FR2908136A1

FR2908136A1 - Evaluating origin of infection by pathogenic bacteria in penaeid shrimp, comprises quantification of messenger RNA of the shrimp in hemocytes taken from animal to be tested after infection

Info

Publication number: FR2908136A1
Application number: FR0609724A
Authority: FR
Inventors: Lorgeril Julien De; Evelyne Bachere; Yannick Gueguen
Original assignee: Institut Francais de Recherche pour lExploitation de la Mer (IFREMER)
Current assignee: Institut Francais de Recherche pour lExploitation de la Mer (IFREMER)
Priority date: 2006-11-07
Filing date: 2006-11-07
Publication date: 2008-05-09
Also published as: BRPI0718624A2; WO2008068402A3; WO2008068402A2; CN101553580A; US20110045461A1; MX2009004832A

Abstract

Method for evaluating origin of an infection by pathogenic bacteria in a penaeid shrimp, comprises quantification of messenger RNA (mRNA) of the shrimp in hemocytes taken from animal to be tested 6-72 hours after infection. Independent claims are included for: (1) a reagents kit for implementation of the method in which the quantification of transcripts made by quantitative reverse transcriptase PCR, and further comprises buffers and reagents necessary for amplification of the reaction and the detection of amplification products, at least a pair of specific initiators of mRNAs to be measured; and (2) a DNA chip for allowing the implementation of the method comprises a specific probe of shrimp mRNA, preferably a specific probe of mRNA-peptide rich in proline and cysteine.

Description

1 La présente invention est relative à l'utilisation de transcrits deThe present invention relates to the use of transcripts of

gènes codant pour des peptides antimicrobiens comme marqueurs de la résistance de crevettes pénéides aux infections bactériennes. genes encoding antimicrobial peptides as markers of penaeid shrimp resistance to bacterial infections.

L'élevage des crevettes pénéides en aquaculture concerne de nombreux pays des zones tropicales, subtropicales, et tempérées. Neuf espèces de crevettes pénéides sont principalement exploitées : Litopenaeus vannamei (Pacifie White shrimp) qui est l'espèce la plus exploitée, L. styiirostris (Pacifie Blue shrimp), trois espèces d'origine atlantique dont L. setiferus (Atlantic White shrimp), L. schmitti (Southern White shrimp), et Farfanpenaeus paulensis (Sao Paulo shrimp), ainsi que Penaeus semisulcatus (Green Tiger prawn), P. monodon (Black Tiger prawn), Fenneropenaeus chinensis (Fleshy prawn) et Marsupenaeus japonicus (Kuruma prawn). Un problème majeur pour cette aquaculture est causé par les maladies infectieuses, majoritairement d'origine virale ou bactériennes. 2.0 En ce qui concerne les pathologies bactériennes, les principaux agents décrits appartiennent au genre des Vibrionaceae (VANDENBERGHE et al., Appl. Environ. Mic.robiol., 65 : 2592-7, 1999). Bien que les Vibrics soient généralement considérés comme des bactéries commensales ou symbiotes, de 25 nombreuses espèces peuvent devenir pathogènes pour les crevettes dans certaines conditions environnementales. Parmi les plus étudiées, on citera Vibrio penaeicida, qui est pathogène pour les larves, ainsi que pour les crevettes juvéniles et adultes, et qui est fréquemment utilisé comme 30 modèle de l'infection par les Vibrios chez les crevettes. Ce Vibrio pathogène est par ailleurs le principal agent étiologique associé à des mortalités cycliques nommées Syndrome 93 , apparues en 1993 et affectant les élevages néo-calédoniens en phase de grossissement (MERMOUD et al., 35 Aquaculture, 323-335, 1998). Les antibiotiques ont été très utilisés, comme agents préventifs et curatifs dans le traitement des animaux et des eaux des élevages. Leur utilisation est aujourd'hui 2908136 remise en question par L'apparition de bactéries résistantes, ainsi que pour les déséquilibres environnementaux qu'elle peut engendrer. De nouvelles méthodes prophylactiques ont été 5 proposées pour le contrôle des maladies, comme par exemple l'utilisation de bactéries probiotiques qui auraient des effets bénéfiques sur la survie et la croissance des animaux en élevage, ou celle d'immunostimulants, tels que des (3-glucanes ou des polysaccharides dérivés de levures ou de 10 bactéries. Les méthodes de vaccination utilisées chez les vertébrés ne sont pas envisageables chez les crustacés du fait de l'absence d'un système immunitaire à mémoire. Chez les crustacés, la défense contre les infections est basée sur une 15 réponse immunitaire innée, dont les acteurs principaux sont les hémocytes (cellules sanguines), producteurs notamment de différents peptides anti-microbiens. Chez les crevettes pénéides, les peptides antimicrobiens les mieux connus à ce jour appartiennent à la famille des pénaeidines (BACHERE et al., Immunol. Rev., 198 : 149--68, 2004). Les pénaeidines identifiées à l'heure actuelle ont été classées en 3 sous-groupes, respectivement dénommés PEN2, PEN3, et PEN4 (GUEGUEN et al., Dev. Comp. Immunol., 30 : 283-8, 2006), le sous-groupe PEN3 étant le plus représenté quantitativement. D'autres polypeptides antimicrobiens ont également été identifiés chez les crevettes. A titre d'exemples, on citera, des polypeptides homologues des antilipopolysaccharide factors (ALFs) de la limule identifiés à partir de banques d'ADNc d'hémocytes de P. monodon (SOMBOONWIWAT et al., Dev. Comp. Immunol., 29 : 841-51, 2005), ainsi que des homologues du lysozyme et d'une protéine antimicrobienne de 11.5 kDa, dénommée crustine, identifiés dans des ESTs de différentes espèces de pénéides (CROSS et al., Dev. Comp. Immunol., 25 : 565-77, 2001; SUPUNGUL et al., Mar. Biotechnol. (NY), 4 : 481-94, 2002). Chez les crevettes pénéides, l'étude de la population hémocytaire, et celle de l'expression des 2908136 s pénaeidines, en réponse à la stimulation par des agents non pathogènes, ou lors de l'infection par des bactéries pathogènes (MUNOZ et al., Pur. J. Eiochem., 269 : 2678-89, 2002; MUNOZ et al., Cc-11 Mol. Lite Sci., 61 : 961-72, 2004; DESTOUMIEUX et al., J. Cet]. Sci., 113(Pt 3) . 461-9, 2000), ont permis de mieux comprendre les mécanismes de la réponse immunitaire. La première phase de la réponse immunitaire des pénéides à une infection bactérienne, correspondant aux 6 ou 10 12 premières heures post-infection, est caractérisée par une diminution du nombre total d'hémocytes circulants, ainsi que par une diminution de l'expression relative des pénaeidines. Cette diminution traduit une migration des hémocytes vers les sites d'infection, ou ils sont lysés, et libèrent les 15 pénaeidines. Cette première phase est suivie d'un retour à un niveau de base 24 à 48 heures après ]'infection. Pendant la seconde phase de la réponse immunitaire, correspondant aux 48-72 heures post-infection, les pénaeidines 20 libérées sont observées à la fois dans les tissus et dans le plasma. Par ailleurs, on observe une augmentation importante des hémocytes exprimant des pénaeidines, à la fois dans la circulation sanguine et dans la plupart des tissus. Cette augmentation des hémocytes reflète un processus d'activation 25 de l'hématopoïèse, produisant une nouvelle population d'hémocytes granuleux caractérisée par une activité transcriptionnelle des pénaeidines plus importante que celle des hémocytes matures. La sélection genetique de lignées d'animaux 30 résistants aux infections constitue une approche potentiellement intéressante pour pérenniser les productions de crevettes. Pour mettre en œuvre cette approche, il est souhaitable de disposer de marqueurs permettant d'évaluer ou de prédire le niveau de résistance des animaux à l'infection. 35 Dans des travaux antérieurs (DE LORGERIL et al., Physiol. Genomics, 21 : 174-83, 2005) l'équipe des Inventeurs a étudié, par hybridation suppressive soustractive (SSH), l'expression de différents gènes avant et pendant une 2908136 9 infection expérimentale par V. penaeicida, chez des crevettes survivant à cette infection. Ils ont ainsi identifié différents gènes parmi lesquels figurent notamment des gènes codant pour des peptides 5 antimicrobiens, tels que les pénaeidines 2 (Litsty PEN2) et 3 (Litsty PEN3), le lysozyme, ainsi qu'un peptide riche en proline et cystéine apparenté à une cryptdine. En revanche, les gènes codant pour d'autres peptides antimicrobiens habituellement exprimés dans les hérnocytes de crevettes, à 10 savoir les crustines et le facteur anti-LPS (ALF) n'ont pas été identifiés dans cette banque SSH. Le niveau de transcription de ces gènes au cours de l'infection a également été étudié chez les crevettes survivant à l'infection, et chez celles n'y survivant pas. Le 15 niveau de transcription des gènes codant pour la pénaeidine-3, le lysozyme, et le peptide riche en proline et cystéine diminue en début d'infection chez tous les animaux, puis augmente ensuite uniquement chez les animaux qui survivent à l'infection. Il en est conclu que les profils d'expression 20 différentielle de ces 3 gènes au cours de l'infection peuvent ccnstituer de bons marqueurs pour évaluer la capacité des crevettes à survivre à l'infection. Les Inventeurs ont entrepris de rechercher d'autres marqueurs utilisables pour évaluer la réponse immunitaire et 25 la survie des crevettes aux infections. Ces études ont été effectuées sur deux lignées de crevettes de l'espèce Litopenaeus stylirostris : l'une, présentant une forte résistance aux vibrioses, est une lignée obtenue en troisième génération à partir de géniteurs ayant 30 survécu à des épisodes infectieux du Syndrome 93 , l'autre lignée dite contrôle ou non-sélectionnée est issue d'animaux élevés dans les conditions d'élevages communément utilisées en Nouvelle Calédonie. Ils ont ainsi mis en évidence d'autres gènes dont 35 le profil de transcription en réponse à l'infection par un V.ibrio est corrélé à la survie à cette infection, et ont en outre découvert que dans le cas de certains gènes, le niveau de transcription de base (c'est-à-dire le niveau d'expression 2908136 5 en l'absence d'infection par un pathogène) était également corrélé à la survie à l'infection. La présente invention concerne l'utilisation de ces différents gènes comme marqueurs de la résistance de crevettes 5 pénéides aux infections, notamment aux vibrioses. Les gènes pour lesquels les Inventeurs ont observé une corrélation du niveau de transcription de base avec la résistance à l'infection sont ceux du lysozyme, de la pénaeidine-3, et de ses isoformes PEN3-1 et PEN3-2. Le niveau 10 basal de transcription du lysozyme ainsi que celui de celui de l'isoforme PEN3-1 apparaissent corrélés positivement à la résistance à l'infection, alors que ceux de la pénaeidine-3, et de l'isoforme PEN3-2 apparaissent corrélés négativement à la résistance à l'infection. 15 La séquence d'ADNc du transcrit du lysozyme de L. styiirostris (SEQ ID NO : 1) . GCTTATTTATCALCCATTACAACGTCTGCACGTCAGCTGTGTTTTGCAATT CTGTTATTTGCATTTCAATGTTGTATAAATTCATACATCATGATATACAGGCAATCATTGTT TATTAACCCCLACTAATACTGGAATCCTGGCTTTAGCATTGCATTCGTATTATTTGCAGTAA 20 TAATGGTAACCCTGGTGCCAAGCCTGTAAATCTAGAACATAGAGCTCGAAG est disponible sur GenBank sous le numéro d'accès CV699332. Des homologues de la séquence SEQ ID NO : 1 chez d'autres espèces de crevettes sont disponibles sur GenBank 25 sous les numéros d'accès suivants : Litopenaeus vannamei (AF425673), Penaeus monodon (AF539466, Fenneropenaeus chinensis (AY661543), Penaeus semisulcatus (AY169675), et Marsupenaeus japonicus (AB080238). La séquence d'ADNc du transcrit PEN3-1 (SEQ ID NO : 30 2) : GGTTCCCTCCTCCGTCCGCCATGCGCCTCGTGGTCTGCCTGGTCTTCTTGG CC TCCTTCGCCCTGG'TCTGCCAAGGCCAAGGCTACAAGGGCGGTTACACAGGCCCGGTAGTC AGGCCCTTCGTGAGACCGATAGGCAGGCCCTTCGTGACACCGATAGGCAGGCCTGTTGTTTC GGGCAACGTGTGCCCTCTATCGTGCCGGGGCATTACCACCTTACAAGCGCGTTCTTGCTGCA 35 GCCGCTTGGGGCGCTGCTGTCGCGAGGCCAAGGGGTACTCCGGCTGATGGAGAAGAC correspond à celle retrouvée au niveau de l'ADN génomique (numéro d'accès GenBank AY351656 pour L. styiirostris). 2908136 6 La séquence d'ADNc du transcrit PEN3-2 (SEQ ID NO : GGTTCCCTCCTCCGTCCGCCATGCGCCTCGTGGTCTGCCTGGTCTTCTTGG CCTCCTTCGCCCTGGTCTGCCAAGGCCAAGGCTACAAGGGCGGTTACACAGGCCCGGTAGTC AGGCCCTTCGTGAGACCGATAGGCAGGCCTGTTGTTTCATACAACGTGTGCCCTCTATCGTG CCGGGGCATTACCACCTTACAAGCGCGTTCTTGCTGCAGCCGCTTGGGGCGCTGCTGTCGCG AGGCCAAGGGGTACTCCGGCTGATGGAGAAGAC dérive de modifications post-transcriptionnelles de PEN3-1, faisant intervenir une édition de l'ARN, ainsi que 1.0 l'élimination d'un motif de quelques acides aminés. La comparaison entre les séquences de ces deux isoformes est illustrée par la Figure 1. Les régions identiques sont indiquées par des astérisques ; les régions dissemblables par des points. Dans 15 les séquences nucléotidiques, les codons d'initiation et d'arrêt de la traduction sont soulignés. Dans les séquences polypeptidiques (SEQ ID NO : 38 et 39), les peptides signal sont soulignés, les régions riches en glycine et proline sont surlignées en gris clair, et les régions riches en cystéines 20 en gris foncé. La présente invention a en conséquence pour objet un procédé pour évaluer la capacité de résistance d'une lignée de crevettes pénéides à l'infection par une bactérie pathogène, caractérisé en ce qu'il comprend la quantification, 25 dans des hémocytes prélevés chez des animaux de la lignée à tester, non-infectés, d'au moins l'un des ARNs suivants . l'ARNm du lysozyme ; l'ARNm de la pénaeidine-3 ; l'ARNm de l'isoforme PEN3-lde la pénaeidine-3 ; 30 l'ARNm de l'isoforme PEN3-2 de la pénaeidine-3. On définit ici par : ARNm de la pénaeidine-3 , l'ensemble des transcrits des isoformes PEN3-1 et PEN3-2 de ce gène. Selon un mode de mise en ouvre préféré d'un procédé 35 conforme à l'invention, on détermine la quantité d'un ou plusieurs des ARNm définis ci-dessus, chez les animaux à tester et on la compare avec la quantité moyenne du même ARNm chez des animaux non-infectés d'une lignée contrôle (c'est-à- 2908136 7 dire non-sélectionnée pour sa résistance à une bactérie pathogène) de crevettes de la même espèce. Dans le cas du lysozyme, ou de l'isoforme PEN3-1, un niveau de transcrits supérieur à celui des crevettes 5 contrôle est prédictif d'une capacité élevée de résistance à l'infection. Dans le cas de la pénaeidine-3, ou de l'isoforme PEN3-2, un niveau de transcrits inférieur à celui des crevettes contrôle est prédictif d'une capacité élevée de résistance à l'infection. 10 Selon un autre mode de mise en oeuvre préféré d'un procédé conforme à l'invention, il comprend la comparaison entre les quantités d'ARNm des deux membres d'au moins l'une des paires suivantes . - lysozyme/pénaeidine-3 ; 15 - lysozyme/isoforme PEN3-2 ; - isoforme PEN3-1/pénaeidine-3 ; - isoforme PEN3-1/isoforme PEN3-2. Un rapport lysozyme/pénaeidine-3 supérieur à 1,2, de préférence supérieur à 6,.34, de même qu'un rapport 20 lysozyme/isoforme PEN3-2 supérieur à 0,077, de préférence supérieur à 1,02, un rapport isoforme PEN3-1/pénaeidine-3 supérieur à 23,09, de préférence supérieur à 46,87, ou un rapport isoforme PEN3-1/isoforme PEN3-2 supérieur. à 1,48, de préférence supérieur à 7,7, sont prédictifs d'une capacité 25 élevée de résistance à l'infection. Les profils de transcription au cours de l'infection qui apparaissent corrélés à l'issue de l'infection sont, outre ceux de la pénaeidine-3, du lysozyme, et du peptide riche en proline et cystéine, identifiés précédemment 30 (DE LORGERIL et al., 2005, précité), ceux de la pénaeidine 2, de la crustine, et de l'isoforme PEN3-1. Dans tous les cas, lesdits profils de transcription sont observés 6 à 72 heures après l'infection, de préférence 24 heures après l'infection. 35 Après l'infection, on observe, dans le cas de la crustine et du peptide riche en praline et cystéine, un niveau de transcription plus élevé chez les animaux qui survivent à l'infection que chez ceux qui n'y survivent pas. Dans le cas 2908136 8 de la crustine, ce niveau est sensiblement égal au niveau basal de transcription (mesuré préalablement à l'infection) chez les animaux qui survivent, alors qu'il est significativement plus faible chez ceux qui ne survivent pas. 5 Dans le cas du peptide riche en proline et cystéine, ce niveau est un peu plus faible que le niveau basal de transcription chez les animaux qui survivent, alors qu'il est significativement plus faible chez ceux qui ne survivent pas. Pour les autres gènes, la corrélation entre le 10 profil d'expression du gène et la résistance de l'animal à l'infection dépend de la lignée dont est issu l'individu testé (lignée contrôle ou lignée sélectionnée pour sa résistance à l'infection). Dans le cas du lysozyme, de la pénaeidine 3, et de 15 l'isoforme PEN3-1 : pour la lignée contrôle, le niveau de transcription après l'infection est plus élevé chez les crevettes survivantes que chez les crevettes non-survivantes ; pour le lysozyme, il est égal ou supérieur au niveau basal de 20 transcription chez les animaux qui survivent, alors qu'il est significativement plus faible chez ceux qui ne survivent pas ; pour la pénaeidine 3, il un peu plus faible que le niveau basal de transcription chez les animaux qui survivent, alors qu'il est significativement plus faible chez ceux qui ne 25 survivent pas ; pour l'isoforme PEN3-1, il est égal ou supérieur au niveau basal de transcrits chez les animaux qui survivent, alors qu'il est significativement plus faible chez ceux qui ne survivent pas ; pour la lignée sélectionnée, le niveau de 30 transcription après l'infection ne diffère pas significativement entre les crevettes survivantes et les crevettes non-survivantes. Dans le cas de la pénaeidine-2 : pour la lignée contrôle, le niveau de 35 transcription après l'infection ne diffère pas significativement entre les crevettes survivantes et les crevettes non-survivantes ; 2908136 9 - pour la lignée sélectionnée, le niveau de transcription après l'infection est plus élevé chez les crevettes survivantes que chez les crevettes non-survivantes ; il n'est pas significativement différent du niveau de base de 5 transcription chez les animaux qui survivent, alors qu'il est significativement plus faible (au plus égal à 60 du niveau de base) chez ceux qui ne survivent pas. La présente invention a pour objet un procédé pour évaluer l'issue d'une infection par une bactérie pathogène 10 chez une crevette pénéide, caractérisé en ce qu'il comprend la quantification de l'ARNm de la crustine, dans des hémocytes prélevés chez l'animal à tester 6 à 72 heures, de préférence 24 heures, après l'infection. Selon un mode de mise en oeuvre préféré d'un procédé 15 conforme à l'invention, il comprend en outre la comparaison de la quantité d'ARNm de la crustine déterminée comme indiqué ci-dessus, avec la quantité du même ARNm dans des hémocytes prélevés chez l'animal à tester préalablement à l'infection. La séquence d'ADNc du transcrit de la crustine (SEQ 20 ID NO : 4) est la suivante : TCCCGGGGCGGTTTAGTGTAGGTGGTGGCGGTTTAGGTGTAGGTGGTGGCT TCCCGGGGCGGTGTAGGTGTAGGTGGCGGTCTTGGCGTGGGAGGAGGCCTTGGAGTTAGCGG TGGCTCAAGCAACTGCAGGTATTGGTGCAAGACTCCGGAGGGTCAAGCCTACTGCTGCGAGT CGGCCCACGAACCAGAGACACCTGTTGGCACCAAGCTACTCGACTGCCCCCAAGTCCGTCCC 25 ACATGCCCACGCTTCCATGGGCCCCCCACGACCTGTTCCAACGACTACAAGTGTGCTGGCCT CGACAAGTGTTGCTTCGACAGGTGTCTGGGAGAACACGTGTGCAAGCCTCCTTCGGCCTTCG GACAGCAAGTTTTCGGATGAAGAATAAACACAAAAGGATTTTAAAGGATGAAGAGAAAGACG AAAAGACCATCTGAAGGACGACCGATGTTTTGGAATTTGACTGAAAAAAGAAAGAAAAACTA ACAGGGAATTCTTTCTTTCTGTAGGATTTATCTGATTAACATGATTTTTGTTATATGTTAAT 30 TAGACTGTATTCTGTCAAAAGAAACTTATAGAGAAAAAAAAAAAAAAAAAAAAAAAAGCTTG TA CACCTCGGCCGCGACCACGCT Des homologues de la séquence SEQ ID NO : 4 chez d'autres espèces de crevettes sont disponibles sur GenBank sous les numéros d'accès suivants : Litopenaeus vannamei 35 (AF430076), Penaeus monodon (DW042799), Marsupenaeus japonicus (AB121740), et Litopenaeus setiferus (AF430079). Un rapport ARNm de la crustine après infection/ARNm de la crustine avant infection compris entre 2908136 10 0,9 et 1,1 est prédictif de la survie à l'infection ; au ccntraire, un rapport ARNm de la crustine après infection/ARNm de la crustine avant infection inférieur ou égal à 0,6 est prédictif de la non-survie à l'infection. 5 Le cas échéant, ledit procédé comprend en outre la quantification de l'ARNm du peptide riche en proline et en cystéine, dans des hémocytes prélevés chez l'animal à tester 6 à 72 heures, de préférence 24 heures, après l'infection, et, avantageusement, la comparaison de la quantité d'ARNm ainsi 1.0 déterminée avec la quantité du même ARNm dans des hémocytes prélevés chez l'animal à tester préalablement à l'infection. La séquence d'ADNc du transcrit du peptide riche en proline et cystéine (SEQ ID NO : 5) . TCTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGTCCAGAC 15 GCTGTTCTGCTCCTGTGTGGTGGCCGAACTCTGGACGCATCCCTGCTGCCATCATGAAGACC TACAGTCGGGTCTCCGTCTTTGTCTTATTGGTTGCGATCTTGCACACGTCACAAGGATCTTC CTTTTCACCTCCCAGAGGACCTCCGGGCTGGGGACCTCCATGCGTACAACAACCGTGCCCTA AGTGCCCATATGATGATTACAAGTGTCCGACGTGTGATAAATTCCCGGAGTGTGAGGAGTGC CCCCATATTAGTATAGGATGTGAATGCGGCTATTTTAGCTGCGAATGTCCGAAGCCTGTGTG 20 TGAACCGTGCGAGAGTCCCATCGCCGAGTTGATAAAAAAGGGAGGTTATAAAGGATAAAGAA GCGAGAACGAAGCCACAGCATTCTTTCACAAACCTCACTGAACTGAAAGAAGAGAGAGGGAG AGAGGGGGGAGGGAGAGGGAGAGAGAGAGAGAATAGAACGTGAGATGGGAGAAAGGAGAGAT GTTT Des homologues de la séquence SEQ ID NO : 5 chez 25 d'autres espèces de crevettes sont disponibles sur GenBank sous les numéros d'accès suivants : Litopenaeus vannamei (BE188497), et Penaeus monodon (DT366712). Un rapport ARNm du peptide riche en proline et cystéine après infection/ARNm du peptide riche en proline et 30 cystéine avant infection supérieur ou égal à 0,7 est prédictif de la survie à l'infection ; au contraire, un rapport ARNm du peptide riche en proline et cystéine après infection/ARNm du peptide riche en proline et cystéine avant infection inférieur ou égal à 0,3 est prédictif de la non- 35 survie à l'infection. Dans le cas où les animaux chez lesquels on souhaite évaluer l'issue de l'infection n'appartiennent pas à une lignée sélectionnée pour sa résistance à une bactérie 2908136 11 pathogène, on peut en outre quantifier un ou plusieurs des ARNm suivants . - l'ARNm du lysozyme ; -l'ARNm de la pénaeidine-3 ; 5 - l'ARNm de l'isoforme PEN3-1 de la pénaeidine-3. dans des hémocytes prélevés chez l'animal à tester 6 à 72 heures, de préférence 24 heures, après l'infection, et, avantageusement, comparer, pour chaque ARNm choisi, la quantité ainsi déterminée avec celle du même ARNm dans des 10 hémocytes prélevés chez l'animal à tester préalablement à l'infection. Un rapport ARNm du lysozyme après infection/ARNm du lysozyme avant infection supérieur ou égal à 1 est prédictif de la survie à l'infection ; au contraire, un 15 rapport ARNm du lysozyme après infection/ARNm du lysozyme avant infection inférieur à 0,2 est prédictif de la non-survie à l'infection. Un rapport ARNm de la pénaeidine 3 après infection/ARNm de la pénaeidine 3 avant infection supérieur 20 ou égal à 0,8 est prédictif de la survie à l'infection ; au contraire, un rapport ARNm de la pénaeidine 3 après infection/ARNm de la pénaeidine 3 avant infection inférieur ou égal à 0,5 est prédictif de la non-survie à l'infection. Un rapport ARNm de l'isoforme PEN3-1 après 25 infection/ARNm de l'isoforme PEN3-1 avant infection supérieur ou egal a 1 est prédictif de la survie à l'infection ; au contraire, un rapport ARNm de l'isoforme PEN3-1 après infection/ARNm de l'isoforme PEN3-1 avant infection inférieur ou égal à 0,2 est prédictif de la non- 30 survie à l'infection. Alternativement, dans le cas où les animaux chez lesquels on souhaite évaluer l'issue de l'infection appartiennent à une lignée sélectionnée pour sa résistance à une bactérie pathogène, on peut en outre quantifier l'ARNm de 35 la pénaeidine-2, dans des hémocytes prélevés chez l'animal à tester 6 à 72 heures, de préférence 24 heures, après l'infection, et, avantageusement, comparer la quantité ainsi 2908136 12 déterminée avec celle du même ARNm dans des hémocytes prélevés chez l'animal. à tester préalablement à l'infection. Un rapport ARNm de la pénaeidine 2 après infection/ARNm de la pénaeidine 2 avant infection supérieur 5 ou égal à 0,8 est prédictif de la survie à l'infection ; au contraire, un rapport ARNm de la pénaeidine 2 après infection/ARNm de la pénaeidine 2 avant infection inférieur ou égal à 0,6 est prédictif de la non-survie à l'infection. Les procédés conformes à l'invention peuvent en 10 particulier être mis en œuvre pour évaluer la résistance de crevette pénéides, et notamment de L. stylirostris à des vibrioses, et notamment à des infections par Vibrio penaeicida. Une grande variété de méthodes de quantification de 15 l'ARN, connues en elles-mêmes de l'homme du métier, sont utilisables pour la mise en œuvre de la présente invention (pour revue, cf. par exemple QUORE et al., J. Virol. Methods, 105(2) 189-196, 2002 ; Brevet FR 2 815 043 au nom de SKULD TECH ; HUGGETT et al., Genes Immun., 6(4) : 279-284, 2005 ; 20 EMR1CH et al., Methods Mol. Biol., 191 : 99-108, 2002; POWELL, Methods Mol. Biol., 99: 297-319, 2000 ; NESS, Methods Mol. Biol., 316 : 13-33, 2.006 ; SCHENA et al., Trends Biotechnol., 16(7): 301-306, 1998; RAMSAY, Nat. Biotechnol., 16(1) : 40-44, 1998). 25 A titre d'illustration, on citera les diverses méthodes basées sur la RT-PCR (transcription inverse suivie d'une amplification en chaîne par polymérase) quantitative. Le principe général de ces méthodes consiste à amplifier sélectivement par PCR le ou les gène(s) dont on veut mesurer 30 l'expression (gènes cible), à partir d'une préparation d'ADNc obtenue par transcription inverse des ARNm extraits de l'échantillon biologique à tester, et à quantifier le(s) produit(s) d'amplification obtenu(s). Les méthodes de RT-PCR quantitative les plus utilisées à l'heure actuelle mettent en 35 oeuvre les techniques de PCR en temps réel (pour revue, cf. par exemple VALASEK & REPA, Adv Physiol Educ, 29 : 151-9, 2005), où la quantification des produits d'amplification s'effectue, par mesure de leur fluorescence au fur et à mesure de leur 2908136 13 formation pendant la phase exponentielle de la réaction d'amplification. La présente invention a également pour objet des kits de réactifs pour la mise en œuvre d'un procédé conforme à 5 l'invention, dans lequel la quantification des transcrits s'effectue par RT-PCR quantitative. Des kits de réactifs conformes à l'invention comprennent outre les tampons et réactifs classiques nécessaires à la réaction d'amplification et à la détection 10 des produits d'amplification, au moins une paire d'amorces spécifiques de chacun des ARNm à doser. Selon un premier mode de réalisation, un kit de réactifs conforme à l'invention peut comprendre : une paire d'amorces spécifiques de l'ARNm du 15 lysozyme, une paire d'amorces spécifiques de l'ARNm de la pénaeidine-3 et/ou une paire d'amorces spécifiques de l'ARNm de l'isoforme PEN3-2 de la pénaeidine-3 ; ou - une paire d'amorces spécifiques de l'ARNm de l'isoforme PEN3-1 de la pénaeidine-3, une paire d'amorces 20 spécifiques de l'ARNm de la pénaeidine-3 et/ou une paire d'amorces spécifiques de l'ARNm de l'isoforme PEN3-2 de la pénaeidine-3 ; ou, avantageusement une paire d'amorces spécifiques de l'ARNm du lysozyme, une paire d'amorces spécifiques de l'ARNm de la 25 pénaeidine-3, une paire d'amorces spécifiques de l'ARNm de l'isoforme PEN3-1 de la pénaeidine-3, et une paire d'amorces spécifiques de l'ARNm de l'isoforme PEN3-2 de la pénaeidine-3. Selon un autre mode de réalisation, un kit de réactifs conforme à l'invention comprend une paire d'amorces 30 spécifiques de l'ARNm de la crustine, et avantageusement, une paire d'amorces spécifiques de l'ARNm du peptide riche en proline et cystéine. De préférence, ledit kit comprend en outre une paire d'amorces spécifiques de l'ARNm du lysozyme, et/ou une paire d'amorces spécifiques de l'ARNm de la 35 pénaeidine-3, et/ou une paire d'amorces spécifiques de l'ARNm de l'isoforme PEN3-1. Pour la mise en oeuvre de la présente invention, on peut également utiliser des puces à ADN - également dénommées 2908136 14 biopuces, microarrays, chips, etc... - (pour revue, cf. par exemple LOCKHART & WINZELER, Nature, 405 : 827-36, 2000). Le principe général des puces à ADN consiste à fixer à différents endroits de la surface d'un support solide 5 (par exemple une surface de verre, de plastique, ou de nylon) des sondes constituées par des polynucléotides complémentaires des différents gènes dont on veut mesurer l'expression (gènes cible). Les ARNm extraits de l'échantillon biologique à tester (et généralement convertis en ADNc par transcription inverse) 10 sont marqués et mis en contact avec les sondes fixées sur le support. La mesure des signaux d'hybridation permet d'évaluer la quantité des ARNm des gènes cible dans l'échantillon à tester. La présente invention a également pour objet des 15 puces à ADN permettant la mise en oeuvre d'un procédé conforme à l'invention. Selon un premier mode de réalisation, une puce à ADN conforme à l'invention peut par exemple comprendre : - une sonde spécifique de l'ARNm du lysozyme, une 20 scnde spécifique de l'ARNm de la pénaeidine-3 et/ou une sonde spécifique de l'ARNm de l'isoforme PEN3-2 de la pénaeidine-3 ; ou - une sonde spécifique de l'ARNm de l'isoforme PEN3-1 de la pénaeidine-3, une sonde spécifique de l'ARNm de 25 la pénaeidine-3 et/ou une sonde spécifique de l'ARNm de l'isoforme PEN3-2 de la pénaeidine-3 ; ou, avantageusement une sonde spécifique de l'ARNm dulysozyme, une sonde spécifique de l'ARNm de la pénaeidine-3, une sonde spécifique de l'ARNm de l'isoforme PEN3-1 de la pénaeidine-3, 30 et une sonde spécifique de l'ARNm de l'isoforme PEN3-2 de la pénaeidine-3. Selon un autre mode de réalisation, une puce à ADN conforme à l'invention comprend une sonde spécifique de l'ARNm de la crustine, et avantageusement, une sonde spécifique de 35 l'ARNm du peptide riche en prolne et cystéine. De préférence, ladite puce comprend en outre une sonde spécifique de l'ARNm du lysozyme, et/ou une sonde spécifique de l'ARNm de la 2908136 15 pénaeidine-3, et/ou une sonde spécifique de l'ARNm de l'isoforme PEN3-1. La présente invention sera mieux comprise à l'aide du complément de description qui va suivre, qui de réfère à 5 des exemples non-limitatifs, illustrant la corrélation entre le niveau de transcription de peptides anti-microbiens dans les hémocytes de crevettes pénéides, et la résistance desdites crevettes à l'infection par Vibrio penaeicida. EXEMPLES : 10 Materiels et méthodes Animaux :Des L. stylirostris juvéniles (20-30 g) issus de deux lignées de crevettes ont été obtenues auprès du laboratoire IFREMER de Nouvelle Calédonie (Ifremer, BP2059, 98896 Nouméa Cedex, Nouvelle Calédonie, France). 15 L'une de ces lignées, dénommée lignée sélectionnée résulte du croisement d'animaux ayant survécu au Syndrome 93 , élevés en bassins pendant les 6 premiers mois de leur vie, dans des conditions favorables à l'infection par Vibrio penaecicida (densité initiale : 20-25 PL/m2) ; les 20 animaux survivants sont alors élevés à des densités plus faibles (1-2 crevettes/m) pour se reproduire à l'âge de 12 mois. L'autre lignée, dénommée lignée de contrôle résulte du croisement d'animaux élevés en bassins en 25 conditions traditionnelles (densité initiale : 2 PL/m`), où l'occurrence du syndrôme 93 est très faible. Dans les deux lignées, la consanguinité a été contrôlée en marquant individuellement les animaux afin d'éviter l'accouplement de parents proches. 30 Les animaux utilisés dans les expériences décrites ci-après ont été prélevés dans la 3eme génération de la lignée sélectionnée (G3-sélection), et dans la 3eme génération de la lignée contrôle (G3-contrôle). Infections expérimentales : 35 Les infections ont été réalisées par immersion des crevettes pendant 2 heures dans des réservoirs d'eau de mer contenant Ix101 CFU/mi de la souche AM101 de V. penaeicida, ce qui correspond à 20% de la dose létale (LD20) (SAULNIER et 2908136 16 al., Dis. Aquatic Org., 40 : 109-115, 2000). Les animaux ont ensuite été rincés avec de l'eau de mer filtrée, et transférés dans des réservoirs de 100 L. Des animaux non-infectés ont été conservés dans un réservoir distinct de 100 L. 5 Pour le premier type d'infection expérimentale, utilisée pour les analyses globales, des animaux de chaque lignée de crevettes (contrôle et sélectionnée) ont été répartis en trois groupes (15 crevettes par groupe) placés dans des réservoirs distincts. Pour chacune des lignées de 10 crevettes, des échantillons de l'hémolymphe du premier groupe ont été collectés, 24 heures avant l'infection expérimentale (-24) pour constituer le contrôle non-infecté ; des échantillons de l'hémolymphe des deux autres groupes ont été collectés 12 heures après l'infection (+12) et 24 heures après 15 l'infection (+24). Le protocole du second type d'infection expérimentale, utilisée pour les analyses individuelles, est illustré par la Figure 2. Les crevettes sont marquées individuellement par 20 l'injection de silicone colorée sous le troisième segment abdominal de la cuticule. Un premier prélèvement d'hémolymphe est effectué 24 heures avant l'infection, et un second prélèvement 24 heures après l'infection. Les échantillons d'hémolymphe des animaux qui sont morts dans les 96 heures suivant l'infection (période de mortalité aiguë), et ceux des animaux ayant survécu à l'issue de cette période ont été individuellement distingués. Isolement d'ARN et analyse par PCR en temps réel : Les ARNs totaux ont été isolés des hémocytes des crevettes en utilisant le réactif Trizol (Gibco BRL) (1 ml/107 cellules), selon le protocole indiqué par le fabricant. Les ARNs totaux ont été traités par la Dnase (TURBO DNase, Ambion) pour éliminer l'ADN génomique contaminant, puis la Dnase a été éliminée par extraction au phénol-chloroforme. L'ADNc a été synthétisé à partir de 1 pg d'ARN total, en utilisant le kit de transcription inverse SuperScript II, 25 30 35 2908136 17 selon les instructions du fabricant (Invitrogen), dans un volume réactionnel de 20 pl. 0,5 pl de chaque réaction de transcription inverse ont servi de matrice pour la PCR en temps réel dans 10 pl de 5 volume réactionnel contenant IX SYBR GREEN MASTER MIX (Qiagen) et 0,5 pM de chaque amorce utilisée. Chaque réaction de PCR en temps réel a été réalisée avec une étape de dénaturation initiale de 900s à 95 C, suivie d'une amplification de l'ADNc cible (35 cycles de dénaturation 10 à 95 C pendant 15 secondes, d'une hybridation entre 54 C et 64 C (selon l'amorce utilisée) pendant 15 secondes, et d'une élongation à 72 C pendant 15 secondes), avec le LightCycler (Roche Molecular Biomedicals). Chaque réaction a été effectuée en trois exemplaires. 15 Pour déterminer l'efficacité de chaque paire d'amorces utilisée, des courbes standard ont été obtenues en utilisant des séries de 5 dilutions des plasmides contenant les séquences-cibles correspondantes (103 à 10' copies/pl). Les résultats de PCR en temps réel sont représentés 20 sous forme de variations de l'expression relative normalisée par rapport à un gène de référence, le facteur d'élongation la (EF--la, SEQ ID NO : 41), comme décrit par PFAFFL (Nucleic Acids Res., 29 : 45, 2001). Pour les gènes testés, l'efficacité de PCR en temps réel varie entre 1,87 et 1,98. 25 Cette efficacité n'étant pas exactement égale à 2,00 (représentant 100% d'efficacité d'amplification à chaque cycle), l'abondance relative a été calculée, comme indiqué par PFAFFL (précité, 2001), en utilisant l'équation corrigée pour les différences d'efficacité. 30 EXAMPLE 1 : ISOLEMENT D'UNE NOUVELLE SEQUENCE DE PENAEIDINE A PARTIR DU SOUS-GROUPE PEN3 DANS LES HEMATOCYTES DE L. STYLIROSTRIS Une première série de PCR en temps réel a été réalisée à partir des ADNc de pools d'hématocytes de 35 15 crevettes de chacune des deux lignées, pour comparer l'abondance du transcrit du peptide Litsty PEN3 (GenBank AY351656) entre ces deux lignées, en utilisant les amorces suivantes . 2908136 18 [5'-GGTTCCCTCCTCCGTCCGCC-3' (SEQ ID NO : 6) et 5'-GTCTTCTCCATCAGCCGGAG-3' (SEQ ID NO : 7), efficacité 1.94, température d'hybridation 60 C]. Les analyses des courbes de fusion des produits de 5 PCR sont présentées dans la Figure 3. Légende de la Figure 3 : lignée de crevettes sélectionnée lignée de crevettes contrôle La température de fusion correspondant à chaque pic est 10 indiquée au-dessus du pic. Les résultats montrent deux pics de fusion qui varient de près de 0,5 C. La température de fusion des produits de PCR apparaît plus élevée pour la lignée de crevettes sélectionnée que pour celle de la lignée contrôle (86.43 0.06 et 15 85.98_+0.02, respectivement, p<0.01, logiciel LightCyler 3.5). Les produits de PCR en temps réel présentant différentes températures de fusion ont été clonés et séquencés, ce qui a conduit à la caractérisation de deux séquences d'ADNc de 294 et 270 nucléotides (Figure 1A). La 20 séquence correspondant à la température de fusion la plus élevée, identifiée dans la lignée de crevettes sélectionnée, a été identifiée comme la séquence Litsty PEN3 précédemment caractérisée, et qui sera dénommée ci-après Litsty PEN3-l. La seconde séquence d'ADNc identifiée dans la lignée de crevettes 25 contrôle, diffère de Litsty PEN3-1 par une délétion de 24 nucléotides, et un changement de trois nucléotides dans une autre partie de la séquence (Figure 1A). Cette séquence sera dénommée ci-après Litsty PEN3-2. Au niveau de la séquence en acides aminés, Litsty 30 PEN3-2 diffère de Litsty PEN3-1 par l'absence dans le domaine N-terminal des 8 résidus PIGRPFVT, et par la substitution d'un résidu glycine par un résidu tyrosine (Figure 1B). Du fait de la proche similitude entre les séquences Litsty PEN3-1 et Litsty PEN3-2, il a été recherché si celles- 35 ci étaient exprimées par deux gènes distincts ou par un seul gène. Pour cela, les deux séquences de l'ADN génomique et de l'ADNc de l'hémocyte ont été amplifiées par PCR. 2908136 19 Des paires d'amorces permettant de distinguer ces deux séquences ont été construites : P3-1R et P3-1F: [5'--ACCGATAGGCAGGCCCTTCGTGAC-3' (SEQ ID NO : 8) et 5'-CGATAGAGGGCACACGTTGCCC-3' (SEQ ID NO : 9), efficacité 1.85, 5 température d'hybridation 64 C] pour Litsty PEN3-1 et P3-2R et P3-2F: [5'-GAGACCGATAGGCAGGCCTG-3' SEQ ID NO : 10 et 5'-CGATAGAGGGCACACGTTGTAT3' (SEQ ID NO : 11, efficacité 1.91, hybridation 64] pour Litsty PEN3-2. Les résultats d'électrophorèse en gel d'agarose des 10 produits de PCR obtenus avec ces amorces pour Litsty PEN3-1 et Litsty PEN3-2 sont présentés sur la Figure 4A et la Figure 4B, respectivement. Légende de la Figure 4 : gDNA = ADN génomique 15 cDNA = ADNc C- = contrôle négatif Les paires d'amorces utilisées sont indiquées au-dessus des représentations schématiques des deux transcrits par des flèches. 20 Les différences de nucléotides entre les deux transcrits sont représentés pour la délétion de 24 nucléotides par un rectangle hachuré sur Litsty PEN3-1 et par une ligne pointillée sur Litsty PEN3-2, et pour le changement de 3 nucléotides par un carré gris sur Litsty PEN3-1 et par un 2.5 carré blanc sur Litsty PEN3-2. Quelles que soient les paires d'amorces utilisées, Litsty PEN3-1 a pu être amplifié à partir de l'ADN génomique et de l'ADNc. Les fragments amplifiés sont de même taille dans les deux cas, indiquant l'absence d'intron (Figure 4A). Dans 30 le cas de Litsty PEN3-2 l'amplification est obtenue seulement à partir d'ADNc, mais pas à partir de l'ADN génomique (Figure 4B). EXEMPLE 2: PROFILS D'EXPRESSION DE GENES DE PEPTIDES ANTIMICROBIENS AU COURS D'UNE INFECTION PAR VIBRIO PENAEICIDA 35 Afin d'analyser l'expression des gènes de peptides antimicrobiens (AMPs) dans les hémocytes circulants de crevette, 6 séquences d'ADNc d'AMPs (ou d'AMPs putatifs) décrits dans des études récentes (MUNOZ et al., Cell. Mol. 2908136 20 Life Sci., 61 : 961-972, 2004 ; DE LORGERIL et al., 2005, précité) ont été choisies chez L. stylirostris. Les numéros d'accession GenBank des pénaeidines Litsty PEN2-1 et PEN3, sont respectivement AY351655 et AY351656. Les numéros 5 d'accession GenBank du lysozyme et du peptide riche en cystéine sont respectivement CV699332 et CV699287. La séquence d'ADNc de la crustine est indiquée dans la liste de séquences en annexe sous le numéro SEQ ID NO : 4. La séquence d'ADNc de ALF est indiquée dans la liste de séquences en 10 annexe sous le numéro SEQ ID NO : 40. Les profils d'expression des gènes codant pour les AMPs, Litsty PEN2-1 et -3, ALF, crustine, lysozyme et peptide riche en cystéine, ont été analysés par PCR en temps réel pour examiner le schéma général d'expression pendant l'évolution de 15 l'infection par V. penaeicida, pour la lignée sélectionnée et pour la lignée contrôle. Les amorces PCR (sens et anti-sens) listées dans le Tableau 1 ci-dessous ont été utilisées. La température paire d'amorces est la PCR ; calculée par Nom du Amorce sens(5'? 3') Amorce anti-sens(5'? 3') Hybridation Efficacité Gène ( C) PCR ALF GCCACTCCTGCACCTACAA TTCACAACACCGGATTTGCTG 55 1.87 (SEQ ID NO : 12) SEQ ID NO : 13) Litsty CCATGCGCCTCGTGGTCTG GAACGCGCTTGTAAGGTGGTAA 64 1.98 PEN3 (SEQ ID NO : 14) (SEQ ID NO : 15) Litsty CCATGCGCCTCGTGGTCTG AGCAATTGCGGCATCTGGGAA 64 1.91 PEN2-1 SEQ ID NO : 16 (SEQ ID NO : 17) ( ) lysozyme CGTCTGCACGTCAGCTGTG GGCTTGGCACCAGGGTTACC 59 _ (SEQ ID NO : 18) (SEQ ID NO : 19) 1.93 crustine CCAAGTCCGTCCCACATGC CTGTCGAAGCAGCACTTGTC 55 1.91 (SEQ ID NO : 20) (SEO ID NO : 21) Peptide GCCCTAAGTGCCCATATGA GCCGCATTCACATCCTATA 54 1.89 riche en (SEQ ID NO : 22) (SEQ ID NO : 23) cystéine EF-1 u GGTGCTGGACAAGCTGAAGGC 1CGTTCCGGTGATCATGTTCTTGATG 60 1.96 _(SEQ ID NO : 24) (SEQ ID NO : 25) Les résultats sont présentés dans la Figure 5. Les expressions relatives ont été normalisées par rapport au 25 facteur d'élongation la, et chaque valeur a été calculée par d'hybridation spécifique de chaque 20 indiquée, de même que l'efficacité de l'équation E=10[-l/pente] (PFAFFL, 2001, Penaeid shrimp farming in aquaculture concerns many tropical, subtropical, and temperate countries. Nine penaeid shrimp species are mainly exploited: Litopenaeus vannamei (Pacifie White shrimp) which is the most exploited species, L. styiirostris (Pacifies Blue shrimp), three species of Atlantic origin including L. setiferus (Atlantic White shrimp), L. schmitti (Southern White shrimp), and Farfanpenaeus paulensis (Sao Paulo shrimp), and Penaeus semisulcatus (Green Tiger prawn), P. monodon (Black Tiger prawn), Fenneropenaeus chinensis (Fleshy prawn) and Marsupenaeus japonicus (Kuruma prawn). A major problem for this aquaculture is caused by infectious diseases, mostly of viral or bacterial origin. 2. With respect to bacterial pathologies, the main agents described belong to the genus Vibrionaceae (VANDENBERGHE et al. , Appl. About. Mic. robiol. 65: 2592-7, 1999). Although Vibrics are generally considered to be commensal or symbiotic bacteria, many species may become pathogenic to shrimp under certain environmental conditions. Among the most studied are Vibrio penaeicida, which is pathogenic for larvae, as well as for juvenile and adult shrimp, and is frequently used as a model for Vibrio infection in shrimp. This pathogenic Vibrio is also the main etiological agent associated with cyclical deaths known as Syndrome 93, which appeared in 1993 and affects the New Caledonian breeding farms (MERMOUD et al. Aquaculture, 323-335, 1998). Antibiotics have been widely used as preventive and curative agents in the treatment of animals and farm water. Their use is today questioned by the appearance of resistant bacteria, as well as for the environmental imbalances that it can cause. New prophylactic methods have been proposed for the control of diseases, such as the use of probiotic bacteria which would have beneficial effects on the survival and growth of farmed animals, or that of immunostimulants, such as (3) glucans or polysaccharides derived from yeasts or bacteria. The vaccination methods used in vertebrates are not possible in crustaceans because of the absence of a memory immune system. In crustaceans, the defense against infections is based on an innate immune response, the main actors of which are hemocytes (blood cells), in particular producers of different antimicrobial peptides. In penaeid shrimp, the best-known antimicrobial peptides to date belong to the penaeidin family (BACHERE et al. , Immunol. Rev. 198: 149-68, 2004). The penaeidines identified at present have been classified into 3 subgroups, respectively called PEN2, PEN3, and PEN4 (GUEGUEN et al. , Dev. Comp. Immunol. , 30: 283-8, 2006), the PEN3 subgroup being the most quantitatively represented. Other antimicrobial polypeptides have also been identified in shrimp. By way of examples, mention may be made of homologous polypeptides of limpet antilipopolysaccharide factors (ALFs) identified from P-hemocyte cDNA libraries. monodon (SOMBOONWIWAT et al. , Dev. Comp. Immunol. , 29: 841-51, 2005), as well as homologs of lysozyme and an antimicrobial protein of 11. 5 kDa, called crustin, identified in ESTs of different species of penaids (CROSS et al. , Dev. Comp. Immunol. , 25: 565-77, 2001; SUPUNGUL et al. , Mar. Biotechnol. (NY), 4: 481-94, 2002). In penaeid shrimp, the study of the hemocyte population, and that of the expression of 2908136 s penaeidins, in response to stimulation by non-pathogenic agents, or during infection by pathogenic bacteria (MUNOZ et al. , Pure. J. Eiochem. 269: 2678-89, 2002; MUNOZ et al. , Cc-11 Mol. Lite Sci. 61: 961-72, 2004; DESTOUMIEUX et al. , J. This]. Sci. , 113 (Pt 3). 461-9, 2000), provided a better understanding of the mechanisms of the immune response. The first phase of the immune response of penaeids to a bacterial infection, corresponding to the first 6 or 10 hours post-infection, is characterized by a decrease in the total number of circulating hemocytes, as well as by a decrease in the relative expression of penaeidins. This decrease reflects a migration of hemocytes to infection sites, where they are lysed, and release the penaeidines. This first phase is followed by a return to a baseline level 24 to 48 hours after infection. During the second phase of the immune response, corresponding to 48-72 hours post-infection, the released penaeidins are observed in both tissues and plasma. In addition, there is a significant increase in haemocytes expressing penaeidines, both in the bloodstream and in most tissues. This increase in hemocytes reflects a process of activation of hematopoiesis, producing a new population of granular hemocytes characterized by greater transcriptional activity of penaeidins than mature haemocytes. Genetic selection of infection-resistant animal lines is a potentially valuable approach for sustaining shrimp production. To implement this approach, it is desirable to have markers to evaluate or predict the level of animal resistance to infection. In previous work (DE LORGERIL et al. , Physiol. Genomics, 21: 174-83, 2005) the team of the inventors studied, by subtractive suppressive hybridization (SSH), the expression of different genes before and during an experimental V. infection. penaeicida, in shrimp surviving this infection. They have thus identified various genes among which include genes coding for antimicrobial peptides, such as penaeidines 2 (Litsty PEN2) and 3 (Litsty PEN3), lysozyme, as well as a peptide rich in proline and cysteine related to a cryptdine. In contrast, genes encoding other antimicrobial peptides usually expressed in shrimp hernocytes, ie, crustins and anti-LPS factor (ALF) have not been identified in this SSH library. The level of transcription of these genes during infection has also been studied in shrimp surviving infection, and in those not surviving. The level of transcription of the genes encoding penaeidin-3, lysozyme, and proline-rich peptide and cysteine decreases early in all animals, and then increases only in animals that survive the infection. It is concluded that the differential expression patterns of these 3 genes during infection may be good markers for assessing the ability of shrimp to survive infection. The inventors have begun to search for other markers that can be used to evaluate the immune response and survival of shrimp to infections. These studies were carried out on two lines of shrimps of the species Litopenaeus stylirostris: one, having a high resistance to vibriosis, is a third generation line obtained from broodstock having survived infectious episodes of Syndrome 93, the other so-called control or non-selected line comes from animals raised under the conditions of farms commonly used in New Caledonia. They thus identified other genes including the transcriptional profile in response to V infection. ibrio is correlated with survival at this infection, and further found that in the case of certain genes, the basic level of transcription (i.e. the level of expression 2908136 in the absence of pathogen infection) was also correlated with survival to infection. The present invention relates to the use of these different genes as markers of resistance of penae shrimp to infections, especially to vibriosis. The genes for which the inventors have observed a correlation of the basic level of transcription with resistance to infection are those of lysozyme, penaeidin-3, and its PEN3-1 and PEN3-2 isoforms. The basal level of transcription of lysozyme as well as that of the PEN3-1 isoform appear positively correlated with resistance to infection, whereas those of penaeidin-3 and PEN3-2 isoform appear correlated. negatively to resistance to infection. The cDNA sequence of the lysozyme transcript of L. styiirostris (SEQ ID NO: 1). GCTTATTTATCALCCATTACAACGTCTGCACGTCAGCTGTGTTTTGCAATT CTGTTATTTGCATTTCAATGTTGTATAAATTCATACATCATGATATACAGGCAATCATTGTT TATTAACCCCLACTAATACTGGAATCCTGGCTTTAGCATTGCATTCGTATTATTTGCAGTAA TAATGGTAACCCTGGTGCCAAGCCTGTAAATCTAGAACATAGAGCTCGAAG 20 is available on GenBank under accession number CV699332. Homologues of the sequence SEQ ID NO: 1 in other shrimp species are available on GenBank under the following accession numbers: Litopenaeus vannamei (AF425673), Penaeus monodon (AF539466, Fenneropenaeus chinensis (AY661543), Penaeus semisulcatus ( AY169675), and Marsupenaeus japonicus (AB080238). The cDNA sequence of the transcript PEN3-1 (SEQ ID NO 30 2): GGTTCCCTCCTCCGTCCGCCATGCGCCTCGTGGTCTGCCTGGTCTTCTTGG CC TCCTTCGCCCTGG'TCTGCCAAGGCCAAGGCTACAAGGGCGGTTACACAGGCCCGGTAGTC AGGCCCTTCGTGAGACCGATAGGCAGGCCCTTCGTGACACCGATAGGCAGGCCTGTTGTTTC GGGCAACGTGTGCCCTCTATCGTGCCGGGGCATTACCACCTTACAAGCGCGTTCTTGCTGCA GCCGCTTGGGGCGCTGCTGTCGCGAGGCCAAGGGGTACTCCGGCTGATGGAGAAGAC 35 corresponds to that found in the genomic DNA (GenBank accession number AY351656 for L. styiirostris). 2908136 6 The cDNA sequence of the transcript PEN3-2 (SEQ ID NO: GGTTCCCTCCTCCGTCCGCCATGCGCCTCGTGGTCTGCCTGGTCTTCTTGG CCTCCTTCGCCCTGGTCTGCCAAGGCCAAGGCTACAAGGGCGGTTACACAGGCCCGGTAGTC AGGCCCTTCGTGAGACCGATAGGCAGGCCTGTTGTTTCATACAACGTGTGCCCTCTATCGTG CCGGGGCATTACCACCTTACAAGCGCGTTCTTGCTGCAGCCGCTTGGGGCGCTGCTGTCGCG AGGCCAAGGGGTACTCCGGCTGATGGAGAAGAC derived from post-transcriptional modifications of PEN3-1, involving an RNA editing, as well as one. 0 elimination of a pattern of some amino acids. The comparison between the sequences of these two isoforms is illustrated in Figure 1. Identical regions are indicated by asterisks; the dissimilar regions by points. In nucleotide sequences, translation start and stop codons are underlined. In the polypeptide sequences (SEQ ID NOs: 38 and 39), the signal peptides are underlined, the glycine and proline rich regions are highlighted in light gray, and the cysteine rich regions in dark gray. The subject of the present invention is therefore a method for evaluating the resistance capacity of a penaeid shrimp line to infection by a pathogenic bacterium, characterized in that it comprises the quantification, in haemocytes taken from animals of the line to be tested, uninfected, of at least one of the following RNAs. lysozyme mRNA; penaeidin-3 mRNA; mRNA of PEN3-1 isoform of penaeidin-3; The mRNA of the PEN3-2 isoform of penaeidin-3. Here we define by: penaeidin-3 mRNA, all the transcripts of the PEN3-1 and PEN3-2 isoforms of this gene. According to a preferred embodiment of a method according to the invention, the quantity of one or more of the mRNAs defined above is determined in the animals to be tested and is compared with the average amount of the same. MRNA in uninfected animals of a control line (that is, non-selected for resistance to a pathogenic bacterium) of shrimp of the same species. In the case of lysozyme, or the PEN3-1 isoform, a level of transcripts higher than that of the control shrimp is predictive of a high capacity for resistance to infection. In the case of penaeidin-3, or the PEN3-2 isoform, a level of transcripts lower than that of shrimp control is predictive of a high capacity for resistance to infection. According to another preferred embodiment of a method according to the invention, it comprises the comparison between the amounts of mRNA of the two members of at least one of the following pairs. lysozyme / penaeidine-3; Lysozyme / isoform PEN3-2; - PEN3-1 isoform / Penaeidin-3; - PEN3-1 isoform / PEN3-2 isoform. A lysozyme / penaeidine-3 ratio greater than 1.2, preferably greater than 6,. 34, as well as a lysozyme / PEN3-2 isoform ratio greater than 0.077, preferably greater than 1.02, a PEN3-1 / penaeidin-3 isoform ratio greater than 23.09, preferably greater than 46.87. , or a higher PEN3-1 isoform / PEN3-2 isoform ratio. at 1.48, preferably above 7.7, are predictive of a high capacity for resistance to infection. The transcript profiles during infection that appear correlated with the outcome of the infection are, in addition to those of penaeidin-3, lysozyme, and proline-rich peptide and cysteine, previously identified (DE LORGERIL et al. al. 2005, supra), those of penaeidin 2, crustin, and PEN3-1 isoform. In all cases, said transcription profiles are observed 6 to 72 hours after infection, preferably 24 hours after infection. After infection, in the case of crustin and the peptide rich in praline and cysteine, a higher level of transcription is observed in the animals that survive the infection than in those that do not survive there. In the case of crustin, this level is substantially equal to the basal level of transcription (measured prior to infection) in surviving animals, whereas it is significantly lower in those who do not survive. In the case of proline-rich peptide and cysteine, this level is somewhat lower than the basal level of transcription in surviving animals, whereas it is significantly lower in those who do not survive. For the other genes, the correlation between the expression profile of the gene and the resistance of the animal to the infection depends on the line from which the tested individual originates (control line or line selected for its resistance to infection). infection). In the case of lysozyme, penaeidin 3, and the PEN3-1 isoform: for the control line, the level of transcription after infection is higher in surviving shrimp than in non-surviving shrimp; for lysozyme, it is equal to or greater than the basal level of transcription in surviving animals, whereas it is significantly lower in those who do not survive; for penaeidin 3, it is a little weaker than the basal level of transcription in surviving animals, whereas it is significantly lower in those who do not survive; for the PEN3-1 isoform, it is equal to or greater than the basal level of transcripts in surviving animals, whereas it is significantly lower in those who do not survive; for the selected line, the level of transcription after infection does not differ significantly between surviving shrimp and non-surviving shrimp. In the case of penaeidin-2: for the control line, the level of transcription after infection does not differ significantly between surviving shrimp and non-surviving shrimp; For the selected line, the level of transcription after infection is higher in surviving shrimps than in non-surviving shrimps; it is not significantly different from the basic level of transcription in surviving animals, whereas it is significantly lower (at most 60 baseline) in those who do not survive. The present invention relates to a method for evaluating the outcome of an infection with a pathogenic bacterium in a penaeid shrimp, characterized in that it comprises the quantification of the mRNA of crustin, in hemocytes taken from the test animal 6 to 72 hours, preferably 24 hours, after infection. According to a preferred embodiment of a method according to the invention, it furthermore comprises the comparison of the amount of crustin mRNA determined as indicated above, with the quantity of the same mRNA in hemocytes. taken from the test animal prior to infection. The cDNA sequence of the transcript of the crustine (SEQ 20 ID NO: 4) is: TCCCGGGGCGGTTTAGTGTAGGTGGTGGCGGTTTAGGTGTAGGTGGTGGCT TCCCGGGGCGGTGTAGGTGTAGGTGGCGGTCTTGGCGTGGGAGGAGGCCTTGGAGTTAGCGG TGGCTCAAGCAACTGCAGGTATTGGTGCAAGACTCCGGAGGGTCAAGCCTACTGCTGCGAGT CGGCCCACGAACCAGAGACACCTGTTGGCACCAAGCTACTCGACTGCCCCCAAGTCCGTCCC 25 ACATGCCCACGCTTCCATGGGCCCCCCACGACCTGTTCCAACGACTACAAGTGTGCTGGCCT CGACAAGTGTTGCTTCGACAGGTGTCTGGGAGAACACGTGTGCAAGCCTCCTTCGGCCTTCG GACAGCAAGTTTTCGGATGAAGAATAAACACAAAAGGATTTTAAAGGATGAAGAGAAAGACG AAAAGACCATCTGAAGGACGACCGATGTTTTGGAATTTGACTGAAAAAAGAAAGAAAAACTA ACAGGGAATTCTTTCTTTCTGTAGGATTTATCTGATTAACATGATTTTTGTTATATGTTAAT 30 TAGACTGTATTCTGTCAAAAGAAACTTATAGAGAAAAAAAAAAAAAAAAAAAAAAAAGCTTG TA CACCTCGGCCGCGACCACGCT Homologues of SEQ ID NO: 4 with other Shrimp species are available on GenBank under the following access numbers: Litopenaeus vannamei 35 (AF430076), Penaeus monodon (DW042799), Marsupenaeus japonicus (AB121740), and Litopenaeus set iferus (AF430079). An mRNA ratio of post-infection crustin / mRNA of pre-infection crustin between 2908136 0.9 and 1.1 is predictive of survival to infection; on the other hand, an mRNA ratio of crustin after infection / mRNA of crustin before infection less than or equal to 0.6 is predictive of non-survival to infection. If appropriate, said method further comprises the quantification of the mRNA of the proline-rich peptide and cysteine in haemocytes taken from the test animal 6 to 72 hours, preferably 24 hours, after the infection, and, advantageously, comparing the amount of mRNA thus 1. 0 determined with the amount of the same mRNA in haemocytes taken from the animal to be tested prior to infection. The cDNA sequence of the transcript of the proline rich peptide and cysteine (SEQ ID NO: 5). TCTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGTCCAGAC 15 GCTGTTCTGCTCCTGTGTGGTGGCCGAACTCTGGACGCATCCCTGCTGCCATCATGAAGACC TACAGTCGGGTCTCCGTCTTTGTCTTATTGGTTGCGATCTTGCACACGTCACAAGGATCTTC CTTTTCACCTCCCAGAGGACCTCCGGGCTGGGGACCTCCATGCGTACAACAACCGTGCCCTA AGTGCCCATATGATGATTACAAGTGTCCGACGTGTGATAAATTCCCGGAGTGTGAGGAGTGC CCCCATATTAGTATAGGATGTGAATGCGGCTATTTTAGCTGCGAATGTCCGAAGCCTGTGTG 20 TGAACCGTGCGAGAGTCCCATCGCCGAGTTGATAAAAAAGGGAGGTTATAAAGGATAAAGAA GCGAGAACGAAGCCACAGCATTCTTTCACAAACCTCACTGAACTGAAAGAAGAGAGAGGGAG AGAGGGGGGAGGGAGAGGGAGAGAGAGAGAGAATAGAACGTGAGATGGGAGAAAGGAGAGAT CTWG Homologues of SEQ ID NO: 5 in 25 other shrimp species are available on GenBank under the following accession numbers: Litopenaeus vannamei (BE188497), and Penaeus monodon (DT366712). An mRNA ratio of proline-rich peptide and cysteine after infection / mRNA of proline-rich peptide and cysteine before infection greater than or equal to 0.7 is predictive of survival to infection; in contrast, an mRNA ratio of proline-rich peptide and cysteine after infection / mRNA of proline-rich peptide and cysteine before infection of less than or equal to 0.3 is predictive of non-survival to infection. In the case where the animals in which it is desired to evaluate the outcome of the infection do not belong to a line selected for its resistance to a pathogenic bacterium, one or more of the following mRNAs can be further quantified. the mRNA of lysozyme; mRNA of penaeidin-3; The mRNA of the PEN3-1 isoform of penaeidine-3. in haemocytes taken from the animal to be tested for 6 to 72 hours, preferably 24 hours, after infection, and, advantageously, to compare, for each mRNA selected, the quantity thus determined with that of the same mRNA in haemocytes removed. in the animal to be tested prior to infection. A lysozyme mRNA ratio after infection / mRNA of lysozyme before infection greater than or equal to 1 predicts survival to infection; in contrast, a mRNA ratio of lysozyme after infection / mRNA of lysozyme before infection less than 0.2 is predictive of non-survival to infection. An mRNA ratio of penaeidin 3 after infection / mRNA of penaeidin 3 before infection greater than or equal to 0.8 is predictive of survival to infection; in contrast, a mRNA ratio of penaeidin 3 after infection / mRNA of penaeidin 3 before infection less than or equal to 0.5 is predictive of non-survival to infection. An mRNA ratio of the PEN3-1 isoform after infection / mRNA of the PEN3-1 isoform before infection greater than or equal to 1 is predictive of survival to infection; in contrast, an mRNA ratio of the PEN3-1 isoform after infection / mRNA of the PEN3-1 isoform before infection less than or equal to 0.2 is predictive of non-survival to infection. Alternatively, in the case where the animals in which it is desired to evaluate the outcome of the infection belong to a line selected for its resistance to a pathogenic bacterium, the penaeidin-2 mRNA can be further quantified hemocytes taken from the animal to be tested 6 to 72 hours, preferably 24 hours, after infection, and advantageously compare the amount thus determined with that of the same mRNA in haemocytes taken from the animal. to test before infection. An mRNA ratio of penaeidin 2 after infection / mRNA of penaeidin 2 before infection greater than or equal to 0.8 is predictive of survival to infection; on the contrary, a mRNA ratio of penaeidin 2 after infection / mRNA of penaeidin 2 before infection inferior or equal to 0.6 is predictive of non-survival to infection. The processes according to the invention can in particular be used to evaluate the resistance of penaeid shrimp, and in particular L. stylirostris to vibriosis, and in particular to Vibrio penaeicida infections. A wide variety of methods for quantifying RNA, known in themselves to those skilled in the art, can be used for the implementation of the present invention (for review, cf. for example, QUORE et al. , J. Virol. Methods, 105 (2) 189-196, 2002; Patent FR 2 815 043 in the name of SKULD TECH; HUGGETT et al. , Immun Genes. , 6 (4): 279-284, 2005; EMR1CH et al. Mol. Biol. , 191: 99-108, 2002; POWELL, Methods Mol. Biol. , 99: 297-319, 2000; NESS, Methods Mol. Biol. , 316: 13-33, 2. 006; SCHENA et al. , Trends Biotechnol. , 16 (7): 301-306, 1998; RAMSAY, Nat. Biotechnol. , 16 (1): 40-44, 1998). By way of illustration, mention will be made of the various methods based on quantitative RT-PCR (reverse transcription followed by a polymerase chain reaction). The general principle of these methods consists in selectively amplifying by PCR the gene (s) whose expression (target genes) is to be measured, from a cDNA preparation obtained by reverse transcription of the mRNAs extracted from the biological sample to be tested, and to quantify the product (s) of amplification (s) obtained. The most widely used quantitative RT-PCR methods at present implement real-time PCR techniques (for review, cf. for example, VALASEK & REPA, Adv Physiol Educ, 29: 151-9, 2005), where the amplification products are quantified by measuring their fluorescence as they are formed during the exponential phase. of the amplification reaction. The present invention also relates to reagent kits for carrying out a process according to the invention, in which the quantification of transcripts is carried out by quantitative RT-PCR. Reagent kits according to the invention comprise, in addition to the conventional buffers and reagents necessary for the amplification reaction and the detection of the amplification products, at least one pair of primers specific for each of the mRNAs to be assayed. According to a first embodiment, a reagent kit according to the invention may comprise: a pair of primers specific for lysozyme mRNA, a pair of primers specific for penaeidin-3 mRNA and / or a pair of primers specific for the mRNA of the PEN3-2 isoform of penaeidin-3; or a pair of primers specific for the mRNA of the PEN3-1 isoform of penaeidin-3, a pair of primers specific for penaeidin-3 mRNA and / or a specific pair of primers mRNA of PEN3-2 isoform of penaeidin-3; or, advantageously, a pair of primers specific for lysozyme mRNA, a pair of primers specific for penaeidin-3 mRNA, a primer pair specific for PEN3-1 isoform mRNA of penaeidin-3, and a pair of primers specific for the mRNA of the PEN3-2 isoform of penaeidin-3. According to another embodiment, a reagent kit according to the invention comprises a pair of primers specific for crustin mRNA, and advantageously a pair of primers specific for proline-rich peptide mRNA. and cysteine. Preferably, said kit further comprises a pair of primers specific for lysozyme mRNA, and / or a pair of primers specific for penaeidin-3 mRNA, and / or a specific primer pair. mRNA of the PEN3-1 isoform. For the implementation of the present invention, it is also possible to use DNA chips - also called microarrays, microarrays, chips, etc. . . - (for review, cf. for example LOCKHART & WINZELER, Nature, 405: 827-36, 2000). The general principle of microarrays is to fix at different points on the surface of a solid support 5 (for example a surface of glass, plastic, or nylon) probes made up of polynucleotides complementary to the different genes that we want. measure the expression (target genes). The mRNAs extracted from the biological sample to be tested (and generally converted to cDNA by reverse transcription) are labeled and contacted with the probes fixed on the support. The measurement of the hybridization signals makes it possible to evaluate the quantity of the mRNAs of the target genes in the sample to be tested. The present invention also relates to DNA chips for carrying out a process according to the invention. According to a first embodiment, a DNA chip according to the invention may for example comprise: a probe specific for lysozyme mRNA, a scinde specific for penaeidin-3 mRNA and / or a probe mRNA specific of the PEN3-2 isoform of penaeidin-3; or a probe specific for the mRNA of the PEN3-1 isoform of penaeidin-3, a probe specific for penaeidin-3 mRNA and / or a probe specific for the mRNA of the PEN3 isoform -2 of penaeidine-3; or, advantageously, a probe specific for dulysozyme mRNA, a probe specific for penaeidin-3 mRNA, a mRNA-specific probe for PEN3-1 isoform of penaeidin-3, and a specific probe. mRNA of the PEN3-2 isoform of penaeidin-3. According to another embodiment, a DNA chip according to the invention comprises a specific probe of the crustin mRNA, and advantageously a probe specific for the mRNA of the proline-rich peptide and cysteine. Preferably, said chip further comprises a probe specific for lysozyme mRNA, and / or a probe specific for penaeidin-3 mRNA, and / or a probe specific for isoform mRNA. PEN3-1. The present invention will be better understood with the aid of the additional description which follows, which refers to non-limiting examples, illustrating the correlation between the level of transcription of antimicrobial peptides in penaeid shrimp hemocytes, and the resistance of said shrimps to infection with Vibrio penaeicida. EXAMPLES 10 Materials and Methods Animals: Of L. juvenile stylirostris (20-30 g) from two shrimp lines were obtained from the IFREMER laboratory in New Caledonia (Ifremer, BP2059, 98896 Nouméa Cedex, New Caledonia, France). One of these lines, called the selected line, results from the crossing of animals having survived Syndrome 93, raised in basins during the first 6 months of their life, under conditions favorable to infection with Vibrio penaecicida (initial density: 20-25 PL / m2); the surviving animals are then reared at lower densities (1-2 shrimp / m) to reproduce at 12 months of age. The other line, called the control line, results from the crossing of animals reared in pools in 25 traditional conditions (initial density: 2 PL / m2), where the occurrence of the syndrome 93 is very low. In both lineages, consanguinity was controlled by individually marking the animals to avoid mating of close relatives. The animals used in the experiments described hereinafter were taken in the 3rd generation of the selected line (G3-selection), and in the 3rd generation of the control line (G3-control). Experimental Infections: The infections were carried out by immersing the shrimp for 2 hours in seawater tanks containing 1x101 CFU / ml of the AM strain AM101. penaeicida, which corresponds to 20% of the lethal dose (LD20) (SAULNIER and 2908136 16 al. , Say. Aquatic Org. 40: 109-115, 2000). The animals were then rinsed with filtered seawater and transferred to 100 L tanks. Uninfected animals were kept in a separate tank of 100 L. For the first type of experimental infection used for the overall analyzes, animals from each shrimp (control and selected) line were divided into three groups (15 shrimp per group) placed in separate tanks. For each of the shrimp lines, hemolymph samples from the first group were collected 24 hours before the experimental infection (-24) to constitute the uninfected control; Hemolymph samples from the other two groups were collected 12 hours after infection (+12) and 24 hours after infection (+24). The protocol for the second type of experimental infection, used for the individual analyzes, is shown in Figure 2. The shrimp are individually labeled with the colored silicone injection under the third abdominal segment of the cuticle. A first haemolymph sample is taken 24 hours before infection, and a second sample taken 24 hours after infection. Hemolymph samples from animals that died within 96 hours of infection (acute mortality period), and animals surviving from this period were individually distinguished. RNA isolation and real-time PCR analysis: Total RNAs were isolated from shrimp haemocytes using Trizol reagent (Gibco BRL) (1 ml / 107 cells), according to the protocol indicated by the manufacturer. Total RNAs were treated with DNase (TURBO DNase, Ambion) to remove contaminating genomic DNA, and then the DNase was removed by phenol-chloroform extraction. The cDNA was synthesized from 1 μg of total RNA, using the SuperScript II reverse transcription kit, according to the manufacturer's instructions (Invitrogen), in a reaction volume of 20 μl. 0.5 μl of each reverse transcription reaction served as a template for the real-time PCR in 10 μl reaction volume containing SYBR GREEN MASTER MIX IX (Qiagen) and 0.5 μM of each primer used. Each real-time PCR reaction was performed with an initial denaturation step of 900s at 95 ° C, followed by amplification of the target cDNA (35 cycles of denaturation at 95 ° C for 15 seconds, hybridization between 54 C and 64 C (depending on the primer used) for 15 seconds, and an elongation at 72 C for 15 seconds), with the LightCycler (Roche Molecular Biomedicals). Each reaction was performed in triplicate. To determine the efficiency of each pair of primers used, standard curves were obtained using series of plasmid dilutions containing the corresponding target sequences (103 to 10 'copies / μl). The real-time PCR results are represented as variations of normalized relative expression against a reference gene, the elongation factor la (EF-1a, SEQ ID NO: 41), as described by PFAFFL (Nucleic Acids Res. , 29: 45, 2001). For the genes tested, the real-time PCR efficiency varies between 1.87 and 1.98. Since this efficiency was not exactly equal to 2.00 (representing 100% amplification efficiency at each cycle), the relative abundance was calculated, as indicated by PFAFFL (cited above, 2001), using the equation corrected for differences in efficiency. EXAMPLE 1: ISOLATION OF A NEW SEQUENCE OF PENAEIDINE FROM THE PEN3 SUB-GROUP IN L. HEMATOCYTES STYLIROSTRIS A first series of real-time PCR was performed from shrimp hematocyte pool cDNAs from each of the two lines to compare the abundance of the Litsty PEN3 peptide transcript (GenBank AY351656) between these two lines. , using the following primers. 2908136 [5'-GGTTCCCTCCTCCGTCCGCC-3 '(SEQ ID NO: 6) and 5'-GTCTTCTCCATCAGCCGGAG-3' (SEQ ID NO: 7), Efficiency 1. 94, hybridization temperature 60 C]. The analyzes of the PCR product fusion curves are shown in Figure 3. Legend of Figure 3: shrimp line selected shrimp line control The melting temperature corresponding to each peak is indicated above the peak. The results show two melting peaks which vary by close to 0.5 C. The melting temperature of the PCR products appears higher for the selected shrimp line than for that of the control line (86. 43 0. 06 and 85. 98_ + 0. 02, respectively, p <0.01, LightCyler 3.5 software). Real-time PCR products with different melting temperatures were cloned and sequenced, leading to the characterization of two 294 and 270 nucleotide cDNA sequences (Figure 1A). The sequence corresponding to the highest melting temperature, identified in the selected shrimp line, was identified as the previously characterized Litsty PEN3 sequence, which will be hereinafter referred to as Litsty PEN3-1. The second cDNA sequence identified in the control shrimp line differs from Litsty PEN3-1 by a deletion of 24 nucleotides, and a change of three nucleotides in another part of the sequence (Figure 1A). This sequence will be hereinafter referred to as Litsty PEN3-2. At the amino acid sequence level, Litsty PEN3-2 differs from Litsty PEN3-1 in the absence of the N-terminal domain of the 8 PIGRPFVT residues, and by the substitution of a glycine residue by a tyrosine residue (FIG. 1B). Because of the close similarity between the Litsty PEN3-1 and Litsty PEN3-2 sequences, it was investigated whether these were expressed by two distinct genes or by a single gene. For this, the two sequences of the genomic DNA and the cDNA of the hemocyte were amplified by PCR. Primer pairs to distinguish these two sequences were constructed: P3-1R and P3-1F: [5 '- ACCGATAGGCAGGCCCTTCGTGAC-3' (SEQ ID NO: 8) and 5'-CGATAGAGGGCACACGTTGCCC-3 '( SEQ ID NO: 9), efficiency 1.85, hybridization temperature 64 C] for Litsty PEN3-1 and P3-2R and P3-2F: [5'-GAGACCGATAGGCAGGCCTG-3 'SEQ ID NO: 10 and 5'-CGATAGAGGGCACACGTTGTAT3 '(SEQ ID NO: 11, Effectiveness 1.91, Hybridization 64) for Litsty PEN3-2 The results of agarose gel electrophoresis of the PCR products obtained with these primers for Litsty PEN3-1 and Litsty PEN3-2 are shown in Figure 4A and Figure 4B, respectively Legend of Figure 4: gDNA = genomic DNA cDNA = cDNA C- = negative control The primer pairs used are shown above the schematic representations of the two transcripts by The nucleotide differences between the two transcripts are shown for the deletion of 24 nucleotides by a hatched on Litsty PEN3-1 and by a dotted line on Litsty PEN3-2, and for the change of 3 nucleotides by a gray square on Litsty PEN3-1 and by a 2.5 white square on Litsty PEN3-2. Regardless of the primer pairs used, Litsty PEN3-1 could be amplified from genomic DNA and cDNA. The amplified fragments are of the same size in both cases, indicating the absence of intron (Figure 4A). In the case of Litsty PEN3-2 amplification is obtained only from cDNA, but not from genomic DNA (Figure 4B). EXAMPLE 2: EXPRESSION PROFILES OF ANTIMICROBIAL PEPTIDE GENES DURING VIBRIO PENAEICIDA INFECTION In order to analyze the expression of antimicrobial peptide (AMP) genes in circulating shrimp haemocytes, 6 cDNA sequences were analyzed. AMPs (or putative AMPs) described in recent studies (MUNOZ et al., Cell Mol., 2908136 Life Sci., 61: 961-972, 2004, DE LORGERIL et al., 2005, supra) have been selected from L. stylirostris. The GenBank accession numbers for Penstedin PEN2-1 and PEN3 Penaeidines are AY351655 and AY351656, respectively. The GenBank accession numbers of lysozyme and cysteine-rich peptide are CV699332 and CV699287, respectively. The crustin cDNA sequence is indicated in the attached sequence listing under the number SEQ ID NO: 4. The ALF cDNA sequence is indicated in the attached sequence listing as SEQ ID NO: 40. Expression profiles of the genes encoding AMPs, Litsty PEN2-1 and -3, ALF, crustin, lysozyme, and cysteine-rich peptide, were analyzed by real-time PCR to examine the general pattern of expression during pregnancy. evolution of V. penaeicida infection, for the selected line and for the control line. PCR primers (sense and antisense) listed in Table 1 below were used. The primer pair temperature is PCR; calculated by Primer Name sense (5 '? 3') Antisense primer (5 '? 3') Hybridization Efficiency Gene (C) PCR ALF GCCACTCCTGCACCTACAA TTCACAACACCGGATTTGCTG 55 1.87 (SEQ ID NO: 12) SEQ ID NO: 13) Litsty CCATGCGCCTCGTGGTCTG GAACGCGCTTGTAAGGTGGTAA 64 1.98 PEN3 (SEQ ID NO: 14) (SEQ ID NO: 15) Litsty CCATGCGCCTCGTGGTCTG AGCAATTGCGGCATCTGGGAA 64 1.91 PEN2-1 SEQ ID NO: 16 (SEQ ID NO: 17) () lysozyme CGTCTGCACGTCAGCTGTG GGCTTGGCACCAGGGTTACC 59 _ (SEQ ID NO : 18) (SEQ ID NO: 19) 1.93 crustin CCAAGTCCGTCCCACATGC CTGTCGAAGCAGCACTTGTC 55 1.91 (SEQ ID NO: 20) (SEO ID NO: 21) Peptide GCCCTAAGTGCCCATATGA GCCGCATTCACATCCTATA 54 1.89 rich in (SEQ ID NO: 22) (SEQ ID NO: 23) ) cysteine EF-1 u GGTGCTGGACAAGCTGAAGGC 1CGTTCCGGTGATCATGTTCTTGATG 60 1.96 _ (SEQ ID NO: 24) (SEQ ID NO: 25) The results are shown in Figure 5. The relative expressions were normalized with respect to the elongation factor 1a, and each value was calculated by specific hybridization of each Indicated, as well as the efficiency of the equation E = 10 [-l / slope] (PFAFFL, 2001,

précité). Tableau 1 2908136 21 référence aux crevettes non infectées (expression relative = 1) selon la méthode 2-AACt corrigée pour les efficacités (PFAFFL, 2001, précité). Légende de la Figure 5 5 Lignée de crevettes sélectionnée -- Lignée de crevettes contrôle -24 = crevettes non infectées +12 = 12 heures après l'infection +24 = 24 heures après l'infection 10 Il apparaît que la quantité des ARNs d'ALF, du lysozyme, de la crustine et du peptide riche en cystéine varie pendant l'infection, et par rapport aux crevettes non infectées, dans les deux lignées de crevettes. Seul ALF présente un schéma d'expression au cours 15 de l'infection qui diffère entre les deux lignées de crevettes. En effet, la quantité de transcrit d'ALF augmente dès 12 heures après l'infection pour la lignée contrôle (augmentation relative de respectivement 3x et 2,1x, 12 et 24 heures après l'infection), alors que l'augmentation (d'un 20 facteur de 2,7x) est différée à 24 heures après l'infection pour la lignée de crevettes sélectionnée. Pour les autres AMPs la quantité de transcrits diminue dans les 12 premières heures suivant l'infection. Ceci est particulièrement évident pour le lysozyme, la crustine et 25 le peptide riche en cystéine, dans la lignée contrôle (diminution relative de 3,2x, 3,3x et 4,5x par rapport aux crevettes non infectées, respectivement) aussi bien que dans la lignée sélectionnée (diminution relative de 25x, 3,5x et 9,1x par rapport aux crevettes non infectées, respectivement). supra). Table 1 2908136 21 reference to uninfected shrimp (relative expression = 1) according to the 2-AACt method corrected for efficiencies (PFAFFL, 2001, cited above). Legend of Figure 5 Shrimp line selected - shrimp line control -24 = uninfected shrimp +12 = 12 hours after infection +24 = 24 hours after infection 10 It appears that the amount of RNAs ALF, lysozyme, crustin, and cysteine-rich peptide varied during infection, and compared to uninfected shrimp, in both shrimp lines. Only ALF exhibits an expression pattern during infection that differs between the two shrimp lines. Indeed, the amount of transcript ALF increases from 12 hours after infection for the control line (relative increase of respectively 3x and 2.1x, 12 and 24 hours after infection), while the increase ( 2.7x) is delayed at 24 hours post-infection for the selected shrimp line. For other AMPs the amount of transcripts decreases in the first 12 hours after infection. This is particularly evident for lysozyme, crustin and cysteine-rich peptide, in the control line (relative decrease of 3.2x, 3.3x and 4.5x compared to uninfected shrimp, respectively) as well as in the selected line (relative decrease of 25x, 3.5x and 9.1x compared to uninfected shrimp, respectively).

30 La diminution des transcrits de la crustine et du peptide riche en cystéine est suivie, 24 heures après l'infection, d'une tendance à un retour aux niveaux observés dans les crevettes non infectées. Cette tendance est observée pour les deux lignées de crevettes, mais l'augmentation des transcrits 35 de la crustine et du peptide riche en cystéine entre 12 et 24 heures apparaît significativement plus importante dans la lignée sélectionnée (augmentation relative de 5,8x et 9,8x, 2908136 22 respectivement) que dans la lignée contrôle (augmentation relative de 2,5x et 2,6x, respectivement). La même diminution est observée pour le lysozyme 12 heures après l'infection pour les deux lignées ; cependant 5 les transcrits du lysozyme demeurent moins abondants 24 heures après l'infection pour la lignée de crevettes sélectionnée que pour la lignée de crevettes contrôle. En ce qui concerne les pénaeidines Litsty PEN2-1 et Litsty PEN3, leur expression ne varie que faiblement chez la 10 lignée contrôle, en particulier pour Litsty PEN3. Dans la lignée sélectionnée, la quantité des transcrits de Litsty PEN2-1 et Litsty PEN3 augmente (de respectivement 3,93x et 2,73x) entre 12 heures et 24 heures après l'infection. EXEMPLE 3 : MISE EN EVIDENCE DE LA RELATION ENTRE LE NIVEAU 15 BASAL D'EXPRESSION DE PEPTIDES ANTI-MICROBIENS ET LA RESISTANCE A L'INFECTION D'UNE L:IGNEE DE CREVETTES. Expression du lysozyme, et expression globale de la pénaeidine-3 Le niveau basal de transcription du lysozyme, de 20 Litsty PEN3, et des deux isoformes Litsty PEN3-1 et Litsty PEN3-2 a été comparé dans les deux lignées de crevettes (sélectionnée et contrôle). La quantité de transcrits 24 heures avant l'infection a été mesurée par PCR en temps réel, comme indiqué ci-dessus dans Matériel et Méthodes, à 25 partir de pools d'échantillons d'ARN d'hémocytes (pools de 15 crevettes) prélevés 24 heures avant l'infection. Pour quantifier la transcription du lysozyme et la transcription globale de Litsty PEN3 les amorces utilisées sont celles indiquées dans le tableau 1 ci-dessus. Pour 30 quantifier spécifiquement la transcription de Litsty PEN3-1 et de Litsty PEN3-2, les amorces P3-1R et P3-1F pour Litsty PEN3-1, et P3-2R et P3-2F pour Litsty PEN3-2, décrites dans l'Exemple 1, ont été utilisées. Les résultats obtenus pour le lysozyme sont 35 illustrés par la Figure 6A, et ceux obtenus pour Litsty PEN3 sont illustrés par la Figure 6P. Les résultats obtenus pour Litsty PEN3-1 et Litsty PEN3-2 sont présentés dans la Figure 7.The decrease in crustin and cysteine-rich peptide transcripts is followed, 24 hours after infection, by a tendency to return to levels observed in uninfected shrimp. This trend is observed for both shrimp lines, but the increase of crustin and cysteine-rich peptide transcripts between 12 and 24 hours appears significantly greater in the selected line (relative increase of 5.8x and 9, 8x, 2908136 22 respectively) than in the control line (relative increase of 2.5x and 2.6x, respectively). The same decrease is observed for lysozyme 12 hours after infection for both lines; however, lysozyme transcripts remain less abundant 24 hours after infection for the selected shrimp line than for the control shrimp line. With regard to the penaeidines Litsty PEN2-1 and Litsty PEN3, their expression varies only slightly in the control line, in particular for Litsty PEN3. In the selected line, the amount of Litsty PEN2-1 and Litsty PEN3 transcripts increased (by 3.93x and 2.73x, respectively) between 12 hours and 24 hours after infection. EXAMPLE 3: DISCLOSURE OF THE RELATIONSHIP BETWEEN THE BASAL LEVEL OF EXPRESSION OF ANTI-MICROBIAL PEPTIDES AND THE RESISTANCE TO INFECTION OF L: IGNEE OF SHRIMPS. Expression of Lysozyme, and Overall Penaeidine-3 Expression The basal transcriptional level of lysozyme, Litsty PEN3, and both Litsty PEN3-1 and Litsty PEN3-2 isoforms were compared in both shrimp lines (selected and control). The amount of transcripts 24 hours prior to infection was measured by real-time PCR, as indicated above in Materials and Methods, from pools of hemocyte RNA samples (shrimp pools) collected. 24 hours before infection. To quantify the lysozyme transcription and the overall Litsty PEN3 transcription, the primers used are those shown in Table 1 above. To specifically quantify the transcription of Litsty PEN3-1 and Litsty PEN3-2, primers P3-1R and P3-1F for Litsty PEN3-1, and P3-2R and P3-2F for Litsty PEN3-2, described in FIG. Example 1 were used. The results obtained for lysozyme are shown in Figure 6A, and those obtained for Litsty PEN3 are shown in Figure 6P. The results obtained for Litsty PEN3-1 and Litsty PEN3-2 are shown in Figure 7.

2908136 23 Les niveaux d'expression relative ont été normalisés par rapport au facteur d'élongation la. Dans le cas du lysozyme et de Litsty PEN3 (Figure 6), les résultats sont exprimés comme des valeurs moyennes SDV à partir de 5 ou 6 5 crevettes par lignée de crevettes. Chaque valeur est calculée en référence au groupe de la lignée contrôle (expression relative = 1) selon la méthode 2-,nACt corrigée pour l'efficacité (PFAFFL, 2001, précité). Dans le cas de Litsty PEN3-1 et Litsty PEN3-2 (Figure 7) les niveaux d'expression 10 relative ont été normalisés par rapport à EF-la, et chaque valeur a été calculée en référence à la première valeur de Litsty PEN3-2 à partir de la lignée contrôle (expression relative = 1) selon la méthode 2-GéCt corrigée pour l'efficacité. Les résultats sont exprimés comme des valeurs 15 moyennes SDV à partir de deux pools de crevettes réalisés en trois exemplaires. Légende de la Figure 6 ^ lignée de crevettes contrôle ^ lignée de crevettes sélectionnée 20 différence statistique entre les deux lignées de crevettes, p<0,05 (Student test). Légende de la Figure 7 transcrits de Litsty PEN3-1 ^ transcrits de Litsty PEN3-2 25 Ces résultats révèlent des différences significatives entre les crevettes de la lignée sélectionnée pour la survie et les crevettes de la lignée contrôle. En ce qui concerne le lysozyme, le niveau basal de transcription est moindre dans les hémocytes des crevettes de 30 la lignée contrôle, que dans ceux des crevettes de la lignée sélectionnée. Au contraire, en ce qui concerne la transcription globale de Litsty PEN3, son niveau basal est plus élevé dans les hémocytes des crevettes de la lignée contrôle que ceux des 35 crevettes de la lignée sélectionnée. En ce qui concerne Litsty PEN3-1 son niveau basal de transcription est beaucoup plus élevé dans les hémocytes 2908136 24 des crevettes de la lignée sélectionnée que dans ceux des crevettes de la lignée contrôle. Au contraire, le niveau basal de transcription de Litsty PEN3-2 est bien moindre dans les hémocytes des 5 crevettes de la lignée sélectionnée que dans ceux des crevettes de la lignée contrôle En outre, dans la lignée sélectionnée, le niveau basal de transcription de Litsty PEN3-1 est beaucoup plus élevé que celui de Litsty PEN3-2, alors qu'aucune différence 10 entre les niveaux de transcription de base de Litsty PEN3-1 et Litsty PEN3-2 n'est observable dans la lignée contrôle. EXEMPLE 4 : RELATION ENTRE LE PROFIL D'EXPRESSION DE GENES DE PEPTIDES ANTIMICROBIENS AU COURS DE L'INFECTION PAR VIBRIO PENAEICIDA ET LA CAPACITE INDIVIDUELLE DE SURVIE DES CREVETTES 15 Les quantités de transcrits de l'ALE, de Litsty PEN3 (PEN3) et de ses isoformes Litsty PEN3-1 et Litsty PEN3-2, de Litsty PEN2-1 (PEN2), du lysozyme, de la crustine et du peptide riche en cystéine, 24 heures avant l'infection, et 24 heures après l'infection ont été comparées entre les 20 individus ayant survécu à l'infection et ceux n'ayant pas survécu, dans la lignée de crevettes sélectionnée et dans la lignée contrôle. Les résultats sont présentés dans les Figures 8 et 9. La quantité de transcrits a été déterminée par PCR 25 en temps réel, comme décrit ci-dessus, à partir d'échantillons individuels (5 ou 6 crevettes par condition), et les résultats présentés représentent la moyenne de ces mesures. Les niveaux d'expression relative ont été normalisés par rapport à EF-la. Pour l'ALE, Litsty PEN3,3 Litsty PEN2-1, le 30 lysozyme, la crustine et le peptide riche en cystéine (Figure 8), les valeurs durant l'infection ont été calculées en référence au groupe non infecté (expression relative = 1) selon la méthode 2-ôôCt corrigée pour l'efficacité. Les conditions expérimentales associées par un crochet présentent 35 une différence statistique, p<0,05 (ANOVA-test LSD). Légende de la Figure 8 : ^ : quantité avant l'infection (-24) 2908136 25 ^ : quantité 24 heures après l'infection chez les crevettes ayant survécu (+24S) . quantité 24 heures après l'infection chez les crevettes n'ayant pas survécu (+24NS) 5 Pour ALF, on observe une augmentation des transcrits 24 heures après l'infection dans les deux lignées de crevettes. Dans la lignée contrôle, une différence significative du niveau de transcription par rapport aux crevettes non infectées est observée pour les crevettes ayant 10 survécu, mais pas pour celles n'ayant pas survécu. Au contraire, dans la lignée de crevettes sélectionnée, une différence significative du niveau de transcription par rapport aux crevettes non infectées est observée pour les crevettes n'ayant pas survécu, mais pas pour celles ayant 15 survécu. Aucune des deux lignées ne présente de différence significative entre les crevettes ayant survécu et celles n'ayant pas survécu. Pour la famille des pénaeidines, les transcrits de Litsty PEN2-1 et PEN3 diminuent 24 heures après l'infection. Pour Litsty PEN3, on n'observe de différences significatives des niveaux de transcription que chez la lignée contrôle, entre les crevettes n'ayant pas survécu et les aux crevettes non infectées, et également entre les crevettes n'ayant pas survécu et celles ayant survécu. Pour Litsty PEN2-1 des différences significatives sont observées dans les deux lignées. Dans la lignée contrôle, une diminution significative des transcrits par rapport aux crevettes non infectées est observée à la fois chez les crevettes ayant 30 survécu et chez celles n'ayant pas survécu. Dans la lignée sélectionnée, on observe des différences significatives entre les crevettes ayant survécu et celles n'ayant pas survécu, ainsi qu'entre les crevettes n'ayant pas survécu et celles non infectées. En revanche, 35 aucune différence significative n'est observée entre les crevettes non infectées et celles ayant survécu.Relative expression levels were normalized with respect to elongation factor la. In the case of lysozyme and Litsty PEN3 (FIG. 6), the results are expressed as mean SDV values from 5 or 6 shrimps per shrimp line. Each value is calculated with reference to the group of the control line (relative expression = 1) according to the method 2-, nACt corrected for efficacy (PFAFFL, 2001, mentioned above). In the case of Litsty PEN3-1 and Litsty PEN3-2 (Figure 7) the relative expression levels were normalized with respect to EF-1a, and each value was calculated with reference to the first value of Litsty PEN3- 2 from the control line (relative expression = 1) according to the 2-GeCt method corrected for efficiency. The results are expressed as mean SDV values from two shrimp pools made in triplicate. Legend of Figure 6 Shrimp line control Shrimp line selected 20 statistical difference between the two shrimp lines, p <0.05 (Student test). Legend to Figure 7 Litsty PEN3-1 transcripts Litsty PEN3-2 transcripts These results reveal significant differences between shrimp from the line selected for survival and shrimp from the control line. With regard to lysozyme, the basal level of transcription is lower in the shrimp haemocytes of the control line than in those of the shrimp of the selected line. On the contrary, as regards the overall transcription of Litsty PEN3, its basal level is higher in the shrimp haemocytes of the control line than those of the shrimp of the selected line. Regarding Litsty PEN3-1 its basal level of transcription is much higher in the haemocytes than in those shrimp lineage control. In contrast, the basal level of Litsty PEN3-2 transcription is much lower in the shrimp haemocytes of the selected line than in those of the shrimp of the control line. In addition, in the selected line, the basal level of transcription of Litsty PEN3-1 is much higher than that of Litsty PEN3-2, whereas no difference between the basic transcription levels of Litsty PEN3-1 and Litsty PEN3-2 is observable in the control line. EXAMPLE 4: RELATION BETWEEN THE EXPRESSION PROFILE OF GENES OF ANTIMICROBIAL PEPTIDES DURING INFECTION WITH VIBRIO PENAEICIDA AND THE INDIVIDUAL CAPACITY OF SURVIVAL OF SHRIMPS The quantities of transcripts of ALE, Litsty PEN3 (PEN3) and its Litsty PEN3-1 and Litsty PEN3-2 isoforms, Litsty PEN2-1 (PEN2), lysozyme, crustin and cysteine-rich peptide, 24 hours before infection, and 24 hours after infection were compared between surviving and non-surviving individuals, in the selected shrimp line and in the control line. The results are shown in Figures 8 and 9. The amount of transcripts was determined by real-time PCR, as described above, from individual samples (5 or 6 shrimp per condition), and the results presented. represent the average of these measures. Relative expression levels were normalized to EF-1a. For ALE, Litsty PEN3,3 Litsty PEN2-1, lysozyme, crustin, and cysteine-rich peptide (Figure 8), values during infection were calculated with reference to the uninfected group (relative expression = 1) according to the 2-step method corrected for efficiency. The experimental conditions associated with a hook have a statistical difference, p <0.05 (ANOVA-LSD test). Figure 8: Pre-infection amount (-24): 24 hours after infection in surviving shrimp (+ 24S). 24 hours after infection in surviving shrimp (+24NS) For ALF, an increase in transcripts was observed 24 hours after infection in both shrimp lines. In the control line, a significant difference in transcription level compared to uninfected shrimp is observed for shrimp that survived, but not for those that did not survive. In contrast, in the selected shrimp line, a significant difference in the level of transcription compared to uninfected shrimp is observed for shrimp that did not survive, but not for those that survived. Neither of the two lines showed a significant difference between surviving and non-surviving shrimps. For the penaeidin family, Litsty PEN2-1 and PEN3 transcripts decrease 24 hours after infection. For Litsty PEN3, significant differences in transcription levels were observed only in the control line, between non-surviving shrimps and uninfected shrimps, and also between surviving and surviving shrimps. . For Litsty PEN2-1 significant differences are observed in both lineages. In the control line, a significant decrease in transcripts compared to uninfected shrimp is observed in both surviving and non-surviving shrimp. In the selected line, there are significant differences between surviving and non-surviving shrimp, and between non-surviving and uninfected shrimp. In contrast, no significant difference was observed between uninfected and surviving shrimp.

20 25 2908136 26 Les transcrits de la crustine et du peptide riche en cystéine présentent des schémas d'expression similaires dans les deux lignées de crevettes Chez les deux lignées on observe une diminution 5 significative des transcrits de la crustine et du peptide riche en cystéine chez les crevettes n'ayant pas survécu par rapport aux animaux non infectés, et une augmentation significative de ces transcrits chez les animaux ayant survécu par rapport à ceux n'ayant pas survécu.The crustin and cysteine-rich peptide transcripts show similar expression patterns in both shrimp lines. In both lines there was a significant decrease in crustin and cysteine-rich peptide transcripts. shrimp that did not survive compared to uninfected animals, and a significant increase in these transcripts in surviving versus non-surviving animals.

10 Dans le cas du lysozyme, on observe dans la lignée contrôle, une diminution importante de la quantité de transcrits chez les crevettes n'ayant pas survécu par rapport aux crevettes non infectées, et par rapport aux crevettes ayant survécu. Dans la lignée sélectionnée, on observe une 15 diminution significative de la quantité de transcrits à la fois les crevettes ayant survécu et chez celles n'ayant pas survécu par rapport aux crevettes non infectées. Pour Litsty PEN3-1 et Litsty PEN3-2 (Figure 9), les valeurs durant l'infection ont été calculées en référence à la 20 moyenne de toutes les valeurs selon la méthode 2-êôCt corrigée pour l'efficacité. Légende de la Figure 9 : expression relative des transcripts Litsty PEN3-1 (P3-1) ^ expression relative des transcripts Litsty PEN3-2 (P3-2) 25 -24 = crevettes collectées avant l'infection +24S = crevettes collectées 24 heures après l'infection ayant survécu +24NS = crevettes collectées 24 heures après l'infection n'ayant pas survécu 30 Dans la lignée contrôle, on n'observe de différences significatives entre la quantité de transcrits de Litsty PEN3-1 et la quantité de transcrits de Litsty PEN3-2 que 24 heures après l'infection, et chez les crevettes ayant survécu. Pour les animaux qui n'ont pas survécu les quantités 35 des deux transcrits Litsty PEN3-1 et Litsty PEN3-2, sont extrêmement faibles par rapport à celles mesurées avant l'infection.In the case of lysozyme, the control line shows a significant decrease in the amount of transcripts in shrimps that did not survive compared to uninfected shrimps, and shrimp that survived. In the selected line, there is a significant decrease in the amount of transcripts in both surviving and non-surviving shrimp compared to uninfected shrimp. For Litsty PEN3-1 and Litsty PEN3-2 (Figure 9), the values during infection were calculated by reference to the mean of all values according to the 2-step corrected method for efficacy. Legend of Figure 9: Relative Expression of Litsty PEN3-1 Transcripts (P3-1) Relative Expression of Litsty PEN3-2 Transcripts (P3-2) 25 -24 = shrimps collected prior to infection + 24S = shrimps collected 24 hours After surviving infection + 24NS = shrimp collected 24 hours after infection that did not survive In the control line, there were no significant differences between the amount of Litsty PEN3-1 transcripts and the amount of transcripts of Litsty PEN3-2 only 24 hours after infection, and in surviving shrimp. For animals that did not survive, the amounts of both Litsty PEN3-1 and Litsty PEN3-2 transcripts are extremely low compared to those measured prior to infection.

2908136 2 7 Dans la lignée sélectionnée, on observe des différences significatives entre les quantités de Litsty PEN3-1 et Litsty PEN3-2 quelque soit le moment de l'infection ccnsidérée.In the selected line, there are significant differences between the amounts of Litsty PEN3-1 and Litsty PEN3-2 regardless of the time of infection.

5 Litsty PEN3--1 est beaucoup plus abondant que Litsty PEN3-2, que ce soit avant l'infection, à 24 heures dans les crevettes qui ont survécu, ou dans celles qui n'ont pas survécu. EXEMPLE 5 : ANALYSE DE L'EXPRESSION DES TRANSCRITS SUR PUCE 10 D'ADN Des membranes de miniarrays ont été préparées afin d'évaluer les abondances en transcrits de gènes codant pour six peptides antimicrobiens (ALF, crustine, peptide riche en glycine, Litsty PEN3-1, lysozyme, peptide riche en cystéine) 15 de la crevette L. styl_irostris. Les numéros d'accession peptide riche en cystéine sont CV699287. Les séquences d'ADNc de sont respectivement indiquées dans 20 annexe sous les numéros SEQ ID NO : 2 et SEQ ID NO : 4. La séquence d'ADNc de ALF est indiquée dans la liste de séquences en annexe sous le numéro SEQ ID NO : 40. La séquence d'ADNc du peptide riche en glycine est indiquée dans la liste de séquences en annexe sous le numéro SEQ ID NO : 42.5 Litsty PEN3--1 is much more abundant than Litsty PEN3-2, either before infection, at 24 hours in shrimp that survived, or in those that did not survive. EXAMPLE 5 ANALYSIS OF DNA CHIP TRANSCRIPTS EXPRESSION Miniarrays membranes were prepared to evaluate the abundances of transcripts of genes coding for six antimicrobial peptides (ALF, crustin, glycine-rich peptide, Litsty PEN3 -1, lysozyme, cysteine-rich peptide) of shrimp L. styl_irostris. The peptide accession numbers rich in cysteine are CV699287. The cDNA sequences are respectively shown in the appendix as SEQ ID NO: 2 and SEQ ID NO: 4. The ALF cDNA sequence is indicated in the attached sequence listing under the number SEQ ID NO: 40. The cDNA sequence of the glycine-rich peptide is indicated in the attached sequence listing under the number SEQ ID NO: 42.

25 Préparation des ADNc sondes Des fragments d'ADNc (ADNc sonde) de chacun des gènes codant pour les six peptides antimicrobiens, sont amplifiés par PCR classique. Les amorces PCR (sens et anti-sens) listées dans le 30 Tableau 2 ci-dessous ont été utilisées. La température d'hybridation spécifique de chaque paire d'amorces est indiquée, de même que la taille des produits de PCR amplifiés attendue. GenBank du lysozyme et du respectivement CV699332 et PEN3-1 et de la crustine la liste de séquences en 2908136 28 Tableau 2 Nom de Tm Taille Nom du gène Séquence de l'amorce l'amorce ( C) (pb) Peptide riche CystF 5'-TGGTGGCCGAACTCTGGAC-3' (SEQ ID NO : 26) 62 475 en cystéine CystR ^ 5'-CTCCTTTCTCCCATCTCACG-3' (SEQ ID NO : 27) 62 Peptide riche GIyF 5'-TGCACCGAGCAAAACGTCAG-3' (SEQ ID NO : 28) 62 449 en glycine GIyR 5'-TCGAGGAATTCACACTGAAACA-3' (SEQ ID NO : 29) 62 CrusF 5'-GTGGTGGCGGTTTAGGTGTA-3' (SEQ ID NO :30) 62 Crustine 429 CrusR 5'-CATCGGTCGTCCTTCAGATG-3' (SEQ ID NO : 31) 62 LysoF 5'-TATCAACCATTACAACGTCTGC-3' (SEQ ID NO : 32) 62 Lysozyme 201 LysoR 5'-AGATTTACAGGCTTGGCACCA-3' (SEQ ID NO : 33) 62 PEN3-1 F 5'-CCTGGTCTTCTTGGCCTCC-3' (SEQ ID NO : 34) 62 Litsty PEN3-1 157 PEN3-1R 5'-TAGAGGGCACACGTTGCCC-3' (SEQ ID NO : 35) 62 ALFF 5'-GTGAACTCCGCTGTTAAAGAC-3' (SEQ ID NO : 36) 62 - ALF 507 ALFR 5'-TACACCACACTTGTATATTACAG-3' (SEQ ID NO : 37) 62 Les mélanges de PCR sont préparés selon les concentrations finales suivantes : 1 pM de mélange d'amorces, dNTP 1mM, MgC12 1,5 mM ; Tampon 10X à 1X ; Taq 0,5 pl pour 5 50 pl de volume final (QSP H2O) . Chaque réaction de PCR a été réalisée avec une étape de dénaturation initiale de 15 min. à 97 C, suivie d'une amplification de l'ADNc [dénaturation à 97 C pendant 1 min., hybridation à 62 C pendant 1 min., élongation à 72 C pendant 1 min. (le nombre de cycles varie 10 selon le gène amplifié)), une étape d'élongation finale à 72 C pendant 10 min., et un stockage à 4 C. Les produits de PCR pour chaque gène, précédemment amplifiés, sont purifiés en utilisant le kit QlAquick PCR Purification Kit Protocol (Qiagen) selon les recommandations 15 du fournisseur. Les produits de PCR amplifiés et purifiés sont dosés au spectrophotomètre (abs.. 260 et 280 nm, ratio proche de 1,8) afin de les quantifier, puis sont concentrés à 100 ng/pl pour le dépôt sur membrane.Preparation of the probe cDNAs. CDNA fragments (probe cDNA) of each of the genes encoding the six antimicrobial peptides are amplified by conventional PCR. PCR primers (sense and antisense) listed in Table 2 below were used. The specific hybridization temperature of each pair of primers is indicated, as is the size of the amplified PCR products expected. GenBank of lysozyme and CV699332 and PEN3-1 and crustin, sequence listing in 2908136 Table 2 Tm name Size Gene name Primer sequence primer (C) (pb) Rich peptide 5 'cystF -TGGTGGCCGAACTCTGGAC-3 '(SEQ ID NO: 26) 62,475 to Cysteine CystR ^ 5'-CTCCTTTCTCCCATCTCACG-3' (SEQ ID NO: 27) 62 Peptide rich GIyF 5'-TGCACCGAGCAAAACGTCAG-3 '(SEQ ID NO: 28) 62 449 to glycine GIyR 5'-TCGAGGAATTCACACTGAAACA-3 '(SEQ ID NO: 29) CrusF 5'-GTGGTGGCGGTTTAGGTGTA-3' (SEQ ID NO: 30) Crustin 429 CrusR 5'-CATCGGTCGTCCTTCAGATG-3 '(SEQ ID NO. : 31) 62 LysoF 5'-TATCAACCATTACAACGTCTGC-3 '(SEQ ID NO: 32) 62 Lysozyme 201 LysoR 5'-AGATTTACAGGCTTGGCACCA-3' (SEQ ID NO: 33) 62 PEN3-1 F 5'-CCTGGTCTTCTTGGCCTCC-3 ' SEQ ID NO: 34) 62 Litsty PEN3-1 157 PEN3-1R 5'-TAGAGGGCACACGTTGCCC-3 '(SEQ ID NO: 35) 62 ALFF 5'-GTGAACTCCGCTGTTAAAGAC-3' (SEQ ID NO: 36) 62 - ALF 507 ALFR 5'-TACACCACACTTGTATATTACAG-3 '(SEQ ID NO: 37) The PCR mixtures are prepared according to final concentrations: 1 μM primer mix, 1 mM dNTP, 1.5 mM MgCl 2; 10X to 1X buffer; Taq 0.5 μl for 5 μl final volume (QSP H2O). Each PCR reaction was performed with an initial denaturation step of 15 min. at 97 ° C., followed by amplification of the cDNA [denaturation at 97 ° C. for 1 min., hybridization at 62 ° C. for 1 min., elongation at 72 ° C. for 1 min. (the number of cycles varies according to the amplified gene)), a final elongation step at 72 ° C. for 10 min., and storage at 4 ° C. The PCR products for each gene, previously amplified, are purified using the QlAquick PCR Kit Purification Kit (Qiagen) according to the recommendations of the supplier. The amplified and purified PCR products are assayed with a spectrophotometer (abs. 260 and 280 nm, ratio close to 1.8) in order to quantify them, and then are concentrated at 100 ng / pl for membrane deposition.

20 Préparation des membranes Les produits de PCR purifiés et concentrés sont dénaturés à 98 C pendant 10 min.Membrane Preparation The purified and concentrated PCR products are denatured at 98 ° C for 10 min.

2908136 29 Les produits de PCR (ADNcsonde) sont déposés sur deux membranes de nylon à raison de 100 ng/spot, selon le schéma de l'organisation montrée dans la Figure 10. Légende de la Figure 10 : 5 • _ ALF O = crustine 0 = glycine-riche Litsty PEN3-1 > = lysozyme 10 C)== cystéine-riche Les membranes sont séchées pendant 15 min. à température ambiante. Les produits PCR déposés sur les membranes sont à nouveau dénaturés à l'aide de NaOH 0,5 M pendant 15 min. (2 fois) par capillarité. Les membranes sont 15 neutralisées avec du Tris HC1 0,5 M, pH 7,4 ; pendant 10 min. (2 fois), puis séchées 10 min. à température ambiante. La fixation définitive des produits de PCR. est réalisée sous UV. Les membranes sont ensuite séchées en vue d'un 20 stockage à l'abri de la lumière à température ambiante. Préparation des ADNc cibles Une préparation d'ADNc a été obtenue à partir des ARN totaux isolés des hémocytes, soit d'une crevette non sélectionnée et non-survivante à l'infection, soit d'une 25 crevette sélectionnée et survivante à l'infection. Pour obtenir les ADNc de chacune des conditions expérimentales qui seront hybridés sur les membranes (ADNc cibles), les ADNc de chacun des gènes codant pour les six peptides antimicrobiens, ont été amplifiés avec les mêmes 30 ccuples d'amorces spécifiques et dans les mêmes conditions de PCR que pour la préparation des ADNc sondes. En revanche, des dUTP marqués à la digoxigénine (dUTP-DIG) ( PCR DIG labelling melange , Roche Diagnostics) ont été introduits. Hybridation et révélation des membranes 35 Dans un premier temps les membranes sur lesquelles les ADNc sondes sont fixés, ont été pré-hybridées avec un tampon de pré-hybridation composé de 6X SSC, 0,1% N- 2908136 30 lauroylsarcosine, 0,02% SDS, 1% lait écrémé, 1% Tween20 ; pendant 45 min. Dans un second temps, les ADNc cibles obtenus ont été dénaturés à 98 C pendant 10 min., puis plongés dans la 5 glace. Chaque ADNc cible a été déposé sur sa membrane respective, et incubé pendant 30 min. à température ambiante. Les membranes ont ensuite été lavées 2 fois avec du tampon de lavage Wl (0,1X SSC, 0,1% SDS) pendant 1 min. sous forte agitation.The PCR products (cDNA) are deposited on two nylon membranes at 100 ng / spot, according to the organization scheme shown in Figure 10. Legend of Figure 10: 5 • _ ALF O = crustin 0 = glycine-rich Litsty PEN3-1> = lysozyme 10 C) = cysteine-rich The membranes are dried for 15 min. at room temperature. The PCR products deposited on the membranes are again denatured with 0.5M NaOH for 15 min. (2 times) by capillarity. The membranes are neutralized with 0.5M Tris HCl, pH 7.4; for 10 minutes. (2 times), then dried 10 min. at room temperature. Final fixation of PCR products. is carried out under UV. The membranes are then dried for storage in the dark at room temperature. Preparation of target cDNAs A cDNA preparation was obtained from total RNAs isolated from haemocytes, either from an unselected shrimp and non-surviving infection, or from a shrimp selected and surviving the infection. . To obtain the cDNAs of each of the experimental conditions that will be hybridized on the membranes (target cDNAs), the cDNAs of each of the genes encoding the six antimicrobial peptides were amplified with the same 30 cc of specific primers and under the same conditions. PCR only for the preparation of the cDNA probes. In contrast, dUTPs labeled with digoxigenin (dUTP-DIG) (PCR DIG labeling mixture, Roche Diagnostics) were introduced. Hybridization and Revelation of the Membranes First, the membranes on which the cDNA probes were fixed were prehybridized with a prehybridization buffer composed of 6X SSC, 0.1% N-2908136 lauroylsarcosine, 0.02. % SDS, 1% skim milk, 1% Tween20; for 45 minutes. In a second step, the target cDNAs obtained were denatured at 98 ° C. for 10 minutes and then immersed in ice. Each target cDNA was deposited on its respective membrane, and incubated for 30 min. at room temperature. The membranes were then washed twice with Wash buffer W1 (0.1X SSC, 0.1% SDS) for 1 min. under heavy agitation.

10 Les membranes ont alors été incubées pendant 30 min. à température ambiante et sous faible agitation avec 450 pl de TBS 1X (10mM Tris HC1 pH 7,4 ; 150 mM NaCl ; 0,3% BSA), 1% lait écrémé, 2% sulfate Dextran, contenant une dilution au 1/5000 d'un anticorps anti-digoxigénine (Fab) 1.5 couplé à de la peroxydase. Les membranes ont ensuite été lavées 2 fois avec 0,5 ml de TBS 1X pendant. 1 min. sous forte agitation. Les membranes ont été incubées dans 300 pl de solution de révélation (TMB = 3,,3',5,5'-Tetramethylbenzidine : 20 substrat colorimétrique de la peroxydase) pendant 15 min. dans l'obscurité. Les membranes ont été lavées avec de l'eau stérile (dépourvue de Dnase et Rnase) pendant 5 min. Les résultats sont présentés dans la Figure 11. Légende de la Figure 11 : A = membrane hybridée avec l'ADNc cible provenant de la crevette non sélectionnée et non--survivante B= membrane hybridée avec l'ADNc cible provenant de la crevette sélectionnée et survivante Les résultats montrent que les signaux d'hybridation visualisables sur les membranes hybridées, soit avec l'ADNc cible d'une crevette non sélectionnée et non-survivante (Figure 11A), soit avec l'ADNc cible d'une crevette sélectionnée et survivante (Figure 11B), montrent des profils 35 différentiables sans appareillage particulier. En accord avec les résultats de PCR quantitative, cinq des peptides analysés (crustine, peptide riche en glycine, Litsy PEN3-1, peptide riche en cystéine, et lysozyme) 25 30 2908136 31 présentent des variations de signaux, avec une intensité plus importante sur la membrane hybridée avec la cible préparée à partir de la crevette sélectionnée et survivante à l'infection (Figure 11B) que sur celle hybridée avec la cible préparée à 5 partir de la crevette non sélectionnée et non-survivante à l'infection (Figure 11A). En revanche, les signaux d'hybridation de l'ALE ne présentent aucune différence entre les deux membranes, et constituent ainsi un contrôle positif de l'expérimentation.The membranes were then incubated for 30 minutes. at room temperature and with gentle stirring with 450 μl of 1 × TBS (10 mM Tris HCl pH 7.4, 150 mM NaCl, 0.3% BSA), 1% skimmed milk, 2% Dextran sulfate, containing a 1/5000 dilution. an anti-digoxigenin (Fab) 1.5 antibody coupled to peroxidase. The membranes were then washed twice with 0.5 ml of 1X TBS for 1 hour. 1 min. under heavy agitation. The membranes were incubated in 300 μl of revealing solution (TMB = 3,, 3 ', 5,5'-tetramethylbenzidine: colorimetric peroxidase substrate) for 15 min. in darkness. The membranes were washed with sterile water (lacking Dnase and RNase) for 5 min. The results are shown in Figure 11. Legend to Figure 11: A = membrane hybridized with target cDNA from non-selected and non-surviving shrimp B = membrane hybridized with target cDNA from selected shrimp and survivor The results show that the hybridization signals visualizable on the hybridized membranes, either with the target cDNA of an unselected and non-surviving shrimp (FIG. 11A), or with the target cDNA of a selected and surviving shrimp (FIG. (Figure 11B), show differentiable profiles without particular equipment. In agreement with the quantitative PCR results, five of the peptides analyzed (crustin, glycine-rich peptide, Litsy PEN3-1, cysteine-rich peptide, and lysozyme) exhibit signal variations, with greater intensity on the hybridized membrane with the target prepared from the selected shrimp and surviving infection (Figure 11B) than that hybridized with the target prepared from the non-selected shrimp and non-surviving the infection (Figure 11A). ). On the other hand, the hybridization signals of the ALE show no difference between the two membranes, and thus constitute a positive control of the experiment.

Claims

claims

1. A method for evaluating the outcome of infection with a pathogenic bacterium in a penaeid shrimp, characterized in that it comprises the quantification of crustin mRNA, in haemocytes taken from the animal to be tested 6 to 72 hours after infection.

2. Method according to claim 1, characterized in that it further comprises comparing the amount of crustin mRNA with the amount of the same mRNA in haemocytes taken from the animal to be tested prior to infection.

3. Method according to any one of claims 1 or 2, characterized in that it further comprises the quantification of proline-rich peptide and cysteine-rich mRNA in haemocytes taken from the animal to be tested. at 72 hours after infection, and advantageously, the comparison of the amount of mRNA thus determined with the amount of the same mRNA in haemocytes taken from the animal to be tested prior to infection.

4. Method according to any one of claims 1 to 3, characterized in that it further comprises the quantification of one or more of the following mRNAs: lysozyme mRNA; penaeidin-3 mRNA; the mRNA of the PEN3-1 isoform of penaeidin-3; in haemocytes taken from the animal to be tested 6 to 72 hours after infection, and, advantageously, the comparison, for each mRNA selected, of the quantity thus determined with that of the same mRNA in haemocytes taken from the animal to be tested. 30 test before infection.

5. Method according to any one of claims 1 to 3, characterized in that it further comprises the quantification of penaeidin-2 mRNA, in haemocytes taken from the animal to be tested 6 to 72 hours after The infection, and, advantageously, the comparison of the quantity thus determined with that of the same mRNA in haemocytes taken from the animal to be tested prior to infection. 20 25 2908136 33

6. Method according to any one of claims 1 to 5, characterized in that the penaeid shrimp belong to the species L. stylirostris.

Process according to any one of claims 1 to 6, characterized in that the infection is a vibriosis.

8. A reagent kit for carrying out a method as defined in any one of claims 1 to 7, wherein the quantification of the transcripts is by quantitative RT-PCR, and characterized in that it comprises, in addition to the buffers and reagents necessary for the amplification of the reaction and the detection of the amplification products, at least one pair of primers specific for each of the mRNAs to be assayed.

9. Reagent kit according to claim 8, characterized in that it comprises a pair of primers specific for the crustin mRNA, and advantageously a pair of primers specific for the mRNA of the proline-rich peptide and cysteine.

10. Reagent kit according to claim 9, characterized in that it further comprises a pair of primers specific for lysozyme mRNA, and / or a pair of primers specific for penaeidin-3 mRNA. , and / or a pair of primers specific for the mRNA of the PEN3-1 isoform. 25 1l. DNA chip for implementing a method as defined in any one of claims 1 to 7, characterized in that it comprises a probe specific for the mRNA of crustin, and advantageously, a specific probe of mRNA of the proline-rich peptide and cysteine. DNA chip according to claim 11, characterized in that it further comprises a specific probe of the lysozyme mRNA, and / or a specific probe of the penaeidine-3 mRNA, and / or a probe. specific for the mRNA of the PEN3-1 isoform. 20