FR2830762A1 - Use of collapsin response mediator protein for treating T lymphocyte dysfunction, e.g. viral infection or leukemia, also for drug screening, diagnosis and prognosis - Google Patents

Abstract

Use (M1) of: (i) CRMP (collapsin response mediator protein) (I), or its active fragments; (ii) nucleic acid (II) encoding (i); (iii) antisense nucleic acid that hybridizes to (II); or (iv) anti-CRMP antibodies for treating diseases involving dysfunction of T lymphocytes, i.e. T cell leukemia or lymphoma; viral infections; prion diseases and demyelinizing neuroinflammatory diseases such as multiple sclerosis, is new. Independent claims are also included for: in vitro screening (M2) for molecules useful for treating prion diseases, using CRMP; and in vitro prognostic and/or diagnostic method (M3) for diseases associated with immune system dysfunction based on detecting expression or localization of CRMP.

Description

<Desc / Clms Page number 1>

 The present invention relates to a new use of proteins called "CRMPs" (Co!! Apsin Response Mediator Proteins) for the diagnosis and therapy of pathologies related to a dysfunction of the immune system.

 CRMPs are intracellular signaling molecules hitherto recognized as specific to the nervous system. These proteins are more specifically involved in the control of neuronal development and axonal guidance.

 To date, five proteins of this family have been identified, CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5.

 Unexpectedly, the inventors have demonstrated the presence of CRMPs 1,2 and 4 at high levels in T lymphocytes in patients with dysimmune pathologies. In this case, it appears that the presence of these proteins is increased when it is associated with an abnormality of death or proliferation of lymphocytes.

 Moreover, the inventors have also observed a very increased nuclear translocation of CRMP2 of lymphocytes infected with HTLV-1 and making them probably hyperproliferative, or of T lymphocytes of patients with immune deficiency linked to the Fas-Fas ligand system. This translocation corresponds to a highly phosphorylated form of CRMP2, more particularly recognized by its specific antibody.

 Finally, as is apparent from the examples below, the presence of these proteins has also been characterized in thymic epithelial cells from the embryonic stage. This discovery of CRMPs in immature epithelial cells is one of the rare examples of intracellular signaling protein in the thymus.

 Moreover, the disappearance of CRMPs in the adult thymus and their induction in T cells after TCR stimulation indicates a relationship with the "rearrangement" of the T cell receptor, TCR, and the thymocyte education.

<Desc / Clms Page number 2>

 Consequently, all of these new data testify to the intervention of CRMPs proteins in a signaling pathway that leads to the proliferation, death, maturation and education of lymphocytes and therefore their involvement in the regulation of immune response.

 These observations are all the more unexpected because until now, the CRMPS were considered therapeutically only as potential targets for treating central nervous system (CNS) pathologies.

 It is clear that this discovery opens new therapeutic perspectives. It is now possible to act on proliferation or death of T cells and / or act on thymic cells and autoimmunity via an intervention at the level of CRMPs proteins in lymphocytes.

 In this case, the present invention specifically aims to use the CRMPs as targets for the treatment, prognosis and / or diagnosis of diseases related to a dysfunction of the immune system and in particular the proliferation of T cells.

 In particular, it relates to the use of at least one protein of the family of CRMPs, polypeptide fragment or biologically active derivative thereof, a sequence or nucleotide sequence fragment encoding said protein, an anti -sense capable of specifically hybridizing with a nucleotide sequence coding for said protein or an antibody directed against said protein or a peptide sequence capable of acting with said protein, or pharmaceutical compounds capable of controlling the expression of said protein, and or their partners and / or their interactions, for the manufacture of a medicament for treating pathologies related to a dysfunction of the immune system.

 More specifically, the present invention aims at the use of at least one protein of the CRMP family, polypeptide fragment or derivative

<Desc / Clms Page number 3>

 biologically active thereof, a sequence or nucleotide sequence fragment coding for said protein, an antisense sequence capable of hybridizing specifically with a nucleotide sequence coding for said protein or an antibody directed against said protein for the manufacture of a medicament for treating autoimmune diseases, T-cell leukemia and lymphomas, neuroinflammatory disorders associated with infection with the HTLV-1 retrovirus, tropical spastic paraparesis, neurosida, pathologies such as herpes, measles, Epstein-Barr virus and prion diseases; dysimmune disorders related to the Fas and Fasl mutation; and neuroinflammatory disorders associated with lymphocyte activation.

 Thus, alteration of CRMPs, such as a change in phosphorylation of CRMP2, is likely to lead to hyperproliferation or cell death.

 Similarly, stimulation of CRMPs appears to be an effective means of restoring deficient signaling and improving lymphocyte survival as in the case of HIV infection.

 Finally, a control of the hyperexpression of CRMP seems to be determinant to reduce the proliferation of lymphocytes made "hyper" proliferative as in the case of a HTLV-1 infection or a mutation of Fas. This inhibition could also improve autoimmune processes that involve self-determining T-cells (self-reactive), and CNS involvement related to CNS invasion by these T cells (HTLV-1-linked TSP / HAM, BSE). to measles, multiple sclerosis).

 Pathologies more particularly concerned by an increase in the expression of CRMPs in T cells are: - T-cell leukemia and lymphomas and neuroinflammatory lesions associated with infection with HTLV1 retrovirus, tropical spastic paraparesis or HTLV-1-associated myelopathy -TSP / HAM and neurosida;

<Desc / Clms Page number 4>

 - Herpes-like diseases, measles, Epstein-Barr virus and prion diseases; - the dysimmune disorders related to the mutation of Fas and Fasl; and neuroinflammatory disorders associated with activation of T lymphocytes (multiple sclerosis).

 It is also conceivable to treat autoimmune diseases (and in particular those related to Fas), by acting via the CRMPs proteins and their various biological partners, on the maturation of T lymphocytes at the level of the thymus.

 As representative of these autoimmune pathologies, mention may be made more particularly of rheumatoid arthritis, myasthenia, lupus erythematosus, asthma, multiple sclerosis, adult T-cell leukemia, lymphomas (that is, that is, the malignant proliferation of T cells), or any immune disorder involving immune recognition and targeting of the cells themselves or tissues and resulting in one or more inflammatory responses. Multiple sclerosis is the most common autoimmune disease.

 The CRMPs proteins more particularly considered according to the invention are the CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5 proteins.

 The present invention preferably relates to the use of at least one CRMP protein chosen from the amino acid sequences of the human proteins CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5 which are represented in FIG.

 According to the present invention: the protein CRMP1 refers in particular to a protein comprising the amino acid sequence shown in FIG. 8 as well as any corresponding polypeptide fragments or derivatives.

 The CRMP2 protein refers in particular to a protein comprising the amino acid sequence shown in FIG. 8 as well as any corresponding polypeptide or derivative fragments.

<Desc / Clms Page number 5>

 The CRMP3 protein refers in particular to a protein comprising the amino acid sequence shown in FIG. 8 as well as any corresponding polypeptide or derivative fragments.

 The CRMP4 protein refers in particular to a protein comprising the amino acid sequence shown in FIG. 8 as well as any corresponding polypeptide or derivative fragments.

 The CRMP5 protein refers in particular to a protein comprising the amino acid sequence shown in FIG. 8 as well as any corresponding polypeptide or derivative fragments.

 The derived polypeptides refer to any polypeptide variant of the above proteins or any other molecule resulting from a genetic modification and / or of a chemical nature of one of the sequences specified above, that is to say obtained by mutation, deletion, addition, substitution and / or chemical modification of a single or a limited number of amino acids, as well as any isoform sequence, said derived, modified or isomorphic sequence having conserved at least one of the properties making it biologically active.

 Also concerned are the different forms of proteins considered likely to be recognized by their respective antibodies. It can thus be their dimeric forms, phosphorylated and / or truncated.

 In FIG. 5, it is thus demonstrated by Western Biot using a specific antibody the presence of a particular form of phosphorylated CRMP2 in hyperproliferative T lymphocytes (C91 PL), compared with control lymphocytes (Jurkat).

 More particularly preferred in the context of the present invention as therapeutic targets, CRMP2 and CRMP5 proteins.

The CRMP5 protein appears in particular to be a particularly interesting target for the diagnosis and / or treatment of diseases of the prion disease type.

<Desc / Clms Page number 6>

 In the same way, the invention covers the use of any isolated nucleic acid sequence coding for one of the CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5 proteins, or nucleotide fragments or sequences derived from one of the sequences, because of the degeneracy of the genetic code or the fact of mutation, deletion, or insertion of at least one nucleotide, said derived sequences having a biological activity substantially identical to that of the protein in question.

 The different nucleotide or peptide sequences of the invention may be of artificial origin or not. They may be DNA or RNA sequences, obtained by screening sequence libraries using probes developed on the basis of the original sequences. Such libraries can be prepared by standard molecular biology techniques known to those skilled in the art.

 The nucleotide sequences according to the invention may also be prepared by chemical synthesis or by mixed methods including the chemical or enzymatic modification of sequences obtained by screening the bands. These nucleotide sequences allow the production of nucleotide probes capable of hybridizing strongly and specifically with a nucleic acid sequence, a genomic DNA or a messenger RNA coding for a peptide according to the invention or a biologically active fragment of this one.

 The appropriate hybridization conditions correspond to the temperature and ionic strength conditions usually used by those skilled in the art (Sambrook et al., 1989), preferably at temperature conditions between (Tm-5 C) and (Tm-5). C), where m is the theoretical melting temperature defined as the temperature at which 50% of the paired strands separate.

 These two variants of use are interesting when one seeks to increase the quantity in at least one of the CRMPs. In this case, one can also consider using a compound or a

<Desc / Clms Page number 7>

 a mixture of compounds of synthetic or natural origin that activates or inhibits the expression or action of these CRMPs.

 As an illustration of this type of compounds, mention may be made more particularly of molecules that can behave as a biological partner of CRMPs, for example using CRMPs as an intracellular signaling molecule.

 As an illustration of this type of compounds, there may be mentioned protein Prp.

 The inventors have thus demonstrated an interaction of CRMP5 with prion protein PrP. Presumably, the modulation of CRMP expression in lymphocytes via PrP protein would be involved in the process of degeneration in the transfer of pathogenic information from the immune system to the central nervous system. This aspect of the invention is illustrated by Example 4 hereinafter.

 The therapeutic approach to be considered therefore consists in blocking the interaction between PrP and the CRMP protein, and in particular CRMP5.

 The use of antisense sequences or of anti-CRMP1, CRMP2, CRMP3, CRMP4 and / or CRMP5 antibodies is for its part preferred when seeking to block the expression of the CRMP protein in question.

 The nucleotide sequences encoding the CRMP1, CRMP2, CRMP3, CRMP4 or CRMP5 proteins are useful for the production of antisense sequences capable of specifically hybridizing with a nucleic acid sequence including messenger RNA that can be used in therapy. gene.

 The invention therefore also covers the use of antisense sequences capable of at least partially inhibiting the production of the CRMPs proteins identified above.

 The invention also relates to the use of monoclonal or polyclonal antibodies or their fragments, chimeric antibodies or

<Desc / Clms Page number 8>

 immunoconjugates obtained from a CRMP selected from CRMP1, CRMP2, CRMP3, CRMP4 or CRMP5 proteins, derivatives or biologically active polypeptide fragments of CRMPs.

 The polyclonal antibodies were obtained according to the protocol described in the examples. These antibodies can, however, also be obtained using conventional methods.

 As a representative of the sequences used to produce these antibodies, mention may be made especially of those represented in FIG. 8.

- peptide 6 (CMRP1) : SEO ID nO 22 ; - peptide 3 (CMRP2) : : SEO ID nO 23 ; - peptide 4 (CMRP2) : : SEQ ID nO 24 ; - peptide 7 (CRMP4) : : SEO ID nO 25 ; - peptide 8 (CRMP3) : : SEO ID nO 26 ; - peptide 5 (CRMP5) : : SEO ID nO 27 ; - peptide 9 (CRMP2 C-terminal) : SEQ ID n 28. It is :

peptide 6 (CMRP1): SEO ID No. 22; peptide 3 (CMRP2): SEO ID No. 23; peptide 4 (CMRP2): SEQ ID NO: 24; peptide 7 (CRMP4): SEO ID No. 25; peptide 8 (CRMP3): SEO ID No. 26; peptide 5 (CRMP5) :: SEO ID No. 27; peptide 9 (CRMP2 C-terminal): SEQ ID No. 28.

 Anti-pep4 is more specific to CRMP2, which is particularly advantageous given the strong homology between CRMPs that makes it difficult to produce specific antibodies.

The peptide comprises a serine which is a potential phosphorylation site and which, presumably, facilitates the detection of the phosphorylated form.

 Anti-pep 9 (C-terminal CRMP2) is also specific for a portion of the CRMP2 protein that is truncated in certain pathological circumstances.

 The anti-pep5 is specific to CRMP5 and therefore advantageously makes it possible to differentiate CRMP5 from other CRMPs.

 The antibodies may be chimeric antibodies, humanized antibodies, Fab and F (ab ') 2 fragments. They may also be in the form of immunoconjugates or labeled antibodies.

<Desc / Clms Page number 9>

 In this same perspective, it is also conceivable to intervene in the signaling cascade by using a compound or mixture of compounds of synthetic or natural origin capable of inhibiting the action of said proteins and more particularly of blocking the interaction. either between two of them, or between one of them and their natural biological partners.

 The inventors have thus demonstrated that the CRMPs which are therefore intracellular signaling molecules react with the prion PrP protein, which is presumably involved in membrane signaling.

 In the present case, a second aspect of the invention relates to a pharmaceutical composition comprising, precisely as active principle, a compound or mixture of compounds of synthetic or natural origin capable of targeting at least one CRMP protein and / or of inhibiting the natural interaction of at least one CRMP protein and / or CRMP dimer with prion protein PrP.

 According to a particular embodiment of the invention, the CRMP protein considered is CRMP5.

 Within the meaning of the invention, the compound or mixture of compounds acts more particularly by blocking the interaction between the two proteins in question. Especially suitable for this purpose are so-called aptamer compounds. These are molecules that have the ability to bind to other molecules with high affinity and specificity. As representative of this type of compounds, it is more particularly possible to propose peptide aptamers.

 Pathologies that can be treated according to this variant are prion diseases, sporadic, acquired or genetic or, more generally, any disease involving PrP in cell signaling.

 With respect to compounds having stimulatory or inhibitory activity against CRMPs, they may be

<Desc / Clms Page number 10>

 selected using a screening method in which the test compound is contacted with a CRMP protein and the interaction between the two determined proteins.

 According to a preferred embodiment of the invention, the patient is a human, preferably an adult, but the claimed method of treatment can also be applied to mammals or other vertebrates.

 The optimal modes of administration, dosages and galenic forms of the compositions according to the invention can be determined according to the criteria generally taken into account in the establishment of a therapeutic treatment adapted to a patient, such as, for example, age or weight. the patient's body condition, the severity of his or her general condition, the tolerance to treatment, the observed side effects, etc.

 Preferably, the pharmaceutical compositions according to the invention may be administered systemically, preferably intravenously, intramuscularly, intradermally or orally.

 The invention also relates to a method for the prognosis and / or diagnosis of autoimmune diseases, lymphomas, adult leukemia, neuroinflammatory diseases related to a viral infection and / or prion diseases, characterized in that the presence of at least one CRMP protein whose expression, sequence or location is modified relative to control lymphocytes obtained in healthy subjects is demonstrated in lymphocytes taken from an individual.

 The evaluation of CRMPs protein expression can be performed by various techniques well known to those skilled in the art.

The RNA encoding the proteins can be detected and quantified using specific nucleotide probes. The products of the genes coding for the CRMPs proteins can also be assayed using corresponding antibodies as defined above and located in the cell.

<Desc / Clms Page number 11>

 Alternatively, the presence of anti-CRMP antibodies can be determined using CRMPs or their epitope fragments that can be labeled so that complexes formed between the protein and said antibodies are then easily detectable in biological samples. .

 More generally, it is also possible to envisage the use of CRMPs as baits to identify new therapeutic targets in biological extracts, lipid-type or biopsies, patients with autoimmune diseases, neuroinflammatory diseases, lymphomas or leukemias. T.

 In this case, the invention also aims at protecting the use of at least one CRMP protein as a diagnostic tool for detecting, identifying and / or assaying at least one biological partner of a CRMP protein in extracts of patients with autoimmune diseases, neuroinflammatory diseases, lymphomas or T-cell leukemia.

 The examples and figures below are presented for illustrative and not limiting of the present invention.

FIGURES:
FIG. 1: Comparison by RT-PCR analysis of the level of expression of the mRNAs encoding CRMP-4, -2 and-1 in lymphocytes and mononuclear cells, controls or from patients with dysimmune pathologies. The level of expression of the CRMP mRNAs is normalized with respect to the level of expression of the ubiquitous GAPDH gene. The results are expressed in relative value as a ratio of pixels between the amplicon of each CRMP and the amplicon of G3PDH.

<Desc / Clms Page number 12>

 Figure 2: Electrophoretic profile of CRMP1,2 and 4 proteins in a Jurkat lymphocyte line compared to a nerve cell line Dev.

 Figure 3: Immunocytochemical detection of the subcellular leasing of the CRMP2 protein in blood mononuclear cells (PBLs) of HTLV-1-infected or HTLV-1-infected or immunally-linked immune system / Fas-Fas-ligand-infected patients.

 Figures 4: Characterization of the nuclear presence recognized by the anti CRMP-2 (peptide 4) in hyperproliferative T cells. Figures 4a: Post-immunodetection examination of CRMP-2 and Dipi DNA intercalation with staining in Jurkat T cells (controls) and C 8166 cells (HTLV-1 non-virus infected T cells). Figures 4b: Examination of the immunodetection of CRMP-2 in confocal microscopy in CEM cells (control T line) and C91 P1 cells (HTLV-1 infected line).

 FIG. 5: Western blot demonstration using the specific anti-CRMP2 antibody (peptide 4) for the presence of a particular form of phosphorylated CMRP2 in hyperproliferative T lymphocytes (C91PL) compared to control lymphocytes (Jurkat).

 FIG. 6: Immunohistochemical analysis of the expression of the CRMP5 and CRMP2 proteins at the level of the fetal human thymus (A, B, C) and in a thymoma (D, E, F).

 Figure 7: Characterization by double-hybrid tests by conjugation of the interaction between the bovine protein PrP and human CRMP5.

 Figure 8: Amino acid sequences of human proteins CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5. Also present in this figure are the sequences of the peptides chosen to produce antibodies specifically directed against CRMPs.

 MATERIALS AND METHODS

<Desc / Clms Page number 13>

1. Cells and Cell Culture e SI Cells: T cells are either established lymphocytes in lineages (independent IL-2) or lymphocytes in primary culture and whose growth requires the presence of IL-2. These lymphocytes are cultured (37 C, 5% CO2) in suspension in a saline medium supplemented with either FCS (10%) in the case of lymphocyte lines, or in AB type human serum (10% SAB) and IL-1. 2 in the case of primary cultures of T lymphocytes. Peripheral lymphocytes (PBL) were also freshly isolated from the blood of patients or control subjects, separated on a Ficoll gradient and recovered after a phase of adhesion of monocytes / macrophages.

 . T cell treatments: In some experiments, freshly isolated PBLs were treated with CD3 agonist antibodies (10 g / mt) that mimic lymphocyte activation by an antigen via T-receptor (TCR) or Phytohemagglutinin (PHA). 10 μg / ml) (C.

Malus).

 2. Examination of transcripts (mRNA) by the RT-PCR method (reverse transcription and polymerase chain reaction).

 Isolation of total RNA: This experiment is systematically at 40C to avoid RNA degradation by Rnases. RNA extractions were performed from freshly isolated cell cultures or lymphocytes to which a solution of RNAzol was added (2 ml per 10 6 cells). RNAzol contains phenol and guanidium isothiocyanate and lyses the cells. The phase separation is carried out using chloroform (400 μl for 2 ml of RNAzol). After homogenization (vortex) and then 5 min rest, the sample is centrifuged at rest (5 minutes) and then centrifuged at 12000 rpm for 30 minutes at 4 C. RNA present in the aqueous phase (measured volume) are precipitated a first time by adding a volume

<Desc / Clms Page number 14>

 identical isopropanol (15 min at 4 C then centrifugation (12000 rpm for 15 minutes at 4 C.) A second precipitation is carried out by adding to the pellet a volume of sodium acetate 0.3 M pH 5.2 and three volumes of absolute ethanol at -20 ° C. The precipitate is collected by centrifugation (12000 rpm, 15 minutes, 4 ° C.) The salts are removed by adding 800 μl of ethanol 80% to -20 to the pellet. Followed by centrifugation After removal of all traces of ethanol, the pellet is dissolved in 100 ml of distilled water and stored at -80 ° C. The measurement of the RNA is carried out by measuring the optical density with a spectrophotometer at 260 ° C. and 280 nm (1 OD unit at 260 nm = 40 μg of RNA) The OD ratio obtained at 260 nm and 280 nm should be close to 2, indicative of good RNA extraction without trace protein .

 # Reverse transcription: Reverse transcription (RT for reverse transcription) is the preliminary step to iterative polymerization that uses a DNA polymerase unable to polymerize DNA from RNA. The RT is carried out using a reverse transcriptase Rtase MuLV virus and is initiated by a primer that allows the elongation and synthesis of a DNA strand complementary to the RNA by the enzyme. In a comparative study of the amplification products of different mRNAs, the use of nonspecific primers (oligodT) proved to be more suitable, offering the possibility of conducting the various specific PCRs from the same sample. from RT.

 500 ng of total RNA diluted in 7 of water (qs) are incubated for 10 minutes at 70 ° C. to allow denaturation of the secondary structures and then the tubes are immersed immediately in the ice to avoid any renaturation. At these 70 p. ! total RNA is then added 1 pI of aligodT (100 ng / ti) and 12 l of "incubation" medium containing 0.5 nM of dNTP, 4; RT buffer, 40 U RNAsin (Rnase inhibitor), 10 mM dithiotreitol or DTT (denaturant), 1 μl MuLV-Rtase (200 U / d). The

<Desc / Clms Page number 15>

 The reaction mixture is incubated for 90 minutes at 42 ° C. The RT products are then diluted to 10 μl in distilled water and stored at -20 ° C. The polymerase chain reaction (PCR): the iterative polymerization (PCR) for polymerase chain reaction) is a technique that consists of repeating cycles of polymerization of a segment of a DNA of interest. The first step of each cycle is a denaturation step carried out at 95 ° C. The second step is a hybridization or attachment step with segment-specific primers which frame the region to be amplified at a temperature at which 50% of the DNAs are under double-stranded form and the remaining 50% in single-stranded form (Tm). The third step is the elongation step at 72 ° C., the optimum temperature for the activity of the thermostable DNA dependent DNA polymerase, the Taq polymerase. The parameters that must first be taken into account to optimize the PCR are the choice of primers (made by the Primer3 software and validated by comparison with the human indexed sequences, Blast), the hybridization temperature or Tm, the MgC concentration) 2 and the number of cycles. All of these conditions were developed before performing the PCRs and are summarized in the following table:

<Desc / Clms Page number 16>

<Tb>
<tb> Primers <SEP> for <SEP><SEP> RT-PCR <SEP> Tm <SEP> [MgCl2] <SEP> Number
<tb><SEP> probe for <SEP><SEP> Southem-blot <SEP> of <SEP> cycles
<tb> CRMP-4 <SEP> Sens <SEP>: <SEP> gcaagtgtaggaaggcacgct <SEP> Anti-sense <SEP>: <SEP> ggcagctctggaacgtgaaga <SEP> Probe <SEP>: <SEP> cctcagccttgttcttcacg <SEP> 62 C <SEP> 2mM
<tb> 28
<tb> SEQ <SEP> ID <SEP> N 1 <SEP> SEQ <SEP> ID <SEP> N02 <SEP> SEQ <SEP> ID <SEP> N03
<tb> CRMP-2 <SEP> Direction <SEP>: <SEP> tcacatcagaactcctgtgg <SEP> Anti-sense <SEP>: <SEP> catgagtggaggaactttc <SEP> Probe <SEP>: <SEP> ccatcaccacccttgtctct <SEP> 620C <SEP > 3mM
<tb> 22
<tb> SEQ <SEP> ID <SEP> N04 <SEP> SEQ <SEP> ID <SEP>? <SEP> 5 <SEP> SEQ <SEP> ID <SEP> N06
<tb> CRMP-1 <SEP> Direction <SEP>: <SEP> tcatgctgaatccacctcgg <SEP> Anti-sense <SEP>: <SEP> cctctgaggcagttgacgg <SEP> Probe <SEP>: <SEP> gacatcgccaaggactgact <SEP> 62 <SEP > C <SEP> 3 <SEP> mM <SEP> 26
<tb> SEQ <SEP> ID <SEP> N07 <SEP> SEQ <SEP> ID <SEP>? <SEP> 8 <SEP> SEQ <SEP> ID <SEP> N09
<tb> CRMP-3 <SEP> Means <SEP>: <SEP> gccgcccctaccagagacc <SEP> Anti-sense <SEP>: <SEP> gtgcagcgacagccagat <SEP> Probe <SEP>: <SEP> cggagaaaacctcatcgt <SEP> 62 <SEP > C <SEP> 3 <SEP> mM <SEP> 30
<tb> SEQ <SEP> ID <SEP>? <SEP> 10 <SEP> SEQ <SEP> ID <SEP> N 11 <SEP> SEQ <SEP> ID <SEP> N012
<tb> CRMP-5 <SEP> Meaning <SEP>: <SEP> ctgggagagaggagtggttg <SEP> Anti-sense <SEP>: <SEP> gaagtctcctccctggacct <SEP> Probe <SEP>: <SEP> gttttgtggccgttaccagt <SEP> 62 <SEP > C <SEP> 3 <SEP> mM <SEP> 28
<tb> SEQ <SEP> ID <SEP> N 13 <SEP> SEQ <SEP> ID <SEP> N 14 <SEP> SEQ <SEP> ID <SEP> N 15
<tb> Actinase <SEP> Sense <SEP>: <SEP> ggacttcgagcaagagatgg <SEP> Anti-sense <SEP>: <SEP> acatctgctggaaggtggac <SEP> Probe <SEP>: <SEP> aagtactccgtgtgtggatcgg <SEP> 62 <SEP> C <SEP> 3 <SEP> mM <SEP> 25
<tb> SEQ <SEP> ID <SEP>? <SEP> 16 <SEP> SEQ <SEP> ID <SEP>? <SEP> 17 <SEP> SEQ <SEP> ID <SEP>? <SEP> 18
<tb> G3PDH <SEP> Meaning <SEP>: <SEP> ggctctccagaacatcatcc <SEP> Anti-sense <SEP>: <SEP> ggagattcagtgtggtgg <SEP> Probe <SEP>: <SEP> gacatcaagaaggtggtgaagcag <SEP> 62 <SEP> C <SEP> 3 <SEP> mM <SEP> 23
<tb> SEQ <SEP> ID <SEP> N 19 <SEP> SEQ <SEP> ID <SEP> N020 <SEQ> SEQ <SEP> ID <SEP> N021
<Tb>

<Desc / Clms Page number 17>

Chaque échantillon de PCR contient 10 pLI de RT diluée au 1/10ème et 40 j, t de Mix (5 pI de tampon PCR 1X, 2 ou 3 pI de MgCI2, 4x1 pI de dNTP, 1 loi de chaque amorce (sens et anti-sens), 0, 4 pI de Taq polymérase, qsp 50 ! -LI d'eau distillée. La PCR comprend une première étape de dénaturation de 5 min à 95 C puis un nombre de cycles déterminé pour chaque couple d'amorces (Cf. tableau) (1 min à 95 C, 1 min 15 à 62 C, 1 min 30 à 72 C). La PCR se termine par une étape d'élongation de 15 min à 72 C. les produits de PCR sont stockés à-20 C.

Each PCR sample contains 10 μl of 1: 10 diluted RT and 40 μl of Mix (5 μl of 1X PCR buffer, 2 or 3 μl of MgCl2, 4x1 pI of dNTP, 1 law of each primer (sense and anti -sens), 0.4 μl of Taq polymerase, qs 50 μl of distilled water The PCR comprises a first denaturation step of 5 min at 95 ° C. and then a number of cycles determined for each pair of primers (cf. Table 1) (1 min at 95 ° C., 1 min at 62 ° C., 1 min at 72 ° C.) The PCR is terminated by a step of elongation of 15 min at 72 ° C. The PCR products are stored at 0 ° C. C.

. Visualization of the RT-PCRs: Southern blot: It is carried out after the separation of the amplification products by electrophoresis then transfer on membrane and hybridization with a radiolabelled internal probe. The migration of the different PCR products is done by depositing 10; Of each sample on a 1.5% agarose gel in 0.5% TBE buffer (Tris-Borate-EDTA) containing ethidium bromide (0.5 μg / ml final) and application of 100 V Once migration is complete, the cDNAs are transferred using a semi-dry electrotransfer method on nylon membrane in 0.5X TBE buffer. After transfer (15V-45 min), the DNA is fixed on the membrane with a solution of NaOH (0, 4N-2 min) and then neutralized (SSC 6X-10 min). The internal probe, specific for the PCR-amplified DNA fragment (see table), is radiolabeled at 5 'by a terminal kinase (T4 Kinase) with γ32P-ATP. 2 days ! 1 are incubated for 10 min at 37 ° C. with 5 μl of forward buffer, 1 μl of T4 kinase, 2 μl of γ32P-ATP and 15 μl; J distilled water. The kination is stopped at 4 ° C. The radiolabeled probe is then purified on an exclusion column (Bio-Rad Laboratories) which retains the free nucleotides. The transfer membranes were prehybridized for 30 min at 420 ° C. by incubation in the hybridization medium (6X SSC, 2X Denhardt, 25 mM phosphate buffer, disodium ethylene diamine tetraacetate or 25 mM EDTA, 0.1% SDS, sperm DNA salmon 250 fg / ml) to saturate all non-specific sites. The hybridization is carried out for 30 minutes at 42 ° C. with the probe

<Desc / Clms Page number 18>

 internal. The membranes are then washed at 42 ° C. in medium of increasing stringency: in SSC6X / O, 1% SDS 10 min, SSC 2X / SDS 0.1% 20 min and SSC 0.5X / 0.1% SDS 10 min . Radiolabeled membranes sealed under plastic sheet are then placed in an autoradiography cassette equipped with an amplifier screen. Visualization of radiolabeled cDNA bands is by phosphorimager reading and quantification using computer software (Image Quant).

 3. Immunodetection of CRMP proteins.

 . Anti-Peptide Antibodies: CRMP-specific anti-peptide polyclonal antibodies were prepared after selecting an immunogen located in a non-homologous zone for the other CRMPs and injecting into a rabbit. The specificity of each serum for a given CRMP protein was monitored by Western-blot on recombinant CRMP proteins. The sera of each of these rabbits taken before their immunization (pre-immune sera) are negative in Western blot on the recombinant proteins obtained in formed Ecolitranes or transfected Hela cells and are used as a control. Optimal dilutions for their use in Western blot or immunocytochemistry have been determined beforehand.

 -o Western-blot: This technique consists of the electrophoretic separation of proteins and membrane transfer that allows the visualization of a protein of interest after the binding of a specific antibody revealed by a secondary antibody coupled to peroxidase. The Western blots are made on protein extracts of lysates of immune or nerve cells in culture or freshly isolated. The cells are generally lyzed in a buffer without detergent (20 mM Tris-HCl, 10% sucrose, 1 mM EDTA, 5 mM EGTA and a cocktail of anti-proteases (Complete TM 1X) and sometimes in buffer RIPA (10 mM Tris-HCl pH 7.2, 150 mM NaCl, 1% 100X Triton, 0.1% SDS, 1 mM EDTA, 1% sodium deoxycholate, Complete 1X) Homogenization of the Iysates

<Desc / Clms Page number 19>

cellulaires est ensuite complétée par une sonication à 80Hz. Après un dosage protéique, une solution de 1 ou 2 jg/) J de protéines est conservée à -20oC. L'échantillon de dépôt (40 zu finaux de protéines) est dénaturé par l'addition d'un tampon réducteur (Tris-Hcl 0, 0625 M pH 6, 8, SDS 1%, giycérot 10%, dithiothréitot DTT 0, H\/), bteu de bromophénol) et chauffage (5 min à 95 C). La séparation des protéines est réalisée sur gel d'acrylamide-SDS (10%-0, 1%, respectivement). Après migration sous 100V, les protéines sont électrotransférées sur une membrane de nitrocellulose par transfert discontinu utilisant 3 tampons : Tampon 1 (0, 3M Tris base, 20% Méthanol) ; Tampon 2 (25 mM Tris base, 20% Méthanol) ; Tampon 3 (25 mM Tris base, 40 mM EACA, 20% Méthanol) permettant un meilleur transfert de toutes les protéines, quel que soit leur poids moléculaire. Les membranes sont incubées 5 min dans une solution de Rouge Ponceau-acide trichloroacétique qui permet de fixer et visualiser les protéines. Les membranes sont ensuite saturées pendant 1 h à température ambiante dans une solution de Tampon phosphate (PBS)Tween 20 0, 1% - lait écrémé 5%. L'immunodétection des CRMP avec les sérums polyclonaux de lapin anti-CRMP dilués en PBS-Tween 20 0, 1%lait 1% (CRMP-4 : 1/100 ; CRMP-2 : 1/500 ; CRMP-1 : 1/500 ; CRMP-3 : 1/500 ; CRMP-5 : 1/200) ou pré-immun (1/200) est réalisée à 4 C-une nuit. Les blots sont alors rincés (3x5 min) en PBS-Tween 20 0, 1%-lait 1% puis incubés 1 h avec un anticorps secondaire spécifique des IgG de lapin et couplé à la peroxydase (1/50000e-1h-température ambiante). Après 3 rinçages (5 min) en PBS-Tween 20 0, 1%-lait 1%, le blot est révélé en chambre noire grâce à un kit d'électrochimioluminescence (Covalab) et après impression sur film photographique.

cell is then supplemented with 80Hz sonication. After a protein assay, a solution of 1 or 2 μg / μl of protein is stored at -20 ° C. The deposition sample (40% final protein) is denatured by the addition of a reducing buffer (Tris-HCl 0, 0625 M pH 6, 8, SDS 1%, glycerot 10%, dithiothreitot DTT 0, H \ (b) bromophenol) and heating (5 min at 95 ° C). Protein separation is performed on SDS-acrylamide gel (10% -0.1%, respectively). After migration under 100V, the proteins are electrotransferred on a nitrocellulose membrane by batch transfer using 3 buffers: Buffer 1 (0.3M Tris base, 20% Methanol); Buffer 2 (25 mM Tris base, 20% methanol); Buffer 3 (25 mM Tris Base, 40 mM EACA, 20% Methanol) allowing better transfer of all proteins, regardless of their molecular weight. The membranes are incubated for 5 min in a Ponceau Rouge-trichloroacetic acid solution which makes it possible to fix and visualize the proteins. The membranes are then saturated for 1 hour at room temperature in a solution of phosphate buffer (PBS) Tween 20 0, 1% - skim milk 5%. Immunodetection of CRMP with anti-CRMP rabbit polyclonal sera diluted in PBS-Tween 20 0.1% milk 1% (CRMP-4: 1/100; CRMP-2: 1/500; CRMP-1: 1 / 500, CRMP-3: 1/500, CRMP-5: 1/200) or pre-immun (1/200) is performed at 4 C-one overnight. The blots are then rinsed (3x5 min) in PBS-Tween 20 0, 1% -milk 1% and then incubated for 1 hour with a secondary antibody specific for rabbit IgG and coupled to peroxidase (1 / 50000e-1h-room temperature). . After 3 rinses (5 min) in PBS-Tween 20 0, 1% -lait 1%, the blot is revealed in darkroom thanks to an electrochemiluminescence kit (Covalab) and after printing on photographic film.

In one experiment, the samples were treated with phosphatase for 1 hour at 37 ° C. before being separated on an SDS-acrylamide gel: 2 μl of CIP alkaline phosphatase (Calf intestine phosphatase at 20 units / day) are added to 20 μl of protein sample and at 2 d. tl of buffer allowing the activity of the enzyme.

<Desc / Clms Page number 20>

e Immunocytochimie (ICC) : La détection des CRMP a été réalisée à l'échelle cellulaire par immunocytochimie. Les lymphocytes, cellules non adhérentes, sont étalés par centrifugation (cytospin-600 rpm-5 min) alors que les cellules nerveuses Dev sont cultivées sur des lames de Permanox (Labteck). Une fixation des cellules par l'acétone (-20 C, 5 min) a pour but de fixer les protéines et de perméabiliser les cellules à l'entrée des anticorps réactionnels. Ces conditions ont permis la détection des CRMP 1, 2, 3, 4 et 5. Le blocage des sites non spécifiques se fait avec une solution de BSA 0, 1% (30 minutes à température ambiante). Un premier contact des cellules fixées sur lames est effectué avec l'anticorps primaire (anti-CRMP produits chez le lapin dilués en PBS pH 7, 4) (1h-37 C en chambre humide). Après 3 lavages en tampon phosphate (PBS pH 7, 4, 5 min), l'anticorps secondaire spécifique des IgG de lapin est mis en contact (1h-température ambiante) et rincé 3 fois en PBS 5 min. La contrecoloration des noyaux se fait ensuite par une incubation en solution de Dapi (intercalant nucléique-0, 025 jug/mi-lmin). Les) ames sont montées en glycérol tamponné pH 7, 4. Les résultats de ces analyses sont représentés en sur les figures 2-8.

e Immunocytochemistry (ICC): The detection of CRMP was performed at the cellular level by immunocytochemistry. Lymphocytes, non-adherent cells, are spread by centrifugation (cytospin-600 rpm-5 min) whereas Dev nerve cells are cultured on Permanox slides (Labteck). Acetone fixation of the cells (-20 C, 5 min) is intended to fix the proteins and to permeabilize the cells at the entry of the reaction antibodies. These conditions allowed the detection of CRMP 1, 2, 3, 4 and 5. The blocking of nonspecific sites is done with a solution of BSA 0, 1% (30 minutes at room temperature). A first contact of the cells fixed on slides is carried out with the primary antibody (anti-CRMP produced in the rabbit diluted in PBS pH 7.4) (1h-37 C in a humid chamber). After 3 washes in phosphate buffer (PBS pH 7.4.4 min), the rabbit IgG specific secondary antibody is contacted (1 hr-room temperature) and rinsed 3 times in PBS for 5 min. The counterstaining of the nuclei is then done by incubation in Dapi solution (nucleic intercalator-0.025 μg / ml-1min). The amines are mounted in buffered glycerol pH 7.4. The results of these analyzes are shown in FIGS. 2-8.

EXAMPLE 1 Evaluation of the Expression of CRMPs 1, 2 and 4 in Lymphocytes and Mononuclear Cells, Controls or Derived from Patients with Dysimmune Pathologies e mRNA (relative to GAPDH) A first evaluation is performed by titrating the corresponding mRNAs. The results are presented in detail in Figure 1 and summarized in Table 1 below.

Comparative profile, considering all the samples for the same CRMP:

<Desc / Clms Page number 21>

TABLE 1

<Tb>
<tb> CRMP2 <SEP> CRMP4 <SEP> CRMPI
<tb> Lines <SEP> T <SEP> control <SEP> + <SEP> 0 <SEP> 0
<tb> Lymphocytes <SEP> T / HTLV-1 ++ <SEP> +++ <SEP> +++
<tb> Lympho. <SEP> patients <SEP>"eontrol"<SEP> + <SEP> 0 <SEP> +
<tb> Lympho. <SEP> patients <SEP> challenges. <SEP> Apopt. <SEP> 0 <SEP> + / ++
<tb> Patients <SEP> HIV <SEP> ++ <SEP> ++ <SEP> ++
<Tb>

L'analyse précédente est complétée par détection des protéines CRMP1, 2 et 4 dans des lymphocytes T et des cellules nerveuses par Western Biot sur Iysat cellulaire (Dev : cellules nerveuses ; Jurkat : lignée Iymphocytaire T) en tampon non détergent et en utilisant les anticorps polyclonaux antipeptide spécifiques de chaque CRMP.

The previous analysis is completed by detection of CRMP1, 2 and 4 proteins in T cells and nerve cells by Western Biot on cellular lysate (Dev: nerve cells, Jurkat: T lymphocyte line) in non-detergent buffer and using antibodies. polyclonal antipeptide specific to each CRMP.

The results are shown in Figure 2.

It is noted that anti CRMP-1, -2 and -4 detect several isoforms shared by T cells and nerve cells.

EXAMPLE 2 Immunocytochemical Detection of the Subcellular Location of the CRMP2 Protein in Blood Mononuclear Cells (PBLs) of Patients Controlled or Infected with HTLV-1 or with Fas-Fas-Linked or HIV-Infected Immune Deficiency.

The anti-CRMP-2 antibody was previously prepared and isolated according to the protocol described in point 3 of the preamble materials and method.

The results are illustrated in Figure 3.

It is noted that: - the localization of CRMP-2 is essentially cytoplasmic in lymphocytes (PBL) isolated from a control subject or an HIV-1 infected subject; it can also be nuclear in lymphocytes isolated from patients infected with HTLV-1 or in the PBLs of a dysimmun patient (Fas deficiency);

<Desc / Clms Page number 22>

 CRMP-2 is more expressed in the lymphocytes of the patients compared to those of the control subject grown in IL2, thus preactivated.

 By examination after immunodetection of CRMP-2 and countercoloration by intercalating DNA Dapi, it is noted that the expression is predominantly nuclear in T lymphocytes chronically infected with HTLV-1 and hyperproliferative. As for the examination of the immunodetection of CRMP-2 in confocal microscopy, it reveals a very weak nuclear presence in the control and majority T lymphocytes in T lymphocytes chronically infected with HTLV-1 (FIG. 4).

 In conclusion, the expression of CRMP2 is increased in the nuclei of proliferative lymphocytes. In contrast, in patients infected with HIV, CRMP2 remains cytoplasmic. In dysimmune patients (Fas deficient), the localization is nuclear in some cells. Figures 3 and 4 show the results obtained.

 Similarly, the nuclear presence of a protein recognized by this same antibody was verified in hyperproliferative T lymphocytes by Western blotting on nuclei enriched cell fractionations.

EXAMPLE 3
Immunohistochemical characterization of the expression of CRMP5 and CRMP2 proteins at the level of the thymus.

 Proteins were characterized using their respective antibodies.

 The cells analyzed are normal fetal human thymus cells and in a thymoma in an adult patient.

 As a control, the same immunohistochemistry was performed on human thymus of a 6 weeks old embryo. The thymus is frozen and cut with cryostat (15 sum). The sections are fixed for 15 minutes in acetone. Immunohistochemistry is performed under the same conditions as on the brain.

<Desc / Clms Page number 23>

 This analysis reveals an expression of CRMP2 and CRMP5 in normal thymic epithelial cells at the embryonic stage.

The expression disappears in the normal adult and can be induced in the case of tumoral pathology (thymoma).

EXAMPLE 4
Characterization of the interaction between bovine protein PrP and human CRMP5.

 The interaction between bovine protein PrP and human CRMP5 has been characterized by double-hybrid conjugate assays.

The cDNAs encoding these two proteins (complete or different derived forms) were cloned into a "bait" vector and a "prey" vector. The pEG202 bait vector (Gyuris et al., 1993, Cell 75, 791-803), has the gene encoding the HIS3 tag, an origin of replication, and directs the expression of fused proteins to the binding domain. DNA of the LexA protein (1-202), under the control of the constitutive promoter ADHp. With regard to the prey vector, pJG 4-5 (US 5,580,736), it comprises the gene encoding the TRP1 marker, a 2 micron origin of replication and directs the expression of fused proteins to a nuclear localization sequence (NLS), B42 transcriptional activator domain and HA epitope, under the control of the GALp inducible promoter. For convenience, the NLS-B42-HA merge is here referred to as "Act".

EGY42 strain (MAT) (Golemis et al., 1992, Mol Cell Biol 12, 3006-3014) was co-transformed with the plasmid vector pSH18-34 (US 5,695,941) comprising the URA3 marker gene and eight LexA operators placed upstream of the reporter gene lace and different bait vectors directing the expression of LexA, LexA-PrP, LexA-PrPm (mutations on PrP still to be determined), LexA-PrPtr (PrP truncation still to be determined), LexA-MAX (Negative Control) and LexA-CRMP5.

<Desc / Clms Page number 24>

 Strain EGY48 (MAT a) was transformed with different prey vectors directing the expression of Act, Act-PrP, Act-BaxATM (negative control) and Act-CRMP5.

 These different strains were conjugated to create an interaction matrix.

 This matrix was replicated on indicator medium (mura ', His-, Trip-, Galactose / X-gal) allowing to express the baits and the preys, to select the diploid exconjugants and to reveal the interaction phenotypes (blue color revealing β-galactosidase activity observed when lac reporter gene is transcribed).

 Figure 7 reports the results obtained.

PrP : protéine PrP bovine (AA 22-237), PrPm : protéine PrP bovine (AA 22-237) contenant diverses mutations restant à déterminer, PrPtr : protéine PrP bovine (AA-22- ?), tronquée vers le milieu de sa séquence (la position du codon stop reste à déterminer),
MAX : contrôle négatif d'interaction
CRMP 5 : protéine CRMP 5 humaine complète. The constructs tested are as follows:

PrP: bovine PrP protein (AA 22-237), PrPm: bovine PrP protein (AA 22-237) containing various mutations yet to be determined, PrPtr: bovine PrP protein (AA-22-?), Truncated towards the middle of its sequence (the position of the stop codon remains to be determined),
MAX: negative interaction control
CRMP 5: complete human CRMP 5 protein.

 BAXATM: Negative control of interaction.

 The interaction between the PrP proteins (different constructs detailed below) and the CRMP5 protein is detected when the PrP proteins are expressed as baits and the CRMP5 protein is expressed as prey. LexA-CRMP5 and Act-Prp do not give an interaction phenotype. Negative controls (LexA-MAX and Act-BaxATM as well as LexA and Act) give no phenotype of interaction with PrP and CRMP proteins. The homodimerization of CRMP5 provides the positive interaction control of this matrix.

Claims (8)

1. Use of at least one protein of the CRMP family, polypeptide fragment or biologically active derivative thereof, a nucleotide sequence or fragment encoding said protein, an antisense sequence capable of specifically hybridizing with a nucleotide sequence coding for said protein or an antibody directed against said protein, for the manufacture of a medicament for the treatment of pathologies related to a dysfunction of the immune system.  2. Use according to claim 1, characterized in that the pathology is selected from autoimmune diseases, T leukemias and lymphomas, neuroinflammatory lesions associated with infection with the retrovirus HTLV-1, tropical spastic paraparesis. , neurosida, herpes-like diseases, measles, Epstein-Barr virus and prion diseases; dysimmune disorders related to the Fas and Fasl mutation; and neuroinflammatory disorders associated with activation of T lymphocytes.  3. Use according to claim 1 or 2, characterized in that the CRMP protein is selected from CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5 proteins.  4. Use according to claim 1 or 2 of an isolated nucleic acid sequence encoding one of the CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5 proteins, or nucleotide fragments or sequences derived from one of the sequences, due to the degeneracy of the genetic code or the fact of mutation, deletion, or insertion of at least one nucleotide, with said derived sequences coding for a protein <Desc / Clms Page number 26>  having a biological activity substantially identical to the CRMP protein under consideration.  5. Use according to claim 1 or 2 of an antisense sequence capable of hybridizing with a nucleic acid sequence encoding a protein selected from CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5 proteins.  6. Use according to claim 1 or 2 of monoclonal or polyclonal antibodies or their fragments, chimeric or immunoconjugate antibodies obtained from a CRMPs chosen from CRMP1, CRMP2, CRMP3, CRMP4 and CRMP5 proteins, biologically derived or polypeptide fragments. assets of CRMPs.  7. Method for the prognosis and / or diagnosis of autoimmune diseases, neuro-inflammatory diseases associated with a viral infection, prion diseases, lymphomas and / or adult T-leukemia, characterized in that one in lymphocytes taken from an individual, the presence of at least one CRMP protein whose expression, sequence or location is modified relative to healthy control lymphocytes.  8. Method for detecting, identifying and / or assaying a biological partner of a CRMP protein in a biological extract of "patients suffering from autoimmune diseases, neuroinflammatory diseases, lymphomas or T. leukemias", characterized in that it is used as a diagnostic tool at least one CRMP protein.