FR2881436A1 - Determining diversity of T-lymphocytes, to detect a disorder of DNA repair, comprises analyzing combinative diversity and/or joint diversity of excision circles of delta T-cell receptor locus resulting from the rearrangement of delta Rec-1 - Google Patents

Abstract

Determining the diversity of T-lymphocytes in a biological sample of a human or animal patient, comprises analysing the combinative diversity and/or the joint diversity of the T-cell receptor excision circle (TREC) resulting from the excision of all or part of the TCRD (T-cell receptor delta) locus, is new. An independent claim is also included for a reagent kit for carrying out (I), comprising at least four primers of which at least one is specific for delta Rec-1, and at least three specific for each of the different AJ regions selected from AJ61, AJ60, AJ59, AJ58, AJ57 and AJ56.

Description

METHOD FOR DETERMINING THE DIVERSITY OF LYMPHOCYTES

T IN A BIOLOGICAL SAMPLE

  The present invention relates to the field of diagnosis of possible disorders of the immune system or having repercussions on the immune system. In particular, the invention relates to a method for determining T cell diversity in a biological sample.

  A mature T lymphocyte has on its surface a unique antigen receptor (TCR) formed by the association of two α and 13 or γ and γ chains. TCR provides the T cell antigen recognition function, which is the starting point for the activation and proliferation of these cells. The TCR is expressed clonally: each T lymphocyte carries on its surface a different TCR, specific for a given antigen. The term "repertoire" refers to the set of T lymphocytes with different antigenic specificities, and therefore distinct TCRs. The analysis of the diversity of TCRs in a given sample therefore makes it possible to determine the diversity of T lymphocytes in this sample.

  The genes encoding the V domain of the TCR chains are formed by the juxtaposition of genes V and J, for the chains TCRα and TCRy, and V, D and J for the chains TCRf3 and TCRα. They are assembled during T cell differentiation by a directed somatic recombination mechanism, called "V (D) J recombination". The TCR genes are grouped into several loci. The TCRB locus contains the BV, BD and BJ genes whose recombination will give the genes encoding the TCR chain. (3) The TCRAD locus is unique: it comprises both the genes encoding the TCRα chain and the genes encoding the chain. TCRâ This locus contains several dozens of ADV / DV genes, most of which can be used for either an α-chain or an â-chain.This ADV / DV region is followed by the DD and DJ genes, followed by the AJ genes. A rearrangement between an ADV / DV gene, a DD gene and a DJ gene will encode a TCRα chain A rearrangement between an ADV / DV gene and an AJ gene will encode a TCRα chain.

  The recombination V (D) J makes it possible to generate an extremely vast repertoire of TCR. The TCRs differ primarily by the combination of the rearranged V, D or J segments (combinatorial diversity). For the TCRA genes, encoding the TCRα chain, there are, for example, in the mouse approximately 100 V genes and 60 J genes. There are thus potentially 6000 possible combinations (see FIG. 1). For the TCRB genes (encoding the TCRUU chain) there are approximately 450 possible combinations (25 V genes, 2 D genes and 12 J genes).

  In addition, the molecular mechanisms of V (D) J recombination introduce junctional diversity. Genes V, D and J are bounded by short conserved nucleotide sequences called recombination signal sequences (RSS). These RSS are nucleotide motifs composed of a conserved heptamer and a semi-conserved nonamer, separated by 12 or 23 bases. The recombination is carried out by a complex which comprises three proteins specifically expressed in lymphocytes: the RAG 1 and 2 proteins (recombination activating genes), and the TdT (terminal nucleotidyl transferase). The other enzymatic activities involved in V (D) J recombination are provided by ubiquitous proteins involved in DNA repair by end religation or non-homologous end joining (or NHEJ).

  Recombination V (D) J is initiated by the introduction of a single-strand cut by the RAG proteins linked to RSS. This cleavage, located exactly at the junction between the gene and the RSS, generates a free end 3'-OH. A nucleophilic attack of this free end, on the opposite strand, then generates a double-strand break; the coding end of the gene is closed in a hairpin structure, while the end of the RSS is frank and phosphorylated. During the next phase of V (D) J recombination, the coding ends undergo a primer before being ligated to each other by the NHEJ participating proteins. This implies in particular the opening of the hairpin structure, which is imprecise and can generate inverted repeats of some bases, called "nucleotides P". Bases may also be removed from the free ends of the coding DNA. Finally, the TdT can add to these free ends additional bases, called "N nucleotides", independently of a matrix.

  As a result, the coding junctions (JC) have a very large diversity, both in terms of the sequence of the junction 35 and its length. Virtually every junction made in a T lymphocyte is unique and this junction thus constitutes the molecular signature of a T lymphocyte. Structurally, within the V domain of the TCR chains, the amino acids encoded by the V (D) J junction are in the center of a pattern called "complementary determination region 3" (CDR3), bordered by residues coded by the V and J genes. Each T lymphocyte expresses a unique combination of TCRα and TCR13 or TCRy and TCR6 chains, and the CDR3s of these two chains dictate the antigenic specificity of the TCR.

  The DNA between the fused segments during V (D) J recombination is in most cases excised, and its ends with RSS are ligated, thus forming a circle of excision (see Figure 2). These circles or T cell receptor Excision Circles (TREC) do not replicate and are diluted during cell division. Each TREC is therefore the marker of a rearrangement event, and unlike the rearrangement coding for the TCR chains, its absolute quantity does not vary as a function of cell proliferation. In the formation of TREC, SSRs are ligated by factors involved in DNA repair by end religation or nonhomologous recombination (NHEJ). The junctions resulting from this fusion of RSS rearranged genes are called "signal junctions" (JS).

  In a few cases, when the rearranged genes are in reverse transcription orientation, V (D) J recombination does not result in the formation of TREC, but leads to the inversion of the DNA fragment separating the genes; in this case only, the signal junction is retained on the chromosome and replicated during cell divisions.

  In the differentiation of T lymphocytes in the thymus, the genes encoding the TCR (3 chain are rearranged and expressed before those encoding the TCRα chain.These two periods of rearrangement are separated by an intense proliferation during which the lymphocytes having managed to express a TCR33 chain will be very strongly amplified (up to 9 division cycles) .There may therefore be up to 1000 cells (29) carrying the same TCRB rearrangement, which can potentially rearrange and express different TCRA genes The ADV and AJ genes are separated on the TCRAD locus by the TCRD genes In humans, it is generally accepted that during the maturation of af3 T cells, the TCRD genes are excised from the locus before the ADV genes. This excision results from the recombination of a particular RSS, δRec-1, with the nearest AJ gene, AJ61 No coding sequence is associated with this RS S. The mechanism of deletion of the gene segments coding for the TCR b-chain, which marks the commitment of T lymphocytes in the α (3) line, has in particular been studied by Shutter et al (Shutter, Cain et al. 1995), using transgenic mice in which were integrated the human sequences corresponding to the deletion elements b and genes of the chain of the TCR. The results described in this study confirm that the deletion b occurs before the recombination Va-Ja, and show that this deletion involves the junction of the element bRec with different segments AJ. These authors have also shown, from DNA from a human thymus sample, that bRec-1 recombines with AJ 61, 60, 59, 58 and 57.

  The junctional diversity resulting from the processing of the coding ends is one of the essential characteristics of the V (D) J recombination process, at the origin of the immense diversity of the TCRs. On the other hand, it is generally accepted that RSSs are ligated without being primed / modified, and therefore that the signal junctions (JS) carried by the TRECs are invariant. This idea remains largely widespread, despite some publications describing a diversity at the level of some JS. Thus, Candéias et al showed that a significant fraction (up to 24%) of the signal junctions resulting from the rearrangement of the TCRB and TCRD genes in the mouse are modified (Candéias, Muegge et al., 1996). A more recent article, also studying the signal junctions resulting from V (3-D (3) recombinations, shows that the appearance of N nucleotides at the signal junctions apparently depends on the V (3 locus used for recombination, which leads to authors to suggest that the local configuration of chromosomes affects the accessibility to recombinase (Kanari, Nakagawa et al., 1998), but these articles remain limited to the rearrangement of the chain 13 and, concerning the article by Candéias et al, also the rearrangement of the chain A. There is no suggestion that the mechanisms at the origin of the JS diversity at the rearrangements of the chains (i and b also act for the genes encoding the TCRα chain.

  The dominant dogma, according to which the signal junctions do not possess a junctional diversity dogma illustrated in particular by the figure 5 of the recent synthesis article of Jung et al (Jung and Alt 2004) has never been questioned concerning the rearrangement genes encoding the TCRα chain. In contrast, several authors have recently described methods for quantifying TRECs resulting from the excision of TORD genes, to evaluate thymic activity in patients, based on the real-time amplification of the signal junction Recl / AJ61, in vitro. using a probe covering this signal junction (Hochberg, Chillemi et al 2001, Schonland, Zimmer et al., 2003), or located just on the edge (Hazenberg, Otto et al., 2000). The choice of such a probe indicates that these authors are convinced that this signal junction is invariant.

  In some situations, it may be interesting to determine the level of heterogeneity of circulating T cells. This may be useful for detecting immune system deficiencies (less or no new lymphocyte production) due to acquired or congenital immune deficiency. For example, the presence of a clonal or pauci-clonal population may be indicative of a developing immune response, either against tumor cells or in response to an infection.

  It is also useful to know the level of heterogeneity of circulating T cells to follow the reconstitution of the immune system after transplantation of hematopoietic cells (bone marrow or stem cells). Indeed, this reconstitution leads to the de novo production of lymphocytes, possibly with the possibility of clonal expansions due to graft-versus-host (GvH) or graft rejection. The presence of a clonal or pauci-clonal population would then be indicative of the abnormal expansion of a particular lymphocyte pool, which may be indicative of GvH or rejection.

  Several methods for determining the diversity of a T cell population have already been described. Most of these are reviewed in the review article by Hodges et al (Hodges, Krishna et al., 2003).

  At the cellular level, it is possible to analyze the diversity of a lymphocyte population by flow cytometry (FACS), using a battery of monoclonal antibodies directed against the products of the different V genes [3 (V3 region). By comparison with normal values, this test makes it possible to determine whether or not the distribution of lymphocytes is impaired. Nevertheless, the expression of a V13 region is only one of the characteristic parameters of a given lymphocyte because, as explained above, the genes encoding the TCR (3 chain are rearranged and expressed before those encoding the TCRα chain. These two periods of rearrangement are separated by an intense proliferation of TCRl3-expressing lymphocytes.There are few antibodies against the Va gene products, making the analysis of this parameter by FACS impossible. Thus, flow cytometric analysis of TCR diversity is at best indicative of the homogeneity of a T cell population: it only concerns the expression of V8 genes, without even taking into account the junctional diversity of the T cells. CDR3 chains TCR8 In addition, this analysis requires a large amount of cells (at least a few million T cells).

  At the molecular level, it is possible to analyze the structure of TCRA and TCRB genes expressed by T cells by different PCR-based techniques, by amplifying the rearranged genes either from transcripts or from genomic DNA. Since the complete sequence of the TCRB and TCRA loci is available, it is possible to choose oligonucleotide primers specific for each gene (or gene family) BV and ADV, BJ and AJ genes, and BC and AC genes coding for the different domains of the TCR3 and TCRa chains, respectively. From transcripts, we can therefore analyze the rearrangements of the different ADV and BV families by quantitative PCR in real time. The comparison for each family (41 ADV families and 30 BV families, in humans) with the expression profile obtained from control samples makes it possible to determine whether one or more genes are over-represented, indicating a lymphocyte expansion. This test defines the level of expression of each ADV or BV family in a given sample. However, it does not give any information as to the diversity of the rearrangements of each gene or family of ADV or BV genes.

  Still from transcripts, an "immunoscope" type test (marked primer elongation) makes it possible to determine the size distribution of the CDR3s of the rearranged TCRA and TCRB genes (International Application WO 02/084567). This test requires the realization of two PCR reactions for each family: the first to amplify the transcripts using a given ADV or BV gene and to obtain enough material, the second to produce, by elongation of a labeled primer, DNA labeled single strand which will then be deposited on an acrylamide gel. This test makes it possible to analyze the heterogeneity of the CDR3s of the TCRa and TCR8 chains expressed in the analyzed population. On the other hand, it does not make it possible to determine the distribution of the different ADV and BV genes in the analyzed population.

  The tests described above are relatively heavy to implement because they require the preparation of RNA, then the synthesis of cDNA from the sample, as well as the carrying out of a large number of PCR reactions for analyze all ADV and BV families. In addition, work from RNA requires the implementation of elaborate precautions to prevent its degradation, and thus maintain the representativeness of the sample.

  The methods described to date for determining the diversity of a lymphocyte population are therefore all based on the analysis of TCRB gene rearrangements and possibly TCRA. None of these methods take into account the rearrangement that leads to the inactivation of the TCRD locus. In this regard, it is known that the rearrangement of bRec-1 inter-comes after the rearrangement of the TCRB genes, but before the TCRA rearrangement, during the differentiation of the T lymphocytes. Recombination at the -Rec-1 level is considered as the initiator event of TCRA gene recombination. This rearrangement excises from the locus the DD, DJ and DC genes encoding a TCRα chain and thus prevents the recombination and expression of the genes encoding a TCRα chain. It thus definitively binds the T lymphocytes in the a (3) pathway, thus the analysis of this rearrangement would make it possible to specifically determine the diversity of the a8 T lymphocytes, excluding the T y6.

  The inventors have now demonstrated that: - in addition to the rearrangement of bRec1 with an AJ gene, which leads to the excision of the entire TCRD locus, there are other rearrangements leading to the inactivation of the TCRD genes. The inventors have notably observed, in the mouse, rearrangements bRec-1 / DJ2 and DD / AJ, which lead to the excision, respectively, of all the DD genes, and of the DC gene, thus making it impossible to express a TCRâ string.

  - in humans as in mice, bRec-1 rearranges not only with AJ61, but also with (at least) AJ58, AJ57 and AJ56. In humans, bRec-1 also rearranges with at least AJ60 and AJ59.

  in humans and in mice, the signal junctions resulting from the rearrangement of Mec-1 with an AJ gene are not invariant. A significant proportion (10 to 30%) of the junctions show signs of processing (addition of nucleotides by TdT and / or deletion of some bases) of the signal ends before ligation. As a result, it is possible to determine a characteristic profile of signal junction heterogeneity for each type of rearrangement -Rec-1 / AJ.

  These new results imply that there is combinatorial and junctional diversity at the signal junctions present on TRECs resulting from excision of TCRD genes. These circles of excision thus constitute a new criterion for analyzing the diversity of T lymphocytes in a sample. This criterion, which is absent from the current methods for analyzing T-cell diversity, described above, is particularly interesting because the excision of TCRD genes occurs after the rearrangement of TCRB genes, but before the TCRA rearrangement, during differentiation. In particular, the inventors have demonstrated that the signal junction produced during the recombination of δRec1 constitutes, as well as the junction of the TCR genes, an element of the molecular signature of a T lymphocyte, and that the rearrangement of the element âRec-1 generates a repertoire of signal junctions having both a combinatorial diversity and a junctional diversity.

  A particular advantage related to the analysis of the signal junctions resulting from the excision of all or part of the TCRD locus is that these junctions are carried by an excision circle that does not replicate during cell proliferation. They therefore do not undergo any of the variations due to the selective events that shape the repertoire of T lymphocytes as a function of the antigenic specificity of their TCRs. This rearrangement is therefore a molecular marker characteristic of the emergence of new T lymphocytes in the thymus, before the TCR repertoire is set up. Such a marker, which is then not modified qualitatively or quantitatively, makes it possible to analyze, from peripheral T lymphocytes, events which took place during the emergence of new T lymphocytes in the body ( especially in the thymus).

  The present invention therefore firstly relates to a method for determining the diversity of T lymphocytes in a biological sample of a human patient or an animal, characterized in that it comprises a step of analysis of the combinatorial diversity and / or the junctional diversion of the excision circles (TREC) resulting from the excision of all or part of the TCRD locus, during recombination V (D) J. This method can advantageously be implemented by analyzing the combinatorial diversity and / or the junctional diversity of the excision circles (TREC) resulting from the rearrangement of bRec-1.

  The patients for whom this procedure will be particularly useful are those for whom a defect of the immune system or a disease affecting the immune system is either suspected or proven, as well as the recipients of a hematopoietic cell transplant, for which wish to follow the reconstitution of the immune system. This method can be used in addition to the flow cytometry analysis method described above, but it can also be used independently. It makes it possible to simply analyze a later rearrangement stage than the TCRB rearrangement, and much less complicated than the TCRA rearrangement.

  The method of the invention can also be used in animals.

  An example of implementation in the mouse is described below, but this method is also transferable to other animals, in particular to mammals such as cattle, monkey, pig, cat, dog, chicken The method of the invention may be useful for experimental purposes to study animal models of pathologies involving the immune system. As such, we can cite infections simian immunodeficiency virus (SIV) or feline (FIV), which are animal models of HIV infection in humans.

  Sequence data have been published for some species of monkeys, and show sequences of RSS-Reec-1 and AJ very similar to those of humans and mice. The method of the invention is therefore directly applicable to the monkey. The monkey is used as an animal model to study different human pathologies. These pathologies include infections, in particular by the hepatitis C virus, or by the immunodeficiency virus (HIV in humans, SIV in monkeys). In this context, the above method can be used to study, from biopsies, the diversity of T lymphocytes present at different stages of the infection, corresponding for example to the recruitment and then to the proliferation of T lymphocytes. The biopsy will be chosen by those skilled in the art to reflect the evolution of the pathology and / or the immune response. Thus, to study the immune response during infection with the hepatitis C virus, biopsies will be advantageously performed in the liver.

  The process of the invention can be carried out using any biological sample comprising T lymphocytes. Non-limiting examples of usable biological samples include samples of whole blood and mononuclear cells. total, a biopsy containing T cells, or a population of T cells sorted by flow cytometry based on the expression of different membrane markers, including their TCR or a given VR region.

  In a preferred implementation of the method of the invention, the combinatorial diversity of the excision circles resulting from the rearrangement of bRec-1 is analyzed by performing at least three amplification reactions of a fragment of the excision circles, each amplification reaction being specific for a signal junction resulting from the rearrangement of bRec-1 with an AJ region capable of being ligated with Mec-1. The inventors have shown that these AJ regions are essentially the AJ61 (also noted ipJa), AJ58, AJ57, and AJ56 regions. It can also be regions AJ60 and AJ59. Of course, in this implementation of the invention, the amplification reactions aim at rearrangements with at least 3, preferably 4, and possibly 5 or 6 distinct AJ regions. It is important to note also that the signal junction analysis corresponding to other rearrangements is not excluded from the methods according to the invention, from a perspective of a more exhaustive study of the diversity of a population of T lymphocytes. Indeed, δRec-1 can rearrange at least up to AJ18 in the mouse (signal junctions resulting from this rearrangement have been demonstrated), and at least up to AJ2 in humans (coding junctions resulting from this rearrangement has been highlighted).

  In the above method, the term "amplification reaction" refers to any method of nucleic acid amplification known to those skilled in the art. Nonlimiting examples include Polymerase Chain Amplification (PCR), more commonly referred to by those skilled in the art as its English acronym, PCR (Polymerase Chain Reaction), TMA ( Transcription Mediated Amplification), NASBA (Nucleic Acid Sequence Based Amplification), 3SR (Self Sustained Sequence Replication), Strand Displacement Amplification (SDA) and LCR (Ligase Chain Reaction).

  According to a preferred embodiment of the method of the invention, the nucleic acid amplification reactions are polymerase chain reaction (PCR) reactions, carried out with pairs of primers each consisting of specific primer of δRec-1 and a primer specific for an AJ region selected from AJ61, AJ60, AJ59, AJ58, AJ57, and AJ56. These reactions are preferably carried out in separate tubes. Whatever the technique used to carry out the amplification reactions, the analysis of the results consists of examining which reactions made it possible to obtain an amplification product. They correspond to the rearrangements present in the lymphocyte population examined, whereas the absence of amplification of a signal junction between âRec-1 and a given AJ region indicates that the corresponding rearrangement is absent from this population. Of course, positive controls are preferably used in carrying out the process of the invention.

  If necessary, the amplification can be followed in real time, for example by carrying out quantitative PCRs. This makes it possible to quantify the TRECs present in the biological sample and, if the latter is appropriate (for example, a blood sample), to evaluate the quantity of T lymphocytes recently produced by the thymus. Methods for quantifying the recent synthesis of T cells, based on the quantification of TRECs in a biological sample, are described in particular in the articles by Schonland et al., Hazenberg et al., And Hochberg et al, cited above. However, these authors use, to quantify the TREC present in a sample, a probe located either on the signal junction Rec-1 / AJ61, or in the immediate border of this junction. Such a probe therefore makes it possible to effectively detect only the unmodified JSs (in the case of the probe at the edge of the JS, it also makes it possible to detect modified JSs only on the other side of the junction). This may perhaps explain the dispersion of the results observed by these authors, even in healthy subjects (see in particular Figure 1 of the article by Hochberg et al). The use of a probe capable of hybridizing with TRECs with modified JSs will reduce this dispersion, and will result in results that are easier to interpret by the clinician.

  It is therefore proposed, according to one aspect of the present invention, a method for evaluating recent T-cell production by quantitating TREC in a suitable biological sample, using a probe at least 5-10 apart, and preferably at least 15 nucleotides from the signal junction resulting from perfect rearrangement (without modification) of at least one AJ region selected from the group consisting of AJ61, AJ60, AJ59, AJ58, AJ57, and AJ56. This method is advantageously implemented by quantifying the TREC resulting from the rearrangement of δRec-1 with at least 2, 3, or 4 different AJ regions. This quantification can of course be carried out in addition to the analysis, according to the invention, of the combinatorial and / or junctional diversity of the excision circles. According to this aspect of the invention, the distance between the probe and the signal junction is measured with respect to the actual "junction" between the two merged RSSs, thus with respect to the center of the GTGCAC pattern resulting from the perfect rearrangement. AJ, when this pattern is created.

  Another important aspect of the invention is the analysis of the junctional diversity at the signal junctions present on the excision circles (TREC) resulting from the rearrangement of bRec-1. In fact, the inventors have demonstrated that a significant proportion of these signal junctions, up to 40%, present "imperfections", and in particular additions of nucleotides N. This property, unsuspected before the works discussed above. below, can also be exploited to determine the degree of heterogeneity of a population of T lymphocytes. Thus, the invention also relates to a method for determining the diversity of a population of T lymphocytes present in a sample, comprising at least a step of analyzing the junctional diversity of at least one signal junction bRec-1 / AJ. Preferably, the junctional diversity of the most common signal junction, i.e., the bRec-1 / AJ61 junction, is examined. Even more preferably, the analysis of the junctional diversity of the JS is performed in addition to the analysis of the combinatorial diversity described above.

  As described above, the signal junctions correspond to the fusion of the RSS bordering the rearranged fragments. These RSS consist of a conserved heptamer and a semi-preserved nonamer, separated by 12 or 23 bases. The first three bases of heptamer have a very high degree of conservation, so the vast majority of HSS begin with a CAC triplet. As a result, the "perfect" ligation of two RSSs, by NHEJ, during the creation of a signal junction, generates a 5'-GTGCAC-3 'sequence, which corresponds to the restriction site of the ApaL1 enzyme. This makes it easy to distinguish signal junctions that have not been added or deleted because they are sensitive to ApaL1 restriction, unlike modified signal junctions.

  Some RSS, however, have variations from the preserved sequences. This is the case, in particular AJ60 RSS, in humans and in mice, and AJ59, in mice. The analysis of the junctional diversity at the signal junctions involving these RSS therefore requires the use of other techniques, for example to sequence the junctions in question.

  According to a preferred embodiment of the methods of the invention involving an analysis of the junctional diversity at the JS level, the analysis of the junctional diversity thus comprises, for each analyzed signal junction bRec-1 / AJ, an amplification step. a fragment of the excision circle, including the signal junction in question. This amplification is preferably followed for each analyzed bRec-1 / AJ signal junction resulting from the rearrangement of bRec-1 with an AJ region selected from the group consisting of AJ61, AJ59, AJ58, AJ57, and AJ56 in humans, or AJ61, AJ58, AJ57, and AJ56 in the mouse, a step of analysis of the restriction profile by ApaL1 of the amplified fragment. Various techniques for analyzing a restriction profile of a given DNA fragment by a specific enzyme are well known to those skilled in the art. Of course, the fragment is incubated in the presence of the enzyme in an ad hoc buffer. The result of the digestion can then be analyzed by agarose gel migration and visualization by any available technique, for example by staining with ethidium bromide (BET) or SybrGreen, or by membrane transfer and hybridization. with a labeled probe (radioactive, coupled with peroxidase, Texas Red or other).

  When the junctional diversity analysis is complementary to the TREC combinatorial diversity analysis, the same amplification product of a TREC fragment can be used for both aspects.

  The interpretation of the result of the digestion of the fragment by ApaL1 is as follows: if the fragment is completely digested, it means that all the JS corresponding to the δRec-1 / AJ junction analyzed are identical and correspond to the "canonical" JS, unmodified; if the fragment is completely resistant to restriction by ApaL1, all the JS corresponding to the analyzed bRec-1 / AJ junction are modified (which does not mean that they are identical); the hybrid profile (fragment partially sensitive to ApaL1) is indicative of the presence, in the sample studied, of at least two populations of lymphocytes comprising TREC resulting from the rearrangement of bRec-1 with the analyzed AJ region, one comprising a modified JS and the other no.

  In the case where a modification is evidenced by the appearance of an ApaL1-resistant fragment, as well as for JS that do not have an ApaL1 restriction site, even in the absence of modification (for example, JS bRec-1 / AJ60), it may be interesting to carry out a qualitative analysis of the signal junctions, in particular to determine whether the population of lymphocytes carrying TRECs resistant to restriction by ApaL1 is homogeneous or not. By "qualitative analysis" is meant an analysis to determine the nature (addition, deletion, substitution) of the modifications made to the ends before their ligation to form the signal junction. Methods as described above, further comprising a step of qualitatively analyzing the ApaL1 restriction-resistant signal junctions, are also part of the present invention. This qualitative analysis can be performed by various techniques known to those skilled in the art, such as sequencing, or extension of labeled primer. It is preferably made from only fragments totally or partially resistant to ApaL1, but if necessary, from an automation perspective, it can be carried out systematically on all the fragments.

  A particular method according to the invention comprises the following steps: a. preparing the DNA from the biological sample; b. performing at least 3 or 4 PCRs, using primer pairs each consisting of a specific primer of bRec-1 and a primer specific for a AJ region selected from the group consisting of AJ61 AJ58, AJ57, and AJ56; vs. restriction of PCR products with the restriction enzyme ApaL1; d. analysis of the restriction profiles obtained in step c.

  e. if necessary, qualitative analysis of ApaL1 restriction-resistant signal junctions, by extension of labeled primer.

  In step "a" of this process, the preparation of the DNA can be carried out by any technique known to those skilled in the art, such as the techniques described in chapter 6 of the Sambrook and Russel manual ( Molecular Cloning, 5th edition, CSHL press), or using commercially available DNA preparation kits.

  An intermediate step may, if necessary, be carried out between steps "b" and "c" of this process, consisting of analyzing the products of the amplifications carried out in step "b", for example by agarose gel migration. and coloring. This makes it possible to restrict the analysis of ApaL1 restriction profiles to only those junctions for which a fragment has actually been amplified.

  As mentioned above, signal junction formation is provided by ubiquitous proteins involved in DNA repair. It is therefore likely that if one of these proteins is not fully functional, the proportion of modified signal junctions will increase. The methods described above can therefore be used to detect a possible disorder of the mechanism of DNA repair, whether it is a defect affecting one of the enzymes involved in the non-homologous recombination repair (NHEJ), or a factor acting upstream or downstream of the non-homologous recombination.

  Another aspect of the invention is a reagent kit for determining the diversity of T cells present in a biological sample by a method such as those described above. Such a kit comprises a set of at least four primers of which at least one is specific to 6Rec-1, and at least three are each specific for a different AJ region, selected from the group consisting of AJ61, AJ60, AJ59, AJ58 , AJ57, and AJ56. These primers are of course chosen so as to allow amplification by PCR of the signal junctions resulting from the rearrangement of bRec-1 with the selected AJ regions. Among the additional reagents that may be present in the kits of the invention, mention may be made of the various buffers and / or enzymes required for the amplification reactions and / or digestion with ApaL1, samples that can be used as controls for extractions reactions. DNA and / or amplification and / or restriction, etc. As primers and probes that may be used in the methods and kits of the invention, mention may be made of the following oligonucleotides: Table 1: Primers and probes for amplifying signal junctions in humans Sequence name SEQ ID NO: hReRec-1 RSS GAAAACACAGTGTGACATGGAGGGCTG 1 HOREC-1 RSSP AACTCGTGAGAACGGTGAATGAAG 2 hAJ61 RSS GGTGCCTCTGTCAACAAAGGTGATG 3 hAJ61 RSSP ATCCCTTTCAACCATGCTGACACC 4 hAJ6ORSS TCCCCCTTGCATCCCTAATCATGC 5 hAJ6ORSSp TGAGAGGAGGAAGTTACAGCACAGC 6 hAJ59RSS GCAATCAGAGGGCTGAAACACTTGG 7 hAJ59RSSp AAAAGGCTGTAAAGATCAAACCACC 8 hAJ58RSS TCATATCTCTGGACATATCTGTCAGG 9 hAJ58RSSp TAGTTCTTGGGAAGCTCTGCAAAGC 10 hAJ57RSS AGTAATCAGATTTGTTCTATAGGTCC 11 hAJ57RSSp GGGAATAGCTATACAATTGTATAA 12 hAJ56RSS GCTGGTTTTATCAGGGGGATTCTTGG 13 hAJ56RSSp TTAAGTAAATATCAAGGGGAGTTTGGG 14 Table 2: Primers and probes for amplifying signal junctions in mice sequence SEQ ID NO: 5'JATA47 (AJ56) CAGTAGGGGATGGATGCTAACATGA 5'AJ47p (AJ56) AGTCCACAGATCCTACCACTGCTG 16 AJ57RSS-L TCCCTGGGAGACTCAC 17 AJ57RSSp TCTGGCTCCTATCGGCTAGCAGAAG 18 AJ58RSS-L GGATGGTATCGCTTATTCCT 19 AJ58RSSp TCGCACAGTGGAGGAAACTTCTAGTCCT 20 AJ59RSS CTCAGCAGACCTCAGTCCATCACC 21 AJ59RSSp ACAGGCACAATGAGTTGCCCTATCC 22 AJ6ORSS ATGACAGTCCAAGATGCTGCCTCC 23 AJ6ORSSp GACCTGGAGTGTGAGGGAAAAGTG 24 TREC_AJ61 TCTCTGAGGAACACGGAGTATC 25 TREC_AJ61p GCTGACAGGGCAGGTTTTTGTAAA 26 TREC_DR TGTGTCCTCAGCCTTGATCCAT 27 TREC_DRp ACTTATTGCAGCTCCTGAGCAT 28 In Tables 1 and 2 above, the oligonucleotides whose name ends with a "p" can be used as probes when labeled, but can also be used as primers, especially for performing nested or semi-nested PCR (ie, from a product amplified by PCR, using two or one primer (s), respectively, internal to the product of the first amplification).

  In addition to the foregoing, the invention also comprises other arrangements, which will emerge from the description which follows, which refers to examples of implementation of the method which is the subject of the present invention, as well as to the appended drawings, in which which: Figures 1 and 2: Schemes of the recombination V (D) J.

  Figure 3: Amplification analysis and ApaL1 digestion of signal junctions present in a population of T lymphocytes isolated from a patient.

  The signal junctions Recec-1 / AJ61, bRec-1 / AJ58 and EcoR-1 / AJ57 were amplified from DNA extracted from CD4 + CD8 + V1i1 + peripheral cells (sorted by FACS) from a patient and from a sample of human thymus (polyclonal control). The PCR products, undigested (lanes 1, 3 and 5) and digested (lanes 2, 4 and 6) by ApaL1 were separated on agarose gel, then transferred to a nylon membrane and hybridized with a specific radioactive probe. of ôRec-1.

  In the patient, only the δRec-1 / AJ61 and δRec-1 / AJ58 (lanes 1 and 3) amplifications give a product, whereas in the control, the 3 reactions are positive (lanes 1, 3 and 5). The diversity of the repertoire of the signal junctions Rec-1 is therefore reduced in the patient. In addition, the amplified signal junctions Rec-1 / AJ61 and ORec-1 / AJ58 in the patient are completely resistant to digestion with the restriction enzyme ApaL1 (lanes 2 and 4), indicating that the signal ends rearranged genes were rearranged before being ligated. In contrast, all amplified signal junctions from the control DNA contain both sensitive products and products resistant to digestion (lanes 2, 4 and 6). The amplified junctions in the patient are therefore less diversified than in the control sample, since they do not include unmodified junctions. The CD4 + CD8 + V (31+) cells isolated from the patient thus possess a reduced reec-1 rearrangement repertoire: there are fewer reec-1 rearrangements, and their junctional diversity is restricted, compared to a control polyclonal sample.

  FIG. 4: Analysis of the diversity of the rec-1 / AJ58 junctions In order to determine whether the PCR-1 / AJ58 (ApaL1 digestion-resistant) PCR product amplified from the CD4 + CD8 + V (31+) population patient contains one or more molecular species, a diversity analysis was performed The δRec-1 / AJ58 PCR product served as a template in a PCR reaction to produce labeled single-stranded DNA from a primer This single stranded DNA was then deposited on an acrylamide gel, with the corresponding product amplified from the control sample.This method makes it possible to separate the different molecular species according to their length, each In the control sample (solid line curve), a majority peak is observed at the expected size for an unmodified junction.These molecular species correspond in large part to the junctions. Several peaks corresponding to larger sizes, which represent molecular species comprising junctions modified at least by addition of nucleotides (boxed), are also present in ApaLl digestion. These peaks correspond to the modified junctions present in this PCR product, resistant to ApaL1 digestion.

  In the bRec-I / AJ58 PCR product amplified from the patient's CD4 + CD8 + V population, a single peak was observed. This product therefore contains only one molecular species. It migrates to the position corresponding to the expected size for an unmodified junction, although it is resistant to ApaL1 digestion (see Figure 1). It can therefore be concluded that this junction has been modified by deletion and then addition of nucleotide (s).

  FIG. 5: Demonstration of the JS ADV / AJ Modifications N The signal junctions resulting from the ADV2 and ADV8 rearrangements with AJ61, AJ58, AJ57 and AJ56 were amplified from C57BL / 6 mouse thymocyte DNA ( wt) and deficient in TdT (TdT). The PCR products were digested (+) or not (-) with ApaL1 before gel migration and hybridization with internal AJ probes.

  Figure 6: Result of the sequencing of ADV2 / AJ signal junctions from wild mouse and mouse samples TdToro * indicates two sequences having the same junction but using different ADV2 genes; and ^^ indicate two sequences having the same junction amplified from thymocyte DNA of two different mice.

  Figure 7: Result of sequencing of the DV102 / DD2 and ADV2 / DD2 murine signal junctions Figure 8: Analysis of human ôRec-1 / AJ signal junctions DNA samples of thymocytes from two patients aged 10 days (A) and 6 days (B) were used to amplify the JS resulting from the? -Ec-1 rearrangement with AJ61, AJ58, AJ57 and AJ56. A fraction of the PCR products were digested with ApaL1; the digested and undigested products were then separated on agarose gel, transferred to a nylon membrane and hybridized with a radiolabelled EcoR-1 probe.

  FIG. 9: Result of the sequencing of the Rec-1 / AJ signal junctions present in a human sample. Example 10: Amplification of the JS resulting from the rearrangement of δRec-1 with AJ61, AJ58, AJ57 and AJ56, from murine thymocyte DNA.

  The PCR products were separated on an agarose gel, then transferred to a nylon membrane and hybridized with a radiolabeled EcoR-1 probe.

  Figure 11: Sequencing result of the Rec-1 / AJ61 signal junctions present in a murine sample.

  It should be understood, however, that these examples are given solely by way of illustration of the subject matter of the invention, of which they in no way constitute a limitation.

EXAMPLES

  Example 1 Determination of the Degree of Heterogeneity of a T Cell Population in a Patient I.A. Procedure 1.A.1. DNA Preparation For extraction of DNA, the nucleospin tissue extraction kit from Machery Nagel was used, following the instructions provided.

  The cells are pelleted by centrifugation for 5 minutes at 1200 rpm (corresponding to 300 g). The dry pellet (up to 10 million cells) is taken up in 185 μl of lysis buffer Ti mixed with 25 μl of proteinase K provided in the kit.

  The sample is vigorously vortexed and digested overnight at 56 ° C.

  200 μl of buffer B3 are then added, the lysate is vortexed and incubated at 70 ° C. for 10 minutes. 210 μl of absolute ethanol are added and the whole is placed on a column supplied in the kit. is vortexed at 11000 g for one minute (fixation of the DNA on the silica). The column is then washed with 500 μl of BW and then 600 μl of B5 with a centrifugation of 1 minute at 11000 g each time. The DNA is then eluted with a volume of 50 to 200 μl of BE, depending on the amount of cells initially lysed. For this, the BE preheated to 70 C is deposited on the column and the whole is incubated for 2 minutes at 70 C in an oven. The DNA is recovered by centrifugation for 1 minute at 11000 g 1. A.2. Amplification of Signal Junctions This step aims at amplifying by PCR the signal junctions of interest, in order to obtain enough material to study their structure.

  200 ng of total DNA are used for each PCR reaction. Depending on the sample, a second PCR (nested PCR) may be required.

  The amplifications are carried out using the enzyme TaqGold (Applied Biosystem), in the "Master Mix" buffer provided. Specific primers of δRec-1 (SEQ ID No: 1) on the one hand, and AJ61 (SEQ ID No: 3), AJ58 (SEQ ID No: 9), AJ57 (SEQ ID No: 11) and AJ56 ( SEQ ID No: 13) on the other hand, were used. These primers are chosen so as to amplify the four PCR reactions are carried out with or from 200 ng 12.5 μl 2 μl 2 μl 25 μ 10 'to 94 ° C cycles comprising the following sequence: 30 "to 94 ° C., 30" to 64 ° C. and 30 ° to 72 ° C. and then 10 ° to 72 ° C.

  signal junctions only. sample.

  For 25 μl of reaction: DNA: Master MIX 2X: 5μM sense oligon: 5μM reverse oligon: H2O: PCR conditions: Second PCR with a more internal AJ-specific oligonucleotide (nested PCR): SEQ ID No : 4 for AJ61, SEQ ID No: 10 for AJ58, SEQ ID No: 12 for AJ57, and SEQ ID No: 14 for AJ 56 and, still, SEQ ID No: 1 for ôRec-1.

  For 25 μl of reaction: Product of the 1st PCR: 4p1 Master MIX 2X: 12.5 μl 5 μM sense oligon: 2 μl reverse oligon to 5 μM: 2 μH H2O: qsp 25 μl PCR conditions: 10 to 94 C cycles having the following sequence: 30 "at 94 ° C., 30 ° at 64 ° C. and 30 ° at 72 ° C., then 10 ° at 72 ° C.

  Deposit of PCR products on agarose gel. A first indication of the degree of heterogeneity of the lymphocytes contained in the sample is obtained at this stage, depending on whether the 4 reactions are positive or not.

  1.A.3. Detection of the diversity of signal junctions by digestion with the enzyme ApaL 1: This step aims to determine if the signal junctions amplified in the previous step are diversified. The RSS of the selected genes (bRec-1, AJ61, AJ58, AJ57, AJ56) correspond to the consensus RSS sequence and thus begin with the three nucleotides GTG or CAC. As a result, perfect ligation of the two RSSs to form a signal junction creates a site (5'-GTGCAC-3 ') recognized by the restriction enzyme ApaL1.

  A significant fraction (up to 30%) of the signal junctions resulting from the V (D) J recombination of the genes carried by the TCRAD locus are not formed by the perfect ligation of the rearranged genes' RSS, but show signs of processing. by deletion and / or addition of nucleotides to the RSS ends before ligation. The resulting junctional diversity prevents the formation of the ApaL1 restriction site, and these modified junctions are therefore resistant to digestion by this enzyme. The presence of two molecular species after digestion of the PCR products by ApaL1, a sensitive and a resistant, is therefore indicative of the diversity of the amplified junctions. This diversity reveals the presence of T lymphocytes having performed different V (D) J recombination events.

  If, on the contrary, only a molecular species is detected, then the diversity of the sample analyzed is reduced compared with a control sample.

  The digestion is carried out in a final volume of 20 μl at 37 ° C. for 3 h with 5 μl of ApaL1 enzyme.

  PCR product: 10 μl 10X digestion buffer: 2 μ Enzyme 10U / μl: 0.5 μl H2O: 7.5 μl Control is performed under the same conditions, omitting the restriction enzyme: PCR product: 10 10X digestion buffer: 2 μl H2O: 8 μl Separation of the digested or non-digested products by electrophoresis on 2% agarose gel in 1 × TBE buffer in the presence of BET.

  The DNA is then transferred by capillarity to Nylon Hybond N + membrane (Amersham) and then fixed under UV (700 J).

  The membrane is then prehybridized with Rapid Hyb buffer (Amersham) for 30 min at 42 ° C. and then hybridized at 42 ° C. for 4 hours with an oligonucleotide probe specific for 32 P-labeled δRec-1 by incubation with phage T4 polynucleotide kinase and ATPy32P, under the conditions indicated by the supplier.

  Detection of the radioactive signal is by means of a phosphorimager.

  1.A.4. Qualitative analysis of human signal junctions by labeled primer extension This technique makes it possible to determine the length of the different amplified bRec-1 / AJ signal junctions from a population of T lymphocytes. It is thus possible to qualitatively determine the modifications introduced at the level of the signal junction. The distribution of the fragments obtained makes it possible to estimate the diversity of the analyzed population. This method consists in amplifying single-stranded DNA by PCR with a primer comprising a fluorochrome: Texas-red. These fragments are then resolved on a polyacrylamide gel.

  Final volume: 12.5 pl with Applied biosytem Amplitaq Gold Mix master kit PCR product: 0.5 μl 2X Master Mix: 6.25 μl Oligo 1 μM: 0.5 μl H2O: 5.25 μl PCR Cycles : 6 'to 94 C 12 cycles comprising the following sequence: 2' to 94 C, 1 'to 64 C, and 7' to 72 C, then 12 'to 72 C.

  9 μl of PCR product was then mixed with 16 μl of formamide and 1 μl of fluorescent label. The mixture was heated at 96 ° C and then injected into an ABI Prism 310 sequencer.

  1.B. Results Flow cytometric analysis of T lymphocytes in blood samples in one patient showed a highly altered distribution of the use of different V genes [3. The T-cells of this patient use a very large majority of the V gene (31), and an unusual T cell population has been detected in this patient, which expresses both CD4 and CD8 molecules. also use the V gene (31.

  These CD4 + CD8 + V (31+) T cells were sorted by flow cytometry and their DNA prepared This DNA served as a template for amplifying the bRec-1 / AJ61, δRec-1 / AJ58, and δRec-1 signal junctions / AJ57 (the fourth combination, bRec-1 / AJ56, was not performed in this example.) Only the amplifications δRec-1 / AJ61 and δRec-1 / AJ58 gave a product, while a control sample of DNA extracted from total thymocytes (normally diversified population) gave a product for the 3 reactions (Fig 1, lanes 1, 3 and 5) This result indicates that the CD4 + CD8 + T cells were purified from the patient's blood present a repository directory óRec-1 restricted.

  The PCR products were digested with the restriction enzyme ApaL1 and those from the patient were found to be resistant (Fig 1, lanes 2, 4 and 6). This result indicates that all the amplified signal junctions are modified in the patient, whereas in the control sample amplified from thymocytes, the majority of the signal junctions are unmodified, and therefore there are sensitive products and resistant products. digestion with ApaL1 (FIG. 1, lanes 2, 4 and 6). This result indicates that the junctional diversity of amplified signal junctions from the patient's CD4 + CD8 + Vt31 + T cells is limited.

  To determine whether the amplified signal junctions from the CD4 + CD8 + V (31+) population are poly or mono-clonal, a marked immunoscope type primer elongation test was performed on the PCR product. A single molecular species was found in this PCR product (Figure 2).

  These experiments indicate 1) that the repertoire of bRec-1 rearrangements is limited in the analyzed population (only 2 out of 3 rearrangements tested), and 2) that the junctions that are found have a very limited degree of diversity compared to a polyclonal sample. control.

  These results therefore suggest that the CD4 + CD8 + V (31+) T cell population results from the proliferation of a small number of initial lymphocytes.

  Example 2: Changes in signal junctions during recombination of V (D) J genes of the TCRAD locus in mouse 2.A. Materials and methods 2.A.1. Mice The C57BL / 6 mice were raised in the pet shop of the Atomic Energy Commission in Grenoble. The mice were sacrificed by inhalation of CO2 and their thymus was removed at the age of 4-8 weeks.

  2.A.2. DNA Preparation The C57BL / 6 mouse thymocyte DNA was prepared from 10 'cells using the Machery Nagel Extractionnucleospin Tissue Kit, following the manufacturer's instructions. TdT '0 thymocyte DNA was obtained from TdT-0 mice (Gilfillan, Dierich et al., 1993).

  2.A.3. Amplification and Digestion of Signal Junctions Thymocyte DNA (100 ng) was amplified with appropriate primers using AmpliTaqGold PCR as follows: 10 minutes at 94 ° C, followed by 35 cycles with the following sequence: 30 sec.

  at 94 C, 30 sec. at 60 C and 30 sec. at 72 C, followed by 10 min. at 72 C. The PCR reactions were performed on a device "GenAmp PCR system 9600" Perkin-Elmer, in a final volume of 25 pl. The sequences of the primers are shown in Tables 1 and 2 above.

  After amplification, 5 to 10 μl of the PCR amplification products were digested with 5 units of ApaL1 restriction enzyme (Amersham Pharmacia Biotech) for 3 hours at 37 ° C in the buffer provided with the enzyme. Controls were incubated in the same way but without ApaLl. The digested and undigested products were resolved side by side on 2% agarose gel, transferred to N-Hybond + membrane (Amersham Biosciences) and hybridized with a mixture of radiolabelled oligonucleotide probes specific for the AJ regions of the amplified signal junctions presented in FIG. Tables 1 and 2 above (probes of SEQ ID Nos: 16, 18, 20 and 24). Hybridized blots with these probes were analyzed on a "Persona / FX Imager" (Biorad), using the "Quantity One" software.

  2.A.4. Cloning and Sequencing of the Signal Junctions The PCR products were gel purified, cloned into the pGEM-T Easy vector (Promega) according to the manufacturer's instructions, and transformed into competent bacteria. After plating, positive colonies were identified by hybridization with AJ-specific oligonucleotide probes. The plasmids were prepared from the colonies containing the signal junctions, either with the Wizard Miniprep Kit (Promega) or with Montage Plasmid Miniprep 96 (Millipore Corporation). Plasmids containing the JS were then digested individually with ApaL1. The plasmid pGEM-T easy contains 2 sites for this enzyme. If the recombinant plasmid contains an unmodified signal junction formed by the perfect fusion of RSSs, an additional ApaL1 site is introduced and the digestion gives 3 bands after agarose gel migration. If the recombinant plasmid contains a modified signal junction, such an additional site is not introduced and the digestion gives only 2 bands. Plasmids with unexpected patterns in number or size of DNA fragments were excluded from further analysis. Plasmids containing modified signal junctions were sequenced (Genome Express, Meylan, France) to identify the nature of the modifications. Identical signal junctions obtained from the same sample were counted only once, since it is impossible to determine if these multiple occurrences result from independent events or over amplification of a single signal junction.

  2.B. Results 2.8.1. The ADV / AJ signal junctions have a functional diversity linked to the action of TdT. The JS resulting from the recombination of the ADV2 and ADV8 genes with AJ61, AJ58, AJ57 and AJ56 were amplified from C57BL mouse thymocyte DNA. / 6. The undigested and digested ApaL1 digested PCR products were then analyzed by agarose gel migration, followed by diffusion and hybridization revelation with radiolabeled AJ-specific probes. For all ADV-AJ combinations tested, a significant fraction of PCR products were resistant to ApaL1 restriction. This resistance indicates that some signal junctions are modified and do not consist of a simple splicing of the RSS.

  The potential involvement of TdT in the generation of restriction-resistant signal junctions by ApaL1 (SJ ApaL1-R) was analyzed by performing the same experiments from TdT-deficient thymocyte DNA. This clearly revealed that in the absence of TdT expression, ApaL1-R SJs are almost non-existent for all combinations tested (Figure 5).

  Similar results were obtained by analyzing the SJs produced after the rearrangement of ADV1, ADV20 and ADV6 with the same AJ genes. The modification of the SJ therefore occurs during the rearrangement of at least 5 of the 21 families of ADV genes situated in the ADV / DV region in 5 'of OR-1.

  These results show that (i) the ADV-AJ signal junctions present a junctional diversity, and (ii) this diversity results almost completely from the addition of N nucleotides by the TdT.

  2.8.2. Quantification and Structure of Modified Signal Junctions In order to accurately determine the percentage of modified signal junctions, the ADV2 / AJ signal junctions were amplified from wild-type and cloned thymocyte DNA, so that each JS could be independently analyzed by digestion with ApaL1 of the corresponding recombinant plasmid. As shown in Table 3 below, the frequency of ApaL1-R SJ ranged from 9.7% for ADV2 / AJ58 to 39.1% for ADV2 / AJ61, with an average of 33.6%. Thus, a significant fraction of the JS ADV2 / AJ are modified, although the frequency of the modifications seems to vary slightly according to the rearranged AJ gene.

  Table 3: Analysis of the signal junctions produced during the rearrangement of the TCRA genes in the ApaL1-S ApaL1-R mouse ApaL1-R Sequences N / Seq. JS with (S) unique sequences (R) R * / (R * + S) deletion ADV2-AJ61 14 11 9 9 39.1% 3.1 1 ADV2-AJ58 28 4 4 3 9.7% 1.7 0 ADV2-AJ57 25 6 6 6 19, 3% 2,5 0 ADV2-AJ56 35 18 17 16 31,4% 3,1 0 Total 67 39 36 34 33,6 2,6 1 The majority of these JS ApaLl-R have been sequenced, to precisely identify the nature of the changes. These modifications consisted essentially of the addition of N nucleotides. It was found that these sequences contained between 1 and 7 nucleotides without support on a template, with an average of 2.8 per sequence. These additions of nucleotides N correspond mainly to nucleotides G and C, which together represent more than 70% of the added bases (Figure 6). This is a typical bias of TdT activity. With two exceptions, ApaLl-resistant JS ADV2 / AJ were unique, indicating that the repertoire of modified SJs is highly diverse.

  It is important to note that a JS ADV2 / AJ57 in which 4 N nucleotides have been inserted also shows a 3-base deletion of the ADV2 heptamer, suggesting that a loss of nucleotides from the RSS ends may contribute to the diversity. SJ. This observation led the inventors to examine the structure of the SJ in the absence of TdT expression. ADV2 / AJ56 SJs amplified from TdT deficient mice were cloned, and the resulting recombinant plasmids were analyzed. The frequency of ApaL1-R plasmids was found to be 2.7% (2 of 74). In one of these sequences, nucleotides were deleted from the two signals carried on ADV2 and AJ56 (1 and 3 nucleotides, respectively). In the other, 4 bases were deleted from the heptamer AJ56, while the signal on ADV2 is complete. This junction also contains an additional nucleotide (Figure 6, last lines).

  It thus appears that the loss of SSR bases is rare, and that most of the modifications observed in the TCRA SJ result from additions of N nucleotides. 2.8.3. The signal junctions of the TCRD are modified by N nucleotide additions and by an exonucleolytic activity. A previous study by Candéias et al (supra) showed that the rearrangement of the TCRD genes generates modified signal junctions by both nucleotide N addition and by loss. basic (s). These data were obtained after analysis of the rearrangement of DV105 with DD2. However, DV105 rearranges by inversion and SJ formation is therefore crucial to maintain chromosomal integrity and ensure cell survival. It is theoretically possible that, in inversion recombination, the RSSs are more closely linked with the V (D) J recombination complex, including the exonucleolytic activity, to ensure the formation of SJ. This could explain the presence of deletions at the RSS ends of DV105 and DD2. Therefore, in order to determine whether signal base deletion (ES) is a general feature of TCRD gene rearrangement, or if this is a reverse inversion rearrangement specificity, the inventors have analyzed the structure of the JSs. produced during the rearrangement that occurs by deletion between DV102 and DD2.

  ApaL1 digestion of recombinant plasmids obtained after amplification of DV102 / DD2 SJ and cloning from C57BL / 6 mouse thymocyte DNA revealed the presence of 34% of ApaL1-R 3 SJ (Table 4). Remarkably, the sequencing analysis showed that 4 of these modified signal junctions (on 17 different junctions) lost nucleotides at the terminal ends of the DV102 and / or DD2 RSS (Figure 7). The loss of nucleotides from the ES prior to their ligation is therefore not dependent on whether the TCRD genes rearrange by deletion or inversion.

  The same analysis was then performed on JS ADV2 / DD2 amplified from C57BL / 6 thymocyte DNA. The proportion of recombinant plasmids ApaL1-R was found to be 44.7% (Table 4). Sequencing analysis revealed 21 different modified junctions. In 5 of them, the modifications consisted of both the addition of N nucleotides and the deletion of bases from the signal ends (Figure 7). This proportion is similar to that found in DV102 / DD2 SJs. However, it is statistically different (p = 0.01 by the Mann-Whitney test) from the deletions found in ApaL1-resistant JS ADV2 / AJ (1 deletion on 34 signal junctions in wild thymocytes), indicating that more deletions are introduced into the JSs produced during the rearrangement of the TCRD genes than during the rearrangement of the TCRA genes, even when the same ADV gene family is used in both types of rearrangements.

  Table 4: Analysis of the signal junctions produced during the rearrangement of the TCRD kernels in the ApaL1-S ApaL1-R ApaL1-R mouse Sequences N / Seq JS frequency with (S) single sequence (R *) R * / (R * + S ) deletion (s) ADV2- 26 28 25 21 44.7% 2.8 6 DD2 DV102- 33 25 25 17 34% 3, 1 4 DD2 Total 59 53 50 38 39.2 2.9 10 It therefore appears that The mechanisms responsible for the diversity of the signal junctions differ according to whether the JS in question result from the rearrangement of the TCRA or TCRD genes.

  2.8.4. The rearrangement of the 6Rec-1 element exhibits a combinatorial and functional diversity. The inventors then analyzed in greater detail the structure of the signal junctions produced by the recombination of the δRec-1 element with the AJ genes. JS produced by Recec-1 recombination with AJ61, AJ58, AJ57 and AJ56 were amplified from human thymocyte DNA, and the products of these amplifications were digested with ApaL1. Figure 8 shows that a large fraction of the PCR products are resistant to ApaL1 restriction, revealing the existence of modified signal junctions for all rearrangements tested. To determine the nature of the modifications, the ApaL1-resistant products were gel purified and cloned; plasmids present in colonies selected at random were sequenced (Figure 9). The presence of N nucleotides was evident in all the analyzed JS ApaL1-Rs. On average, 5.45 nucleotides were added per sequence, their number varying from 1 to 11. In four cases (16%), bases of one of the signal elements were lost. These deletions range from 1 to 13 bases. This time again, only one of the sequences was found twice, which shows the diversity of the repertoire of modified SJs. The bRec-1 / AJ signal junctions in human thymocytes thus present a junctional diversity.

  The inventors then sought to determine whether the rearrangement of the murine Rec-1 element is restricted to the AJ61 pseudogene or whether, as in the human thymus, other AJ genes can also be used. The same approach was used, and the JS resulting from recombination of? Rec-1 with AJ61, AJ58, AJ57 and AJ56 were amplified from murine thymocyte DNA. These JS were easily detectable, as shown in Figure 10. In addition, the inventors detected rearrangements of? Rec-1 with other, more distant AJ genes up to AJ18. These results demonstrate that the JS involving the murine RRec-1 element have, as in humans, a combinatorial diversity. Since the RSS of the murine element -Rec1 contains an ApaL1 site, the junctional diversity of these JS can not be tested directly by restriction. The JS bRec-1 / AJ61 were therefore directly cloned and sequenced. Of 34 JS analyzed, 11 (31.42%) were modified (Figure 11). They all contain N nucleotides, from 2 to 12 per sequence, with an average of 4.4 per sequence. In one of the JS, 3 bases were further deleted from âRec-1. Once again, the absence of redundant sequences illustrates the diversity of the murine repertoire of JS involving bRec-1.

  These results show that recombination of the murine Rec-1 element in wild thymocytes generates a JS repertoire that exhibits combinatorial and junctional diversity.

REFERENCES

  Candéias, S., K. Muegge, et al. (1996). "Junctional diversity in signal joints from T cell receptor beta and delta loci via terminal deoxynucleotidyl transferase and exonucleolytic activity." J Exp Med 184 (5): 1919-26.

  Gilfillan, S., A. Dierich, et al. (1993). "Mice lacking TdT: mature animais with an immature lymphocyte repertoire." Science 261 (5125): 11758.

  Hazenberg, M.D., S.A. Otto, et al. (2000). "Increased cell division but not thymic dysfunction rapidly affects the T-cell receptor excision circle content of the naive T cell population in HIV-1 infection." Nat Med 6 (9): 1036-42.

  Hochberg, E.P., A.C. Chillemi, et al. (2001). "Quantitation of T-cell neogenesis in vivo after allogeneic bone marrow transplantation in adults." Blood 98 (4): 1116-21.

  Hodges, E., M. T. Krishna, et al. (2003). "Diagnosis of tests for T cell receptor (TCR) genes." J Clin Pathol 56 (1): 1-11.

  Jung, D. and F. W. Alt (2004). "Unraveling V (D) J recombination; insights into gene regulation." Cell 116 (2): 299-311.

  Kanari, Y., R. Nakagawa, et al. (1998). "Variable segment-specific gene Ninsertions at the joint signal of T-cell receptor Vbeta-Dbeta recombinations." Immunol Lett 61 (2-3): 151-5.

  Schonland, S.O., J.K. Zimmer, et al. (2003). "Homeostatic control of Tcell generation in neonates." Blood 102 (4): 1428-34.

  Shutter, J., J. A. Cain, et al. (1995). "A delta T-cell receptor deleting transgenic element reporter construct is rearranged in alpha beta but not gamma delta T-cell lineages." Mol Cell Biol (12): 7022-31.

Claims (16)

  A method for determining the diversity of T lymphocytes in a biological sample of a human patient or an animal, characterized in that it comprises a step of analysis of the combinatorial diversity and / or the junctional diversity of the excision circles (TREC) resulting from the excision of all or part of the TCRD locus.   2. Method according to claim 1, characterized in that it comprises a step of analyzing the combinatorial diversity and / or the junctional diversity of the excision circles (TREC) resulting from the rearrangement of bRec-1.   3. Method according to claim 2, characterized in that the combinatorial diversity of the excision circles resulting from the rearrangement of bRec-1 is analyzed by performing at least three amplification reactions of a fragment of the excision circles, each reaction wherein the amplification is specific for a signal junction resulting from the rearrangement of bRec-1 with a region AJ selected from the group consisting of AJ61, AJ60, AJ59, AJ58, AJ57, and AJ56.   4. Method according to claim 3, characterized in that the nucleic acid amplification reactions are polymerase chain reaction (PCR) reactions carried out with pairs of primers each consisting of a specific primer of bRec-1 and a region-specific primer AJ selected from the group consisting of AJ61, AJ60, AJ59, AJ58, AJ57, and AJ56.   5. Method according to claim 3 or 4, characterized in that three or four amplification reactions are carried out, each amplification reaction being specific for a signal junction resulting from the rearrangement of bRec-1 with a selected AJ region. in the group consisting of AJ61, AJ58, AJ57, and AJ56.   6. Method according to any one of claims 1 to 5, comprising a step of analyzing the diversity of the signal junctions present on the excision circles resulting from the rearrangement of bRec-1 with at least one AJ region selected from the group consisting of AJ61, AJ60, AJ59, AJ58, AJ57, and AJ56.   7. Method according to claim 6, characterized in that, for each analyzed signal junction bRec-1 / AJ, the analysis of the junctional diversity comprises a step of amplifying a fragment of the excision circle, said fragment comprising said signal junction.   8. Method according to claim 7, characterized in that, for each signal junction bRec-1 / AJ analyzed and resulting from the rearrangement of bRec-1 with a region AJ selected from the group consisting of AJ61, AJ59, AJ58, AJ57 , and AJ56 in humans, or AJ61, AJ58, AJ57, and AJ56 in mice, the junctional diversity analysis further comprises a step of analysis of the restriction profile, by the ApaL1 enzyme, of the fragment of amplified excision circle.   9. Method according to any one of claims 6 to 8, characterized in that it comprises a step of qualitative analysis of the signal junctions present on the excision circles resulting from the rearrangement of bRec-1 with at least one region AJ selected from the group consisting of AJ61, AJ60, AJ59, AJ58, AJ57, and AJ56.   10. The method of claim 8, characterized in that it further comprises a qualitative analysis step signal junctions partially or completely resistant to restriction by ApaLl.   11. The method of claim 9 or claim 10, characterized in that the qualitative analysis of the signal junctions is performed by extension of marked primer.   12. Method according to any one of claims 1 to 11, characterized in that it comprises the following steps: a. preparing the DNA from the biological sample; b. performing at least 3 or 4 PCRs, using primer pairs each of which consists of a specific primer of δRec-1 and a primer specific for an AJ region selected from the group consisting of AJ61 AJ58, AJ57, and AJ56; vs. restriction of PCR products with ApaL1 restriction enzyme; d. analysis of the restriction profiles obtained in step c; e. where appropriate, qualitative analysis of the ApaL1 restriction-resistant signal junctions.   The method of any one of claims 1 to 12, including a step of quantizing the excision circles resulting from the rearrangement of RRec-1 with at least one AJ region selected from the group consisting of AJ61, AJ60, AJ59, AJ58. , AJ57, and AJ56.   14. Use of a method according to any one of claims 1 to 12 for detecting a possible disorder of the DNA repair mechanism.   A kit of reagents for determining the diversity of T cells present in a biological sample, characterized in that it comprises a set of at least four primers of which at least one is specific to Eco-1, and at least three are specific. each of a different AJ region, selected from the group consisting of AJ61, AJ60, AJ59, AJ58, AJ57, and AJ56, said primers being selected to allow PCR amplification of the signal junctions resulting from the rearrangement of bRec -1 with the AJ regions selected.   16. The method of claim 4 or claim 12 or kit according to claim 15, characterized in that the primers are chosen from the primers of SEQ ID Nos. 1 to 28.