FR2871811A1 - RECOMBINANT ENDOFUCANASE - Google Patents

Abstract

The subject of the invention is a gene encoding a polypeptide having an endofucanase activity, that is to say an enzyme capable of degrading fucans or fucoidans which are polysaccharides constituted by sulphated fucose units. The subject of the invention is also a process for producing the aforesaid polypeptide in recombinant form by using genetic engineering techniques using the aforesaid gene. Finally, the invention relates to the use of the aforesaid recombinant polypeptide for the degradation of fucoidan-type polysaccharides for obtaining oligosaccharide fractions and in particular a tetrasaccharide fraction and a hexasaccharide fraction.

Description

RECOMBINANT ENDOFUCANASE

  The subject of the invention is a gene encoding a polypeptide having an endofucanase activity, that is to say for a polypeptide and more specifically an enzyme capable of degrading fucans or fucoidans which are polysaccharides constituted by sulphated fucose units.

  The invention also relates to a process for producing the aforesaid polypeptide by using genetic engineering techniques using the aforesaid gene.

  PCT patent application WO 00/17215 describes oligosaccharide fractions, obtained from fucoidans and of considerable interest, in particular in their applications in the field of plant protection, including tobacco, cereals including wheat and wheat. parsley.

  These fractions are obtained by hydrolysis of fucoidans using an enzyme characterized by certain polypeptide sequences. This enzyme is extracted from a bacterium called SW5 and deposited under No. 12171 in the DSMZ collection (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH).

  The preparation of an enzyme by extraction from bacterial cells has a low yield that does not allow its production on an industrial scale.

  However, the preparation of the oligosaccharide fractions referred to above requires large amounts of enzyme.

  The invention therefore aims, above all, to provide a process for industrially preparing the enzyme in question by genetic engineering techniques.

  2871811 2 And it is to the merit of the Applicant Society to have made possible the use of these techniques thanks to the work that enabled it to isolate, identify and define the gene responsible for the endofucanase activity in the genome of the bacterium SW5 .

  The isolated gene in question according to the invention is characterized in that it consists of the nucleotide sequence SEQ ID NO: 1 and polynucleotides consisting of analogous nucleotide sequences.

  The nucleotide sequence SEQ ID NO: 1 is represented in FIG.

  It will be recalled that a nucleotide sequence will be analogous to the nucleotide sequence of the gene SEQ ID NO: 1 insofar as, although having one or more different nucleotides with respect to SEQ ID NO: 1, the polypeptides encoded by the two nucleotide sequences exhibit an identical endofucanase activity.

  The gene according to the invention encodes the desired enzyme or polypeptide which is characterized by an amino acid sequence analogous to the sequence SEQ ID NO: 2; this polypeptide or enzyme has an enzymatic activity for the degradation of fucoidans.

  The peptide sequence SEQ ID NO: 2 is represented in FIG.

  It should be remembered that two peptide sequences are analogous insofar as, although differentiated by one or more amino acids, the polypeptides exhibit identical endofucanase activity.

  The subject of the invention is also the aforesaid gene or polynucleotide in a modified form, in particular by site-directed mutagenesis.

  More particularly, the invention relates to any polynucleotide encoding a polypeptide comprising an amino acid sequence analogous to one of the sequences: SEQ ID NO: 3 corresponding to amino acids 29 to 1007 of SEQ ID NO: 2, SEQ ID NO: 4 corresponding to amino acids 29 to 794 of SEQ ID NO: 2, SEQ ID NO: 5 corresponding to amino acids 29 to 736 of SEQ ID NO: 2, SEQ ID NO: 6 corresponding to amino acids 29 to 526 of SEQ ID NO: 2, SEQ ID NO: 7 corresponding to amino acids 29 to 418 of SEQ ID NO: 2, SEQ ID NO: 8 corresponding to amino acids 29 to 399 of SEQ ID NO: 2, Each of these polypeptides exhibits an activity enzymatic degradation of fucoidans.

  By specifying that the gene according to the invention is isolated, it is indicated that it is placed in an environment different from that in which it is found naturally. It is recalled that this term "isolated" is also used in connection with the polypeptides or enzymes and the host cells.

  It is also recalled that the terms polynucleotide and nucleic acid can be used interchangeably. They denote polymers of nucleotides of any length, whether they are ribonucleotides or deoxynucleotides.

  These terms include but are not limited to DNA, RNA, single-stranded or double-stranded genomic DNA, or DNA-RNA hybrids.

  The nucleic acids can be chemically or biochemically modified, for example by labeling with a radioactive isotope or a fluorescent group.

  They can also be modified by the substitution of one or more nucleotides with an analogue or with means for grafting a nucleic acid onto a protein, on labeled compounds, on other nucleic acids or on a solid substrate.

  The following is a definition of some terms and expressions used in the text of this patent application.

  Thus, a recombinant polynucleotide is a single or double-stranded nucleic acid molecule that has been modified by human intervention so as to contain nucleic acid segments combined or juxtaposed in an arrangement that does not exist in the natural state. .

  By the term genome is meant the whole genetic material of a cell.

  The term "genomic library" refers to all the molecular clones comprising genomic DNA fragments or inserts.

  By the term clones, we designate at least two entities (molecules, cells, ...) having identical genetic information.

  The terms polypeptide, enzyme and protein may be used interchangeably and denote molecules characterized by amino acid sequences of any length, optionally modified by chemical or biochemical means.

  These terms include fusion proteins, an expression by which is meant a hybrid protein encoded by a polynucleotide comprising the nucleotide sequences of at least two genes or fragments of the two genes different from each other; one of the sequences can encode for a tag.

  The term "tag" denotes any polypeptide sequence capable of binding to affinity matrices and / or of being recognized by antibodies making it possible to detect and / or purify the polypeptide to which it is fused.

  This being the method according to the invention by which it was possible to isolate, identify and define the gene according to the invention, is characterized in that successively -on prepares, by conventional techniques of molecular biology, a probe for screening a genomic library, a genomic library is constructed by conventional cloning techniques from the genome of the bacterium SW5, the genomic library is screened by hybridization of the probe with a view to to isolate the desired gene, the gene thus isolated is sequenced by standard sequencing techniques, and the endofucanase activity of the enzyme encoded by said gene is demonstrated.

The probe is first prepared.

  It is recalled that a probe corresponds to a nucleic acid fragment marked by the incorporation of radioactive atoms or fluorescent groups and whose sequence is substantially complementary to the sequence of a desired gene; the latter will be detected by hybridization with the probe, this hybridization occurring when the two complementary sequences pair up.

  By complementary sequence, is meant a nucleotide sequence consisting of a succession of bases complementary to those of another sequence with which it is therefore able to hybridize.

  According to a preferred embodiment of the invention, the nucleotide sequence of the probe prepared for the screening of the genomic library SW5 is complementary to a segment of the nucleotide sequence SEQ ID NO: 1.

  This probe is prepared by proceeding as indicated below.

  Bacterial cells of strain SW5 are cultured under standard culture conditions.

  The inventors have shown that when the culture media are supplemented with fucoidans, the fucoidan degradation activity is more important.

  The endofucanase enzyme produced by cultured SW5 cells is extracted from the culture medium and purified using conventional precipitation and chromatography techniques. The enzyme thus purified is then subjected to partial hydrolysis. The peptide fragments resulting from this hydrolysis are separated and purified by absorption chromatography such as high performance liquid chromatography (HPLC); these peptide fragments are then micro-sequenced for example according to the Edman method which allows the identification of N-terminal amino acids; the fragments are then analyzed.

  The knowledge of these partial peptide sequences of endofucanase makes it possible, by means of the genetic code, to deduce the corresponding nucleotide sequences.

  The genetic code is equivalent to the correspondence between the nucleotide sequences and the peptide sequences. Thus, each triplet of nucleotides of the nucleotide sequence or codon corresponds to a single amino acid.

  We speak of degeneracy of the genetic code insofar as several synonymous codons can specify the same amino acid. As a result, by the genetic code, several nucleotide sequences can be deduced for a single peptide sequence.

  On the basis of this information, two degenerate oligonucleotide primers are designed and synthesized: they serve as primers in the context of an amplification reaction, after which a probe having a high specificity for the desired gene is obtained.

  In addition, the genomic DNA library is constructed using conventional cloning techniques.

  To do this, the genome of the SW5 bacterium is cut as randomly as possible, by mechanical action or using a restriction nuclease.

  The use of nucleases leading to cohesive ends is a preferred means as it simplifies the subsequent cloning step. The DNA fragments thus obtained, the size of which is such that they are admissible by a vector, are inserted into this vector; recombinant vectors are thus obtained.

  The entire genome studied, here that of the bacterium SW5, is represented in the genomic library thus constructed.

  It is recalled that the term "vector" designates an extrachromosomal nucleic acid molecule, in particular a plasmid, a cosmid or a phage having autonomous replication and capable of being incorporated into a host cell, namely a microorganism, an animal or plant eukaryotic cell or a cell of a cell line as a unicellular entity that can be used as a container for a recombinant vector.

  The host cell becomes recombinant when it contains a cloning or expression vector or foreign nucleic acid. In the context of the invention, an example of a recombinant host cell is a cell that produces a polypeptide having endofucanase activity from an expression vector comprising the polynucleotide encoding said polypeptide.

  Typically a cloning vector is designed to allow the transport of a cloned DNA fragment and contains one or more recognition sites for restriction enzymes that allow the insertion or cloning of a nucleic acid fragment as well as one or more nucleotide sequences encoding genes for identifying and selecting host cells transformed by said vector.

  In the case where the host cells are E. coli bacterial cells, the aforementioned genes correspond to antibiotic resistance genes including ampicillin and kanamycin.

  An expression vector is designed to allow the expression of a coding nucleotide sequence inserted downstream of a promoter. The inserted sequence or insert is then transcribed and translated into polypeptide.

  Some expression vectors have a coding sequence for a tag upstream or downstream of the insertion or cloning site; the inserted sequence is then transcribed and translated in the form of a fusion protein.

  By promoter is meant a regulatory region located upstream of the coding region of a gene, near its 5 'end.

  A promoter comprises certain characteristic nucleotide sequences for the binding of the transcription initiation complex as well as the binding of transcriptional regulatory proteins.

  When the promoter is inducible, the transcription rate increases in response to an inducing agent.

  The recombinant vectors are transferred and amplified using bacterial host cells, including E. Coli.

  After a sufficient time of culture, cell clones each containing a recombinant vector are separated, it being understood that the clones differ from each other by the nature of the insert of the vector.

  So we got the genomic library.

  The genomic library is then screened; such screening serves to sort and identify positive clones.

  By positive clones, are meant clones which comprise an insert corresponding to a nucleotide sequence complementary to the sequence of the probe.

  Screening is one of the most delicate parts of cloning techniques and there are many variations.

  Advantageously, the procedure is as follows.

  The desired nucleotide sequence is detected, generally by molecular hybridization.

  Advantageously, the hybridization is carried out in situ when the genomic library is propagated in bacterial cells.

  Thus, bacterial clones grown in Petri dishes are replicated on nitrocellulose discs.

  After a sufficient culture time, the bacterial clones of the replicas are treated with sodium hydroxide which not only lyses the bacterial cells but also denatures the nucleic acid as a single-stranded molecule.

  Thus, in the clone collection, only those which possess an insert whose sequence is complementary to that of the probe are hybridized with it and are selected.

  Each selected positive clone comprises an insert coding for all or part of the desired polypeptide; the nucleotide sequence of this insert is determined by a conventional method of sequencing.

The screening is finished.

  The next step involves sequencing the gene.

  To reconstitute the nucleotide sequence of this gene, the nucleotide sequences of each insert are determined by sequencing, then are ordered relative to each other within a contig by highlighting recoveries overlapping ends.

  Contig refers to two or more nucleotide sequences having sequenced overlapping ends to reconstitute the desired gene; the goal is to obtain by successive recoveries a contig resulting in the consensus nucleotide sequence coding for the enzyme endofucanase.

  It is recalled that the term "overlapping ends" designates terminal regions having a sequence of identical nucleotides.

  The term "consensus nucleotide sequence" designates an idealized sequence in which each position represents the nucleotide most often found when several sequences are compared: it is then established after alignment of the nucleotide sequences of the inserts.

  The knowledge of the consensus nucleotide sequence of the gene makes it possible to prepare it by an amplification method.

  From the aforementioned consensus nucleotide sequence, it is possible to design and synthesize primers to obtain and amplify the gene coding for endofucanase or one of its fragments.

  The process for preparing the gene coding for endofucanase or a fragment thereof comprises two steps, namely the selection of a pair of oligonucleotide primers, each being complementary to one of the ends of the selected gene or fragment. and amplification of the gene or fragment chosen, using oligonucleotide primers and a polymerase enzyme.

  The amplification may be carried out either from the genome of a bacterium studied, including SW5, or from the gene coding for endofucanase or one of its fragments.

  The endofucanase activity is verified for each polypeptide according to the invention by means of a test demonstrating, by polyacrylamide-carbohydrate gel electrophoresis (C-PAGE), the release of anionic oligosaccharides resulting from the degradation of fucoidans. .

  Advantageously, the method used is that developed by Zablackis E. and Perez J. [Partially Pyruvated Carrageenan from Hawaiian Grateloupia filicina (Cryptonemiales, Rhodophyta) 1990 Bot. Mar. 33, 273-276].

  The isolated gene or polynucleotide according to the invention is characterized in that it also encodes a modified polypeptide comprising one or more modified amino acids, said modified polypeptide having optimized enzymatic fucoidan degradation activity.

  Typically, to modify the amino acid sequence of a polypeptide, one acts on the nucleic acid molecule that encodes that polypeptide using techniques known to those skilled in the art.

  It is possible to modify the nucleic acid constituting the gene or one of the polynucleotides according to the invention, to subject it to treatment with a mutagenic agent, that is to say a physical or chemical agent. capable of causing mutations that alter the meaning of the codons, which by the game of the genetic code modifies the amino acid sequence.

  Advantageously, a directed mutagenesis technique is used to modify the nucleotide sequence of the gene as well as those of the polynucleotides according to the invention; it is then a question of specifically introducing one or more mutations in the polynucleotide studied, which by means of the genetic code results in the substitution of one or more amino acids by one or more other amino acids in the polypeptide encoded by the polynucleotide. mutated.

  The interest of carrying out these mutations is not only to allow a thorough study of the catalytic mechanism of the polypeptide on the degradation of fucoidans but also to optimize said catalytic activity of the polypeptide in recombinant form for its industrial application.

  The endofucanase activity is verified according to the method of Zablackis E. and Parez J. as mentioned above.

  Once in accordance with the invention the gene has been isolated and identified, it becomes possible to produce the enzyme endofucanase on an industrial scale in the form of a recombinant polypeptide encoded by the gene coding for endofucanase or one polynucleotides according to the invention.

  It is also possible to produce the recombinant polypeptide in the form of a fusion protein corresponding to one of the polypeptides according to the invention fused to a tag, including in particular a sequence of histidine residues or glutathione-S- transferase; such a tag is capable of binding to affinity matrices and thereby facilitating the detection and purification of the recombinant polypeptide.

  To produce the recombinant polypeptide, on an industrial scale, whether it is encoded by the gene or by one of the polynucleotides according to the invention, successively - a host cell selected from the group comprising microorganisms of the bacterium type is selected. and yeast, animal or plant eukaryotic cells and cells of cell lines, the gene or one of the polynucleotides according to the invention is introduced into said host cell by conventional genetic engineering techniques; gene or one of the polynucleotides, and - the recombinant polypeptide obtained is extracted.

  To introduce into a host cell a recombinant polynucleotide characterized by the fact that it comprises the gene or one of the polynucleotides in accordance with the invention, conventional means of transformation, transfection or conjugation may be used.

  Advantageously, this recombinant polynucleotide can be introduced and produced in the host cell by means of an expression vector; such a vector is characterized in that it comprises the gene or one of the polynucleotides according to the invention coding for the endofucanse.

  However, because endofucanase is an enzyme, carrying out the production of its recombinant form may encounter major difficulties; these difficulties arise from the system and expression conditions, the purification procedure of the recombinant enzyme thus produced and finally the possibility of loss of activity for the recombinant enzyme relative to the native enzyme.

  The host cell is cultured under specific conditions including pH and composition of the culture medium, supplemented or not with particular compounds that are adapted to the cell type of the host cell; these conditions are optimized to efficiently produce the desired volumes of the recombinant polypeptide in soluble form.

  The host cell is advantageously an E. coli bacterial cell.

  The recombinant polypeptide thus obtained is extracted from the host cells and purified.

  The extraction of the recombinant polypeptide from a homogenate of cells is a delicate procedure on the one hand because of the fact that one is in the presence of several hundred proteins with chemical properties relatively close to those of the desired recombinant polypeptide and, on the other hand, because extraction and purification conditions which do not denature this recombinant polypeptide must be selected.

  Insofar as the expression system of the recombinant polypeptide allows its overexpression, the first difficulty can be overcome.

  The second difficulty can be overcome by the means used in the process for producing the recombinant polypeptide according to the invention and which will be discussed below.

  The recombinant polypeptide accumulates in E. coli bacterial host cells.

  After a sufficient culture time, the cells are centrifuged and then lysed by conventional mechanical or chemical treatments.

  Only the liquid phase free of cell fragments is stored and subjected to purification means such as dialysis, precipitation by neutral salts including ammonium sulfate, absorption chromatography, ion exchange chromatography and / or affinity chromatography.

  The endofucanase activity is verified after each purification step.

  The recombinant polypeptide may also accumulate in host cells as inclusion bodies.

  In this case, the host cells are lysed, the inclusion bodies are collected by centrifugation and made soluble by means of compounds commonly used in the field of the purification of proteins such as urea or guanidine hydrochloride.

  Once solubilized, the desired recombinant polypeptide is purified by the purification methods described above.

  The recombinant polypeptide may also be secreted by the host cell directly into the culture medium and may then be isolated by ultracentrifugation techniques, the final purification being as described above.

  The invention relates to the use of the aforesaid recombinant polypeptide obtained in particular by the method according to the invention for degrading fucoidan-type polysaccharides, which makes it possible to obtain oligosaccharide fractions and in particular the tetrasaccharide and hexasaccharide fractions which are particularly interesting.

  The invention can be better understood with the aid of the nonlimiting example described below; this example relates to the identification of the gene coding for endofucanase, to its preparation, to the process for preparing the recombinant endofucanase and to the use of the endofucanase enzyme for the degradation of fucoidan polysaccharides.

  Figure 3 shows the different structural domains of endofucanase isolated from SW5 (1007 amino acids, 110 kDa).

Example

  In a first step, a genomic DNA library of the bacterial strain SW5 is constructed.

  The extraction of the genomic DNA of the SW5 strain is carried out by conventional methods of molecular biology. The bacterial cells are cultured until saturation in a filtered seawater medium comprising 5 g / l of Bacto peptone (Difco), 1 g / l of yeast extract (Difco) and are then harvested by centrifugation. They are then chemically lysed in the presence of lysozyme and cold SDS. The nucleic acids of the lysate are then subjected to phenol chloroform extraction, followed by ethanol precipitation. The RNAs are removed by RNAse treatment and the genomic DNA is repurified by ethanol precipitation and then stored in a Tris-EDTA buffer.

  The genomic DNA is then partially digested with the Sau3AI restriction enzyme and then fractionated in a sucrose gradient. The DNA fragments obtained with a size of 4 to 10 kb are cloned into the BamHI restriction site of the pAT153 vector. The recombinant vectors are introduced into host cells of E. coli DH5α bacterial strain. The bacterial cells thus transformed are cultured and then spread on petri dishes comprising a solid culture medium; this in order to isolate the bacterial clones. The genomic library thus constructed comprises approximately 6,000 clones.

  In parallel, an oligonucleotide probe is constructed to allow genomic library screening.

  The probe is obtained by carrying out a polymerase chain reaction (PCR) on the genomic DNA extracted from the SW5 strain using two degenerate primers whose nucleotide sequences are read as follows: - upstream primer complementary to a sequence at the 5 'end of the sequence to be amplified: - downstream primer complementary to a sequence at the 3' end of the sequence to be amplified: TGYTGDATNGTIAGCCA The DNA thus amplified corresponding to the probe is purified by electrophoresis on agarose gel and then inserted into a cloning vector (cloning vector TOPO TA Cloning, Invitrogen): the recombinant vector is itself amplified and maintained in E. coli bacterial strainDH5a. The insert corresponding to the probe is sequenced by automatic sequencing.

  The probe with a length of 203 nucleotides has the following nucleotide sequence: ATTACAGTTGATCATGTTGCAGGTTTTACTAATTTGGGTAATGGAGCACCT GTTTGGTCTTCACCTATACTTAATCTTACCGATGGAAAAGGATCATTCGCCT ATAATTATACTTTGCAATTAGGAACCGATTATTATGATTTTGAAGGTGATG CACTTACTATTACTAAAACATCAGGACCTGATTGGCTTACTATTCAACA the probe by excising the insert of the recombinant vector is then prepared using the restriction enzyme EcoRI. After purification on agarose gel, this fragment serves as a template for a Random priming reaction allowing the synthesis of complementary single-stranded oligonucleotide having incorporated [α 32 P] labeled dCTP. The radioactive labeling of the probe is carried out using the Megaprime DNA labeling system kit (Amersham Pharmaciabiotech). The probe is purified on a Microspin S-200HR columns column (Amersham Pharmaciabiotech) in order to eliminate free labeled dCTPs.

  Using this labeled probe, the genomic library is screened by in situ hybridization for positive clones.

  The screening is carried out according to the procedure developed by Sambrook and Russel [Molecular cloning: a laboratory manual, third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1, 1126-1128, 1135-1142 (2001)].

  Each bacterial colony derived from a bacterial clone is transferred from the Petri dish to a nitrocellulose membrane (HybondN +, Amersham Pharmaciabiotech). These colonies are then treated according to a standard colony blotting protocol recommended by the manufacturer of the membrane. It is based on alkaline lysis of the colonies followed by neutralization, washing and fixation of the nucleic acid to the membrane by cooking at 80 ° C.

  Hybridization of the probe on the membranes also follows a standard protocol recommended by the manufacturer. The membrane is immersed at 65 ° C. in a prehybridization solution comprising 5X SSPE, 0.5% SDS, DENHARDT 5X solution and 100 μg / ml of denatured salmon sperm DNA. The actual hybridization step takes place at 65 ° C. in a solution of the same composition but without DENHARDT to which the labeled probe is added. The following three successive washings are carried out in solutions comprising 0.1% SDS and 2X SSPE, then 0.1% SDS and 1X SSPE, and finally 0.1% SDS and 0.1% X SSPE. Finally, the membranes are dried and then read on Storm system840 (Molecular Dynamics) after exposure on a phosphor screen.

  For each positive clone, the recombinant vector is extracted and purified by isopycnic centrifugation on a cesium chloride gradient.

  Of the 6000 clones contained in the library, 3 clones pAT153full, pAT153fu14 and pAT153fu33 respectively were selected; these clones each have an insert capable of hybridizing to the probe; their size is respectively 4 kb, 13.5 kb and 4 kb.

  The inserts were sequenced by automatic sequencing using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems) 16 capillary sequencer and the so-called chromosome-step method allowing step by step progression of each overlapping sequence. reading with the previous one. The sequence reactions are obtained via the BigDye Terminator V3.0 kit (Abi Prism, 2871811 19 Applied Biosystems) which meets the principle of independent terminal fluorescent labeling for the four bases.

  All sequencing was repeated 5 times in order to remove any ambiguity. Thus, the inserts of clones pATl53ful1 and pAT153fu33 have approximately the same nucleotide sequence except for their orientation. By approximately, are meant nucleotide sequences that may possibly differ in their nucleotide sequence due to spontaneous mutations that would result from errors occurring during the replication, repair or recombination of the DNA.

  The insert of clone pAT153fu14 has its 5 'end which overlaps the 3' end of the clone pAT153fu11 insert.

  The sequences of these inserts have been aligned and organized within a contig. Since the sequence of the gene encoding the endofucanase straddles the two inserts, its obtaining in its physical entirety was carried out by PCR from the genomic DNA of SW5. For this purpose, the information resulting from the nucleotide sequences of the inserts of the clones made it possible to design and synthesize oligonucleotide primers complementary to the nucleotide sequences upstream and downstream of the gene of interest.

  The upstream primer complementary to the sequence located at the 5 'end of the gene coding for endofucanase corresponds to the following sequence: GGA AAC ATC AAC CCA ACT CTT G The downstream primer complementary to the sequence located at the end 3 'of the gene coding for endofucanase corresponds to the following sequence: GCC ATG AGG CAT CAA 30 ACA ACT AGA 2871811 A consensus nucleotide sequence of the gene was then deduced; in its reading frame it comprises 3021 nucleotides.

  It is represented by the nucleotide sequence SEQ ID NO: 1.

  The structure of the peptide sequence of the isolated and identified gene coding for endofucanase was then determined.

  By means of the genetic code, a peptide sequence has been deduced from the nucleotide sequence of the gene. It is represented by the sequence SEQ ID NO: 2.

  A comparative analysis using the BLASTp and PSI-BLAST programs (from the NCBI server) between the peptide sequence SEQ ID NO: 2 and peptide sequences available in the GENBANKnr library revealed that about 60% of the sequence SEQ ID NO: 2 shows no significant similarity with the other peptide sequences.

  However, it has been possible to deduce the existence of particular domains as illustrated in FIG. 3: a region consisting of 3 tandemly repeated domains corresponding to amino acids 419 to 736 of SEQ ID NO: 2 whose function has not not fully understood; however, it appears that the motifs favor protein-protein interactions, with a C-terminal portion of about 70 amino residues comprising a conserved YPNP motif whose functionality is completely unknown to date.

  Another comparative analysis of SEQ ID No. 2, again by the BLASTp program (NCBI server) but against the PAT library, revealed the presence of a broad region homologous to a portion of the peptide sequences of the isolated Fdal and Fda2 fucoidanase enzymes. of the bacterial strain Alteromonas sp. SN-1009. Their alignment made it possible to deduce that the limits of the catalytic domain 2871811 21 correspond approximately to amino acids 29 to 418 of SEQ ID NO: 2 located at the N-terminus of the endofucanase sequence.

  Fucoidanase enzymes Fdal and Fda2 were identified by Sakai et al (US Patent 6,489,155).

  From this analysis, the inventors have suggested that three aspartic acid residues at positions 226, 275 and 289 could be catalytic residues involved in the hydrolysis of the glycosidic linkages of fucoidans.

  The pre-protein further comprises a signal sequence comprising 28 amino acids at the N-terminus.

  To produce the recombinant endofucanase enzyme, the procedure is as follows.

  The coding region of the gene coding for endofucanase and / or one of the polynucleotides encoding one of the peptide sequences SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 are amplified by PCR from the genomic DNA of SW5 using a high fidelity polymerase (Platinum Pfx DNA polymerase, Invitrogen) as well as primers comprising a sequence complementary to that of the gene. or one of the desired polynucleotides. Moreover, to allow the cloning of the PCR products in the cloning vector pDONR201 (GatewayTM, Invitrogen), these primers are flanked by a specific sequence of this cloning system.

  The upstream primer used to perform these amplifications is identical regardless of the sequence to be amplified. The nucleotide sequence of the upstream primer reads: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCAAGTACCAGATCCAAACC AAGGAT Each downstream primer used to carry out these amplifications has a specific sequence of the polynucleotide sequence to be amplified.

  The nucleotide sequence of the downstream primer used to amplify the coding region of the gene coding for endofucanase reads:

  GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATTTCTTAATGAATTTTTCGAAC

AA

  The nucleotide sequence of the downstream primer used to amplify the nucleotide sequence coding for SEQ ID NO: 3 reads:

  GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACGTTATACCTCCTGAAGAACCA

GA

  The nucleotide sequence of the downstream primer used to amplify the nucleotide sequence coding for SEQ ID NO: 5 reads:

  GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATCCATCACTAATAATAGTAGCA

AT

  The nucleotide sequence of the downstream primer used to amplify the nucleotide sequence coding for SEQ ID NO: 6 reads:

  GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATCCAGGATTTGTAAAACCTGCA

GG

  The nucleotide sequence of the downstream primer used to amplify the nucleotide sequence coding for SEQ ID NO: 7 reads:

  GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATGG TGATTGAAATTCTTT

CAAATA

  The nucleotide sequence of the downstream primer used to amplify the nucleotide sequence coding for SEQ ID NO: 8 reads:

  GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAGGTTGTAAAGTAAGCACTGG

AGC

  Each polynucleotide may also be amplified by PCR either from the coding region of the gene encoding the previously amplified endofucacanse or from one of the polynucleotides whose sequence is longer than that of the polynucleotide to be amplified.

  The PCR products are therefore cloned into the cloning vector pDONR201 (GatewayTM, Invitrogen). The recombinant vectors obtained are then amplified and maintained after transformation into E. coli strain DH5. The sequence of the inserts is checked. The insert having the sequence corresponding to that of the gene or that of one of the polynucleotides is then subcloned in phase in the pDEST17 expression vector (GatewayTM technology, Invitrogen). In this vector, the insert is under the control of the T7 promoter. Upstream of the insert, there is a hexahistidine label that will allow purification of the recombinant polypeptide facilitated.

  Cells of E. coli bacterial strain BL21 pLysS (Novagen) are transformed with the recombinant vectors pDEST17. The bacterial cells thus transformed are cultured in an M9 medium supplemented with 2% casamino acid, 100 g / ml of ampicillin and 35 ml of chloramphenicol in a Bioflow 3000 incubator at 37 ° C. under controlled atmosphere. The growth of the bacterial cells is carried out until the exponential growth phase (OD of 0.8 at 600 nm). The production of the recombinant polypeptide is induced by addition of isopropyl-1-thio- (3-D-galactopyranoside to a final concentration of 1 mM.

  Upon induction, the bacterial cells are incubated at a temperature of 20 C overnight.

  A volume of 500 ml of culture is then centrifuged at 10,000xg for 15 minutes. The cell pellet is taken up in 50 ml of a 20 mM Tris buffer pH 7.5 supplemented with 250 mM NaCl and 80 mM Imidazol. The cells are then incubated at 4 ° C. and then lycées using a device commonly used and commonly known as French Press. The cell lysate is then ultracentrifuged at 40,000 × g for 1 hour at 4 ° C.

  Finally, the protein fraction comprising the recombinant polypeptide is partially purified from the supernatant by affinity chromatography using a resin capable of binding the histidine residues and consequently retaining the recombinant polypeptide comprising a histidine tag. The protein fraction comprising the recombinant polypeptide is eluted in an imidazole gradient (imidazole gradient of 80 mM to 300 mM, final elution with 1 mM imidazole). Elution fractions with endofucanase activity were pooled for dialysis against 20 mM Tris buffer pH 7.5, 50 mM NaCl, 5 mM CaCl 2, 5 mM MgCl 2.

  The protein fraction comprising the recombinant polypeptide and obtained after dialysis is then concentrated by ammonium sulphate precipitation following a fractionation between 40 and 60% saturation. This fractionation is carried out by adding (NH4) 2SO4 at 130 g / l little by little and with slow stirring at 4 ° C. The protein fraction between 40 and 60% saturation of the ammonium sulphate is conserved and solubilized in the same buffer that used during the dialysis step.

  The protocols described below use the protein fraction comprising the recombinant polypeptide obtained either from the clarified cell lysate, or after purification by affinity chromatography or at the end of the precipitation step. .

  In order to estimate the enzymatic activity of the protein fraction comprising the recombinant polypeptide, it is firstly necessary to prepare fucoidans which will serve as substrates.

  The preparation of these substrates is carried out as follows.

  A quantity of one kg fresh weight of Pelvetia canaliculata seaweed is collected at low tide in Roscoff (France), then washed with distilled water.

  These algae are then crushed in a mortar in the presence of liquid nitrogen and allowed to macerate overnight in a volume of 2 L of an ethanol / formaldehyde / water solution (80: 5: 15 v / v).

  The algae fragments are extracted from this solution and then rinsed with 2 L of acetone. The algae fragments are recovered in the form of a pellet which is dried at a temperature of 60 ° C. Then the algae fragments undergo two extractions for 3 hours at 70 ° C. in a 0.01 N solution of HCl supplemented with 4%. (w / v) CaCl2.

  The extract is filtered, concentrated in a rotary evaporator and neutralized with ammonium carbonate.

  The fucoidans are precipitated in 2.5 volumes of ethanol. The precipitate is redissolved in water and frozen (Lyolab ALSL, Secfroid).

  Typically, this fraction of fucoidan has an amount of 55% of carbohydrate by weight relative to the total dry weight (according to the method of Tillmans and Phillipi [(1929) The carbohydrate content of the important protein of foodstuff on colorimetric procedure for the determination of Biochem Z. 215, 36-60]), an amount of 30% fucosyl residues in dry weight relative to the total dry weight (according to the method of Disches and Schettles (1948) A specific color reaction of methyl-pentoses and a spectrophotometric micromethod for their determination J. Biol Chem 175, 595-603]). In addition, the amount of sulfate corresponds to 26% and the amount of uronic acid is 2%, these percentage being expressed as dry weight relative to the total dry weight.

  Advantageously, fractions of fucoidans can be extracted from the species Pelvetia canaliculata, Ascophyllum nodosum or Fucus spiralis according to a method described in Mabeau et al. [(1990) Fractionation and analysis of fucans from brown alguae. Phytochemistry 19, 2441-2445].

  The endofucanase activity of the protein fraction in the form of a fraction precipitated with ammonium sulphate between 40 and 60% of saturation is demonstrated according to the following protocol.

  A test is carried out using polyacrylamidecarbohydrate gel electrophoresis (C-PAGE) making it possible to estimate the release of oligosaccharides according to the protocol of Zablackis E. and Perez J. [A partial pyruvated carrageenan from 2871811 26 Hawaiian Grateloupia filicina (Cryptonemiales, Rhodophyta) 1990 Bot. Mar. 33, 273-276].

  1 μl of pH 7.5 buffer comprising 20 mM Tris / H +, 5 mM MgCl2, 5 mM CaCl2 and 50 mM NaCl and 0.2% (w / v) fucoidans, are incubated with 5 μl of the protein fraction (as a fraction). precipitated with ammonium sulphate at 40-60% saturation) for 1 hour at room temperature. The result of the enzymatic hydrolysis is analyzed by electrophoresis through a polyacrylamide gel (at 6% for the concentration gel and 27% for the separation gel) in a pH 8.7 buffer comprising 50 mM Tris / H + and 2 mM. EDTA. A sample corresponding to pure fractions of hexasaccharide and tetrasaccharide is also deposited on the gel as a qualitative reference.

  After migration, the charged sugars are fixed and stained in the gel with a solution of 0.5% alcian blue (Fluka) for 10 minutes. After several rinsing with distilled water until the gel becomes colorless, it is subjected to staining with 0.4% silver nitrate for 10 min and then rinsed with distilled water. The coloring is revealed by a solution of sodium carbonate 7% (w / v) supplemented with 0.1% (v / v) of 37% formaldehyde and quenched with a solution of acetic acid at 5% (v / v).

  After staining of the gel, the migration profile of the oligosaccharides generated after hydrolysis of the fucoidans by the protein fraction comprising the recombinant polypeptide and the migration profile of the pure tetrasaccharide and hexasaccharide fractions are compared. This makes it possible to demonstrate the presence of tetrasaccharide and hexasaccharide fractions among the oligosaccharides generated by the recombinant polypeptide.

  The oligosaccharides generated by the recombinant polypeptide are purified, isolated and analyzed according to the protocol detailed in the PCT patent application WO 00/17215.

  The nuclear magnetic resonance analysis of the structure of the oligosaccharides obtained confirms that the hydrolysis by the protein fraction comprising the recombinant polypeptide effectively generates a tetrasaccharide fraction and a hexasaccharide fraction whose respective structure is: aL-Fucp-2,3 - (diOSO3) -1- * 3-aL-Fucp-2- (OSO3) -14- α-Fucp-2,3- (diOSO3) -1> 3-α-Fucp-2- (OSO3) and, aL -Fucp-2,3- (diOSO3) -1-> 3-aL-Fucp-2- (OSO3) -1> 4αL-Fucp-2,3- (diOSO3) -1> 3-α-Fucp- 2- (OSO3) -1-4- α-Fucp-2,3- (diOSO3) -1> 3-α-Fucp-2- (OSO3).

  The recombinant polypeptide therefore has endofucanase activity.

Claims (3)

  1. Isolated gene characterized in that it consists of the nucleotide sequence SEQ ID NO: 1.   2. Polynucleotide characterized in that it consists of a nucleotide sequence analogous to the sequence SEQ ID NO: 1.   3. Polynucleotide encoding a polypeptide whose amino acid sequence is analogous to the sequence SEQ ID NO: 2.   4. Polynucleotide characterized in that it consists of a fragment of the gene or polynucleotide according to one of claims 1 to 3, said fragment encoding a polypeptide whose amino acid sequence is similar to one of the sequences: SEQ ID NO: 3 corresponding to amino acids 29 to 1007 of SEQ ID NO: 2, SEQ ID NO: 4 corresponding to amino acids 29 to 794 of SEQ ID NO: 2, SEQ ID NO: 5 corresponding to amino acids 29 to 736 of SEQ ID NO: 2, SEQ ID NO: 6 corresponding to amino acids 29 to 526 of SEQ ID NO: 2, SEQ ID NO: 7 corresponding to amino acids 29 to 418 of SEQ ID NO: 2, SEQ ID NO: 8 corresponding to amino acids 29 to 399 of SEQ ID NO: 2, 5. Isolated gene or polynucleotide according to one of claims 1 to 4, characterized in that it encodes a modified polypeptide comprising one or more modified amino acids, said modified polypeptide having an optimized enzymatic activity of fucoidan degradation.   An isolated gene or polynucleotide according to claim 5 modified by the site-directed mutagenesis technique.   7. isolated gene or polynucleotide according to one of claims 1 to 6 characterized in that it encodes a polypeptide having an enzymatic activity of degradation of fucoidans 8. isolated gene or polynucleotide according to one of claims 1 to 6; 7 characterized in that it is isolated from the genome of bacterial strain SW5 registered in the DSMZ collection (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) under No. 12171.   9. A method for isolating, identifying and defining the gene or polynucleotide according to one of claims 1 to 8, characterized in that successively - is prepared by conventional molecular biology techniques, a probe for screening a genomic library a genomic library is constructed by conventional cloning techniques from the genome of a bacterium; the genomic library is screened by hybridization of the probe in order to isolate the gene or one of the desired polynucleotides, the gene or one of the polynucleotides thus isolated is sequenced by standard sequencing techniques; the endofucanase activity of the enzyme encoded by said gene or said polynucleotide is demonstrated.   10. Process for the preparation of the gene or one of the polynucleotides according to one of claims 1 to 8 or obtained at the end of the step of screening the genomic library of the method according to claim 9 characterized by the fact it comprises two steps, namely - the selection of a pair of oligonucleotide primers, each being complementary to one of the ends of the gene or one of the polynucleotides and, - the amplification of the gene or the one of the polynucleotides using said primers and a polymerase enzyme.   11. A recombinant polynucleotide characterized in that it comprises a gene or a polynucleotide according to one of claims 1 to 8.   12. Expression vector characterized in that it comprises a polynucleotide according to claim 11.   An isolated host cell containing either a polynucleotide according to claim 11 or an expression vector according to claim 12.   A method of producing the recombinant polypeptide, encoded by the gene or polynucleotide of any one of claims 1 to 8, said method comprising the successive steps of selecting a host cell selected from the group consisting of microorganisms of bacterium and yeast type, animal or plant eukaryotic cells and cells of a cell line, for introduction, by conventional genetic engineering techniques of the gene or one of the polynucleotides according to one of claims 1 to 8 in the host cell, - expression of said gene or one of the polynucleotides and - extraction of the recombinant polypeptide obtained.   15. Use of a recombinant polypeptide obtained by the process according to claim 14 for the degradation of fucoidan polysaccharides based on sulphated fucose residues.   16. Use according to claim 15 characterized in that it allows to obtain oligosaccharide fractions and in particular a tetrasaccharide fraction and a hexasaccharide fraction.