FR2914316A1 - METHODS AND TOOLS FOR DETERMINING THE ORIGIN OF A SUBJECT. - Google Patents

Abstract

The present application relates to methods for determining the ethnogeographic origin of an individual from a nucleic acid sample. It also relates to genetic markers and tools (primers, probes, chips, etc.) that can be used to determine this origin, as well as kits and analysis tools.

Description

Introduction

  The present application relates to methods for determining the ethnogeographic origin of an individual from a nucleic acid sample. It also concerns a precise collection of genetic markers and tools (primers, probes, chips, etc.) that can be used to determine this origin, as well as kits and analysis tools. The invention can be used in research studies (migrations and / or population dispersal).

  A genetic test for determining the traits of an individual has been proposed in WO2004 / 016768. However, this test requires the analysis of a very large number of genetic markers, namely 176 AIMs (Ancestry Informative Markers). On the other hand, these markers are indifferently located in or out of the coding regions of genes. The analysis of coding sequences poses problems from a regulatory point of view in a number of countries such as France.

  Thus, there is currently no simple genetic method to obtain information on the ethnogeographic origin of an individual

  Summary of the Invention This application proposes methods and tools for determining the ethnogeographic origin of an individual. More particularly, the present invention results from the identification of precise sets of genetic markers for predicting the membership of an individual to a particular ethnogeographic group. 10

  A first object of the invention thus lies in a method for determining the ethnogeographic origin of an individual, comprising determining (in vitro or ex vivo), in a sample of nucleic acid (eg, DNA), from of the individual, alleles of a set of nucleotide polymorphisms (SNPs) located in non-coding regions of the genome, to obtain a set of alleles, this set of alleles being an indication of the ethnogeographic group to which the the individual belongs.

  Advantageously, the set of SNPs comprises at least 5 SNPs chosen from the SNPs described in Table 1, preferably at least 6, 7, 8, 9, 10, 15, 20, 25 or 30 SNPs described in Table 1. In a particular embodiment, the set of SNPs comprises at least 9 SNPs chosen from the SNPs described in Table 1. Examples of sets of SNPs that can be used in the present invention are described in the rest of the text and in the experimental part. As will be described in detail in the rest of the text, the set of alleles determined from the DNA sample of the individual is typically compared to one or more sets of reference alleles characteristic of ethnogeographic groups. , thus making it possible to calculate the probability of membership of the individual to one of these groups, for example by a Bayesian method. Advantageously, the sets of reference alleles are characteristic sets of the European, Saharan, Asian, North African and / or Indian populations, this list not being exhaustive.

  In preferred embodiments, the alleles are determined by sequencing, selective hybridization and / or selective amplification, and / or the nucleic acid sample is derived from a fluid or biological tissue of the individual; and / or the nucleic acid from the individual is amplified beforehand.

  Another subject of the present application resides in a kit that can be used for carrying out a method as defined above, comprising a set of nucleotide probes specific for at least one allele, preferably each allele, SNPs of the set of SNPs and / or a set of nucleotide primers for specific amplification of at least one allele, preferably each allele, SNPs of the set of SNPs. The nucleotide probes are advantageously immobilized on a support.

  Another object of the present application is a product (or device) comprising a support on which nucleotide probes are immobilized, said probes being specific for at least one allele, preferably each SNPs allele of the set. of SNPs defined above.

  The invention also relates to the use of a set of nucleotide probes specific for at least one allele, preferably each SNPs allele of the set of SNPs defined above and / or a set of nucleotide primers for specific amplification of at least one allele, preferably of each allele, SNPs of the set of SNPs defined above, for determining in vitro the ethnogeographic origin of an individual. The invention can be used from samples from any individual, age or origin, and can be used for example for migration and / or population dispersion studies.

  Figure Legend Figure 1. Fst between populations and overall for each marker. Figure 2. Global Fst for each marker in ascending order5

  Figure 3. Assignment of samples from sub-Saharan Africa, East Asia and Europe to the genetic groups deduced from the analysis of the 32 SNPs of the study (Groups I to v) by Bayesian calculation. Each individual is represented by a vertical line partitioned in X segments that represent the fraction belonging to each X genetic group. The origin of individuals is as follows: 1 to 115 (sub-Saharan Africa); 116 to 231 (East Asia) and 232 to 348 (Europe).

  Figure 4. Ethogeographic inference on genotypes of the 9 group I SNPs (Fst> 0.8) of individuals from sub-Saharan Africa (1 to 115), East Asia (116 to 231), Europe ( 232 to 348).

  Figure 5 Ethnogeographic inference on the genotypes of the 32 SNPs of the study (Groups I to v) of individuals from sub-Saharan Africa (1 to 115), East Asia (116 to 231), Europe ( 232 to 348), northern Africa (349 to 463) with 3 genetic clusters (X = 3).

  Figure 6 Ethnogeographic inference made on the genotypes of the 32 SNPs of the study (Groups I to V) of individuals from sub-Saharan Africa (1 to 115), East Asia (116 to 231), Europe ( 232 to 348), northern Africa (349 to 463) with 4 genetic clusters (X = 4).

  Figure 7 Ethnogeographic inference made on the genotypes of the 32 SNPs of the study (Groups I to v) of individuals from sub-Saharan Africa (1 to 115), East Asia (116 to 231), Europe ( 232 to 348), North Africa (349 to 463) and India (464 to 519) with 5 genetic clusters (X = 5).

  Detailed Description of the Invention

  The study of human diversity and population structure has been the subject of much research in recent years. Lewontin5, one of the pioneers of this research, found by studying a large number of biochemical markers of blood groups on different populations that 85.5% of variations were observed within populations while only 6.3% of differences were observed between populations. populations. The conclusion was, therefore, that the majority of the differences residing within populations themselves, the very notion of race had no genetic reality. Further diversity studies were then conducted with the analysis of DNA markers on autosomes (by distinction with mitochondrial DNA and Y chromosome) of the RFLP, STR and SNP6 type. The conclusion remains the same as that of Lewontin: about 83 to 88% of autosomal variations are found within populations while 9 to 13% are found between continental groups. This extreme similarity between human populations can be largely explained by the recent origin of an ancestor common to all populations in Africa7'8.

  After the sequencing of the human genome and despite all the advances made in the biomedical field, the genetic factors causing common diseases remain largely unknown. The international project HapMap9,1o, launched in 2002, aims to map all the variations common to individuals among the 3 billion pairs of nucleotides that make up the human genome, and to define the structure of link blocks. This study was conducted on 270 DNAs from 3 different continental populations (Africa, Asia and Europe) which makes it possible to avoid listing the rare polymorphisms. A project similar to the HapMap project, carried out by the company Perlegen, made it possible to map 1,586,383 SNPs distributed uniformly along the genome in 71 individuals from 3 populations (Africa, Asia and Europe). which are physically close are often linked together, the phenomenon of linkage disequilibrium remains complex and varies from one region of the genome to another and also between populations. 12 With regard to association studies, their success resides in the estimation of the allelic difference of certain markers between a cohort of disease patients (the cases) and healthy individuals (the controls), thus the search for low genetic effects may be biased if There is a stratification between the two populations compared.13,14 The study of markers with population specificities can thus make it possible to detect possible stratifications between both cohorts A new methodology for the genetic study of complex diseases is linkage disequilibrium mapping in mixed populations (MALD) 16'17 The MALD is based on the analysis of mixed-origin patients such as Africans American or Hispanic Americans. MALD must perform well in the case of more frequent diseases in some populations18 (examples: multiple sclerosis where the genetic risk is higher in Europeans, prostate cancer more common among Africans). In this perspective, many teams are working to build a dense mapping of markers distributed along the genome and showing a big difference between parental populations.19 A simple measure of population differentiation is the Fst (Wright's fixation index) statistic. which measures the fraction of total genetic variation due to inter-population differences. The Fst is quantified by the variation of the allelic frequency on the tested loci and on a set of population. Its value is between 0 (no genetic difference) and 1 (fixed difference between populations) 20. Its calculation is a means of detecting any natural selection signatures that then engender a systematic deviation of Fst for the gene under selection and the surrounding genetic markers22'23. The most obvious natural selection phenomenon in humans is that of the Duffy blood group locus, consisting of 3 alleles FY * B, FY * A and FY * 024. The 3 alleles show a very strong differentiation according to the geographic regions considered. Thus, the distribution of the silent allele (which corresponds to an absence of Fy antigen on red blood cells) is superimposed on the endemic areas of Plasmodium vivax-related malaria and is fixed in sub-Saharan populations23'25'26. This silent phenotype is due to a transition within the promoter of the FY * B gene (Blood group duffy system [MIM 110700]). Another example of selection is the capacity to digest milk in adulthood (lactase persistence [MIM 223100]), a characteristic that varies with the populations associated in Europeans with two polymorphisms located far upstream of the lactase gene. The allelic frequency of these SNPs is very variable between populations of European and African / Asian origin27'28'29. The Fst study of more than 20,000 SNPs distributed in the genome suggests that at least 174 genes would be subjected to natural selection30. Recently, Hinds et al. have questioned this systematic approach to the genome by pointing out that strong Fst are localized as much in gene regions as nongenic and similarly affect non-synonymous, synonymous coding SNPs. "The ideal genetic markers for distinguishing two populations are therefore, those with allele binding in one population and its absence in the other In reality, such so-called private loci are rare in the general population. coding and non-coding, they do not seem to be the products of natural selection.

  The present application results from the identification of precise and selected genetic markers to allow the characterization of the ethnogeographic origin of individuals. More specifically, the invention shows that the ethnogeographic origin of individuals can be determined on the basis of a limited number of genetic markers located in non-coding regions of the genome. Thus, 32 SNPs were selected and tested on a panel of individuals from 5 populations (Europe, Asia, Africa, North Africa and India). The genotyping of the SNPs was performed by the allelic discrimination technique which combines the amplification of the DNA portion carrying the variant and the detection of this variant using two probes specific to one or the other of the alleles. A panel of about 100 DNAs per population was tested for each individual while the population of India was characterized on 56 DNAs. Genotyping each of these SNPs allowed us to calculate the allelic frequency of each SNP in each of the groups. These SNPs have a very different frequency between the DNAs of sub-Saharan Africa, Asia, Europe and North Africa.

  The genetic markers identified are not directly correlated with a very distinctive phenotypic character between populations, as is for example the color of the skin. Indeed, this character is linked to extremely strong selection forces, which implies that the same skin color can reflect a common adaptation as well as a common genetic origin. So even though sub-Saharan Africans, tribal people in southern India, and aboriginals have similar skin pigmentation, they do not have more similarity with each other than with other populations.

  In addition, the identified genetic markers are located in non-coding regions of the genome.

  Moreover, the markers used are preferentially localized on the most possible chromosomes and, in the case where they are located on the same chromosome, the most distant possible.

  Finally, the markers of the invention are of the SNP type, and are mainly transitions or transversions, which facilitates their analysis. Single nucleotide polymorphisms (SNPs) are the most abundant form of variation in the human genome and it is estimated that the global population shares about 10 million sites (or 1 variant every 300 bases) 9. They correspond to the change of a single nucleotide, by transition, transversion, insertion or deletion, on a DNA sequence.

  The list of identified SNPs is described in Table 1 with, for each SNP, the two alleles encountered. This list makes it possible to define (sub) sets of SNPs characteristic of the ethnogeographic origin of human individuals, comprising at least one, preferably at least 5 SNPs represented in Table 1. It is understood that these sets of SNPs can also include additional SNPs.

  A first object of the invention thus lies in a method for determining the ethnogeographic origin of an individual, comprising determining, in a sample of DNA from the individual, the alleles of a precise set of SNPs located in non-coding regions of the genome, said set comprising at least 5 SNPs selected from the SNPs described in Table 1, preferably at least 6, 7, 8, 9, 10, 15, 20, 25 or 30 SNPs described in FIG. Table 1, to obtain a set of alleles, this set of alleles being an indication of the ethnogeographic group to which the individual belongs.

  In a first particular embodiment, the set of SNPs comprises all 32 SNPs mentioned in Table 1, and the method comprises a determination of each allele of said SNPs.

  In another embodiment, the set of SNPs comprises at least the 9 SNPs of group I as defined in Table 4, namely the SNPs M1, M2, M5, M6, M7, M9, M15, M24. and M30. Such a set of SNPs makes it possible to determine the membership of an individual in the African, Asian or European group.

  In another embodiment, the set of SNPs comprises at least 5 SNPs among the SNPs M1, M2, M3, M4, M5, M6, M7, M8 and M9. Such a set of SNPs makes it possible to determine the membership of an individual in the African group (see Table 3 for specific alleles).

  In another embodiment, the set of SNPs comprises at least the SNPs M20, M21, M22, M23, M24, M25, M26, M27, M28, M29, M30, M31 and M32. Such a set of SNPs makes it possible to determine the membership of an individual in the European group (see Table 3 for specific alleles).

  In another embodiment, the set of SNPs comprises at least 5 SNPs among the SNPs M10, M11, M12, M13, M14, M15, M16, M17, M18 and M19. Such a set of SNPs makes it possible to determine the membership of an individual in the Asian group (see Table 3 for specific alleles).

  Examples of population-specific reference profiles are provided in Table 10.

  It is understood that the set of SNPs may be supplemented by other markers or SNPs, in order to further refine the method, if this is useful. Nevertheless, the sets of markers of the invention can make it possible to determine the ethnogeographic origin of the individuals with total reliability.

  The determination of the set of alleles can be performed simultaneously, parallel or sequentially.

  Various techniques can be used to determine alleles of a SNP in a sample, such as, for example, allele-specific hybridization (5 'nuclease assay, LightCycler, hybridization on chips, etc.), primer extension. (mini-sequencing, SNAPshot, pyrosequencing, allele-specific extension, mass spectrometry), oligonucleotide-specific ligation, invasive cleavage, sequencing, selective hybridization, use of probed oligonucleotide-coated carriers, nucleic acid amplification, or ligation-PCR or any molecular biology technique useful for genotyping. These methods may include the use of a nucleic probe (eg an oligonucleotide) capable of selectively or specifically detecting an SNP allele in the sample. The amplification can be carried out according to various methods known per se to those skilled in the art, such as PCR, CSF, strand displacement amplification (SDA), the use of oligonucleotides specific for alleles ( ASO), allele-specific amplification, Southern blotting, SSCA conformational analysis, electrophoresis, etc.

  Several detection methods can be used to analyze the products of each type of reaction: fluorescence, luminescence, size measurement, mass measurement, etc.). Moreover, the reaction can be carried out in solution or on a solid support.

  According to a preferred embodiment, the method comprises the detection of the presence or absence of an allele by selective hybridization and / or by selective amplification.

  Selective hybridization is typically performed using nucleic probes, preferably immobilized on a support, such as a solid or semi-solid support having at least one surface, flat or not, allowing the immobilization of nucleic probes. Such supports are for example a blade, ball, membrane, filter, column, plate, etc. They can be made of any compatible material, such as glass, silica, plastic, fiber, metal, polymer, etc. Nucleic probes can be any nucleic acid (DNA, RNA, PNA, etc.), preferably single-stranded, comprising a specific sequence of an allele of an SNP. The probes typically comprise from 5 to 300 bases, preferably from 8 to 150, more preferably less than 100, and even more preferentially less than 60, 50, 40 or 30 bases. The probes may be synthetic oligonucleotides, produced on the basis of the sequences of the alleles to be detected, according to conventional synthesis techniques. Such oligonucleotides typically have from 10 to 50 bases, preferably from 20 to 40, for example about 25 bases.

  In a particular mode of implementation, several different oligonucleotides (or probes) are used to detect an allele of interest. This may include specific oligonucleotides centered differently on the SNP to be analyzed.

  In another embodiment, one can use, for analyzing each biallelic SNP, a pair of probes whose one member is perfectly matched to one of the alleles and whose other member is perfectly matched to the other allele. Of course, it is possible to combine these two embodiments.

  Specific examples of probes usable for the implementation of the invention are described in Table 2.

  The probes may be synthesized beforehand and then deposited on the support, or synthesized directly in situ, on the support, according to methods known per se to those skilled in the art. The probes can also be manufactured by genetic techniques, for example by amplification, recombination, ligation, etc.

  The probes thus defined constitute another object of the present application, as well as their uses (essentially in vitro) for determining the ethnogeographic origin of an individual.

  Hybridization can be carried out under standard conditions known to those skilled in the art and adjustable by it (see, for example, Sambrook et al., (1989) Molecular Cloning, Cold Spring Harbor Laboratory Press). In particular, the hybridization can be carried out under conditions of high, medium or low stringency, depending on the desired level of sensitivity, the quantity of available material, etc. For example, appropriate hybridization conditions include a temperature of 55 to 65 C for 2 to 18 hours. After hybridization, different washes can be performed to remove unhybridized molecules, typically in SSC buffers comprising SDS, such as a buffer comprising 0.1 to 10 X SSC and 0.5-0.01% SDS.

  The selective amplification is preferably carried out using a primer or a pair of primers for amplifying a region of the nucleic acid carrying the SNP to be analyzed. The primer may be specific for a sequence of the SNP or a region flanking the sequence of the SNP in a nucleic acid of the sample. The primer typically comprises a single-stranded nucleic acid, preferably between 5 and 50 bases in length, preferably between 5 and 30.

  Specific examples of primers usable for the implementation of the invention are described in Table 2.

  Such primers are another object of the present application, as well as their use (essentially in vitro) to determine the ethnogeographic origin of an individual.

  In this regard, another object of the invention lies in the use (in vitro) of a nucleotide primer allowing the amplification of an SNP as defined above to determine the ethnogeographic origin of an individual. Another particular object of the invention resides in the use (in vitro) of a set of nucleotide primers allowing the amplification of a set of SNPs as defined above, to determine the ethnogeographic origin of An individual The method of the invention can be performed from any sample comprising nucleic acids. Advantageously, a sample of tissue (bone, muscle) or biological fluid comprising nucleic acids, typically a sample of blood, sperm, saliva, urine, stool, hair, skin, etc., may be advantageously mentioned. The method may further be practiced from partially damaged, degraded nucleic acid and / or in very small amounts.

  The sample may be obtained by any technique known per se, for example by sampling, by non-invasive techniques, from collections or sample banks.

  The sample may also be pre-treated to facilitate the accessibility of the nucleic acids, for example by lysis (mechanical, chemical, enzymatic, etc.), purification, centrifugation, separation, dilution, etc. The sample can also be labeled, to facilitate the determination of the presence of nucleic acids (fluorescent, radioactive, luminescent, chemical, enzymatic labeling, etc.).

  In addition, the nucleic acids of the sample can be amplified prior to the SNP analysis step.

  According to a particular example of implementation of the invention, a sample of the individual is taken. The sample is optionally processed to make the nucleic acids more accessible and / or to amplify the nucleic acids (or a fraction thereof). The nucleic acids are then brought into contact with nucleic probes as defined above (optionally immobilized on a support) and the hybridization profile obtained is determined, making it possible to determine or predict the ethnogeographic group of membership of the individual. Alternatively, the nucleic acids are brought into contact with nucleic primers as defined above and the amplification product is analyzed, making it possible to determine or predict the ethnogeographic group of membership of the individual.

  Another subject of the present application resides in a kit usable for the implementation of a method as defined above, comprising a set of nucleotide probes specific for at least one allele, preferably each allele, SNPs. a set of SNPs as defined above and / or a set of nucleotide primers allowing specific amplification of each SNP of a set of SNPs as defined above. The nucleotide probes are advantageously immobilized on a support.

  The term "specific", when referring to hybridization or amplification, refers to the fact that hybridization or amplification makes it possible to discriminate, according to the conditions used, between two alleles of an SNP. Thus, a specific probe of an allele hybridizes, under appropriate conditions, only to this allele. Similarly, a specific primer of an allele makes it possible, under appropriate conditions, to amplify only this allele.

  Another object of the present application resides in a product (or device) comprising a support on which nucleotide probes are immobilized, said probes being specific for at least one allele, preferably each SNPs allele of a set of SNPs. defined above. The support can be any solid or semi-solid support having at least one surface, flat or not, allowing the immobilization of nucleic acids or polypeptides. Such supports are for example a blade, ball, membrane, filter, column, plate, etc. They can be made of any compatible material, such as glass, silica, plastic, fiber, metal, polymer, polystyrene, teflon, etc. The reagents can be immobilized on the surface of the support by known techniques, or, in the case of nucleic acids, synthesized directly in situ on the support. Immobilization techniques include passive adsorption 321a covalent bonding. Techniques are described for example in WO90 / 03382, WO99 / 46403. The probes immobilized on the support can be ordered according to a pre-established scheme, to facilitate the detection and identification of the complexes formed, and in a variable and adaptable density.

  The invention can be used to determine the probability of membership of any individual to any ethnogeographic group, such as for example the European, Saharan African, Asian, North African and / or Indian populations, this list not being exhaustive.

  Other aspects and advantages of the present invention will appear on reading the examples which follow, which should be considered as illustrative and not limiting.

  EXAMPLES 1. Materials and Methods 1.1. Marker Selection An exhaustive study of each chromosome was conducted on the National Center for Biotechnology Information (NCBI) SNPs database (dbSNP), searching for genotyped SNPs from the 3 East Asian populations. , from Europe and Africa those with the most difference between allelic frequencies. This resulted in the selection of about 100 SNPs distributed in the genome. Among these SNPs, the 32 with the highest discriminating power were retained.

  The complete sequence of the 32 SNPs is presented in Table 1.

  The selected genetic markers are all SNPs and are transitions or transversions. all markers were selected from non-coding regions of the genome. In addition, efforts have been made to select markers for as many chromosomes as possible and, in the case where they are located on the same chromosome, the most distant possible for a given marker group. The SNPs of our study were selected on the basis of their discriminant allelic frequency between the 3 continental populations of Africa, Asia and Europe.

  Of the 32 SNPs selected, only the SNPs associated with the GUCY2D19, FY33 and LAC28 genes (respectively M31, M9, M32) have been described in the literature as having possible allelic discrimination between populations. However, no set of SNPs according to the invention has been described previously, making it possible to provide reliable information on the ethnogeographic membership of individuals.

  Table 3 shows the distribution of the alleles of each marker among the different populations. We can distinguish 3 groups: SNPs allowing to distinguish the Africans from the Europeans and the Asians: group M1 to M9 SNPs making it possible to distinguish the Asians from the Europeans and the Africans: group M10 to M19 30 SNPs making it possible to distinguish the Europeans from the Africans AND the Asians : group M20 to M32 We favored markers with maximal allelic differences between populations because, for biallelic markers such as SNPs, we can consider that the informativeness will be maximum if one of the alleles is limited to a single population . .2. DNA samples

  The validation of the markers was carried out in two stages. Firstly, a first-order screening of 24 DNAs from 3 different continental origins (sub-Saharan Africa, East Asia and Europe: prescreening plate) allowed the selection of markers with the most discriminating allelic frequency between these three groups. The genetic markers selected for the study were then tested on a panel of 92 individuals per population.

  In addition to validating our markers on the 3 populations mentioned above, we tested the 10 DNAs of 112 North African and 56 Indian individuals.

  All these individuals come from grandparents from the geographical area of interest. The DNAs were extracted from the donor blood using the Nucleon Bac2 kit (Amersham) and quantified by the Quantifier kit (Applied Biosystems). 1.3. Validation of markers by Taqman

  Taqman primers and probes of all markers were custom synthesized (Custom TaqMan SNP Genotyping Assays, Applied Biosystems, Table 2) with the exception of the 20 markers GUCY2D and FY null for which TaqMan marketed tests were exploited. SNP Genotyping Assays (respectively C_11951988_20, C_15769614_10, C_3211308_20, Applied Biosystems). For each of the tests, an allelic discrimination PCR was carried out in a reaction volume of 11 l in the presence of 5 ng of DNA, 5.5 gl of Taqman Master Mix (Applied Bioystems) and 0.275 of 40X of TaqMan's Custom SNP Genotyping Assays, ie 0.55 l of 20X of TaqMan SNP Genotyping Assays. After amplification on thermal cycler 7500 (15 min at 95 followed by 40 cycles of 15 sec at 92 and 1 min at 60) the plate is read in end point, and all data is interpreted using Sequence Detection System software 1.2 (SDS 1.2, Applied Biosystems). The genotypic data for all SNPs tested are expressed as 11 (homozygous allele 1), 12 (heterozygous) and 22 (homozygous allele 2). 1.4. Estimation of Fst and analysis of ethnogeographic inference:

  The differentiation of populations for each of the loci was estimated using Wright's Fst fixation index calculated using the Weir and Cokerham formulas. 34,35 A software, based on Bayesian calculations, calculates the inference of individuals to an ethnogeographic group This program uses genotypic data from several independent loci to search for population structure. For each individual, the software estimates the proportion of membership in relation to each population subjected to the calculation. 2. Results 2.1. Distribution of Fst

  After the compilation of all the Taqman genotypes, the proportion of the variation attributed to the differences between populations (Fst) was calculated for each pair of population and for each locus (Figure 1), a high value of Fst reflects the a population shows a large difference in allelic frequency with respect to the other one or two (global Fst). The differentiation between the populations of Europe and East Asia, as reflected by the Fst Europe Asia, is obtained with markers M10 to M32 whereas the loci M1 to M9 remain monomorphic in these two populations (Fst close or equal to 0). Discriminant loci have an interpopulation Fst greater than 0.4 apart from the M17 and M22 markers. Europe differs significantly from Africa by the markers Ml to M9 and M20 to M32, with Fst greater than 0.5 (except for the M20 to M23 loci) and this time the 25 markers M10 to m19 which present a very weak differentiation. Markers M1 to M19 distinguish Africa from Asia, while values close to zero are observed for M20 to M32.

  With regard to the global Fst, it is undeniable that the markers M1 to M9 have the strongest Fst, greater than 0.70, which shows that for these markers a very small part of the observed variance (less than 30 %) is due to differences within populations. The markers M10 to M32 generally have an Fst of between 0.41 and 0.92. On the other hand, some values of Fst indicate a weak diversification for the markers M17, M21, M22 (Fst of 0.23 to 0.37).

  A hierarchy of the informativity of the markers can be established according to the values of Fst (Figure 2). Of the five groups of markers (Table 4), group I collects the most informative SNPs whose Fst are greater than 0.80. It can be noted that these are mainly markers discriminating Africa from Europe and Asia. Groups II to IV include markers whose Fst are between 0.40 and 0.80. The markers M17, M21 and M22 of the group V are the least discriminating with Fst less than 0.4.

  2.2. Inference of ethnogeographic origin 2.2.1. Inference with the 32 group I to v markers

  All genotypes of the 32 markers on DNA from Africa (n = 115, DNA 1 to 115), Asia (n = 116, DNA 116 to 231) and Europe (n = 117, DNA 232 to 348) were submitted to the Baysesian calculation software without the label of the population. . The assignment of each DNA of different origin to genetic groups is illustrated in Figure 3. The 3 genetic clusters defined by the algorithm separate the 3 populations of Sub-Saharan Africa, East Asia and Europe without ambiguity. It thus appears that the assignment and clustering based on the analysis of the 32 SNPs selected, are in perfect agreement with the ethnogeographic origin of the individuals.

  The reliability of the test for samples from sub-Saharan Africa, East Asia and Europe is absolute since all submitted samples are correctly assigned. 2.2.2.Inference with the 9 markers of group I

  We then tested whether group I markers with the highest informativeness were sufficient to determine ethnogeographic origins in Bayesian computation (Figure 4). Submission of the only genotypes of the M1, M2, M5, M6, M7, M9, M15, M24, M30 markers is sufficient to distinguish 3 genetic clusters within the 3 populations of different origin. The samples are all correctly assigned, even if the calculation with the only 9 SNPs in group I shows a slight proportion of admixture, especially in Asians, not observed with the 32 markers.

  The 9 markers of group I are therefore sufficient to distinguish the 3 genetic clusters present in the populations of Africa, Asia and Europe. The use of the 32 markers mi to M32 makes it possible to refine the proportions of membership of each individual. This is due to the fact that among the 9 markers, only one allows the discrimination Asia versus Africa / Europe (M15) and two differentiate Europe from Asia and Africa (M24 and M30).

  The determination of the ethnogeographic origin of individuals with only 9 markers is therefore perfectly reliable, but at the individual level the proportion of belonging to the original group with all the markers is better. 2.3. Inference of the ethnogeographic origin of intermediate populations

  After having validated our test on the 3 continental populations of Africa, Asia and Europe, we sought to determine the ethnogeographic origins of two intermediate populations by selecting individuals from North Africa (n = 115) and from India (n = 56).

  The genotypes obtained for the North African population were integrated with those of the 348 DNAs from Africa, Asia and Europe and subjected to Bayesian calculations (Figures 5 and 6). If we consider 3 genetic groups (Figure 5), the Bayesian algorithm separates populations 20 from Africa, Asia and Europe while the North African population presents itself as a mixture of the 3 preceding groups with a very strong predominance from the Europe group. Some individuals, however, have a strong affiliation to the African genetic cluster (N 367-389-423-448-454). If this time we consider 4 genetic groups (Figure 6), the population of North Africa 25 then appears as a separate genetic group, separate from the other 3. On average, 81.2% of the genetic pool of the North African population belongs to this fourth cluster, which underlines the entity of this group. It is interesting to note that this fourth group is the result of a separation of the Europe group and that individuals with strong mixtures with Africa generally have the same admixture proportions (N 367-389-423-454). In spite of this fourth cluster, some individuals still have a stronger European affiliation (N 401-408-424-446). Similarly, a certain proportion of miscegenation with the fourth cluster, inherent to the strong similarity between certain North African and European genotypes, appears in certain European individuals (N 401-408-424-446) .10 Inclusion of Indian samples to the previous 4 populations leads to a simulation on 519 samples (Figure 7) and leads to a new genetic cluster that defines the native population of India. As for North Africa, the European component is very important for some individuals (N 466-475).

  It is very clear in Figure 7 that among the individuals in northern Africa and India, which remain characterized by a genetic cluster of their own, many have a very high percentage of membership in the other three. groups. This represents a very strong contrast with sub-Saharan, Asian and European individuals. 3. Discussion

  We have shown by the analysis of 32 SNPs on a collection of DNA from sub-Saharan Africa, East Asia and Europe that the genetic data make it possible to assign with total reliability the samples to corresponding groups major continental areas. Previous studies had shown that a minimum of 60 Alu sequences or microsatellites 36 or very recently 10 SNPs 37 were necessary for the proper assignment of samples. In our case, the use of the 9 markers with the highest Fst values is sufficient to determine the ethnogeographic origin of the individuals. In addition, the total number of markers remains very modest and easy to implement from a technical point of view. Moreover, it appears that even if the markers of the invention have been selected for their discriminant allelic frequencies between the populations of Africa, Asia and Europe, they also make it possible to distinguish the populations of North Africa and Africa. 'India. These last two populations appear as intermediaries with the populations Asia and Europe because of the chosen markers and the respective histories of settlement. In the case of an analysis comprising 3 genetic groups, North Africa is assigned mainly to Europe while India is included in the Asia cluster. Table 1. List of SNPs

  Refs SNP ID: rs2814778 Allele Organism: human (Homo sapiens) Alleles: A / G Molecule type: Genomic GGCTGTCAGCGCCTGTGCTTCCAAG [A / G] TAAGAGCCAAGGACTAATGAGGGCC Ref SNP ID: rs2816 Allele Organism: human (Homo sapiens) Alleles: C / T Type Molecule: Genomic ACACTGCATTGCTGGGCTGTGTTCC [C / T] CGGGCTCTTCTGGACCTTGCACCGT Ref SNP ID: rs182549 Allele Organism: human (Homo sapiens) Alleles: C / T Molecule type: Genomic actgggacaaaggtgtgagccaccg [C / T] gcccagctGAGAATGCTGTTTTTAA Ref SNP ID: rs2335853 Allele Organism: human ( Homo sapiens) Alleles: A / G Molecule type: Genomic 15 CTCGTTAATGGGTACTCAGTGAATC [A / G] CAAACTCTTAAGGATAGAAAGGGGT

  Ref SNP ID: rs2495813 Allele Organism: human (Homo sapions) Alleles: C / T Molecule type Genomic ACATTTCTTGTACTCAGGGCTGGTG [C / T] TATGGGAGAGCTGGAGGTTGCTGTC 20 15 21

  Ref SNP ID: rs857455 Allele Organism: human (Homo sapiens) Alleles: A / G Molecule type Genomic aaaatctttgtgaaagtttctctgt [A / G] tggagataaaaagatggtacccgtg Ref SNP ID: rs7326934 Allele Organism: human (Homo sapiens) Alleles: C / G Molecule type Genomics GTGATTTCAAGCATCCTGATTTACA [C / G] TTGCTCACTCAGCCACTCAGAGATG Ref SNP ID: rs17031237 Organism: human (Homo sapiens) Molecule type Genomic GCGAGCACCAGAAATGACAGGCTCA [C / G] TGGGGACACGGCAGATAGGTCCCCG Ref SNP ID: rs8079412 Allele Organism: human (Homo sapiens) Alleles: An 'Type of genomic molecule TGATTATTTCCATTTCACTGATGAG [A; T] TATACAGTCCCAGGAAGGGCAGGTG Ref SNP ID: rs17092950 Allele Organism: human (Homo sapiens) Alleles: C / G Molecule type Genomic AGCTCACTAGACTACAGGTAAGGAG [C / G] AGACAGACAGTAAACAAATCATGGA Ref SNP ID: rs12261591 Organism: human (Homo sapiens) Molecule Type Genomic Allele Alleles: C / G Allele Alleles: C / T 15 22 CTAGGGCAAATGAAAGAGGGAAACA [C / T] GGATGGCATGGATGCTTTCAGAAGA

  Ref SNP ID: rs522153 Organism: human (Homo sapions) Molecule type Genomic AGTGACAGATAAAGTGAAGGGCAAT [AIG] ATTTCTGACATTTGCTGCCAGGATC Ref SNP ID: rs4427950 Allele Organism: human (Homo sapions) Allel: C / T Molecule type Genomic TGCTGTGTGTTACAATAGCCCTACA [C / T] AGGCTTTGGAAACAATAACACAACC Ref SNP ID: rs2007542 Allele Organism: human (Homo sapions) Alleles: C / T Molecule type Genomic CTCAACAGGGGTTCTGATGATTTGC [CIT] ATctgcagttatctggagacttgag Ref SNP ID: rs1389600 Allele Organism: human (Homo sapions) Alleles: G / T Molecule type Genomic TTAGTAAGGTGGAAGAAGACCCTAT [G / T] CAATGGGTGGCACTATCTCCATATT Ref SNP ID: rs12594144 Allele Organism: human (Homo sapions) Alleles: A / C Molecule type Genomic CAGTCTGGGTCCTAATTGTTTGTGA [A / C] TCTTTTTCAGGGTGGGAGCAGGGTG Ref SNP ID: rs4830702 Allele Organism: human (Homo sapiens) Alleles: A / G Allele Alleles: A / G 15 23 Molecule Type Genomic GTGAGGGGAGAGCTGCTTCAGACGA [A / G] GGTGAGGAGTGACATGGACAGTGTG

  Ref SNP ID: rs10918999 Allele Organism: human (Homo sapiens) Alleles: C / T Molecule type Genomic TTTGATTGGATTTCCATTTTCAGGG [CT] ATAATCCATTTTCAAGATGTATCAA Ref SNP ID: rs16867765 Allele Organism: human (Homo sapiens) Allèles: NT Molecule type Genomic TCAAGATCTGTCACGGGAAGAATTT [A / T] AAAAAACTGGCGGCTAAGCAGAATG Ref SNP ID: rs16938528 Allele Organism: human (Homo sapiens) Alleles: A / G Molecule type Genomic GTTTCACATTAGCGATAACGAGAGA [A / G] CTGGTGAGATCTTCTTCCCAGAATG Ref SNP ID: rs10842028 Allele Organism: human (Homo sapiens) Alleles: C / T Molecule Type Genomic CACTCTCACCTTGGTTAGGCCTGTG [C / T] GTCTCTCATAGATCCTTGTTACAGC Ref SNP ID: rs4414866 Organism: human (Homo sapiens) Molecule type Genomic ACTTTGTATTGTTTTCTCCCAG [C / T] GATGCAAATTATATTAAATATAATA Allele Alleles: C / T 10 15 24

  Ref SNP ID: rs1297321 Allele Organism: human (Homo sapiens) Alleles: A / G Molecule type Genomic CTGAAACCATCAGATAACACAAATC [A / G] TGATGGCTAAAATACATTGTTGAAC Ref SNP ID: rs7161203 Allele Organism: human (Homo sapiens) Alleles: A / C Molecule type Genomic TATCTAGCTTAGAACATCCCTAAGA [A / C] GTCAGTTGTTCATATTTTGACAGCA Ref SNP ID: rs1441098 Allele Organism: human (Homo sapiens) Alleles: A / T Molecule type Genomic CGCTTGCCAAGAGTGTGGAATCTCA [A / T] TTCTTCCCACCTTCCTACCATCTTT Ref SNP ID: rs35397 Allele Organism: human (Homo sapiens) Alleles: G / T Molecule Type Genomic TCAGTGTCTTCACAGCTGCAACTTA [G / T] GTAAGTGGAGGTTAAGAGGCTCAGA Ref SNP ID: rs10189663 Allele Organism: human (Homo sapiens) Alleles: A / T Molecule type Genomic TTCTTCTTCCATAAAATGCACCACC [A / T] TGGACAGTCAAAAGAAGTAATTTAA Ref SNP ID: rs260692 Allele 15 25

  Organism: human (Homo sapiens) Alleles: C / T Molecule type Genomic AATGTTTGGAAATAATTCCACAAAC [C / TJGTGTAGCATGACAAAAACATACTTA Ref SNP ID: rs7866023 Allele Organism: human (Homo sapiens) Alleles: C / T Molecule type Genomic GGAGTAGAAACTACTCTCTGCAGCA [C / T] GTACTTTCATTTTATACCCTACCAG

  Ref SNP ID: rs5981317 Allele Organism: human (Homo sapiens) Alleles: C / T Molecule type Genomic TTACGCACTGCCTAGAGTACAGCTA [C! T] GAAGACAATTTTCTAATTCACAGAA Ref SNP ID: rs973649 Allele Organism: human (Homo sapiens) Molecule type Genomic tatagcacacagcgctcaaaagata [C T ctgtGagccaggtgtgctggccctg

  Ref SNP ID: rs2413887 Organism: human (Homo sapiens) Molecule type Genomic

  GAATCAGTTTTATAACTGGGGACTT [C / r] TGTTTTTAATAATATTTTGTTATTA Alleles: C / T Allele Alleles: C / T 20 Table 2. List of primers and probes used in custom synthesized Taqman assays. Sequence forward primer (Forward) primer sequence Reverse probe 1 allele allele probe 2 M1 ACCCCAACCCCTTTCTATCCTTAA CCCAGAAGTGGCTCGTTAATGG TCAGTGAATCACAAACT TCAGTGAATCGCAAACT M2 GGCTGCTACCAGGAAATTTCG CTGCATGGTCTCATAGGTGACA CTCTCCCATAGCACCAG CTCTCCCATAACACCAG M3 AGTTCAAATCTTTTCACGGGTACCA AACTTGTTTGATGAGTTTTGCCTTGT AAAGTTTCTCTGTATGGAGATA TTTCTCTGTGTGGAGATA M4 TGGCGGAAAGAGGTGTTTATTAGG CAAAATCATCTCTGAGTGGCTGAGT CCTGATTTACAGTTGCTC CCTGATTTACACTTGCTC M5 GGACTGTGATGCCCCAACA CCCACCGTGTGCACATG CCCCAGTGAGCCTG CCCCACTGAGCCTG M8 CTTTGAGCCCATTTTGTCTTGTGA GGTTATTCACCTGCCCTTCCT ATTTCACTGATGAGTTATACA TTCACTGATGAGATATACA M7 ACTGTGAGAGCTCACTAGACTACAG AGCTCTCATCACCTCTAGTTTCCAT CTGTCTGTCTGCTCCTTA CTGTCTGTCTCCTCCTTA MB GCTGTGACTAGGGCAAATGAAAGA TCCATGTCTCTTCTTCCAGTTTCAAAA CCATCCGTGTTTCC CCATCCATGTTTCC M10 CAGCATTGGCCTAGACTAAGTCA CACTACAGTAAAGTGTCAGTOACAGA ATGTOAGAAATCATTGCC AATGTCAGAAATTATrGCC Mil CATCTCTGCTGTGTGTTACAATAGC TGGCAGGGTGTGAAATACAQATTG TTTCCAAAGCCTGTGTAGG TTTCCAAAGCCTATGTAGG M12 CCAGTCTCACTCAAG TCTCCAGAT CTTCCTCTGGGTGTCTCAACAG AACTGCAGATAGCAAAT CTGCAGATGGCAAAT M13 CATCATTGAAAATATGGAGATAGTGCCAC CCAACTCAGCTATAGGGTGGTTAGT AAGAAGACCCTATTCAATGG AAGACCCTATGCAATOG M14 CCTACAAGACCCTCTCCTACAAGAC GGACCCATGGTCATTCCATAACC AATTGrTTGTGACTCTTTT TTGTTTGTGAATCTTTT M15 GGGCTQGCGGTGAGG GGTCAOACTGTCCATGTCACT TTCAGACGAGGGTGAG CTTCAGACGAAGGTGAG M18 TCTATGTTTGGAGCATGAGGAAGTTC TCCCTATTGCAAAGTTGATACATCTTGA CATTTTCAGGGTATAATC TTCAGGGCATAATC MIT TCCCTAGAAAATCACTCAAQATCTGTCA AAAAGAGTTTTTCACATTCTGCTTAGCC CAGTTTTTTAAAATTCT CCAGi 11111 IAAATTCT MIB TTCCACAAGTGACGGATGTTTCA GACAGGTTTGCACTTCTCATTACAA ATAACOAGAGAACTGGTG ACGAOAGAOCTGGTG M19 CTGACACTCTCACCTTGGTTAGG GTGCCAGTGGCTGTAACAAG ATCTATGAGAGACGCACAGG TCTATGAGAGACACACAGG M20 GAAGTTTGGAATGACTAAATTCAATTTCTCTGA AGATACAAGTGTT7TATAGACAATAACTTTGTAAGCTATTAT ATAATTTGCATCGCTGGGAG ATAATTTGCATCACTGGGAG M21 CTGGAAGTATAGTTTCAGTAACTCTGAAACC AATCACAATAACTTAAAATATATTCGTOTTCAACAATGT ATAACACAAATCATGATGGC CACAAATCGTGATGGC M22 ACTATACTGACTAGTGTACTATGAAGTATCTAGCT TCTCTCTACATTTG CTTTGCTGTCAA AACATCCCTAAGACGTCAGT ACATCCCTAAGAAGTCAGT M23 GGCAAAGGATAGAAAGATGGTAGGAA CCTCACGCTTGCCAAGAGT TGGAATCTCATTTCTTCCCA TGGAATCTCAATTCTTCCCA M24 AATCCCTTTGTTCAGTGTCTTCACA GCCAGCTTTTCTGAGCCTCTTAA CTCCACTTACCTAAGTTG TCCACTTACATAAGTTG M25 CAGGGCCTTCTTCTTCTTCCATAAA TOTTGAGTTTTCATGIiIi i IGAAMAAGTGG ACTGTCCAAGGTGGTG ACTGTCCATGGTGGTG M28 GCCACAGACCCCAAATGTITG TGAACTGTTCCTTATTCCAGACGTG ATGCTACACGGTTTGT ATGCTACACAGTTTGT M27 ATCAGCAAGGGAGGAGTAQAAACTA GTAAAGGAATTGCGAGAACCTGGTA TATAAAATGAAAGTACGTGCTGC AAATGAAAGTACATGCTGC M28 CCACTTTACOCACTGCCTAGA CCTCCTTCTTTTCCATTATATCCTTTTTCTTTC AGAAAATTGTCTTCGTAGCTG AAAATTGTCTTCATAGCTG M29 CACCTTAGTCTCCCAAGAAGCT CCAGCATAGCCTATAGCACACA CTCACAGATATCTTTTG CACAGGTATCTTTTG M30 CTGTTGAGTATTTTGAACACCTTAOTAATTGTG CTGCTTTTCTACTGATATAGAGCATAATATGATATGA TTATTAAAAACAGAAGTCCC ATTAAAAACAAAAGTCCC M32 CAAAGTACTGGGACAAAGGTGTGA GGCCTATAAGTTACCATTAAAAAGATGTCCTT ACCGCGCCCAGCT CACCGTGCCCAGCT Table 3. List of SNPs in the study and segregation of alleles by 5N population P Chromosome Allele 1 Allele 2 "Allele" African "Allele" Asian "Allele" European M1 XTC 1 2 2 M2 XCT 1 2 2 M3 6 TC 1 2 2 M4 13 GC 2 1 1 M5 1 CG 2 1 1 M6 17 TA 2 1 1 M7 14 CG 2 1 1 M8 10 CT 2 1 1 M9 1 GA 1 2 2 M10 6 CT 2 1 2 M11 2 CT 2 1 2 M12 10 AG 2 1 2 M13 11 AC 2 1 2 M14 15 CA 1 2 1 M15 XGA 1 2 1 M16 1 TC 1 2 1 M17 5 A T 1 2 1 M18 8 GA 1 2 1 M19 12 CT 1 2 1 M20 3 CT 2 2 1 M21 XTC 2 2 1 M22 14 CA 2 2 1 M23 2 A T 2 2 1 M24 5 GT 1 1 2 M25 2 TA 1 1 2 M26 2 CT 2 2 1 M27 9 CT 2 2 1 M28 XCT 2 2 1 M29 17 AG 1 1 2 M30 15 CT 2 2 1 M31 17 CT 1 1 2 M32 2 CT 1 1 2 Table 4. Classification of the informativity of the markers according to their values Fst. Group Values Fst Markers M1 M2 M5 M6 Group 1 Fst> 0.80 M7 M9 M15 -30 M3 M4 M8 M14 Group II 0.70 <Fst <0.80 M18 M19 M28 M16 M25 Group III 0.50 <Fst <0.70 M27 [V 32 M10 M11 M12 Group IV 0.40 <Fst <0.50 M13 M20 M23 M ^: 1 M17 Group V Fst <0.40 << '2 2 Table 5 Examples of reference profiles characteristic of populations. Sub-Saharan Africa East Asia Europe Ex profile profile Ex profile Ex profile Ex profile profile Observed observed profile profile M1 11 11 22 22 22 22 M2 11 11 22 22 22 22 M3 11 11 22 22 22 22 M4 22 22 11 11 11 11 M5 22 22 11 11 11 11 M6 22 22 11 11 11 11 M7 22 22 11 11 11 11 M8 22 22 11 11 11 11 M9 11 11 22 22 22 22 M10 22 22 11 11 22 22 M11 22 22 11 11 22 22 M12 22 22 11 11 22 22 M13 22 22 11 22 22 22 M14 11 11 22 22 11 11 M15 11 11 22 11 11 11 M16 11 11 22 22 11 11 M17 11 11 11 12 11 11 M18 11 11 22 22 11 11 M19 11 11 22 22 11 11 M20 22 22 22 22 11 11 M21 22 22 22 22 11 11 M22 22 22 22 22 11 11 M23 22 22 22 22 11 11 M24 11 11 11 11 22 22 M25 11 11 11 11 22 12 M26 22 12 22 22 11 11 M27 22 12 22 22 11 11 M28 22 22 22 22 11 11 M29 11 11 11 11 22 22 M30 22 22 22 22 11 11 M31 11 11 22 11 22 22 M32 11 11 11 11 22 12 References 5 5 Lewontin RC: The Apportionment of Human Diversity. Evol. Biol. 1972; 6: 381-398. 6 Barbujani G, Magagni A, Minch E, Cavalli-Sforza LL: An apportionment of human DNA diversity. Froc Natl Acad Sci USA 1997; 94: 4516-4519. 7 Tishkoff SA, Verrelli BC: Patterns of human genetic diversity: implications for human evolutionary history and disease. Annu Rev Genomics Hum Genet 2003; 4: 293-340. Pakendorf B, Stoneking M: Mitochondrial DNA and human evolution. Annu Rev Genomics Hum Genet 2005; 6: 165-183. 9 The International HapMap Project. Nature 2003; 426: 789-796. Altshuler D, Brooks LD, Chakravarti A, FS Collins, Daly MJ, Donnelly P: A haplotype map of the human genome. Nature 2005; 437: 1299-1320. Hinds DA, Stuve LL, Nilsen, GB et al: Whole-genome patterns of common DNA variation in three human populations. Science 2005; 307: 1072-1079. 12 Wall JD, Pritchard JK: Haplotype blocks and disequilibrium linkage in the human genome. Nat Rev Genet 2003; 4: 587-597. 13 Hinds DA, Stokowski PR, Patil N et al: Matching Strategies for Genetic Genetics 25 studies in structured populations. Am JHum Genet 2004; 74: 317-325. 14 Campbell CD, Ogburn EL, Lunetta KL et al: Demonstrating stratification in a European American population. Nat Genet 2005; 37: 868-872. Freedman ML, Reich D, Penney KL et al: Assessing the impact of population stratification on genetic association studies. Nat Genet 2004; 36: 388-393. 30 16 Chakraborty R, Weiss KM: Admixture as a tool for finding a link between genes and detecting that difference between allelic association between loci. Froc Natl Acad Sci USA 1988; 85: 9119-9123. 17 Smith MW, O'Brien SJ: Mapping by admixture disequilibrium linkage: advances, limitations and guidelines. Nat Rev Genet 2005; 6: 623-632. 35 18 Chakraborty R, Weiss KM: Frequencies of complex diseases in hybrid populations. Am J Phys Anthropol 1986; 70: 489-503. 19 Shriver MD, Parra EJ, Dios S et al: Skin pigmentation, biogeographical ancestry and admixture mapping. Hum Genet 2003; 112: 387-399. 20 Kittles RA, Weiss KM: Race, ancestry, and genes: implications for defining disease risk. 40 Annu Rev Genomics Hum Genet 2003; 4: 33-67. Rana BK, Hewett-Emmett D, Jin L et al: High polymorphism at the human melanocortin 1 receptor locus. Genetics 1999; 151: 1547-1557. 22 Hollox EJ, Poulter M, Zvarik M et al: Lactase haplotype diversity in the Old World. Am J Hum Genet 2001; 68: 160-172. 45 Hamblin MT, Thompson EE, Di Rienzo A: Complex signatures of natural selection at the Duffy blood group locus. Am JHum Genet 2002; 70: 369-383. 24 Jobling MA, Hurles ME, Tyler-Smith C: Human evolutionary genetics. Origins, peoples and disease. Garland Science, 2004. 25 WelIems TE, Fairhurst RM: Malaria-protective traits at odds in Africa? Nat Genet2005; 50 37: 1160-1162. 31

  26 Kwiatkowski DP: How malaria has affected the human genome and what genetics can teach us about malaria. Am JHum Genet 2005; 77: 171-192. 27 Bersaglieri T, Sabeti PC, Patterson N et al: Genetic Signatures of Strong Positive Positive Selection at the Lactase Gene. Am J Hum Genet 2004; 74: 1111-1120. Mulcare CA, Weale ME, Jones AL et al: The T allele of a single-nucleotide polymorphism 13.9 kb upstream of the lactase gene (LCT) (C-13.9 kbt) does not predict the cause of lactase-persistence phenotype in Africans. Am J Hum Genet 2004; 74: 1102-1110. 29 Hollox E: Evolutionary genetics: the genetics of lactase persistence - fresh lessons in the history of milk drinking. Eur JHum Genet 2005; 13: 267-269. 30 Akey JM, Zhang G, Zhang K, Jin L, Shriver MD: Interrogating a high-density SNP map for signatures of natural selection. Genome Res 2002; 12: 1805-1814. 31 The use of racial, ethnic, and ancestral categories in human genetics research. Am J Hum Genet 2005; 77: 519-532. 32 Inouye S, Hondo R: Microplate hybridization of amplified viral DNA segment. J Clin Microbiol 1990; 28: 1469-1472. 33 Pana EJ, Marcini A, Akey J et al: Estimating African American admixture proportions by use of population-specific alleles. Am J Hum Genet 1998; 63: 1839-1851. 34 Weir BS, Cockerham CC: Estimating F-statistics for the analysis of population structure.

  Evolution 1984; 38: 1358-1370.

Weir BS, Hill WG: Estimating F-statistics. Annu Rev Genet 2002; 36: 721-750.

36 Bamshad MJ, Wooding S, WS Watkins, Ostler CT, Batzer MA, Jorde LB: Human population genetic structure and inference of group membership. Am J Hum Genet 2003; 72: 578-589.

37 Lao O, van Duijn K, Kersbergen P, Knijff P, Kayser M: Proportioning Whole-Genome Single-Nucleotide ™ Polymorphism Diversity for Identification of Geographic Population Structure and Genetic Ancestry. Am JHum Genet 2006; 78: 680-690.30

Claims (10)

  A method for determining the ethnogeographic origin of an individual, comprising determining, in a nucleic acid sample, preferably DNA, from the individual, alleles of a set of nucleotide polymorphisms (SNPs) ) located in non-coding regions of the genome, to obtain a set of alleles, this set of alleles being an indication of the ethnogeographic group to which the individual belongs, the set of SNPs comprising at least 5 SNPs chosen from the SNPs identified in Table 1.   2. Method according to claim 1, characterized in that the set of SNPs comprises at least 6, 7, 8, 9, 10, 15, 20, 25 or 30 SNPs identified in Table 1.   3. Method according to claim 1 or 2, characterized in that the set of SNPs comprises all 32 SNPs mentioned in Table 1.   4. Method according to claim 1 or 2, characterized in that the set of SNPs comprises at least the 9 SNPs MI, M2, M5, M6, M7, M9, M15, M24 and M30 as defined in Table 3. 20   5. Method according to claim 1 or 2, characterized in that the set of SNPs comprises at least 5 SNPs among the SNPs M1, M2, M3, M4, M5, M6, M7, M8 and M9 presented in Table 3. ; or at least 5 SNPs among the SNPs M20, M21, M22, M23, M24, M25, M26, M27, M28, M29, M30, M31 and M32 presented in Table 3; or at least 5 SNPs among the M10, M11, M12, M13, M14, M15, M16, M17, M18 and M19 SNPs shown in Table 3.   6. Method according to one of claims 1 to 5, characterized in that the set of alleles determined from the nucleic acid sample of the individual is compared to one or more sets of alleles of reference characteristics of ethnogeographic groups, and in that the probability of membership of the individual to one of these groups is calculated.   7. Method according to claim 6, characterized in that the sets of reference alleles are characteristic sets of the European, Saharan, Asian, North African and / or Indian populations.   8. Method according to claim 6 or 7, characterized in that the probability of membership of the individual to one of the reference groups is calculated by a Bayesian method.   9. Method according to any one of the preceding claims, characterized in that the alleles are determined by sequencing, selective hybridization and / or selective amplification.   10. Method according to any one of the preceding claims, characterized in that the nucleic acid sample comes from a fluid or biological tissue of the individual. 12. Method according to any one of the preceding claims, characterized in that the nucleic acid from the individual is amplified beforehand. 13. A kit for carrying out a method according to any one of claims 1 to 12, comprising a set of nucleotide probes specific for at least one allele, preferably each allele, SNPs of the set. SNPs and / or a set of nucleotide primers allowing specific amplification of at least one allele, preferably each SNPs allele of the set of SNPs. 14. Kit according to claim 13, characterized in that the nucleotide probes are immobilized on a support. 15. A product comprising a carrier on which nucleotide probes are immobilized, said probes being specific for each SNPs allele of a set of SNPs defined in any one of claims 1 to 5. 16. Use of a set of nucleotide probes specific for an at least one SNP allele of a set of SNPs defined in any one of claims 1 to 5 and / or a set of nucleotide primers allowing specific amplification of each SNP of a set of SNPs defined in any one of claims 1 to 5, for determining in vitro the ethnogeographic origin of an individual. IO17. Isolated nucleic acid comprising a sequence selected from the sequences given in Table 2.