen is an ideal target in immunotherapy because it is a membrane protein for which no modulation of expression or polymorphism is known.

Dans le cadre du traitement de la maladie de Waldenstrdm, l'utilisation de rituximab en monothérapie donne une réponse insuffisante (environ 35% de réponse, Gertz MA et al. Multicenter phase 2 trial of rituximab for Waldenstrdm macroglobulinemia (WM): an Eastern Cooperative Oncology Group Study (E3A98). Leuk Lymphoma. 45(10):2047-55, [12]). 1 o Par ailleurs, il est à noter que très peu d'études ont été réalisées sur les cellules NK (natural killer) de patients atteints de la maladie de Waldenstrdm. Jusqu'à présent, les 3 études publiées montrent des résultats contradictoires. Dans un cas de macroglobulinémie familiale, les cellules NK ont été trouvées fonctionnellement normales (Ogmundsdottir HM et al., 1995. Familial 15 macroglobulinaemia: hyperactive B-cells but normal natural killer function. Scand. J. Immunol. 40: 195-200, [13]), alors que chez d'autres patients atteints de gammapathies monoclonales associées à des polyneuropathies, la proportion de cellules NK est fortement diminuée (Vrethem M, Dahle C, Ekerfeldt C, Nilsson J, Ekstedt B, Ernerudh J. 1994. Abnormalities in T- 20 lymphocyte populations in blood from patients with demyelinating polyneuropathy associated with monoclonal gammopathy. J. Neurol. Sci. 122: 171-178, [14]). Une étude plus récente a montré une expansion et une activation des cellules NK chez des patients atteints de la maladie de Waldenstrdm après traitement par la thalidomide (Zeldis JB et al., 2003. 25 Potential new therapeutics for Waldenstrom's macroglobulinemia. Semin. Oncol. 30: 275-281, [15]). Cependant ces différentes études ne rendent pas compte de l'ensemble des caractéristiques phénotypiques et fonctionnelles des cellules NK au cours de cette maladie, ni de leurs impacts dans une immunothérapie par anticorps monoclonaux. 30 Il existe donc un réel besoin d'un outil thérapeutique palliant ces inconvénients et obstacles quant au traitement de la maladie de Waldenstrôm (appelée ci-après « MW »). In the treatment of Waldenstrdm disease, the use of rituximab monotherapy results in an insufficient response (approximately 35% response, Gertz MA et al., Multicenter phase 2 trial of rituximab for Waldenstrdm macroglobulinemia (WM): an Eastern Cooperative Oncology Group Study (E3A98) Leuk Lymphoma 45 (10): 2047-55, [12]). 1 o Furthermore, it should be noted that very few studies have been carried out on the NK (natural killer) cells of patients with Waldenstrdm disease. So far, the 3 published studies show contradictory results. In a case of familial macroglobulinaemia, NK cells were found to be functionally normal (Ogmundsdottir HM et al., 1995. Familial Macroglobulinaemia: Overactive B-cells normal purpose natural killer function, Scand J. Immunol 40: 195-200, [13]), whereas in other patients with monoclonal gammopathies associated with polyneuropathies, the proportion of NK cells is greatly diminished (Vrethem M, Dahle C, Ekerfeldt C, Nilsson J, Ekstedt B, Ernerudh J. 1994. Abnormalities in T-lymphocyte populations in patients with demyelinating polyneuropathy associated with monoclonal gammopathy, J. Neurol Sci 122: 171-178, [14]). A more recent study has shown NK cell expansion and activation in patients with Waldenstrdm disease after thalidomide treatment (Zeldis JB et al., 2003). Potential New Therapeutics for Waldenstrom's Macroglobulinemia. : 275-281, [15]). However, these different studies do not account for all the phenotypic and functional characteristics of NK cells during this disease, or their impact in monoclonal antibody immunotherapy. There is therefore a real need for a therapeutic tool overcoming these disadvantages and obstacles as regards the treatment of Waldenstrom's disease (hereinafter referred to as "MW").

Description de l'invention D'importantes recherches effectuées par la Demanderesse lui permettent maintenant de fournir des outils de traitement d'immunothérapie par anticorps dirigé contre l'antigène CD20 optimisé pour les patients atteints de la maladie de Waldenstrém. Description of the Invention Important research by the Applicant now enables it to provide anti-CD20 antigen-based antibody immunotherapy treatment tools optimized for patients with Waldenstrem's disease.

Avantageusement, les outils de traitement de l'invention peuvent présenter une plus faible myélotoxicité que les chimiothérapies standards. Un premier objet de l'invention se rapporte ainsi à un anticorps monoclonal dirigé contre l'antigène CD20, cet anticorps ayant une cytotoxicité à médiation cellulaire dépendant des anticorps (ADCC) et/ou une capacité à activer les cellules effectrices exprimant le FcyRlll accrues, et possédant une région Fc dont au moins 60% des oligosaccharides sont non fucosylés, pour son utilisation dans le traitement de la maladie de Waldenstn5m. L'anticorps peut par exemple posséder au moins 70%, ou au moins 80%, ou au moins 90%, ou même 100% d'oligosaccharides non fucosylés. Alternativement, la teneur en fucose peut être comprise entre 20% et 45% ou encore entre 25% et 40%. Aux fins de l'invention, les expressions " anticorps monoclonal " ou " composition d'anticorps monoclonal " sont équivalentes et se réfèrent à une préparation de molécules d'anticorps possédant une spécificité identique et unique. On entend par « anticorps », au sens de la présente invention, toute immunoglobuline constituée d'au moins une chaîne lourde et d'au moins une chaîne légère, liées entre elles par des ponts disulfures. Chaque chaîne est constituée, en position N- terminale, d'une région (ou domaine) variable (codée par les gènes réarrangés V-J pour les chaînes légères et V-D- J pour les chaînes lourdes) spécifique de l'antigène contre lequel l'anticorps est dirigé, et en position C- terminale, d'une région constante, constituée d'un seul domaine CL pour les chaînes légères ou de plusieurs domaines pour les chaînes lourdes. L'anticorps selon l'invention peut être un anticorps chimérique, c'est-à- dire un anticorps dont les régions variables des chaînes légères et lourdes appartiennent à une espèce différente des régions constantes des chaînes légères et des chaînes lourdes. Alternativement, l'anticorps selon l'invention peut être un anticorps humanisé, c'est-à-dire un anticorps humain ayant des parties hypervariables d'un anticorps d'une autre espèce, et présentant une meilleure tolérance par l'organisme humain et une demi-vie plus longue. Alternativement, l'anticorps selon l'invention peut être un anticorps humain. L'anticorps utilisé dans l'invention peut donc posséder en outre des régions constantes de ses chaînes légères et lourdes appartenant à une espèce non-murine. A cet égard, toutes les familles et espèces de mammifères non-murins sont susceptibles d'être utilisées, et en particulier l'homme, le singe, les muridés (sauf la souris), les suidés, les bovidés, les équidés, les félidés, les canidés, par exemple, ainsi que les oiseaux. Les anticorps utilisés dans l'invention peuvent être construits en utilisant les techniques standard de l'ADN recombinant, bien connues de l'homme du métier, et plus particulièrement en utilisant les techniques de construction des anticorps " chimériques " décrites par exemple dans Morrison et al., Proc. Natl . Acad. Sci . U.S.A., 81, pp. 6851-55 (1984) [30], où la technologie de l'ADN recombinant est utilisée pour remplacer la région constante d'une chaîne lourde et/ou la région constante d'une chaîne légère d'un anticorps provenant d'un mammifère non-humain avec les régions correspondantes d'une immunoglobuline humaine. Un mode de réalisation particulier sera illustré plus loin. On entend par « dirigé contre l'antigène CD20 », au sens de la présente invention, la capacité de l'anticorps monoclonal à lier tout ou partie de l'antigène CD20. On entend par « accrue », au sens de la présente invention, une cytotoxicité à médiation cellulaire dépendant des anticorps (ADCC) et/ou une capacité à activer les cellules effectrices exprimant le FcyRlll, supérieure(s) à celle du même anticorps possédant une région Fc dont moins de 60% (non inclus) des oligosaccharides sont non fucosylés, ou supérieure(s) à celle du rituximab. L'ADCC et/ou la capacité à activer les cellules effectrices exprimant le FcyRlll peu(ven)t être supérieure(s) à au moins 50%, ou supérieure(s) à au moins 60%, ou à au moins 70%, ou 80%, ou 90% par rapport à celle du même anticorps ne possédant une région Fc dont moins de 60% (non inclus) des oligosaccharides sont non fucosylés ou à celle du rituximab. Advantageously, the treatment tools of the invention may have a lower myelotoxicity than standard chemotherapies. A first subject of the invention thus relates to a monoclonal antibody directed against the CD20 antigen, this antibody having an antibody-dependent cell-mediated cytotoxicity (ADCC) and / or an ability to activate the effector cells expressing the increased FcyRlll, and having an Fc region of which at least 60% of the oligosaccharides are non-fucosylated for use in the treatment of Waldenstn5m disease. The antibody may for example have at least 70%, or at least 80%, or at least 90%, or even 100% non-fucosylated oligosaccharides. Alternatively, the fucose content may be between 20% and 45% or between 25% and 40%. For purposes of the invention, the terms "monoclonal antibody" or "monoclonal antibody composition" are equivalent and refer to a preparation of antibody molecules having identical and unique specificity. For the purposes of the present invention, the term "antibody" means any immunoglobulin consisting of at least one heavy chain and at least one light chain, linked together by disulfide bridges. Each chain is constituted, in the N-terminal position, of a variable region (or domain) (encoded by the rearranged genes VJ for the light chains and VD-J for the heavy chains) specific for the antigen against which the antibody is directed, and in the C-terminal position, of a constant region consisting of a single CL domain for the light chains or of several domains for the heavy chains. The antibody according to the invention may be a chimeric antibody, that is to say an antibody whose light and heavy chain variable regions belong to a species different from the constant regions of the light and heavy chains. Alternatively, the antibody according to the invention may be a humanized antibody, that is to say a human antibody having hypervariable parts of an antibody of another species, and having a better tolerance by the human organism and a longer half-life. Alternatively, the antibody according to the invention may be a human antibody. The antibody used in the invention may therefore additionally have constant regions of its light and heavy chains belonging to a non-murine species. In this respect, all families and species of non-murine mammals are likely to be used, and in particular humans, monkeys, murids (except the mouse), suids, cattle, equines, felids , canids, for example, and birds. The antibodies used in the invention can be constructed using standard techniques of recombinant DNA, which are well known to those skilled in the art, and more particularly by using the "chimeric" antibody construction techniques described for example in Morrison et al. al., Proc. Natl. Acad. Sci. U.S.A., 81, pp. 6851-55 (1984) [30], wherein the recombinant DNA technology is used to replace the constant region of a heavy chain and / or the constant region of an antibody light chain from a mammal non-human with the corresponding regions of a human immunoglobulin. A particular embodiment will be illustrated below. For the purposes of the present invention, the term "directed against the CD20 antigen" is intended to mean the capacity of the monoclonal antibody to bind all or part of the CD20 antigen. For the purposes of the present invention, the term "increased" is intended to mean antibody-dependent cell-mediated cytotoxicity (ADCC) and / or an ability to activate FcγRIII-expressing effector cells greater than that of the same antibody possessing a specific antibody. Fc region of which less than 60% (not included) oligosaccharides are non-fucosylated, or greater than that of rituximab. ADCC and / or the ability to activate effector cells expressing FcγRlll may be greater than or equal to at least 50%, greater than or equal to at least 60%, or at least 70%, or 80%, or 90% compared to that of the same antibody having an Fc region of which less than 60% (not included) oligosaccharides are non-fucosylated or that of rituximab.

On entend par « même anticorps », au sens de la présente invention, un anticorps dont les séquences primaires sont identiques à celles de l'anticorps de l'invention. Par exemple, l'ADCC peut être quantifiée sur la base de l'EC50 (demi de concentration efficace maximale) de l'anticorps. Par exemple, l'EC50 peut être telle que la quantité du même anticorps possédant une région Fc dont moins de 60% des oligosaccharides sont non fucosylés, ou de rituximab, requise pour atteindre 50% de la lyse maximale observée avec l'anticorps de l'invention est au moins 2 fois supérieure, ou au moins 5 fois supérieure, ou au moins 10 fois supérieure, à celle de l'anticorps de l'invention. For the purposes of the present invention, the term "same antibody" means an antibody whose primary sequences are identical to those of the antibody of the invention. For example, ADCC can be quantified based on the EC50 (half maximum effective concentration) of the antibody. For example, the EC50 may be such that the amount of the same antibody having an Fc region of which less than 60% of the oligosaccharides are non-fucosylated, or of rituximab, required to achieve 50% of the maximum lysis observed with the antibody of The invention is at least 2-fold greater, or at least 5-fold, or at least 10-fold greater than that of the antibody of the invention.

On entend par « EC50 », au sens de la présente invention, la quantité d'anticorps requise pour atteindre 50% de la lyse maximale. La mesure de l'EC50 peut être réalisée au moyen de toute technique connue de l'homme du métier, par exemple (Shi J, Orth JD, Mitchison T, Cell type variation in responses to antimitotic drugs that target microtubules and kinesin-5 Cancer Res. 2008 May 1;68(9):3269-76 [29]) Le même anticorps dont moins de 60% des oligosaccharides sont non fucosylés peut être produit par une lignée CHO, par exemple la lignée CHO DG44. Dans un mode de réalisation particulier, l'anticorps utilisé dans l'invention peut comprendre en outre une quantité d'oligosaccharides complexes présentant une bissection augmentée par modification de la glycosylation. For the purposes of the present invention, the term "EC50" refers to the amount of antibody required to reach 50% of the maximum lysis. The measurement of EC50 can be carried out using any technique known to those skilled in the art, for example (Shi J, Orth JD, Mitchison T, Cell type variation in responses to antimitotic drugs that target microtubules and kinesin-5 Cancer Res., 2008 May 1; 68 (9): 3269-76 [29]) The same antibody of which less than 60% of the oligosaccharides are non-fucosylated can be produced by a CHO line, for example the CHO DG44 line. In a particular embodiment, the antibody used in the invention may further comprise an amount of complex oligosaccharides having increased bisection by modification of glycosylation.

On entend par « bissection », au sens de la présente invention, tout résidu N-acétylglucosamine intercalaire greffé en [31,4, notamment par action de la GNTIII. Dans ce mode de réalisation, l'anticorps peut comprendre en outre au moins 20%, par exemple au moins 30%, ou au moins 40%, ou encore au moins 500/0, 60%, 70% d'oligosaccharides présentant une bissection et non fucosylés. Dans ce mode de réalisation, des méthodes pour produire l'anticorps connues de l'homme du métier peuvent être utilisées, comme par exemples les méthodes décrites dans les documents WO9954342, EP1692182, WO2004065540, US6602684, cette liste n'étant pas limitative, des méthodes pour produire des anticorps comprenant au moins un domaine Fc d'une immunoglobuline et ayant des résidus N-acétylglycosamine intercalaires (GlcNac intercalaire) comme par exemple les méthodes décrites dans les documents EP 1 071 700 et US 2005/123546, cette liste n'étant pas limitative. Par exemple, l'anticorps peut être produit dans une cellule hôte exprimant au moins un acide nucléique codant pour un polypeptide ayant une activité de R-(1,4)-N-acétylglucosaminyltransférase 111 en une quantité suffisante pour modifier la glycosylation de la région Fc dudit anticorps. For the purposes of the present invention, the term "bisection" means any intermediate N-acetylglucosamine residue grafted at [31.4, in particular by action of GNTIII. In this embodiment, the antibody may further comprise at least 20%, for example at least 30%, or at least 40%, or at least 500/0, 60%, 70% oligosaccharides having a bisection. and not fucosylated. In this embodiment, methods for producing the antibody known to those skilled in the art can be used, for example the methods described in the documents WO9954342, EP1692182, WO2004065540, US6602684, this list not being limiting, methods for producing antibodies comprising at least one Fc domain of an immunoglobulin and having intermediate N-acetylglycosamine residues (GlcNac intermediate) such as the methods described in EP 1 071 700 and US 2005/123546, this list n ' being not limiting. For example, the antibody may be produced in a host cell expressing at least one nucleic acid encoding a polypeptide having R- (1,4) -N-acetylglucosaminyltransferase 111 activity in an amount sufficient to modify the glycosylation of the region Fc of said antibody.

Dans un autre mode de réalisation, l'anticorps utilisé dans l'invention peut présenter une faible fucosylation, c'est-à-dire des structures glycanniques ayant une teneur en fucose inférieure à 65%. Dans un autre mode de réalisation, l'anticorps utilisé dans l'invention peut présenter une faible fucosylation, c'est-à-dire des structures glycanniques ayant une teneur inférieure à 500/0 de formes GOF+G1 F. Par exemple, l'anticorps peut comprendre en outre une teneur supérieure à 60% pour les formes GO+G1+GOF+G1 F, les formes GOF +G1 F étant inférieures à 50%. Dans un autre mode de réalisation particulier, les anticorps peuvent comprendre une teneur supérieure à 60% pour les formes GO+G1+GOF+G1F, la teneur en fucose étant inférieures à 65%.Ces formes sont plus particulièrement sélectionnés parmi les formes : GO, GOF et 017, GIi Ac Dans cet autre mode de réalisation, l'anticorps peut comprendre en outre, sur un site de glycosylation Asn297, une structure glycannique présentant des mannoses terminaux et/ou des N-acétylglucosamines terminaux non intercalaires. L'anticorps peut comprendre, sur le site de glycosylation Asn297, une structure glycannique de type biantenné, avec des chaînes courtes, une faible sialylation, et une teneur supérieure à 60% pour les formes GO+G1 +GOF+G1 F, les formes GOF +G1 F étant inférieures à 50%. Par exemple, la composition d'anticorps peut posséder une teneur en acide sialique inférieure à 25%, 20%, 15%, ou 10%, de préférence 5%, 4% 3% ou 2%. La composition d'anticorps peut comprendre une teneur supérieure à 60%, de préférence supérieure à 80% pour les formes GO + G1 + GOF + G1 F étant entendu que les formes GOF + G1 F sont inférieure à 50%, de préférence inférieure à 30%. La composition d'anticorps peut comprendre des structures glycanniques de type biantennées, avec des chaînes courtes, une faible sialylation, des mannoses et des N-acétylglucosamines du point d'attache terminaux non intercalaires, les structures glycanniques ayant une teneur supérieure à 60% pour les formes GO + G1 + GOF + G1 F, et une faible fucocylation, les structures glycanniques ayant une teneur inférieure à 50% de formes GOF + G1 F. In another embodiment, the antibody used in the invention may exhibit low fucosylation, i.e., glycan structures having a fucose content of less than 65%. In another embodiment, the antibody used in the invention may exhibit low fucosylation, i.e., glycan structures having a content of less than 500% of GOF + G1F forms. The antibody may also comprise a content greater than 60% for the GO + G1 + GOF + G1 F forms, the GOF + G1 F forms being less than 50%. In another particular embodiment, the antibodies may comprise a content greater than 60% for the forms GO + G1 + GOF + G1F, the fucose content being less than 65% .These forms are more particularly selected from the forms: In this alternative embodiment, the antibody may further comprise, on an Asn297 glycosylation site, a glycan structure having terminal mannoses and / or non-intermediate terminal N-acetylglucosamines. The antibody may comprise, on the glycosylation site Asn297, a glycan structure of biantenné type, with short chains, a weak sialylation, and a content greater than 60% for the forms GO + G1 + GOF + G1 F, the forms GOF + G1 F being less than 50%. For example, the antibody composition may have a sialic acid content of less than 25%, 20%, 15%, or 10%, preferably 5%, 4%, 3%, or 2%. The antibody composition may comprise a content greater than 60%, preferably greater than 80% for the forms GO + G 1 + GOF + G 1 F, it being understood that the GOF + G 1 F forms are less than 50%, preferably less than 50%, 30%. The antibody composition may comprise glycan structures of biantennate type, with short chains, low sialylation, mannoses and N-acetylglucosamines of the non-intermediate end point of attachment, the glycan structures having a content greater than 60% for forms GO + G1 + GOF + G1 F, and low fucocylation, the glycan structures having a content of less than 50% of forms GOF + G1 F.

Dans un mode de réalisation particulier, l'anticorps utilisé dans l'invention peut présenter des structures glycaniques telles que décrites dans le document WO 01/77181. L'anticorps monoclonal peut être préparé comme cela est décrit dans le document WO 2006/064121 (LFB), ou dans le document WO 01/77181 (LFB), par sélection de lignées cellulaires permettant de produire des anticorps présentant une forte activité ADCC du type FcyRlll (CD 16), c'est-à-dire une forte affinité pour le récepteur CD16 des cellules effectrices du système immunitaire. Par exemple, l'anticorps peut être produit dans un hybridome, notamment un hétérohybridome obtenu avec le partenaire de fusion K6H6-B5 (ATCC CRL 1823) ou dans une cellule animale ou humaine transfectée à l'aide d'un vecteur comportant le gène codant pour ledit anticorps, notamment une cellule dérivée des lignées Vero (ATCC CCL-81), une lignée cellulaire d'hybridome de rat, comme par exemple la lignée d'hybridome de rat YB2/0 (ATCC CRL-1662, cellule YB2/3HL.P2.G11.16Ag.20, déposée à l'American Type Culture Collection) ou encore la lignée CHO Lec-1 (ATCC CRL-1735), CHO-Lec10, CHO dhfr- (par exemple CHO DX BII, CHO DG44) , CHO Lec13 , SP2/0, NSO, 293, BHK, COS, IR983F, un myélome humain comme Namalwa ou toute autre cellule d'origine humaine comme PERCE, CHO Pro-5, CHO dhfr- (CHO DX BII, CHO DG44), Wil-2, Jurkat, Vero, Molt-4, COS-7, 293- HEK, BHK, K6H6, NSO, SP2/0-Ag 14 et P3X63Ag8.653. Avantageusement, l'anticorps peut être produit dans une lignée cellulaire choisie parmi YB2/0, Vero, CHO-Iec10, CHO-1ec13, CHO-lec1, CHOK1SV Potelligent® (Lonza, Suisse), CHOGnTIII (Glycart, Suisse). L'anticorps peut être également produit dans une lignée cellulaire EB66 (Vivalis) De manière particulièrement avantageuse, l'anticorps utilisé dans l'invention est produit par une lignée cellulaire d'hybridome de rat. La lignée productrice de l'anticorps est une caractéristique importante puisqu'elle confère à l'anticorps certaines de ses propriétés particulières. En effet, le moyen d'expression des anticorps est à l'origine des modifications post- traductionnelles, notamment des modifications de la glycosylation, qui peuvent varier d'une lignée cellulaire à l'autre, et ainsi conférer des propriétés fonctionnelles différentes à des anticorps ayant pourtant des structures primaires identiques. In a particular embodiment, the antibody used in the invention may have glycanic structures as described in WO 01/77181. The monoclonal antibody can be prepared as described in WO 2006/064121 (LFB), or in WO 01/77181 (LFB), by selection of cell lines for producing antibodies having a high ADCC activity of type FcγR111 (CD16), i.e., a strong affinity for the CD16 receptor of effector cells of the immune system. For example, the antibody can be produced in a hybridoma, in particular a hetero-hybridoma obtained with the fusion partner K6H6-B5 (ATCC CRL 1823) or in an animal or human cell transfected with a vector comprising the coding gene. for said antibody, in particular a cell derived from Vero lines (ATCC CCL-81), a rat hybridoma cell line, for example the YB2 / 0 rat hybridoma line (ATCC CRL-1662, YB2 / 3HL cell). .P2.G11.16Ag.20, deposited at the American Type Culture Collection) or the CHO Lec-1 line (ATCC CRL-1735), CHO-Lec10, CHO dhfr- (for example CHO DX BII, CHO DG44). , CHO Lec13, SP2 / 0, NSO, 293, BHK, COS, IR983F, a human myeloma such as Namalwa or any other cell of human origin such as PERCE, CHO Pro-5, CHO dhfr- (CHO DX BII, CHO DG44) , Wil-2, Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, K6H6, NSO, SP2 / O-Ag 14 and P3X63Ag8.653. Advantageously, the antibody may be produced in a cell line chosen from YB2 / 0, Vero, CHO-Iec10, CHO-1ec13, CHO-lec1, CHOK1SV Potelligent® (Lonza, Switzerland), CHOGnTIII (Glycart, Switzerland). The antibody can also be produced in an EB66 (Vivalis) cell line. Particularly advantageously, the antibody used in the invention is produced by a rat hybridoma cell line. The antibody producing line is an important feature since it confers on the antibody some of its particular properties. In fact, the means of expression of the antibodies is at the origin of the post-translational modifications, in particular modifications of the glycosylation, which can vary from one cell line to another, and thus confer different functional properties on antibodies having identical primary structures.

Dans un mode de réalisation préféré, l'anticorps est produit dans l'hybridome de rat YB2/0 (cellule YB213HL.P2.G11.16Ag.20, déposée à l'American Type Culture Collection sous le numéro ATCC CRL-1662). Cette lignée a été choisie en raison de sa capacité à produire des anticorps présentant une activité ADCC améliorée par rapport à des anticorps de l0 même structure primaire produits par exemple dans CHO. D'autres méthodes sont connues de l'homme du métier pour produire des anticorps faiblement fucosylés, et peuvent être utilisées pour la préparation de l'anticorps de l'invention. Il peut s'agir par exemple de méthodes de préparation d'anticorps dans des cellules cultivées en présence 15 de kifunensine, comme cela est décrit par exemple dans le document US7700321. Des analogues de fucose peuvent également être introduits dans le milieu de culture de cellules productrices d'anticorps comme décrit dans le document US 20090317869. 20 Un autre moyen de produire des anticorps, peut être l'utilisation, par exemple de cellules pour lesquelles la voie de production des GDP-fucose est inhibée, par exemple par inhibition de l'une au moins des enzymes du cycle de production fucose, telle que décrit par exemple dans le document US 2010291628 ou US 20090228994, le document EP 1 500 698, le 25 document EP 1 792 987 ou encore le document US 7 846 725, cette liste n'étant pas limitative. Il est également possible d'utiliser des ARN interférent (ARNi) inhibant la 1,6-fucosyltransférase comme décrit dans le document US 7 393 683 ou le document WO2006133148. II peut également s'agir de méthodes de préparation d'anticorps dans 30 des animaux transgéniques, comme cela est décrit dans le document WO200748077. Il peut également s'agir de méthodes de préparation d'anticorps dans des levures, comme cela est décrit par exemple dans le document WO 0200879 . Dans le cas où la région Fc de l'anticorps possède 100% d'oligosaccharides non fucosylés, c'est-à-dire quand la région Fc de l'anticorps est totalement dépourvue de fucose, il est possible d'utiliser des méthodes de préparation connues de l'homme du métier, comme par exemple celles décrites dans les documents EP1176195, US 7 214 775, US 6 994 292 , US 7 425 449, US2010223686, WO2007099988, EP 1 705 251, cette liste n'étant pas limitative. II peut s'agir par exemple d'une méthode utilisant une cellule hôte exprimant au moins un acide nucléique codant pour l'anticorps de l'invention, et dont la glycosylation est modifiée par délétion du gène codant pour l'a1,6- fucosyltransférase ou par addition d'une mutation de ce gène pour éliminer l'activité a1,6- fucosyltransférase, et exprimant à ce titre un anticorps dépourvu de fucose. Il peut également s'agir d'une méthode comprenant la mutation des acides aminés de la partie Fc. L'anticorps peut être un anticorps monoclonal dirigé contre l'antigène CD20, dont la région variable de chacune des chaînes légères est codée par la séquence d'acides nucléiques murine SEQ ID NO : 1, dont la région variable de chacune des chaînes lourdes est codée par la séquence d'acides nucléiques murine SEQ ID NO : 2, et dont les régions constantes des chaînes légères et des chaînes lourdes proviennent d'une espèce non murine. Les séquences d'acide nucléique murines SEQ ID NO : 1 et SEQ ID NO : 2 codent pour le domaine variable de chacune des chaînes légères et le domaine variable de chacune des chaînes lourdes respectivement de l'anticorps produit par l'hybridome murin CAT-13.6E12, disponible à la Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) sous le numéro ACC 474. Cet hybridome produit un anticorps monoclonal murin de type IgG2a,x dirigé contre le CD20. In a preferred embodiment, the antibody is produced in the YB2 / 0 rat hybridoma (YB213HL.P2.G11.16Ag.20 cell, deposited at the American Type Culture Collection under number ATCC CRL-1662). This line was chosen because of its ability to produce antibodies with improved ADCC activity compared to antibodies of the same primary structure produced for example in CHO. Other methods are known to those skilled in the art for producing low fucosylated antibodies, and may be used for the preparation of the antibody of the invention. These may be, for example, methods for preparing antibodies in cells cultured in the presence of kifunensine, as described, for example, in US7700321. Fucose analogs may also be introduced into the antibody-producing cell culture medium as described in US 20090317869. Another means of producing antibodies may be the use of, for example, cells for which the The production of GDP-fucose is inhibited, for example by inhibition of at least one of the enzymes of the fucose production cycle, as described, for example, in US 2010291628 or US 20090228994, EP 1,500,698, EP 1 792 987 or US 7 846 725, this list is not limiting. It is also possible to use interfering RNA (RNAi) inhibiting 1,6-fucosyltransferase as described in US 7,393,683 or WO2006133148. They may also be methods for preparing antibodies in transgenic animals, as described in WO200748077. It may also be methods for preparing antibodies in yeasts, as described for example in WO 0200879. In the case where the Fc region of the antibody has 100% non-fucosylated oligosaccharides, that is to say when the Fc region of the antibody is completely free of fucose, it is possible to use preparation known to those skilled in the art, such as those described in documents EP1176195, US 7,214,775, US 6,994,292, US 7,425,449, US2010223686, WO2007099988, EP 1 705 251, this list not being limiting. . It may be for example a method using a host cell expressing at least one nucleic acid encoding the antibody of the invention, and the glycosylation of which is modified by deletion of the gene coding for α1,6-fucosyltransferase. or by adding a mutation of this gene to remove α1,6-fucosyltransferase activity, and expressing as such an antibody free of fucose. It may also be a method comprising the amino acid mutation of the Fc portion. The antibody may be a monoclonal antibody directed against the CD20 antigen, whose variable region of each of the light chains is encoded by the murine nucleic acid sequence SEQ ID NO: 1, whose variable region of each of the heavy chains is encoded by the murine nucleic acid sequence SEQ ID NO: 2, and wherein the constant regions of the light and heavy chains are from a non-murine species. The murine nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 2 encode the variable domain of each of the light chains and the variable domain of each of the heavy chains respectively of the antibody produced by the mouse hybridoma. 13.6E12, available from the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) under the number ACC 474. This hybridoma produces a mouse monoclonal antibody of IgG2a type, x directed against CD20.

La séquence SEQ ID NO. 1 comporte néanmoins un acide nucléique qui diffère par rapport à la séquence codant pour la région variable de la chaîne légère de l'anticorps produit par l'hybridome murin CAT-13.6E12. The sequence SEQ ID NO. 1 nevertheless has a nucleic acid which differs from the sequence coding for the variable region of the light chain of the antibody produced by the murine hybridoma CAT-13.6E12.

Ces séquences murines ont été choisies pour dériver les séquences des régions variables des anticorps selon l'invention en raison de la spécificité de l'anticorps murin CAT-13.6E12 pour l'antigène CD20. Les régions variables des anticorps selon l'invention comportent au moins 70% d'identité avec les séquences SEQ ID NO : 1 et SEQ ID NO : 2 cette identité de séquences conférant une identité de spécificité des anticorps selon l'invention avec l'anticorps murin CAT-13.6E12. De préférence, cette identité de séquences confère également une identité d'affinité pour la cible entre l'anticorps selon l'invention et l'anticorps murin CAT-13.6E12. These murine sequences were chosen to derive the variable region sequences of the antibodies according to the invention because of the specificity of the murine antibody CAT-13.6E12 for the CD20 antigen. The variable regions of the antibodies according to the invention comprise at least 70% identity with the sequences SEQ ID NO: 1 and SEQ ID NO: 2, this identity of sequences conferring an identity of specificity of the antibodies according to the invention with the antibody murine CAT-13.6E12. Preferably, this sequence identity also confers an affinity identity for the target between the antibody according to the invention and the murine antibody CAT-13.6E12.

De manière avantageuse, la région variable de chacune des chaînes légères de l'anticorps utilisés dans l'invention est codée par une séquence possédant au moins 80% d'identité avec la séquence d'acide nucléique murine SEQ ID NO : 1, et la région variable de chacune des chaînes lourdes de l'anticorps selon l'invention est codée par une séquence possédant au moins 80% d'identité avec la séquence d'acide nucléique murine SEQ ID NO : 2. De manière avantageuse, la région variable de chacune des chaînes légères de l'anticorps selon l'invention est codée par une séquence possédant au moins 90% d'identité avec la séquence d'acide nucléique murine SEQ ID NO : 1, et la région variable de chacune des chaînes lourdes de l'anticorps selon l'invention est codée par une séquence possédant au moins 90% d'identité avec la séquence d'acide nucléique murine SEQ ID NO . 2. La région variable de chacune des chaînes légères de l'anticorps utilisés dans l'invention peut être codée par une séquence possédant au moins 95% d'identité avec la séquence d'acide nucléique murine SEQ ID NO : 1, et la région variable de chacune des chaînes lourdes de l'anticorps selon l'invention est codée par une séquence possédant au moins 950/0 d'identité avec la séquence d'acide nucléique murine SEQ ID NO : 2. De manière avantageuse, la région variable de chacune des chaînes légères de l'anticorps utilisées dans l'invention est codée par une séquence possédant au moins 99% d'identité avec la séquence d'acide nucléique murine SEQ ID NO : 1, et la région variable de chacune des chaînes lourdes de l'anticorps selon l'invention est codée par une séquence possédant au moins 99% d'identité avec la séquence d'acide nucléique murine SEQ ID NO : 2. Avantageusement, tout anticorps possédant des régions variables de leur chaînes lourdes et légères présentant une ou plusieurs substitution(s), insertion(s) ou délétion(s) d'un ou plusieurs acides nucléiques, ces modifications de séquences répondant aux pourcentages d'identités de séquences tels que définis ci-dessus, et n'altérant ni la spécificité de l'anticorps pour sa cible, ni son affinité pour sa cible, peut être utilisé aux fins de l'invention. Les anticorps utilisés dans l'invention s'entendent aussi de tout anticorps possédant les régions CDR (Complementary Determining Région) de l'anticorps CAT-13.6E12, associées à des régions FR (framework, régions très conservées des régions variables, nommées aussi "charpente"). De tels anticorps possèdent une affinité et une spécificité très comparables, de préférence identiques, à l'anticorps murin CAT-13.6E12. La région variable de chacune des chaînes légères de l'anticorps utilisé dans l'invention peut être codée par la séquence d'acide nucléique murine SEQ ID NO : 1, et la région variable de chacune des chaînes lourdes de l'anticorps selon l'invention est codée par la séquence d'acide nucléique murine SEQ ID NO : 2. Un anticorps utilisé, notamment comme médicament, dans l'invention peut donc être un anticorps monoclonal dirigé contre l'antigène CD20, dont la région variable de chacune des chaînes légères est codée par la séquence d'acide nucléique murine SEQ ID NO : 1, la région variable de chacune des chaînes lourdes est codée par la séquence d'acide nucléique murine SEQ ID NO : 2, et les régions constantes des chaînes légères et des chaînes lourdes sont des régions constantes provenant d'une espèce non-murine. Ainsi, par « dirigé contre l'antigène CD20 », on entend désigner la capacité de l'anticorps monoclonal à lier tout ou partie de l'antigène CD20, et notamment l'épitope reconnu par l'anticorps EMAB603, également appelé R603. Advantageously, the variable region of each of the light chains of the antibody used in the invention is coded by a sequence having at least 80% identity with the murine nucleic acid sequence SEQ ID NO: 1, and the variable region of each of the heavy chains of the antibody according to the invention is coded by a sequence having at least 80% identity with the murine nucleic acid sequence SEQ ID NO: 2. Advantageously, the variable region of each of the light chains of the antibody according to the invention is coded by a sequence having at least 90% identity with the murine nucleic acid sequence SEQ ID NO: 1, and the variable region of each of the heavy chains of the The antibody according to the invention is encoded by a sequence having at least 90% identity with the murine nucleic acid sequence SEQ ID NO. 2. The variable region of each of the light chains of the antibody used in the invention may be encoded by a sequence having at least 95% identity with the murine nucleic acid sequence SEQ ID NO: 1, and the region variable of each of the heavy chains of the antibody according to the invention is coded by a sequence having at least 950/0 identity with the murine nucleic acid sequence SEQ ID NO: 2. Advantageously, the variable region of each of the light chains of the antibody used in the invention is coded by a sequence having at least 99% identity with the murine nucleic acid sequence SEQ ID NO: 1, and the variable region of each of the heavy chains of the antibody according to the invention is coded by a sequence having at least 99% identity with the murine nucleic acid sequence SEQ ID NO: 2. Advantageously, any antibody having variable regions of their heavy and light chains with one or more substitution (s), insertion (s) or deletion (s) of one or more nucleic acids, these sequence modifications corresponding to the percentages of sequence identities as defined above, and not altering neither the specificity of the antibody for its target nor its affinity for its target can be used for the purposes of the invention. The antibodies used in the invention also include any antibody having the CDR (Complementary Determining Region) regions of the CAT-13.6E12 antibody, associated with FR regions (framework, highly conserved regions of the variable regions, also called " frame "). Such antibodies have a very comparable affinity and specificity, preferably identical, to the murine CAT-13.6E12 antibody. The variable region of each of the light chains of the antibody used in the invention may be encoded by the murine nucleic acid sequence SEQ ID NO: 1, and the variable region of each of the heavy chains of the antibody according to the invention. The invention is encoded by the murine nucleic acid sequence SEQ ID NO: 2. An antibody used, especially as a drug, in the invention may therefore be a monoclonal antibody directed against the CD20 antigen, the variable region of each of the chains being is coded by the murine nucleic acid sequence SEQ ID NO: 1, the variable region of each of the heavy chains is encoded by the murine nucleic acid sequence SEQ ID NO: 2, and the constant regions of the light chains and the Heavy chains are constant regions from a non-murine species. Thus, the term "directed against the CD20 antigen" is intended to denote the capacity of the monoclonal antibody to bind all or part of the CD20 antigen, and in particular the epitope recognized by the antibody EMAB603, also called R603.

Les régions constantes de chacune des chaînes légères et de chacune des chaînes lourdes de l'anticorps utilisés dans l'invention peuvent être des régions constantes humaines. Ce mode de réalisation préféré de l'invention permet de diminuer l'immunogénicité de l'anticorps chez l'homme et par là même d'améliorer son efficacité lors de son administration thérapeutique chez l'homme. Dans un mode de réalisation préféré de l'invention, la région constante de chacune des chaînes légères de l'anticorps selon l'invention est de type K. Tout allotype convient à la réalisation de l'invention, par exemple Km(1), Km(1, 2), Km(1, 2, 3) ou Km(3) mais l'allotype préféré est Km(3) . The constant regions of each of the light chains and each of the heavy chains of the antibody used in the invention may be human constant regions. This preferred embodiment of the invention makes it possible to reduce the immunogenicity of the antibody in humans and thereby improve its efficacy during its therapeutic administration in humans. In a preferred embodiment of the invention, the constant region of each of the light chains of the antibody according to the invention is of type K. Any allotype is suitable for carrying out the invention, for example Km (1), Km (1, 2), Km (1, 2, 3) or Km (3) but the preferred allotype is Km (3).

Alternativement, la région constante de chacune des chaînes légères de l'anticorps selon l'invention est de type a,. Dans un aspect particulier de l'invention, et notamment lorsque les régions constantes de chacune des chaînes légères et de chacune des chaînes lourdes de l'anticorps utilisés dans l'invention sont des régions humaines, la région constante de chacune des chaînes lourdes de l'anticorps est de type y. Selon cette variante, la région constante de chacune des chaînes lourdes de l'anticorps peut être de type y1, de type y2, de type y3, ces trois types de régions constantes présentant la particularité de fixer le complément humain, ou encore de type y4. Les anticorps possédant une région constante de chacune des chaînes lourdes de type y appartiennent à la classe des IgG. Les immunoglobulines de type G (IgG), sont des hétérodimères constitués de 2 chaînes lourdes et de 2 chaînes légères, liées entre elles par des ponts disulfures. Chaque chaîne est constituée, en position N-terminale, d'une région ou domaine variable (codée par les gènes réarrangés V-J pour la chaîne légère et V-D-J pour la chaîne lourde) spécifique de l'antigène contre lequel l'anticorps est dirigé, et en position C-terminale, d'une région constante, constituée d'un seul domaine CL pour la chaîne légère ou de 3 domaines (CHI, CH2 et CH3) pour la chaîne lourde. L'association des domaines variables et des domaines CHI et CL des chaînes lourdes et légères forme les parties Fab, qui sont connectées à la région Fc par une région charnière très flexible permettant à chaque Fab de se fixer à sa cible antigénique tandis que la région Fc, médiatrice des propriétés effectrices de l'anticorps, reste accessible aux molécules effectrices telles que les récepteurs FcyR et le Cl q. La région Fc, constituée des 2 domaines globulaires CH2 et CH3, est glycosylée au niveau du domaine CH2 avec la présence, sur chacune des 2 chaînes, d'un N-glycanne biantenné de type lactosaminique, lié à l'Asn 297. De manière préférée, la région constante de chacune des chaînes lourdes de l'anticorps est de type y1, car un tel anticorps montre une capacité à engendrer une activité ADCC chez le plus grand nombre d'individus (humains). A cet égard, tout allotype convient à la réalisation de l'invention, par exemple G1m(3), G1m (1, 2, 17), G1m(1, 17) ou Glm(1, 3) . De manière préférentielle, l'allotype est G1m(1, 17) . Dans un aspect particulier de l'invention, la région constante de chacune des chaînes lourdes de l'anticorps est de type y1, et elle est codée par la séquence d'acide nucléique humaine SEQ ID NO : 3, la région constante de chacune de ses chaînes légères étant codée par la séquence d'acide nucléique humaine SEQ ID NO : 4. Ainsi, un tel anticorps possède une région variable murine et une région constante humaine, avec des chaînes lourdes de type y1. Cet anticorps appartient donc à la sous-classe des IgG1. Selon le mode de réalisation de l'anticorps utilisé dans l'invention, l'anticorps possède deux chaînes légères dont le domaine variable est codé par la séquence d'acide nucléique murine SEQ ID NO : 1 et la région constante humaine est codée par la séquence d'acide nucléique SEQ ID NO : 4, et deux chaînes lourdes dont le domaine variable est codé par la séquence d'acide nucléique murine SEQ ID NO : 2 et la région constante est codée par la séquence d'acide nucléique humaine SEQ ID NO : 3. De manière préférentielle, chacune des chaînes légères de l'anticorps selon l'invention est codée par la séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 5, et chacune des chaînes lourdes est codée par la séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 6. La séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 5 codant pour chacune des chaînes légères de l'anticorps est obtenue par fusion de la séquence d'acide nucléique murine SEQ ID NO : 1 codant pour le domaine variable de chacune des chaînes légères de l'anticorps et de la séquence d'acide nucléique humaine SEQ ID NO : 4 codant pour la région constante de chacune des chaînes légères de l'anticorps. La séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 6 codant pour chacune des chaînes lourdes de l'anticorps est obtenue par fusion de la séquence d'acide nucléique murine SEQ ID NO : 2 codant pour le domaine variable de chacune des chaînes lourdes de l'anticorps et de la séquence d'acide nucléique humaine SEQ ID NO : 3 codant pour la région constante de chacune des chaînes lourdes de l'anticorps. Dans un aspect particulier de l'invention, lorsque chacune des chaînes légères de l'anticorps est codée par la séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 5, et que chacune des chaînes lourdes est codée par la séquence d'acide nucléique chimère murinehumaine SEQ ID NO : 6, la séquence peptidique de chacune des chaînes légères, déduite de la séquence d'acide nucléique SEQ ID NO : 5, est la séquence SEQ ID NO : 7 et la séquence peptidique de chacune des chaînes lourdes, déduite de la séquence d'acide nucléique SEQ ID NO : 6, est la séquence SEQ ID NO : 8. L'acide aminé situé en position 106 est une lysine (K) dans la séquence SEQ ID NO : 7. L'invention s'entend aussi de l'utilisation des anticorps dont chacune des chaînes légères codées par une séquence d'acide nucléique chimérique murine-humaine possède au moins 70% d'homologie ou d'identité avec la séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 7 et chacune des chaînes lourdes codées par une séquence d'acide nucléique chimère murine-humaine possède au moins 70% d'homologie ou d'identité avec la séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 8, ces modifications n'altérant ni la spécificité de l'anticorps ni ses activités effectrices, comme l'activité ADCC (Antibody-Dependent Cell-mediated Cytotoxicity) . Alternatively, the constant region of each of the light chains of the antibody according to the invention is of type a ,. In a particular aspect of the invention, and especially when the constant regions of each of the light chains and each of the heavy chains of the antibody used in the invention are human regions, the constant region of each of the heavy chains of the antibody is of type y. According to this variant, the constant region of each of the heavy chains of the antibody may be of type y1, of type y2, of type y3, these three types of constant regions having the particularity of fixing the human complement, or of type y4 . Antibodies possessing a constant region of each of the heavy chains of type y belong to the IgG class. Immunoglobulin type G (IgG) are heterodimers consisting of 2 heavy chains and 2 light chains, linked together by disulfide bridges. Each chain consists, in the N-terminal position, of a region or variable domain (encoded by the rearranged genes VJ for the light chain and VDJ for the heavy chain) specific for the antigen against which the antibody is directed, and in the C-terminal position, a constant region consisting of a single CL domain for the light chain or 3 domains (CHI, CH2 and CH3) for the heavy chain. The combination of the variable domains and the CHI and CL domains of the heavy and light chains forms the Fab parts, which are connected to the Fc region by a very flexible hinge region allowing each Fab to bind to its antigenic target while the region Fc, a mediator of the effector properties of the antibody, remains accessible to effector molecules such as the FcγR and Cl q receptors. The Fc region, consisting of the 2 globular domains CH2 and CH3, is glycosylated at the CH2 domain with the presence, on each of the two chains, of a biantennary N-glycan of lactosaminic type, bound to Asn 297. Preferably, the constant region of each of the heavy chains of the antibody is of type y1, since such an antibody shows an ability to generate ADCC activity in the largest number of (human) individuals. In this respect, any allotype is suitable for carrying out the invention, for example G1m (3), G1m (1, 2, 17), G1m (1, 17) or Glm (1, 3). Preferably, the allotype is G1m (1, 17). In a particular aspect of the invention, the constant region of each of the heavy chains of the antibody is of type y1, and it is encoded by the human nucleic acid sequence SEQ ID NO: 3, the constant region of each of its light chains being encoded by the human nucleic acid sequence SEQ ID NO: 4. Thus, such an antibody has a murine variable region and a human constant region, with y1 heavy chains. This antibody therefore belongs to the subclass of IgG1. According to the embodiment of the antibody used in the invention, the antibody has two light chains whose variable domain is encoded by the murine nucleic acid sequence SEQ ID NO: 1 and the human constant region is coded by the nucleic acid sequence SEQ ID NO: 4, and two heavy chains whose variable domain is encoded by the murine nucleic acid sequence SEQ ID NO: 2 and the constant region is encoded by the human nucleic acid sequence SEQ ID NO: 3. Preferably, each of the light chains of the antibody according to the invention is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 5, and each of the heavy chains is coded by the sequence of murine-human chimeric nucleic acid SEQ ID NO: 6. The murine-human chimeric nucleic acid sequence SEQ ID NO: 5 encoding each of the light chains of the antibody is obtained by fusing the nucleic acid sequence Murine peptide SEQ ID NO: 1 coding for the variable domain of each of the light chains of the antibody and the human nucleic acid sequence SEQ ID NO: 4 coding for the constant region of each of the light chains of the antibody. The murine-human chimeric nucleic acid sequence SEQ ID NO: 6 coding for each of the heavy chains of the antibody is obtained by fusion of the murine nucleic acid sequence SEQ ID NO: 2 coding for the variable domain of each of the heavy chains of the antibody and the human nucleic acid sequence SEQ ID NO: 3 coding for the constant region of each of the heavy chains of the antibody. In a particular aspect of the invention, when each of the light chains of the antibody is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 5, and each of the heavy chains is encoded by the sequence of chimeric human murine nucleic acid SEQ ID NO: 6, the peptide sequence of each of the light chains, deduced from the nucleic acid sequence SEQ ID NO: 5, is the sequence SEQ ID NO: 7 and the peptide sequence of each of the heavy chains , deduced from the nucleic acid sequence SEQ ID NO: 6, is the sequence SEQ ID NO: 8. The amino acid located at position 106 is a lysine (K) in the sequence SEQ ID NO: 7. also includes the use of antibodies each of which has light chains encoded by a chimeric murine-human nucleic acid sequence having at least 70% homology or identity with the chimeric murine-human nucleic acid sequence SEQ ID NO: 7 and each heavy chains encoded by a murine-human chimeric nucleic acid sequence has at least 70% homology or identity with the murine-human chimeric nucleic acid sequence SEQ ID NO: 8, these modifications neither altering the specificity of the antibody and its effector activities, such as ADCC (Antibody-Dependent Cell-mediated Cytotoxicity) activity.

Dans un autre mode de réalisation particulier, un autre anticorps selon l'invention est l'anticorps EMAB603 (également appelé LFB-R603) produit par le clone cellulaire R603 déposé le 29 novembre 2005 sous le numéro d'enregistrement CNCM 1-3529 à la Collection Nationale de Cultures de Microorganismes (CNCM, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15). Chacune des chaînes légères de l'anticorps LFB-R603 est codée par la séquence d'acide nucléique chimérique murine-humaine SEQ ID NO: 5, et chacune des chaînes lourdes est codée par la séquence d'acide nucléique chimérique murine-humaine SEQ ID NO : 6. Cet anticorps l0 chimérique entre en compétition avec l'anticorps murin CAT-13.6E12 pour la fixation du CD20 et possède une activité cytotoxique très supérieure à celle du rituximab, qui peut être attribuée pour partie à la glycosylation particulière du N-glycanne de la chaîne lourde de ces anticorps. En effet, le clone R603 a pour particularité de produire une composition d'anticorps LFB-R603 15 possédant un ratio taux de fucose/taux de galactose inférieur à 0,6, pour lequel il a été démontré dans la demande de brevet FR 03 12229 qu'il est optimal pour conférer une forte activité ADCC aux anticorps. Un exemple de vecteur d'expression d'un anticorps selon l'invention, est le vecteur de séquence SEQ ID NO : 17. Ce vecteur est un vecteur 20 permettant l'expression d'un anticorps selon l'invention dont la chaîne légère est codée par la séquence d'acide nucléique SED ID NO : 5, dont la séquence peptidique déduite est la séquence SEQ ID NO : 7, et dont la chaîne lourde est codée par la séquence d'acide nucléique SED ID NO : 6, dont la séquence peptidique déduite est la séquence SEQ ID NO : 8. Ce 25 vecteur est une molécule d'acide nucléique dans laquelle la séquence d'acide nucléique SEQ ID NO : 5 codant pour chacune des chaînes légères de l'anticorps et la séquence d'acide nucléique SEQ ID NO : 6 codant chacune des chaînes lourdes de l'anticorps ont été insérées, afin de les introduire et de les maintenir dans une cellule hôte. Il permet l'expression de 30 ces fragments d'acide nucléique étrangers dans la cellule hôte car il possède des séquences indispensables (promoteur, séquence de polyadénylation, gène de sélection) à cette expression. De tels vecteurs sont bien connus de l'homme du métier, et peuvent être un adénovirus, un rétrovirus, un plasmide ou un bactériophage, cette liste n'étant pas limitative. Dans un autre mode de réalisation, l'anticorps de l'invention peut être produit par co-expression dans une cellule de deux vecteurs d'expression, l'un permettant l'expression de la chaîne légère, et l'autre celle de la chaîne lourde de l'anticorps.Tout comme indiqué précédemment, ces vecteurs possèdent des séquences indispensables (promoteur, séquence de polyadénylation, gène de sélection) à cette expression. Les milieux de culture adaptés à ces cellules sont bien connus de l0 l'homme du métier, et on peut citer de manière non exhaustives les milieux de culture RPMI 1640 (The Journal of the American Medical Association, 199, 519 (1967) [16]), Eagle's MEM (Science, 122, 501 (1952) [17]), Dulbecco's modified MEM (Virology, 8, 396 (1959) [18]), F12 Medium (Proc. Natl. Acad. Sci. USA, 53, 288 (1965) [19]), IMDM (J. Experimental Medicine, 15 147, 923 (1978) [20]), ou encore ceux décrits dans le document EP1229125. Avantageusement, l'anticorps utilisé dans l'invention peut permettre la formation de lymphocytes T mémoires. Ces lymphocytes T mémoires peuvent posséder la capacité de proliférer, et de se réactiver de manière rapide lors d'une deuxième exposition aux cellules prolifératives. 20 L'anticorps peut permettre une déplétion des cellules B périphériques d'au moins 20%, ou au moins 30 %, ou encore au moins 50%, et de préférence d'au moins 60%, ou 70% chez le sujet auquel il est administré. L'anticorps utilisé dans l'invention peut être administré avec un support pharmaceutiquement acceptable, approprié pour l'effet thérapeutique 25 attendu. A cet égard, l'anticorps peut être utilisé en monothérapie. En d'autres termes, l'anticorps peut être utilisé sans autre principe actif, pendant tout la durée du traitement au moyen de l'anticorps. Alternativement, l'anticorps utilisé dans l'invention peut être utilisé en 30 combinaison avec un ou plusieurs autre(s) principe actif, par exemple un anticorps monoclonal, dirigé contre un ou plusieurs autre(s) antigène(s) exprimé(s) sur les cellules lymphoïdes, comme par exemple, de façon non limitative, les antigènes CD1, CD2, CD3, CD4, CD8, CD11, CD16, CD18, CD19, CD21, CD22, CD23, CD25, CD26, CD29, CD30, CD31, CD40, CD43, CD44, CD45, CD49, CD50, CD52, CD53, CD54, CD55, CD58, CD59, CD69, CD70, CD71, CD80, CD81, CD82, CD86, CD95, CD103, CD118, CD119, CD120, CD132, CD210, CD217. L'anticorps selon l'invention peut être utilisé en association avec des cellules exprimant des FcyR telles que les cellules NK, les cellules NKT (Natural Killers T) , les lymphocytes Tyb, les macrophages, les monocytes ou les cellules dendritiques, c'est-à-dire en association avec une thérapie cellulaire (Peller S, Kaufman S Blood 1991, 78:1569 ([21]) ; Kimby E et al. 1989 Leukemia 3 (7) :501-504 ([22]); Soorskaar D et al. 1988 Int Arch Allery Appl Immunol 87(2) ;159-164 ([23]) ; Ziegler HW et al. 1981 Int J Cancer 27(3) ;321-327 ([24]) ; Chaperot L et al. 2000 Leukemia 14 (9) :1667-77 ([25]) ; Vuillier F, Dighiero G 2003 Bull Cancer. 90 (8-9) :744-50 ([26])). La dose d'anticorps administrée aux patients peut être comprise entre 0,5 mg/m2 et 1000 mg/m2, par exemple entre 50 mg/m2 et 700 mg/m2, ou encore entre 100 mg/m2 et 500 mg/m2, ou encore entre 200 mg/m2 et 400 mg/m2 . La dose d'anticorps peut être inférieure à 375 mg/m2, ou à 187,5 mg/m2, à 75 mg/m2, à 37,5 mg/m2, 15 mg/m2, 7,5 mg/m2 ou de manière particulièrement avantageuse inférieure à 3,75 mg/m2 ou encore à 1 mg/m2 ou à 0,5 mg/m2. La dose administrée est avantageusement comprise entre 187,5 mg/m2 et 75 mg/m2, ou entre 75 mg/m2 et 37,5 mg/m2, entre 75 mg/m2 et 15 mg/m2, entre 75 mg/m2 et 7,5 mg/m2 ou encore entre 75 mg/m2 et 3,75 mg/m2. De préférence, la dose administrée est comprise entre 3,75 mg/m2 et 0,5 mg/m2, plus particulièrement comprise entre 2 mg/m2 et 1 mg/m2. Ces doses peuvent être administrées par voie intraveineuse. Avantageusement, l'administration de l'anticorps peut se faire près du site de la prolifération, ou dans le site de la prolifération. In another particular embodiment, another antibody according to the invention is the antibody EMAB603 (also called LFB-R603) produced by the cell clone R603 deposited on November 29, 2005 under the registration number CNCM 1-3529 at the National Collection of Cultures of Microorganisms (CNCM, Pasteur Institute, 25 rue du Docteur Roux, 75724 Paris Cedex 15). Each of the light chains of the LFB-R603 antibody is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 5, and each of the heavy chains is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 6. This chimeric antibody competes with the murine CAT-13.6E12 antibody for CD20 uptake and has a much higher cytotoxic activity than rituximab, which can be attributed in part to the particular glycosylation of N- glycan of the heavy chain of these antibodies. Indeed, the R603 clone has the particularity of producing an LFB-R603 antibody composition having a fucose / galactose content ratio of less than 0.6, for which it has been demonstrated in the patent application FR 03 12229 it is optimal for conferring strong ADCC activity to the antibodies. An example of an expression vector of an antibody according to the invention is the vector of sequence SEQ ID NO: 17. This vector is a vector allowing the expression of an antibody according to the invention, the light chain of which is encoded by the nucleic acid sequence SED ID NO: 5, whose deduced peptide sequence is the sequence SEQ ID NO: 7, and whose heavy chain is encoded by the SED ID NO: 6 nucleic acid sequence, the The deduced peptide sequence is the sequence SEQ ID NO: 8. This vector is a nucleic acid molecule in which the nucleic acid sequence SEQ ID NO: 5 coding for each of the light chains of the antibody and the sequence of nucleic acid SEQ ID NO: 6 encoding each of the heavy chains of the antibody were inserted, to introduce and maintain them in a host cell. It allows the expression of these foreign nucleic acid fragments in the host cell because it has indispensable sequences (promoter, polyadenylation sequence, selection gene) to this expression. Such vectors are well known to those skilled in the art, and may be an adenovirus, a retrovirus, a plasmid or a bacteriophage, this list not being limiting. In another embodiment, the antibody of the invention may be produced by coexpression in a cell of two expression vectors, one allowing the expression of the light chain, and the other that of the As indicated above, these vectors possess indispensable sequences (promoter, polyadenylation sequence, selection gene) for this expression. Suitable culture media for these cells are well known to those skilled in the art, and non-exhaustive are the RPMI 1640 culture media (The Journal of the American Medical Association, 199, 519 (1967)). ]), Eagle's MEM (Science, 122, 501 (1952) [17]), Dulbecco's modified MEM (Virology, 8, 396 (1959) [18]), F12 Medium (Proc Natl Acad Sci USA, 53). , 288 (1965) [19]), IMDM (J. Experimental Medicine, 147, 923 (1978) [20]), or those described in EP1229125. Advantageously, the antibody used in the invention may allow the formation of memory T lymphocytes. These memory T cells may possess the ability to proliferate, and to reactivate rapidly upon second exposure to proliferative cells. The antibody may allow peripheral B cell depletion of at least 20%, or at least 30%, or at least 50%, and preferably at least 60%, or 70% in the subject to which it is administered. The antibody used in the invention may be administered with a pharmaceutically acceptable carrier, suitable for the intended therapeutic effect. In this regard, the antibody can be used alone. In other words, the antibody can be used without any other active ingredient, for the duration of the treatment by means of the antibody. Alternatively, the antibody used in the invention may be used in combination with one or more other active ingredient (s), for example a monoclonal antibody, directed against one or more other antigen (s) expressed on lymphoid cells, for example, without limitation, the antigens CD1, CD2, CD3, CD4, CD8, CD11, CD16, CD18, CD19, CD21, CD22, CD23, CD25, CD26, CD29, CD30, CD31, CD40, CD43, CD44, CD45, CD49, CD50, CD52, CD53, CD54, CD55, CD58, CD59, CD69, CD70, CD71, CD80, CD81, CD82, CD86, CD95, CD103, CD118, CD119, CD120, CD132, CD210, CD217. The antibody according to the invention can be used in combination with cells expressing FcγRs such as NK cells, NKT (Natural Killers T) cells, Tyb lymphocytes, macrophages, monocytes or dendritic cells. that is, in combination with cell therapy (Peller S, Kaufman S Blood 1991, 78: 1569 ([21]), Kimby E et al., 1989 Leukemia 3 (7): 501-504 ([22]), Soorskaar D et al., 1988 Int Arch Allery Appl Immunol 87 (2); 159-164 ([23]); Ziegler HW et al., 1981 Int J Cancer 27 (3); 321-327 ([24]); Chaperot L and 2000 Leukemia 14 (9): 1667-77 ([25]); Vuillier F, Dighiero G 2003 Bull Cancer 90 (8-9): 744-50 ([26])). The dose of antibody administered to patients can be between 0.5 mg / m 2 and 1000 mg / m 2, for example between 50 mg / m 2 and 700 mg / m 2, or between 100 mg / m 2 and 500 mg / m 2, or between 200 mg / m2 and 400 mg / m2. The antibody dose may be less than 375 mg / m2, or 187.5 mg / m2, 75 mg / m2, 37.5 mg / m2, 15 mg / m2, 7.5 mg / m2, or particularly advantageously less than 3.75 mg / m 2 or 1 mg / m 2 or 0.5 mg / m 2. The dose administered is advantageously between 187.5 mg / m 2 and 75 mg / m 2, or between 75 mg / m 2 and 37.5 mg / m 2, between 75 mg / m 2 and 15 mg / m 2, between 75 mg / m 2 and 7.5 mg / m2 or between 75 mg / m2 and 3.75 mg / m2. Preferably, the dose administered is between 3.75 mg / m 2 and 0.5 mg / m 2, more particularly between 2 mg / m 2 and 1 mg / m 2. These doses can be administered intravenously. Advantageously, the administration of the antibody can be near the site of proliferation, or in the site of proliferation.

L'administration peut se faire soit à dose unique (c'est-à-dire administration unique), soit en injections répétées. Si les injections sont répétées, chaque administration peut être suffisamment espacée de la précédente pour que chaque administration soit considérée comme une administration en dose unique. Par exemple, chaque administration peut être espacée d'au moins une semaine, ou d'au moins 2 semaines, d'au ou moins 3 semaines, ou d'au mois 4 semaines, ou d'au moins 6 semaines, ou d'au moins 10 semaines, ou d'au moins 6 mois de l'administration précédente. L'anticorps peut être utilisé chez des patients candidats à une autogreffe de cellules souches hématopoïétiques. L'anticorps peut être utilisé chez des patients très cytopéniques. Administration can be either single dose (ie single administration) or repeated injections. If the injections are repeated, each administration may be sufficiently spaced from the previous one for each administration to be considered as a single dose administration. For example, each administration may be spaced at least a week, or at least 2 weeks, at least 3 weeks, or at least 4 weeks, or at least 6 weeks, or at least 10 weeks, or at least 6 months of the previous administration. The antibody can be used in patients who are candidates for autologous haematopoietic stem cell transplantation. The antibody can be used in very cytopenic patients.

L'invention peut être définie comme l'utilisation d'un anticorps selon l'invention, pour la fabrication d'un médicament destiné au traitement de la maladie de Waldenstrêm. Dans ce cas, toutes les caractéristiques techniques, variantes et modes de réalisation mentionnées ci-avant, et leur combinaison, sont applicables. The invention may be defined as the use of an antibody according to the invention for the manufacture of a medicament for the treatment of Waldenstrem disease. In this case, all the technical characteristics, variants and embodiments mentioned above, and their combination, are applicable.

Un autre objet de l'invention est l'utilisation d'une composition pharmaceutique comprenant un anticorps selon l'invention et au moins un excipient pharmaceutiquement acceptable, pour la fabrication d'un médicament destiné au traitement de la maladie de Waldenstrêm. Dans ce cas, toutes les caractéristiques techniques, variantes et modes de réalisation mentionnées ci-avant, et leur combinaison, sont applicables. L'excipient peut être tout excipient connu de l'homme du métier, comme les excipient utilisés avec les produits Rituxan®, Herceptin®, Synagis®, Campath®, Zevalin®, Avastin®, cette liste n'étant pas limitative. En d'autres termes, cet autre objet de l'invention peut être défini comme une composition pharmaceutique comprenant un anticorps selon l'invention et un excipient pharmaceutiquement acceptable, pour son utilisation dans le traitement de la maladie de Waldenstrêm. Par ailleurs, un autre objet de l'invention est un procédé de préparation d'un médicament destiné au traitement de la maladie de Waldenstrêm, consistant à mélanger l'anticorps monoclonal utilisé dans l'invention avec un support pharmaceutiquement acceptable, puis à obtenir le médicament. Another object of the invention is the use of a pharmaceutical composition comprising an antibody according to the invention and at least one pharmaceutically acceptable excipient, for the manufacture of a medicament for the treatment of Waldenstrem disease. In this case, all the technical characteristics, variants and embodiments mentioned above, and their combination, are applicable. The excipient may be any excipient known to those skilled in the art, such as the excipients used with Rituxan®, Herceptin®, Synagis®, Campath®, Zevalin®, Avastin® products, this list not being limiting. In other words, this other subject of the invention can be defined as a pharmaceutical composition comprising an antibody according to the invention and a pharmaceutically acceptable excipient, for its use in the treatment of Waldenstrem disease. Furthermore, another subject of the invention is a method for preparing a medicament for the treatment of Waldenstrem disease, comprising mixing the monoclonal antibody used in the invention with a pharmaceutically acceptable carrier, and then obtaining the drug.

Un autre objet de l'invention est l'utilisation d'un anticorps tel que défini ci-dessus, pour la fabrication d'un médicament destiné au traitement de la maladie de Waldenstrdm. Un autre objet de l'invention est une méthode de traitement thérapeutique de la maladie de Waldenstrôm, comprenant l'administration, à un patient en présentant le besoin, d'un anticorps ou d'un médicament tel que décrit ci-avant, éventuellement accompagné d'un excipient pharmaceutiquement acceptable. Avantageusement, la méthode de traitement comprend l'étape d'administration des anticorps à un patient atteint de MW. D'autres avantages pourront encore apparaître à l'homme du métier à la lecture des exemples ci-dessous, illustrés par les figures annexées, donnés à titre illustratif. Another object of the invention is the use of an antibody as defined above, for the manufacture of a medicament for the treatment of Waldenstrdm disease. Another subject of the invention is a method of therapeutic treatment of Waldenstrom's disease, comprising the administration, to a patient presenting the need, of an antibody or a drug as described above, possibly accompanied a pharmaceutically acceptable excipient. Advantageously, the treatment method comprises the step of administering the antibodies to a patient with WM. Other advantages may still appear to those skilled in the art on reading the examples below, illustrated by the appended figures, given for illustrative purposes.

Brève description des figures - La figure 1 est la représentation schématique du vecteur CKHu utilisé pour la chimérisation de la chaîne légère kappa des anticorps EMAB603. - La figure 2 est la représentation schématique du vecteur G1 Hu utilisé pour la chimérisation de la chaîne lourde des anticorps EMAB603. - La figure 3 est la représentation schématique du vecteur d'expression des chaînes lourdes et légères utilisé pour la production de l'anticorps R603. BRIEF DESCRIPTION OF THE FIGURES FIG. 1 is a schematic representation of the CKHu vector used for the chimerization of the kappa light chain of the EMAB603 antibodies. FIG. 2 is the schematic representation of the G1 Hu vector used for the chimericization of the heavy chain of the EMAB603 antibodies. FIG. 3 is the schematic representation of the expression vector of the heavy and light chains used for the production of the R603 antibody.

EXEMPLES Exemple 1 : Construction des vecteurs d'expression de l'anticorps chimériques anti-CD20 EMAB603 EXAMPLES Example 1 Construction of chimeric anti-CD20 EMAB603 expression vectors

A. Détermination de la séquence des régions variables de l'anticorps murin CAT-13.6E12 L'ARN total de l'hybridome murin CAT-13.6E12 (fournisseur : DSMZ, réf. ACC 474) produisant une immunoglobuline de type IgG2a,K a été isolé30 (kit RNAeasy, Qiagen réf. 74104). Après transcription inverse, les domaines variables des chaînes légères (VK) et lourdes (VH) de l'anticorps CAT-13.6E12 ont été amplifiées par la technique de 5'RACE (Rapid Amplification of cDNA Ends) (kit GeneRacer, Invitrogen réf. L1500-01). Les amorces utilisées pour ces deux étapes sont les suivantes : A. Determination of Mouse Murine Variable Region Sequence CAT-13.6E12 The total RNA of the murine hybridoma CAT-13.6E12 (supplier: DSMZ, ACC 474 ref.) Producing IgG2a, Kα immunoglobulin type been isolated30 (RNAeasy kit, Qiagen 74104). After reverse transcription, the variable domains of the light (VK) and heavy (VH) chains of the CAT-13.6E12 antibody were amplified by the Rapid Amplification of cDNA Ends (5'RACE) technique (GeneRacer kit, Invitrogen ref. L1500-01). The primers used for these two steps are as follows:

1. amorces de transcription inverse a. Amorce antisens spécifique Kappa murin (SEQ ID NO : 9) 5' - ACT GCC ATC AAT CTT CCA CTT GAC -3' b. Amorce antisens spécifique G2a murin (SEQ ID NO : 10) 5'- CTG AGG GTG TAG AGG TCA GAC TG -3' 1. reverse transcription primers a. Murine Kappa Antisense Primer (SEQ ID NO: 9) 5 '- ACT GCC ATC AAT CTT CCA CTT GAC -3' b. Murine G2a specific antisense primer (SEQ ID NO: 10) 5'-CTG AGG GTG TAG AGG TCA GAC TG -3 '

2. amorces de PCR 5'RACE a. Amorce antisens spécifique Kappa murin (SEQ ID NO : 11) 5'- TTGTTCAAGAAGCACACGACTGAGGCAC -3' b. Amorce antisens spécifique G2a murin (SEQ ID NO : 12) 5'- GAGTTCCAGGTCAAGGTCACTGGCTCAG -3' 2. PCR primers 5'RACE a. Kappa specific antisense primer (SEQ ID NO: 11) 5'-TTGTTCAAGAAGCACACGACTGAGGCAC -3 'b. Murine G2a specific antisense primer (SEQ ID NO: 12) 5'-GAGTTCCAGGTCAAGGTCACTGGCTCAG -3 '

Les produits de PCR VH et VK ainsi obtenus ont été clonés dans le vecteur pCR4Blunt-TOPO (Zéro blunt TOPO PCR cloning kit, Invitrogen, réf. K2875-20) puis séquencés. La séquence nucléotidique de la région VK de l'anticorps murin CAT-13.6E12 est indiquée sous la séquence SEQ ID NO : 1, hormis le dernier nucléotide qui est remplacé par A (AAA au lieu de AAC) . Le gène VK appartient à la famille Vx4 (Kabat et al., "Séquences of Proteins of Immunological Interest", NIH Publication, 91-3242 (1991) [27]). La séquence nucléotidique de la région VH de CAT-13.6E12 est la séquence SEQ ID NO : 2. Le gène VH appartient à la famille VH1. The VH and VK PCR products thus obtained were cloned into the pCR4Blunt-TOPO vector (Zero blunt TOPO PCR cloning kit, Invitrogen, K2875-20) and sequenced. The nucleotide sequence of the VK region of the murine antibody CAT-13.6E12 is indicated under the sequence SEQ ID NO: 1, except the last nucleotide which is replaced by A (AAA instead of AAC). The VK gene belongs to the Vx4 family (Kabat et al., "Sequences of Proteins of Immunological Interest", NIH Publication, 91-3242 (1991) [27]). The nucleotide sequence of the VH region of CAT-13.6E12 is the sequence SEQ ID NO: 2. The VH gene belongs to the VH1 family.

B. Construction des vecteurs d'expression des chaînes lourdes et des chaînes légères des anticorps chimériques EMAB603 1. Vecteur chaîne légère Kappa de l'anticorps EMAB603 La séquence VK clonée dans le vecteur de séquençage pCR4Blunt-TOPO a été amplifiée à l'aide des amorces de clonage suivantes : a) amorce sens VK (SEQ ID NO : 13) 5'-CTCAGTACTAGTGCCGCCACCA TGGATTTTCAAGTGCAGATTTTC AG -3' La séquence soulignée correspond au site de restriction Spe I, la séquence en gras correspond à une séquence de Kozak consensus, l'ATG initiateur est en italiques. B. Construction of EMAB603 Chimeric Antibody Heavy Chain and Light Chain Expression Vectors 1. Kappa Light Chain Vector of EMAB603 Antibody The VK sequence cloned into the pCR4Blunt-TOPO sequencing vector was amplified using the following cloning primers: a) sense primer VK (SEQ ID NO: 13) 5'-CTCAGTACTAGTGCCGCCACCA TGGATTTTCAAGTGCAGATTTTC AG -3 'The underlined sequence corresponds to the Spe I restriction site, the sequence in bold corresponds to a consensus Kozak sequence, 'ATG initiator is in italics.

b) amorce antisens VK: (SEQ ID NO : 14) 5'- TGAAGACACTTGGTGCAGCCACAGTCCG©TTTATTTCCAGCCTGGT - 3' Cette amorce réalise la jonction des séquences VK murine (en italique) et région constante (CK) humaine (en gras). La séquence soulignée correspond au site de restriction Dra III. Cette amorce réalise la jonction des séquences VK murine (en italique) et région constante (CK) humaine (en gras). La séquence soulignée correspond au site de restriction Dra III. b) antisense primer VK: (SEQ ID NO: 14) 5'- TGAAGACACTTGGTGCAGCCACAGTCCG © TTTATTTCCAGCCTGGT - 3 'This primer joins the murine VK (in italics) and the human constant region (CK) sequences (in bold). The underlined sequence corresponds to the Dra III restriction site. This primer joins the murine VK (in italic) and human constant region (CK) sequences (in bold). The underlined sequence corresponds to the Dra III restriction site.

Le produit de PCR VK ainsi obtenu contient la séquence codant le peptide signal naturel de l'anticorps murin CAT-13.6E12, avec la mutation AAC -> AAA (nucléotide encadré dans la séquence de l'amorce antisens SEQ ID NO : 14) qui correspond à la mutation N106K par rapport à la séquence naturelle VK de CAT-13.6E12. The VK PCR product thus obtained contains the sequence coding for the natural signal peptide of the murine antibody CAT-13.6E12, with the mutation AAC → AAA (nucleotide framed in the sequence of the antisense primer SEQ ID NO: 14) which corresponds to the mutation N106K compared to the natural sequence VK of CAT-13.6E12.

La séquence de la chaîne légère de l'anticorps chimérique EMAB603 codée par ce vecteur est présentée en SEQ ID NO : 5 pour la séquence nucléotidique et correspond à la séquence peptidique déduite SEQ ID NO : 7. Cette PCR VK a été ensuite clonée entre les sites Spe 1 et Dra III du vecteur de chimérisation chaîne légère (Fig. 1) qui correspond à la séquence SEQ ID NO : 1, en 5' de la région constante Cx humaine, dont la séquence nucléique est la séquence SEQ ID NO : 4. La séquence CK humaine de ce vecteur de chimérisation avait été préalablement modifiée par mutagénèse silencieuse afin de créer un site de restriction Dra III pour permettre le clonage de séquences VK murines. Ce vecteur de chimérisation contient un promoteur RSV et une séquence de polyadénylation bGH (bovine Growth Hormone) ainsi que le gène de sélection dhfr (dihydrofolate reductase) . The sequence of the light chain of the chimeric antibody EMAB603 encoded by this vector is presented in SEQ ID NO: 5 for the nucleotide sequence and corresponds to the deduced peptide sequence SEQ ID NO: 7. This VK PCR was then cloned between the Spe 1 and Dra III sites of the light chain chimeric vector (FIG 1) which corresponds to the sequence SEQ ID NO: 1, in 5 'of the human Cx constant region, whose nucleic sequence is the sequence SEQ ID NO: 4 The human CK sequence of this chimerization vector was previously modified by silent mutagenesis to create a Dra III restriction site to allow the cloning of murine VK sequences. This chimerization vector contains an RSV promoter and a bGH (Growth Hormone) polyadenylation sequence as well as the dhfr (dihydrofolate reductase) selection gene.

2. Vecteur chaîne lourde Une démarche similaire a été appliquée pour la chimérisation de la chaîne lourde de l'anticorps EMAB603. 2. Heavy chain vector A similar approach was applied for the chimericization of the heavy chain of the EMAB603 antibody.

La séquence VH clonée dans le vecteur pCR4Blunt-TOPO a été tout d'abord amplifiée à l'aide des amorces de clonage suivantes : a) amorce sens VH (SEQ ID NO :15) 5'- CTCAGTACTAGTGCCGCCACCATGGGATTCAGCAGGATCTTTCTC -3' La séquence soulignée correspond au site de restriction Spe I, la séquence en gras correspond à une séquence de Kozak consensus, l'ATG initiateur est en italique. b) amorce antisens VH (SEQ ID NO :16) 5'- GACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACTGAGGTTC C -3'30 Cette amorce réalise la jonction des séquences VH murine (en italique) et région constante GI humaine (en gras). La séquence soulignée correspond au site de restriction Apa 1 . Le fragment VH amplifié contient la séquence codant le peptide signal naturel de l'anticorps murin CAT-13.6E12. Cette PCR VH a été ensuite clonée entre les sites Spe 1 et Apa 1 du vecteur de chimérisation chaîne lourde (Fig. 2) qui correspond à la séquence SEQ ID NO : 2, en 5' de la région constante yl humaine dont la séquence nucléique est la séquence SEQ ID NO : 3. Ce vecteur de chimérisation contient un promoteur RSV et une séquence de polyadénylation bGH (bovine Growth Hormone) ainsi que le gène de sélection néo. La séquence de la chaîne lourde de l'anticorps chimérique EMAB603 codée par ce vecteur est présenté en SEQ ID NO : 6 pour la séquence nucléotidique et en séquence SEQ ID NO : 8 pour la séquence peptidique déduite. The VH sequence cloned in the pCR4Blunt-TOPO vector was first amplified using the following cloning primers: a) sense primer VH (SEQ ID NO: 15) 5'-CTCAGTACTAGTGCCGCCACCATGGGATTCAGCAGGATCTTTCTC -3 'The underlined sequence corresponds at the Spe I restriction site, the bold sequence corresponds to a consensus Kozak sequence, the initiator ATG is italicized. b) VH antisense primer (SEQ ID NO: 16) 5'-GACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACTGAGGTTC C -3'30 This primer joins the murine VH sequences (in italics) and the human GI constant region (in bold). The underlined sequence corresponds to the Apa 1 restriction site. The amplified VH fragment contains the sequence encoding the natural signal peptide of the murine antibody CAT-13.6E12. This VH PCR was then cloned between the Spe 1 and Apa 1 sites of the heavy chain chimeric vector (FIG 2) which corresponds to the sequence SEQ ID NO: 2, 5 'of the human constant region, whose nucleic sequence is the sequence SEQ ID NO: 3. This chimerization vector contains an RSV promoter and a bGH (bovine Growth Hormone) polyadenylation sequence as well as the neo selection gene. The sequence of the heavy chain of the chimeric antibody EMAB603 encoded by this vector is presented in SEQ ID NO: 6 for the nucleotide sequence and in sequence SEQ ID NO: 8 for the deduced peptide sequence.

3. Vecteurs d'expression finaux 3. Final expression vectors

Vecteur d'expression de l'anticorps EMAB603 Un vecteur d'expression unique contenant les deux unités de transcription chaîne lourde et chaîne légère de l'anticorps anti-CD20 EMAB-603 a été construit à partir des deux vecteurs de chimérisation de la chaîne légère et de la chaîne Ce vecteur d'expression HK463-25(FDA) présente deux gènes de sélection, néo (neo-phosphotransphérase II) et dhfr (dihydrofolate reductase) ainsi que deux unités de transcription chaîne lourde et chaîne légère sous le contrôle d'un promoteur RSV (Figure 3). EMAB603 Antibody Expression Vector A single expression vector containing the two heavy chain and light chain transcription units of the anti-CD20 EMAB-603 antibody was constructed from the two light chain chimerization vectors This expression vector HK463-25 (FDA) has two selection genes, neo (neo-phosphotranspherase II) and dhfr (dihydrofolate reductase), as well as two heavy chain and light chain transcription units under the control of an RSV promoter (Figure 3).

Exemple 2 : Création de lignées cellulaires dérivées de la lignée YB210 productrices de l'anticorps chimérique anti-CD20 EMAB603 La lignée de rat YB2/0 (ATCC # CRL-1662) a été cultivée en milieu EMS (Invitrogen, réf. 041-95181M) contenant 5% de sérum de veau foetal30 (JRH Biosciences, réf. 12107). Pour la transfection, 5 millions de cellules ont été électroporées (électroporateur Biorad, modèle 1652077) en milieu Optimix (Equibio, réf. EKITE 1) avec 25 µg de vecteur chaîne légère, pRSVHL-EMAB-603 pour l'expression de l'anticorps EMAB603. Les conditions d'électroporation appliquées étaient de 230 volts et 960 microfarads pour une cuvette de 0,5 ml. Chaque cuvette d'électroporation a été ensuite répartie sur 5 plaques P96 avec une densité de 5000 cellules/puits. La mise en milieu sélectif RPMI (Invitrogen, ref 21875- 034) contenant 5% de sérum dialyse (Invitrogen, réf. 10603-017), 500 µg/ml de G418 (Invitrogen, réf. 10131- 027) et 25 nM de methotrexate (Sigma, réf. M8407), a été réalisée 3 jours après la transfection. Les surnageants des puits de transfection résistants ont été criblés pour la présence d'immunoglobulines (Ig) chimériques par dosage ELISA spécifique des séquences Ig humaines. Example 2 Creation of Cell Lines Derived from the YB210 Line Producing the Anti-CD20 EMAB603 Chimeric Antibody The YB2 / 0 rat line (ATCC # CRL-1662) was cultured in EMS medium (Invitrogen, ref 041-95181M). ) containing 5% fetal calf serum (JRH Biosciences, ref 12107). For transfection, 5 million cells were electroporated (Biorad electroporator, model 1652077) in Optimix medium (Equibio, ref EKITE 1) with 25 μg of light chain vector, pRSVHL-EMAB-603 for the expression of the antibody EMAB603. The electroporation conditions applied were 230 volts and 960 microfarads for a 0.5 ml cuvette. Each electroporation cuvette was then distributed over 5 P96 plates with a density of 5000 cells / well. The RPMI selective medium (Invitrogen, ref 21875-034) containing 5% dialyzed serum (Invitrogen, ref 10603-017), 500 μg / ml of G418 (Invitrogen, ref.10131-027) and 25 nM of methotrexate. (Sigma, M8407), was performed 3 days after transfection. Supernatants from the resistant transfection wells were screened for the presence of chimeric immunoglobulins (Ig) by ELISA assay specific for human Ig sequences.

Les 10 transfectants produisant le plus d'anticorps ont été amplifiés en plaques P24 et leur surnageant redosé par ELISA afin d'estimer leur productivité et de sélectionner les 3 meilleurs producteurs pour le clonage par dilution limite (40 cellules/plaque) . A l'issue du clonage, le clone R603 a été sélectionné pour la production de l'anticorps chimérique EMAB603 et adaptés progressivement au milieu de production CD Hybridoma (Invitrogen, réf. 11279-023). La production des anticorps chimériques EMAB603 a été réalisée par expansion de la culture adaptée en milieu CD Hybridoma, obtenue par dilution à 3x105 cellules/ml en flacons de 75 cm2 et 175 cm2 puis par dilution à 4,5x105 cellules/ml en flacon de type roller. Après avoir atteint le volume maximal, la culture a été poursuivie jusqu'à ce que la viabilité cellulaire ne soit plus que de 20%. Après production, les anticorps chimériques EMAB603 ont été purifiés par chromatographie d'affinité sur protéine A (pureté estimée par HPLC < 95 %) et contrôlés par électrophorèse en gel de polyacrylamide. The transfectants producing the most antibodies were amplified in P24 plates and their supernatant redosed by ELISA in order to estimate their productivity and to select the 3 best producers for limiting dilution cloning (40 cells / plate). After cloning, the clone R603 was selected for the production of the EMAB603 chimeric antibody and progressively adapted to the CD Hybridoma production medium (Invitrogen, ref 11279-023). The production of chimeric EMAB603 antibodies was carried out by expansion of the adapted culture in CD Hybridoma medium, obtained by dilution with 3 × 10 5 cells / ml in flasks of 75 cm 2 and 175 cm 2 and then by dilution with 4.5 × 10 5 cells / ml in vial of type Roller. After reaching maximum volume, culture was continued until cell viability was only 20%. After production, chimeric EMAB603 antibodies were purified by protein A affinity chromatography (purity estimated by HPLC <95%) and monitored by polyacrylamide gel electrophoresis.

Exemple 3 : Etude phénotypique et fonctionnelle des cellules NK 28 de patients atteints de macroglobulinémie de Waldenstrôm 1) Détermination de l'efficacité de l'anticorps anti-CD20 optimisé LFBR603 sur les cellules de maladie de Waldenstrôm (MW) Le phénotype et les capacités fonctionnelles des cellules NK de patients atteints MW sont étudiés et comparés à ceux de cellules NK de donneurs sains du même âge et de patients atteints de LLC. Le but est de déterminer le rôle des cellules NK dans le contrôle et/ou le traitement de la MW, et plus particulièrement le rôle de l'ADCC, médiée par les cellules NK, lors d'un traitement par anti-CD20. L'efficacité in vitro de l'anticorps anti CD20 optimisé LFB-R603 est déterminée en la comparant à celle du rituximab. Le choix des patients à traiter par immunothérapie, et plus particulièrement avec l'anti-CD20 optimisé du LFB, est ainsi orienté en fonction des résultats. 2) Population étudiée et matériel utilisé Les cellules de 20 patients atteints de MW, proviennent de patients suivis à la consultation d'Hématologie Clinique de l'Hôpital Pitié-Salpêtrière à Paris. Cette cohorte d'une centaine de patients est la plus importante cohorte de patients MW suivis en France, et permet d'avoir un recrutement de choix de patients (en moyenne 2 patients par semaine) explorés pour l'ensemble des marqueurs diagnostiques et pronostiques actuellement utilisés dans les différents protocoles cliniques. Example 3: Phenotypic and Functional Study of NK 28 Cells of Patients with Waldenstrom Macroglobulinemia 1) Determination of the Efficacy of Optimized Anti-CD20 Antibody LFBR603 on Waldenstrom's Disease (MW) Cells Phenotype and Functional Capabilities NK cells from WM patients are studied and compared to NK cells from healthy donors of the same age and patients with CLL. The aim is to determine the role of NK cells in the control and / or treatment of WM, and more specifically the role of ADCC, mediated by NK cells, during anti-CD20 treatment. The in vitro efficacy of the optimized anti-CD20 antibody LFB-R603 is determined by comparing it to that of rituximab. The choice of the patients to be treated by immunotherapy, and more particularly with the optimized anti-CD20 of the LFB, is thus oriented according to the results. 2) Study population and material used The cells of 20 patients with WM, come from patients followed at the Clinical Hematology consultation of the Pitié-Salpêtrière Hospital in Paris. This cohort of about one hundred patients is the largest cohort of WM patients followed in France, and allows to have a recruitment of choice of patients (on average 2 patients per week) explored for all current diagnostic and prognostic markers. used in different clinical protocols.

L'étude est effectuée sur des patients non traités ou à distance de plus de 6 mois du dernier traitement (exclusion des patients préalablement traités par anti CD20 ou anti CD52). Les prélèvements proviennent tous d'échantillons récupérés lors de bilans biologiques prescrits par le clinicien. Les résultats obtenus sont comparés à ceux préalablement obtenus lors des deux études précédentes : d'une part un groupe de 57 patients atteints de LLC de stades A et B/C (Le Garff-Tavernier et al., Leukemia) et un groupe de patients LLC délétés p53, qui sont étudiés selon les mêmes critères et dans le même laboratoire. Les résultats sont également comparés à ceux d'un groupe, correspondant en âge, d'échantillons de sang des témoins sains (n=25) (Le Garff Tavernier M, et al., 2010. Human NK cells display major phenotypic and functional changes over the life span. Aging CeIL 9: 527-535, [28]). 3) Phénotype des cellules NK circulantes Cette étude est effectuée à partir de prélèvements sanguins (sur sang frais) par cytométrie de flux. Les marqueurs qui ont été étudiés lors des deux études précédentes sont analysés sur la population NK définie phénotypiquement comme étant CD3-CD56+ : a) L'expression faible (dim) ou forte (bright) du CD56; b) Les récepteurs activateurs de la cytotoxicité NK, comprenant les 15 NCR (NKp30, NKp44, NKp46), NKp80, 2B4, NKG2C et NKG2D; c) Les récepteurs inhibiteurs de la cytotoxicité NK : KIR (p58a, p58b, p70), NKG2A, ILT-2 et LAIR-1; d) Les récepteurs impliqués dans l'activation cellulaire (CD69, HLA-DR) et dans l'ADCC (CD16). 20 Les résultats sont comparés aux résultats obtenus avec des échantillons de donneurs sains du même âge (Le Garff-Tavernier et al., [28]) et des patients atteints de LLC (données non montrées). The study is carried out on untreated patients or at a distance of more than 6 months from the last treatment (exclusion of patients previously treated with anti CD20 or anti CD52). The samples all come from samples collected during biological tests prescribed by the clinician. The results obtained are compared with those previously obtained in the two previous studies: on the one hand, a group of 57 patients with stage A and B / C CLL (Le Garff-Tavernier et al., Leukemia) and one group of patients. Deleted p53 LLCs, which are studied according to the same criteria and in the same laboratory. The results are also compared to those of a group, corresponding in age, to healthy control blood samples (n = 25) (Garff Tavernier M, et al., 2010. Human NK cells display major phenotypic and functional changes over the life span Aging CeIL 9: 527-535, [28]). 3) Phenotype of circulating NK cells This study is carried out on the basis of blood samples (fresh blood) by flow cytometry. The markers that were studied in the two previous studies are analyzed on the NK population defined phenotypically as CD3-CD56 +: a) The weak (dim) or strong (bright) expression of CD56; b) NK cytotoxicity activating receptors, including NCRs (NKp30, NKp44, NKp46), NKp80, 2B4, NKG2C and NKG2D; c) NK: KIR (p58a, p58b, p70), NKG2A, ILT-2 and LAIR-1 cytokinase inhibitory receptors; d) Receptors involved in cell activation (CD69, HLA-DR) and in ADCC (CD16). The results are compared with results obtained with samples of healthy donors of the same age (Garff-Tavernier et al., [28]) and patients with CLL (data not shown).

4) Production de cytokines et de composants cytotoxiques intra- 25 cytoplasmiques par les cellules NK de patients atteints de MW 4) Production of cytokines and intracytoplasmic cytotoxic components by NK cells of WM patients

Cette étude est réalisée à partir des PBMC (Cellule mononucléaire de sang périphérique) obtenus après purification au moyen de ficoll. Les PBMC sont alors non activés ou activés par 10 ng/ml IL-12 et 100 ng/ml IL-18 30 pendant 17 heures (pour un marquage de l'IFN-y). Un marquage de surface des cellules NK par un anti-CD3 et un anti-CD56 est alors effectué avant de fixer et de perméabiliser les PBMC à l'aide d'un kit cytofix/cytoperm (BD Biosciences). Enfin, un marquage intra-cytoplasmique de l'IFN-y, de la perforine et des granzymes A/B sera réalisé avant d'être analysé par cytométrie de flux. Les résultats sont comparés aux résultats obtenus d'une part avec des échantillons de donneurs sains du même âge (Le Garff-Tavernier et al., [28]) et d'autre part, avec les patients atteints de LLC (données non montrées). 5) Test de cytotoxixité directe La capacité cytotoxique des cellules NK des patients atteints de MW est examinée en utilisant le test de lyse directe. Ce test est réalisé à partir de lymphocytes isolés après purification au moyen de ficoll et/ou à partir de cellules NK purifiées par tri-cellulaire sur la plate-forme ce cytométrie inter-IFR, cultivés en présence d'IL-2 pendant 72 heures, vis-à-vis des cellules cibles K562 (lignée cellulaire CMH classe-I négative, (ATCC CCL 243). This study is carried out using PBMC (mononuclear peripheral blood cell) obtained after purification using ficoll. The PBMCs are then inactivated or activated with 10 ng / ml IL-12 and 100 ng / ml IL-18 for 17 hours (for IFN-γ labeling). Surface labeling of NK cells by anti-CD3 and anti-CD56 is then performed before binding and permeabilization of PBMCs using a cytofix / cytoperm kit (BD Biosciences). Finally, intra-cytoplasmic labeling of IFN-γ, perforin and A / B granzymes will be performed before being analyzed by flow cytometry. The results are compared to the results obtained on the one hand with samples of healthy donors of the same age (Le Garff-Tavernier et al., [28]) and on the other hand, with patients with CLL (data not shown) . 5) Direct cytotoxicity test The cytotoxic capacity of the NK cells of patients with WM is examined using the direct lysis test. This test is performed from lymphocytes isolated after purification using ficoll and / or from NK cells purified by tri-cell on the inter-IFR cytometry platform, cultured in the presence of IL-2 for 72 hours. to K562 target cells (class-I negative MHC cell line, (ATCC CCL 243).

L'activité lytique est comparée à celle obtenue avec des PBMC provenant de donneurs sains. Ceci est réalisé en absence et en présence de 1000 unités de proleukin-2, pendant 48 heures. 6) Détermination de l'ADCC La capacité des cellules NK à faire de l'ADCC est examinée en utilisant 2 types de tests différents. Ces tests sont réalisés à partir des PBMC des patients MW en présence de l'anti-CD20 LFB-R603 vis-à-vis des cellules de MW autologues. Les 2 approches utilisées sont : - L'ADCC par relargage de 51 Cr par les cellules MW. The lytic activity is compared with that obtained with PBMCs from healthy donors. This is done in the absence and in the presence of 1000 units of proleukin-2 for 48 hours. 6) Determination of ADCC The ability of NK cells to make ADCC is examined using 2 different types of tests. These tests are performed from PBMCs of WM patients in the presence of anti-CD20 LFB-R603 against autologous MW cells. The 2 approaches used are: - ADCC by release of 51 Cr by the MW cells.

Cette technique a pour but de déterminer la proportion de cellules MW lysées par les cellules NK. Elle est étudiée en utilisant des NK purifiés par tri-cellulaire, sur la plate-forme de cytométrie inter-IFR, vis-à-vis des cellules Raji (lignée cellulaire expirmant le FcyR, ou FcyR+) ou de cellules B autologues de patients MW (patients avec clone circulant), préalablement chromées. Ces études sont réalisées en présence de l'anticorps LFB-R603 en comparaison avec le rituximab, en absence d'activation. - Le test de dégranulation. This technique aims to determine the proportion of MW cells lysed by NK cells. It is studied by using tri-cellular purified NK on the inter-IFR cytometry platform against Raji cells (FcγR-expressing cell line or FcγR +) or autologous B cells of WM patients. (patients with circulating clone), previously chromed. These studies are performed in the presence of the LFB-R603 antibody in comparison with rituximab, in the absence of activation. - The degranulation test.

Cette technique a pour but de déterminer, sans purification préalable, le taux de cellules NK sensibilisées par les cellules de MW. Elle est réalisée à partir des PBMC totaux provenant des patients MW en présence de différentes concentrations de LFB-R603, comprises entre 0 et 10 000 ng/ml, du marqueur de dégranulation CD107a/LAMP1 et de monensin. Le pourcentage de dégranulation est déterminé par le niveau d'expression du CD107a à la surface des cellules NK (CD3-CD56+). Ces différentes stratégies sont utilisées en absence et/ou en présence d'anti-CD20 LFB-R603 ou rituximab. Les résultats obtenus sont comparés à ceux obtenus à part avec des échantillons de donneurs sains du même âge (Le Garff-Tavernier et al., [27]) et les patients atteints de LLC (données non montrées). 7) Détermination de l'apoptose Des tests d'apoptose classiques en cytométrie de flux utilisant l'iodure de propidium et l'Annexine V sont effectués en présence de l'anticorps LFBR603 et les résultats obtenus sont comparés au rituximab et aux molécules de référence (par exemple fludarabine, théophylline).20 Listes des références [1] Vijay A., Gertz M.A. 2007. Waldenstrém macroglobulinemia. Blood. 109 (12): 5096-5103. [2] Harris NL, Jaffe ES et ail. World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting-Airlie House, Virginia, November 1997.J Clin Oncol 1999 ;17.3835-49 [3] Leblond V et al., French Cooperative Group on Chronic Lymphocytic Leukemia and Macroglobulinemia. 2001. Multicenter randomized 1 o comparative trial of fludarabine and the combination of cyclophosphamide-doxorubicin-prednisone in 92 patients with Waldenstrém macroglobulinemia in first relapse or with primary refractory disease. Blood. 2001 98:2640-2644. [4] Dimopoulos MA et al., (2009A). Update on treatment recommendations 15 from the Fourth International Workshop on Waldenstrom's Macroglobulinemia. J. Clin. Oncol. 27: 120-126. [5] Neparidze N, Dhodapkar MV. 2009. Waldenstrom's macroglobulinemia: Recent advances in biology and therapy. Clin. Adv. Hematol. Oncol. 7: 677-681. 20 [6] Treon SP. 2009. How 1 treat Waldenstrém macroglobulinemia. Blood. 114: 2375-2385. [7] Dimopoulos MA, Kastritis E, Roussou M, Eleutherakis-Papaiakovou E, Migkou M, Gavriatopoulou M, Tassidou A, Terpos E. (2009B). Rituximab-based treatments in Waldenstrom's macroglobulinemia. Clin.This technique aims to determine, without prior purification, the rate of NK cells sensitized by MW cells. It is performed from total PBMCs from WM patients in the presence of different concentrations of LFB-R603, between 0 and 10,000 ng / ml, degrading marker CD107a / LAMP1 and monensin. The degranulation percentage is determined by the level of expression of CD107a on the surface of NK cells (CD3-CD56 +). These different strategies are used in the absence and / or in the presence of anti-CD20 LFB-R603 or rituximab. The results obtained are compared with those obtained separately with samples of healthy donors of the same age (Garff-Tavernier et al., [27]) and patients with CLL (data not shown). 7) Determination of apoptosis Conventional apoptosis tests in flow cytometry using propidium iodide and Annexin V are carried out in the presence of the antibody LFBR603 and the results obtained are compared with rituximab and the reference molecules (eg, fludarabine, theophylline) .20 Reference Lists [1] Vijay A., Gertz MA 2007. Waldenstrém macroglobulinemia. Blood. 109 (12): 5096-5103. [2] Harris NL, Jaffe ES and garlic. World Health Organization Classification of Neoplastic Diseases of the Hematopoietic and Lymphoid Tissues: Report of the Clinical Advisory Committee Meeting-Airlie House, Virginia, November 1997. Clin Oncol 1999; 17.3835-49 [3] Leblond V et al., French Cooperative Group Chronic Lymphocytic Leukemia and Macroglobulinemia. 2001. Multicenter randomized 1 o comparative trial of fludarabine and the combination of cyclophosphamide-doxorubicin-prednisone in 92 patients with Waldenstrem macroglobulinemia in first relapse or with primary refractory disease. Blood. 2001 98: 2640-2644. [4] Dimopoulos MA et al., (2009A). Update on treatment recommendations from the Fourth International Workshop on Waldenstrom's Macroglobulinemia. J. Clin. Oncol. 27: 120-126. [5] Neparidze N, Dhodapkar MV. 2009. Waldenstrom's macroglobulinemia: Recent advances in biology and therapy. Clin. Adv. Hematol. Oncol. 7: 677-681. [6] Treon SP. 2009. How 1 treat Waldenstrém macroglobulinemia. Blood. 114: 2375-2385. [7] Dimopoulos MA, Kastritis E, Roussou M, Eleutherakis-Papaiakovou E, Migkou M, Gavriatopoulou M, Tassidou A, Terpos E. (2009B). Rituximab-based treatments in Waldenstrom's macroglobulinemia. Clin.

25 Lymphoma Myeloma. 9: 59-61. [8] Valentine et al. (1987) ; Expression of the human B-cell surface protein CD20: alteration by phorbol 12-myristate 13-acetate Proc Natl Acad Sci U S A. 84 (22) : 8085-9. [9] Valentine et al. 1989, Phosphorylation of the CD20 phosphoprotein in resting B lymphocytes. Regulation by protein kinase C., J.Biol. Chem. 264 (19) : 11282-11287. [10] Golay et al. (1985), The CD20 (Bp35) antigen is involved in activation of B cells from the GO to the G1 phase of the cell cycle. J. Immunol., 135(6) :3795-801. [11] Tedder et al. (1986), Antibodies reactive with the B1 molecule inhibit cell cycle progression but not activation of human B Iymphocytes.J. Immunol .Lymphoma Myeloma. 9: 59-61. [8] Valentine et al. (1987); Expression of the human B-cell surface protein CD20: alteration by phorbol 12-myristate 13-acetate Proc Natl Acad Sci U S A. 84 (22): 8085-9. [9] Valentine et al. 1989, Phosphorylation of the CD20 phosphoprotein in resting B lymphocytes. Regulation by protein kinase C., J. Biol. Chem. 264 (19): 11282-11287. [10] Golay et al. (1985), The CD20 (Bp35) antigen is involved in activation of B cells from the GO to the G1 phase of the cell cycle. J. Immunol., 135 (6): 3795-801. [11] Tedder et al. (1986), Antibodies reactive with the B1 molecule inhibits cell cycle progression but not activation of human B lymphocytes. Immunol.

1986 Aug;16(8) :881-7. [12] Gertz MA et al. Multicenter phase 2 trial of rituximab for Waldenstrôm macroglobulinemia (WM): an Eastern Cooperative Oncology Group Study (E3A98). Leuk Lymphoma. 45(10):2047-55. [13] Ogmundsdottir HM et al., 1995. Familial macroglobulinaemia: hyperactive B-cells but normal natural killer function. Scand. J. immunol. 40: 195-200. [14] Vrethem M, Dahle C, Ekerfeldt C, Nilsson J, Ekstedt B, Ernerudh J. 1994. Abnormalities in T-lymphocyte populations in blood from patients with demyelinating polyneuropathy associated with monoclonal gammopathy. J. Neurol. Sci. 122: 171-178. [15] Zeldis JB et al., 2003. Potential new therapeutics for Waldenstrom's macroglobulinemia. Semin. Oncol. 30: 275-281. [16] The Journal of the American Medical Association, 199, 519 (1967). [17] Science, 122, 501 (1952). [18] Virology, 8, 396 (1959). [19] Proc. Natl. Acad. Sci. USA, 53, 288 (1965). [20] J. Experimental Medicine, 147, 923 (1978) [21] Peller S, Kaufman S, Decreased CD45RA T cells in B-cell chronic lymphatic leukemia patients: correlation with disease stage. Blood 1991, 78:1569. [22] Kimby E et al. Differences in blood T and NK cell populations between chronic lymphocytic leukemia of B cell type (B-CLL) and monoclonal B-lymphocytosis of undetermined significance (B-MLUS), 1989 Leukemia 3 (7) :501-504. [23] Soorskaar D et al., Natural killer cells in chronic leukemia. Function and markers.1986 Aug; 16 (8): 881-7. [12] Gertz MA et al. Multicenter phase 2 trial of rituximab for Waldenstrom macroglobulinemia (WM): An Eastern Cooperative Oncology Group Study (E3A98). Leuk Lymphoma. 45 (10): 2047-55. [13] Ogmundsdottir HM et al., 1995. Familial macroglobulinaemia: overactive B-cells normal purpose natural killer function. Scand. J. immunol. 40: 195-200. [14] Vrethem M, Dahle C, Ekerfeldt C, Nilsson J, Ekstedt B, Ernerudh J. 1994. Abnormalities in T-lymphocyte populations in patients with demyelinating polyneuropathy associated with monoclonal gammopathy. J. Neurol. Sci. 122: 171-178. [15] Zeldis JB et al., 2003. Potential new therapeutics for Waldenstrom's macroglobulinemia. Semin. Oncol. 30: 275-281. [16] The Journal of the American Medical Association, 199, 519 (1967). [17] Science, 122, 501 (1952). [18] Virology, 8, 396 (1959). [19] Proc. Natl. Acad. Sci. USA, 53, 288 (1965). [20] J. Experimental Medicine, 147, 923 (1978) [21] Peller S, Kaufman S, Decreased CD45RA T cells in B-cell chronic lymphatic leukemia patients: correlation with disease stage. Blood 1991, 78: 1569. [22] Kimby E et al. Differences in blood T and NK cell populations between chronic lymphocytic leukemia of B cell type (B-CLL) and monoclonal B-lymphocytosis of undetermined significance (B-MLUS), 1989 Leukemia 3 (7): 501-504. [23] Soorskaar D et al., Natural killer cells in chronic leukemia. Function and markers.

1988 Int Arch Allery Appl Immunol 87(2) ;159-164. [24] Ziegler HW et al. Deficiency of natural killer cell activity in patients with chronic lymphocytic leukemia.1981 Int J Cancer 27(3) ;321-327. [25] Chaperot L et al. 2000, Differentiation of antigen-presenting cells (dendritic cells and macrophages) for therapeutic application in patients with Iymphoma.Leukemia 14 (9) :1667-77. [26] Vuillier F, Dighiero G 2003, Cell therapy by dendritic cells in chronic lymphoid leukemia: state of the art. Bull Cancer. 90 (8-9) :744-50. [27] Kabat et al., "Sequences of Proteins of Immunological Interest", NIH Publication, 91-3242 (1991). [28] Le Garff Tavernier M, et al., 2010. Human NK cells display major phenotypic and functional changes over the life span. Aging Cell. 9: 527-535. [29] Shi J, Orth JD, Mitchison T, Cell type variation in responses to antimitotic drugs that target microtubules and kinesin-5 Cancer Res.1988 Int Arch Allery Appl Immunol 87 (2); 159-164. [24] Ziegler HW et al. Deficiency of natural killer cell activity in patients with chronic lymphocytic leukemia.1981 Int J Cancer 27 (3); 321-327. [25] Chaperot L et al. 2000, Differentiation of antigen-presenting cells (dendritic cells and macrophages) for therapeutic application in patients with Iymphoma.Leukemia 14 (9): 1667-77. [26] Vuillier F, Dighiero G 2003, Cell therapy by dendritic cells in chronic lymphoid leukemia: state of the art. Bull Cancer. 90 (8-9): 744-50. [27] Kabat et al., "Sequences of Proteins of Immunological Interest," NIH Publication, 91-3242 (1991). [28] Garff Tavernier M, et al., 2010. Human NK cells display major phenotypic and functional changes over the life span. Aging Cell. 9: 527-535. [29] Shi J, Orth JD, Mitchison T, Cell type variation in responses to antimitotic drugs that target microtubules and kinesin-5 Cancer Res.

2008 May 1;68(9):3269-76. [30] Morrison et al., Proc. Natl . Acad. Sci . U.S.A., 81, pp. 6851-55 (1984) 2008 May 1; 68 (9): 3269-76. [30] Morrison et al., Proc. Natl. Acad. Sci. U.S.A., 81, pp. 6851-55 (1984)

Claims

REVENDICATIONS1. A monoclonal antibody directed against the CD20 antigen, said antibody having antibody-dependent cell-mediated cytotoxicity (ADCC) and / or an ability to activate effector cells expressing increased FcyRlll, and having an Fc region of which at least 60% of the oligosaccharides are non-fucosylated, for its use in the treatment of Waldenstrom's disease.

The antibody of claim 1, further comprising an amount of complex oligosaccharides having increased bisection by modification of glycosylation.

An antibody according to any of claims 1 or 2, further comprising at least 20% of bisected and nonfucosylated oligosaccharides.

An antibody according to any one of claims 1 to 3, capable of being produced in a host cell expressing at least one nucleic acid encoding a polypeptide having [3- (1,4) -N-acetylglucosaminyltransferase III activity. in an amount sufficient to modify the glycosylation of the Fc region of said antibody.

The antibody of claim 1, further comprising a content of greater than 60% for the GO + G1 + GOF + G1F forms, the GOF + G1 F forms being less than 500/0.

An antibody according to any one of claims 1 or 5, further comprising, at an Asn297 glycosylation site, a glycan structure having terminal mannoses and / or non-intermediate terminal N-acetylglucosamines. w 2976811 36

7. The antibody of any one of claims 1 and 5 to 6, further comprising, at an Asn297 glycosylation site, a biantennan type glycan structure, with short chains, low sialylation.

An antibody according to any one of the preceding claims, said antibody having an Fc region of which 100% of the oligosaccharides are non-fucosylated.

An antibody according to any one of the preceding claims, produced in the YB2 / 0 rat hybridoma (YB2 / 3HL.P2.G11.16Ag.20 cell, deposited at the American Type Culture Collection under the number ATCC CRL- 1662).

10. Antibody according to any one of claims 5 to 8, produced by the clone R603 deposited under the registration number CNCM 1-3529 to the National Collection of Cultures of Microorganisms (CNCM). 20

11.The antibody according to any one of the preceding claims, wherein a variable region of each of the light chains is encoded by the murine nucleic acid sequence SEQ ID NO: 1, a variable region of each of the heavy chains is encoded by the Murine nucleic acid sequence SEQ ID NO: 2, and wherein constant regions of the light and heavy chains are from a non-murine species.

The antibody of claim 11, wherein the constant regions of each of the light chains and each of the heavy chains are human constant regions. 10 15 w 2976811 37

An antibody according to claim 11 or 12, wherein the constant region of each of the heavy chains is encoded by the human nucleic acid sequence SEQ ID NO: 3 and whose constant region of each of the light chains is encoded by the sequence of human nucleic acids SEQ ID NO: 4.

14.The antibody according to any one of claims 11 to 13, each of which is light-chain encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 5, and each of which heavy chains is encoded by the sequence murine-human chimeric nucleic acid SEQ ID NO: 6.

15. The antibody according to claim 14, wherein each of the light chains consists of the amino acid sequence SEQ ID NO: 7 and of which each of the heavy chains consists of the amino acid sequence SEQ ID NO: 8.

An antibody according to any one of the preceding claims for use as monotherapy in the treatment of Waldenstrem's disease.

An antibody according to any one of the preceding claims for use in patients who are candidates for autologous hematopoietic stem cell transplantation.

An antibody according to any one of the preceding claims for use in cytopenic patients. 25