FR2810049A1 - Detecting and quantifying minority viral mutants, especially of human immune deficiency virus resistant to protease inhibitors, by real-time amplification - Google Patents

Abstract

Detection and/or quantification of minority variants, having at least one mutation, in a heterogeneous population of viruses, present in a biological sample. Detection and/or quantification of minority variants, having at least one mutation, in a heterogeneous population of viruses, present in a biological sample. Nucleic acids (I) are extracted from the sample and amplified by polymerase chain reaction (PCR), using primers that flank a viral sequence (Ia) suspected of carrying a mutation. Separately a standard amplicon is prepared similarly, from a sequence known to carry the mutation. Both amplicons are then subjected to real-time PCR using: (i) a pair of highly conserved primers that do not differentiate between mutated and non-mutated sequences, then quantifying the number of viral (I), mutated or not, present in the sample; and (ii) a pair of primers that are mutation specific, and quantifying the number of mutant sequences in the sample. Comparison of the results of (i) and (ii) gives the proportion of mutant viruses in the population. Independent claims are also included for the following: (1) pairs of primers (a) and (b); (c) and (d); (d) and (e), and (d) and (f) (a) CTTTAGCTTCCCTCAGATCACTC; (b) CCTGGCTTTAATTTTACTGGTACA; (c) GGTACAGTATTAGTAGGACCTACA; (d) TGGTACAGTTTCAATAGGACTAAT; (e) TATTAGTAGGACCTACACCAGC; and (f) AACATAATTGGAAGAAATCAGA ; (2) the probe (g) CTCAGATTGGTTGCACTTTAAATTTTCC; and (3) kit for the process comprising primer pairs for the three amplifications; a probe that has conjugated to its 5' and 3'-ends, respectively, a fluorescent reporter and a fluorescence quencher, specific for the amplicons; standard (mutated) nucleic acid; products and reagents for performing PCR amplifications.

Description

 METHOD FOR DETECTING AND / OR QUANTIFYING MINORITY VARIANTS WITHIN A VIRAL HETEROGENEOUS POPULATION IN A BIOLOGICAL SAMPLE. The present invention relates to a method for detecting and / or quantifying minority variants within a heterogeneous viral population in biological samples. The present invention is more particularly applicable to the detection and / or quantification of minor variants of the human immunodeficiency virus (HIV).

In HIV-infected patients, the virus is represented by a heterogeneous population of genetically distinct viral variants. During antiretroviral therapy, if viral replication can not be completely suppressed, the selection of resistant viral variants is observed. These variants carry mutations in the reverse transcriptase and / or protease which are the main targets of antiretroviral treatments. During the escape of the virus from these treatments the emergence of viral resistance is a gradual process in which mutations accumulate gradually, which is accompanied by a growing level of resistance.

These minority variants may play a significant role in the evolution of resistance during treatment or as a result of treatment changes. Indeed, it is suspected that the resistant mutants that emerge at the very beginning of the failure of antiretroviral therapy represent only a very small minority of the viral population. These minority viruses are probably not detectable at this stage, but form the basis for the subsequent selection of highly resistant viruses. When resistant viruses begin to be detected by conventional genotypic tests, highly resistant viruses are already ready to emerge.

In addition, when antiretroviral treatment has to be changed, the relay treatment is chosen according to the viral genotype. The presence of minority viruses carrying mutations absent from the majority viruses could contribute to the subsequent failure of relay processing.

Finally, when a failed antiretroviral treatment is interrupted, the resistant plasma virus is more or less quickly replaced by a wild-type susceptible virus. In many patients, this replacement often seems incomplete, since the reintroduction of the treatment results in the rapid re-emergence of the resistant virus. This failure seems to be a consequence of weak minorities of residual resistant virus, persisting for a long time after the therapeutic interruption.

The dynamics of the evolution of HIV resistance have not yet been thoroughly examined. One reason for this lack of information is the lack of technical means capable of accurately and quantitatively analyzing minority viral subpopulations, rare or limited to specific compartments of organisms.

Classical genotypic tests (sequencing) after reverse transcription and polymerase chain reaction (PCR) can detect the presence of specific mutations, but depending on the mutation studied, the mutated sequences must represent 10 to 50% of the total population to be detected. (Günthard et al., 1998, AIDS Res, Hum Retroviruses, Vol 14, pp 869-76) and the procedure is not strictly quantitative. In addition, the need to sequence hundreds or thousands of clones to achieve even modest sensitivity makes this approach impractical.

The selective PCR technique using nucleotide primers specific for mutated and wild sequences was used to identify the presence of resistance mutations rather than to quantify them. Although superior to sequencing techniques, current selective PCR techniques have certain limitations. For a given resistance mutation, mutated and wild sequences differ in most cases by a single base pair. Even when this mismatch is placed in the most destabilizing position that is to say at the 3 'end the specific primer, the primer recognizing the mutated sequence also allows, with reduced efficiency, amplification of the wild-type sequence. (Huang et al., 1992 Nucleic Acids Res., Vol 20, pp. 4567-73, Kwok et al., 1990, Nucleic Acids Res., Vol. 999-1005). In fact, it is necessary to dilute the samples or decrease the number of amplification cycles to a level where non-specific signals from the unwanted sequence are no longer detectable after the, which limits the sensitivity of the test. An improvement in discrimination between wild-type mutated sequences has been achieved by introduction of additional mismatch (s) into the 3 'end of the primer (Anderson et al., 1994, Antiviral. 25, pp. 245-58, Larder et al., 1991, AIDS, vol 5, pp. 137-44, De Milito et al., 1995, Mol Biotechnol., vol. 3, pp 166-9, Cha et al., 1992, PCR Methods Appl., Vol 2, p 14-20), but the effect of additional mismatches has not been evaluated in detail. In addition, in the tests currently described, the PCR reactions have already reached the plateau phase of the reaction when the amplification products are detected by electrophoresis or hybridization. Under these conditions, a given sample can be identified as having a wild-type, mutant or mixed profile, but the quantification of the number of mutated sequences originally present is not possible.

Recently, there has been described in US Pat. No. 5,827,648 a method for measuring the relative populations of two variants of the target nucleotide sequence. This method is more particularly applicable to HIV variants and is based on a differential hybridization method. The sensitivity of this method remains moderate. Thus, no test allowing precise quantification of mutated sequences in the presence of an excess of wild sequences is currently available.

The present invention specifically relates to a novel method for detecting and / or quantifying viruses carrying at least one mutation, for example antiviral resistance in a heterogeneous viral population contained in a biological sample. The method of the invention makes it possible in particular to detect the presence of minority variants representing less than 1 the viral population.

This object is achieved according to the invention by means of a minority variant detection and / or quantification method carrying at least one mutation within a heterogeneous population of viruses contained in a biological sample, characterized in that it comprises the steps following.

a) extraction of the nucleic acids contained in the biological sample; b) amplification by PCR of the nucleic acids of step (a) with a pair of primers flanking a viral nucleic acid sequence likely to carry the mutation, c) the preparation of a standard by PCR amplification with the same pair of primers as in step (b) of a nucleic acid sequence carrying the mutation, d) the amplification by PCR in time real amplification products of step (b) and the standard of step (c) with a pair of highly conserved primers not discriminating sequences with or without the mutation and the quantification of the number of acid sequences whether or not the viral nuclei carry the mutation present in the sample, e) the amplification by real-time PCR amplification products of step (b) and the standard of step (c) with a pair of primers specific to a sequence carrying the mutation, and quantification the number of viral nucleic acid sequences carrying the mutation present in the sample, f) comparing the quantifications of steps (d) and (e) to determine the proportion of mutating viruses in the sample.

By PCR amplification is meant both actual polymerase chain reaction (PCR) and the amplification techniques derived therefrom.

The nucleic acid extraction step (a) may be carried out by conventional techniques from a biological sample taken from a patient infected with the virus of interest. Sample preparation methods for molecular biology assays are well known to those skilled in the art. All types of biological samples that may contain viral populations such as cells, tissues, biological secretions or body fluids can be used for the method that is the subject of the invention. The biological samples according to the invention are advantageously plasma.

The method of the invention applies to all virus families. In the case of RNA viruses, such as HIV or hepatitis C virus, step (b) is RT PCR in the presence of a pair of primers flanking nucleic acid sequence capable of carrying the mutation.

Step (b) of the invention is a nucleic acid PCR amplification of the step with a pair of primers flanking a viral nucleic acid sequence capable of carrying the mutation. The pair of primers flanking a viral nucleic acid sequence capable of carrying the mutation is chosen so as to amplify with the same efficiency the sequences which carry the mutation and those which do not. The pair of primers used in step (d) is also chosen so as to amplify with the same efficiency the sequences which carry or do not have the mutation.

The standard prepared in step (c) of the method of the invention corresponds to the amplification products of a sequence carrying the mutation studied, obtained with the same primers for step (b) of the method of the invention. invention. The sequence carrying the mutation studied and used to make standard may be a nucleic acid sequence of a virus carrying the mutation a nucleic acid sequence of a wild-type virus in which the mutation has been introduced by site-directed mutagenesis or may be carried out by any technique known to those skilled in the art which makes it possible to obtain a sequence capable of amplifying with the same primers as for step (b) a product having the same characteristics (identical sequence and length) as the acid sequence a virus carrying the mutation studied.

The real-time PCR amplification implemented in steps (d) and (e) of the method of the invention is a recent technique which allows the rapid and precise quantification of DNA or cDNA (Heid <I> and al., 1996, Genome Res., Vol 6, pp. 986-94, Gibson et al., 1996, Genome Res., vol 6, pp 995-1001). In this technique, PCR amplification reactions are performed in the presence of a conjugate probe at its 5 'and 3' ends, respectively, with a reporter fluorescent dye and a fluorescence intensity reduction compound. Advantageously, the reporter fluorescent dye and the fluorescence intensity reduction compound at the ends of the probe are respectively 6-carboxy-fluorescein (FAM) and 6-carboxy-tetramethylrhodamine (TAMRA). The probe used is specific for a sequence present both in the amplification products of steps (d) and (e). Thus, the probe sequence is chosen to be complementary to an amplified region in steps (d) and (e) which does not include the mutation.

During the PCR reactions of steps (d) and (e) of the method object of the invention, amplification products accumulate and bind with the probe. The 5'-3 'exonuclease activity of the polymerase degrades the fluorogenic probe and separates the fluorescence intensity reducing compound and the fluorescent dye resulting in the emission of a fluorescent signal. The emitted fluorescence is measured continuously and the number of amplification cycles necessary for the fluorescence to exceed a given threshold (threshold cycle or Cs) is determined in steps (d) and (e) of the method of the invention.

Quantification of the total number of viral nucleic acid sequences (with or without the mutation) in the sample of step (d) and that of the number of mutated nucleic acid sequences present in the sample of step (e) are performed by comparing Cs with a Cs standard curve obtained with dilutions of the standard subjected to amplifications under the conditions of steps (d) and (e).

The method according to the invention is based on the ability to preferentially amplify sequences comprising a specific mutation. Thus, in step (e) of the method of the invention, it is necessary to use a pair of primers, one of which is complementary to the sequence having the mutation and thus has a mismatch with the non-mutated sequence. Since not all mismatches are equivalent, this mismatch may not prevent amplification of the non-mutated (wild-type) sequence, which may result in nonspecific signals.

The inventors have studied this phenomenon in the context of the invention, and compared several sense primers coupled with the same antisense primer. As already described, the anointing of one or more additional mismatches close to the 3 'end of the primer substantially improves the discrimination (Anderson et al., 1994, Antiviral Res. Vol 25, pp. 245-58, Larder et al., 1991, AIDS, vol 5, pp. 137-44, De Milito et al., 5, Mol Biotechnol., vol 3, pp. 166-9; and <I> al., </ I> 1992, PCR Methods Appl., Vol 2, pages 14-20).

In order to limit the risk of non-specific signals, and thus to achieve a selective amplification of the mutated sequence, the method of the invention comprises in step (e) the implementation of a specific sense primer. of the mutated sequence having at least one or two additional mismatches other than the mutation of interest.

The inventors obtained an optimal discrimination, without reducing the amplification efficiency of the mutated sequences, using in step (e) a specific sense primer of the mutated sequence presenting a moderately destabilizing mismatch, other than the mutation, in position. -2 with respect to the end 3 of the sense primer. The notion of moderately destabilizing mismatch has been described by Huang et al. (1992, Nucleic Acids Res., Vol 20, pp. 4567-73) and by Kwok et al. (1990, Nucleic Acids Res., Vol 18, pages 999-1005).

Bearing sequences or the mutation to be studied may exhibit some genetic variability, for example presence of other mutations or polymorphism. The inventors have therefore identified the conditions of the real-time PCRs of steps (d) and (e) to. use so that the quantification of sequences with a mutation is not distorted by a possible polymorphism in the medium and the 5 'end of the primers. Thus, according to the method of the invention, the real-time PCRs of steps (d) and (e) are carried out in the presence of 3 to 5 mM of MgCl 2, with more than 100 mM of each of the dNTPs, advantageously 200 mM of each of the dNTPs and at a temperature equivalent to the Tm of the primers used.

In a preferred embodiment of the method of the invention, additional control to determine the sensitivity limit of the method is used. This control corresponds to a standard identical to that prepared in step (c) but not presenting the mutation to be studied. This control is amplified by real-time PCR according to the PCR conditions of method steps (d) and (e).

The work carried out in the context of the present invention has particularly concerned the application of the method according to the invention to the detection and / or quantification of minority variants of HIV carrying at least one resistance mutation within a population. heterogeneous virus contained in a biological sample. Advantageously, the method of the invention makes it possible to detect and / or quantify minority variants of HIV carrying at least one resistance mutation in the protease sequence within a heterogeneous viral population contained in a biological sample. More specifically, the method of the invention makes it possible to detect and / or quantify minority variants of HIV carrying the V82A or L90M resistance mutation in the protease sequence in a heterogeneous viral population contained in a biological sample.

The invention thus relates especially to the previously described method applied to the detection and / or quantification of minority variants of HIV carrying one of the least V82A or L90M resistance mutations in the protease sequence, within a heterogeneous viral population contained in a biological sample.

Preferred embodiment of this method application of the invention is characterized in that it comprises the following steps: a) the extraction of the RNAs contained in the biological sample, b) the amplification by RT PCR of the RNA of step (a) with a primer pair flanking a viral nucleic acid sequence capable of carrying the V82A or L90M mutation, this primer pair being SEQ ID No.1 and SEQ ID No.2 in the c) the preparation of a standard by PCR amplification with the same pair of primers as in step (b) of a nucleic acid sequence carrying the mutation V82A or L90M, d ) the real-time PCR amplification of the amplification products of step (b) and the standard of step (c) with a pair of highly conserved primers that do not discriminate sequences with or without the V82A mutation or L90M "this pair of primers being SEQ ID No.3 and SEQ ID No.4 in the seq list. uences, and quantification of the number of viral nucleic acid sequences with or without the V82A or L90M mutation present in the sample, e) the real-time PCR amplification of the amplification products of step (b) and the standard of step (c) with a pair of primers specific for a sequence carrying the V82A or L90M mutation, and quantifying the number of viral nucleic acid sequences carrying the V82A or L90M mutation present in the sample, f) comparing the quantifications of steps (d) and (e) to determine the proportion of virus carrying the V82A or L90M mutation in the sample.

The method step (e) for detecting and / or quantifying minority variants of HIV carrying the V82A resistance mutation in the protease sequence within a heterogeneous viral population contained in a biological sample is advantageously carried out with the pair. of primers referenced as ID No.4 and SEQ ID No.6 in the attached sequence listing.

Step (e) of the method for detecting and / or quantifying minority variants of HIV carrying the L90M resistance mutation in the protease sequence within a heterogeneous viral population contained in a biological sample is advantageously carried out with the pair of primers referenced as SEQ ID No.4 and SEQ ID No.7 in the attached sequence listing.

The invention also relates to the primer pairs used in the various steps of the method for detecting and / or quantifying minority variants of HIV carrying at least one of the V82A or L90M resistance mutations in the protease sequence, at the within a heterogeneous viral population contained in a biological sample.

The invention relates to a re primers capable of being implemented in step (b) of the sequence method SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing in the appendix.

The invention also relates to a pair of primers that can be implemented in step (d) of the method and sequence SEQ ID No. 3 and SEQ ID No. 4 in the attached sequence listing.

The invention applies to a pair of primers that can be implemented in step (e) of the method and of sequence SEQ ID No.4 and SEQ ID No. 6 or sequence SEQ ID No. 4 and SEQ ID No. 7 in the attached sequence listing.

The invention also relates to a probe that can be implemented in steps (d) and (e) of the method and sequence SEQ ID No. 5 in the attached sequence listing.

The method of the invention therefore has many applications as of course - the study of the dynamics of the emergence of mutations in viral populations, for example, during antiviral treatments, - the evolution of mutated virus populations during pharmaceutical interruptions, - more precise assessment of the response or failure of antiviral treatments leading to more effective therapeutic decisions. The invention also relates to a kit for implementing the method of the invention. Such a kit characterized in that it comprises the following reagents - a pair of primers flanking the segment likely to carry a mutation, - a pair of highly conserved primers not discriminating the mutated and non-mutated sequences, - a pair of specific primers of the mutated sequences; a conjugate probe at its 5 'and 3' ends, respectively, with a reporter fluorescent dye and a fluorescence intensity reduction compound, specific for the amplification products of steps (c) and (d); ) of the method according to the invention, - a nucleic acid sequence bearing mutation for the preparation of a standard by PCR amplification with the pair of primers surrounding the segment likely to carry a mutation, - the products and reagents necessary for perform the different amplifications by PCR.

The invention provides a kit for the detection and / or quantification of minority variants of the V82A or L90M antiretroviral resistance mutation in the protease sequence that comprises the following reagents - the primer pair surrounding the segment likely to carry a mutation of sequence SEQ ID No. 1 and SEQ ID No. 2 in the list of sequences in the appendix, the pair of highly conserved primers not discriminating the mutated and non-mutated sequences of sequence SEQ ID No.3 and SEQ ID No. 4 in the attached sequence listing, - the pair of sequence-specific primers carrying the V82A mutation of sequence SEQ ID No.4 and SEQ ID No.6 in the attached sequence listing and the pair of primers specific for sequences carrying an L90M mutation of sequence SEQ ID No.4 and SEQ ID No.7 in the list of accompanying sequences, the probe conjugated at its 5 'and 3' ends, respectively, with a fluorescent dye reporter and a fluorescence intensity reduction compound of sequence SEQ ID No. 5 in the attached sequence listing.

Other advantages and characteristics of the invention will become apparent from the following examples which refer to the following figures - FIG. 1 shows the sequence-selective PCR quantification of the viral populations expressing the L90M resistance mutation. RNA is extracted from clinical samples and RNAs corresponding to the protease gene were amplified by RT-PCR. The amplification products were diluted and the amount of DNA present was quantified by real-time PCR performed using the pair of F3 / R1 non-sequence selective primers of sequence SEQ ID No.3 and SEQ ID No. 4 in the sequence listing in appendix (A). For all samples, the amount of DNA present is determined by a standard curve obtained from dilutions of DNA from the amplification of a plasmid containing the pNL4-3 protease sequence in which the L90M mutation was introduced by directed mutation 0). The same amount of cDNA is amplified in parallel reactions using a pair of M2-L90M / R1 selective-sequence primers of sequence SEQ ID No.4 and SEQ ID No.7 in the attached sequence listing (B). . Samples obtained from untreated patients (#) are superimposed with the curve obtained with standard DNA containing the wild-type sequence ([:] -n), whereas samples obtained from patients failing therapeutic treatment whose genotyping has shown that they have viruses expressing multiple resistance mutations among which L90M (#) correspond to the curve obtained with standard DNA containing the L90M mutation (0-0). Samples containing 41% of mutated <B> (1) </ B> sequences or 3% of <B> (Y) mutated sequences </ B> as shown by analysis of clones derived from parallel PCR reactions yielded results intermediates close to the predicted values (broken lines). It should be noted that samples containing less than 0.1% of mutated sequences can be distinguished from samples containing only wild-type viruses.

FIG. 2 shows the kinetics of conversion of mutated viruses into wild viruses following structured treatment interruptions. The plasma comes from 5 different patients at the indicated times before and after the IT the percentage of viral sequences expressing the V82A (#) and L90M resistance mutations is determined by sequence-selective. The values in the shaded area (U) are below the detection limit (<1 for V82A and <0.05% for L90M). Plasma viral load (O) is determined by Monitor (Roche). By standard genotyping, all patients have the V82A mutation and patients 1, 4 and 5 have L90M mutation before IT. The V82A and L90M mutations are undetectable by standard genotyping at 3, 4, 2 and 2 months respectively for patients 1, 2, 3 and 5. The arrows indicate when antiretroviral therapy is resumed.

I. <U> Materials and Methods </ U>. I-1. <U> Patients </ U>.

Peripheral blood was obtained from HIV-infected patients before and following the interruption of any antiretroviral therapy and plasma was kept at -80 C. All patients gave their consent before following the IT. I-2. <U> Preparation of </ U> the <U> Viral </ U> cDNA.

The plasma (0.5 to 1 ml) was centrifuged at 23,500xg for one hour at 4 ° C and the RNA was extracted from the pellet and eluted in 60 μl of water. Fifteen μl of RNA were used for RT-PCR (Titan One Tube RT-PCR kit, Boehringer Mannheim) according to the supplier's instructions and using at the final concentration of 0.4 μM primers ProtF1 (5'-CTTTAGCTTCCCTCAGATCACTC). ) and ProtR1 (5'-CCTGGCTTTAATTTTACTGGTACA) respectively SEQ ID No.1 and SEQ ID No.2 in the attached sequence listing. The conditions of the RT-PCR are as follows: denaturation at 94 ° C. for 30 sec, hybridization at 52 ° C. for 30 sec, extension at 68 ° C. for 45 sec; 40 cycles.

I-3. <U> Quantification of viral populations </ U> <U> containing resistance mutations using </ U> PCR <U> in </ U> <U> real time </ U>.

Resistance mutations V82A (GTC -> GCC) and L90M (TTG <B> ---> </ B> ATG) were introduced into the plasmid pNL4-3 site-directed mutagenesis as already described as Small and <I> a1. / I>

(1999, J. Virol., Vol.73, pages 5079-88) and verified by sequencing. The plasmid DNA of the wild-type plasmids, V82A and L90M was then amplified by PCR using the ProtF1 / ProtR1 primer pair. The products of this amplification have been used as standard, to ensure that the samples (viral cDNA) and the standards used for the real-time are in the same form.

To quantify the proportion of sequences expressing the V82A mutation, the products obtained by RT-PCR were diluted in 10 mM Tris buffer at pH 7.4 containing 0.1 mM EDTA and sperm DNA. of herring at 100 ng / ml (Sigma) (usually 10-4 -10-6) and 10 u1 aliquots were added to PCR reactions allowing nonselective amplification of all viral sequences or preferential amplification sequences containing the V82A mutation. For non-selective amplification, the reaction conditions are, in a total volume of 50 μl, 1 × Taqman buffer, 3 mM MgCl 2, each 200 nM dNTP, each nM F3 primer (5'-GGTACAGTATTAGTAGGACCTACA) and R1. (5'-TGGTACAGTTTCAATAGGACTAAT), the TaqMan probe has 50 nM [5 '- (6-Fam) CTCAGATTGGTTGCACTTTAAATTTTCC (Tamra) (phosphate)], the uracil-n-glycosylase at 0.5U and the Taq polymerase AmpliTaq Gold at 1 The primers F3, R1 and TaqMan probe correspond respectively to the sequences SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5 in the attached sequence listing. For preferential amplification of V82A, the conditions are identical except for primer F3 replaced by primer M2-V82A (5'-TATTAGTAGGACCTACACCAGC, SEQ ID No.6 in the attached sequence listing). The material reagents provided by Perkin-Elmer, the oligonucleotides were synthesized by Genset. The samples were evaluated in real time (Heid <I> and a1., </ I> 1996, Genome Res., Vol 6, pp. 986-94, Gibson et al., 1996, Genome., Vol. pages -1001) using the Perkin-Elmer 7700 Sequence Detection System (PE Applied Biosystems) using the following cycle parameters: 50 C x 2 min; 95 C x 10 min; followed by 40 cycles at 95 C x sec and 50 C x 1 min. The number of cycles necessary to reach the threshold fluorescence (Cs) is determined and the amount of sequences initially present is calculated by extrapolation to the standard curve. The same standard dilutions (amplification products produced via plasmid V82A) are used for both non-selective and selective amplification of V82A. The percentage of viral sequences is calculated according to the formula:% mutated sequences [amount of mutated sequences in the sample] / (total amount of sequences in the sample)] x 100. To quantify the proportion of sequences expressing the mutation L90M, analogous techniques are used, except the M2-V82A primer replaced by the M2-L90M primer (5'-AACATAATTGGAAGAAATCAGA, SEQ ID No. 7 in the attached sequence listing). Dilutions of the amplification products generated from plasmid L90M are used to make standard curve.

Non-selective and selective amplifications are always performed at the same time. All reactions are performed in duplicate and the average of the two values is used for the calculations. Although the reactions carried out using the M2-V82A and M2-L90M primers amplify sequences containing the corresponding mutations more efficiently than the wild-type sequences, amplification products resulting from the amplification of the wild-type sequences are generated. When samples containing only wild-type sequences are analyzed as described above, the results indicate the apparent presence of 0.6, 2% (DS average, n = 10) of mutated sequences using the V82A system and 0.01 0.02% (DS average, n = 10) mutated sequences using the L90M system. Based on these results, the sensitivity limit was defined as the + 2 DS average of these values, ie 1% for V82A and 0.05% for L90M.

I-4. <U> evaluation of cloned </ U> PCR </ U> products </ U>.

To validate the results obtained by selective-sequence PCR using an independent technique and to evaluate the genotype of the minority viral populations expressing the V82A and OM mutations, aliquots of the initial RT-PCR reactions are amplified using the F4 primers (5'- CTCAGATCACTCTTTGGCA, SEQ ID No.8 in the attached sequence listing) and R1, and the products are cloned into pCR4-TOPO (Invitrogen) and then used to transfect E. coli. </ I> to push on LB boxes. To evaluate the proportion of clones containing wild-type or mutated sequences (V82A or L90M), individual colonies are transferred to 200 μL LB medium. After overnight incubation at 370C, the cultures are resuspended, diluted 1 in 50 in water, and 10 μl aliquots are evaluated by real-time PCR as described above. Clones containing the wild-type or mutated sequences are easily distinguished by comparing the Cs obtained for the reactions performed using the sequence- or non-sequence-selective PCR conditions (mutant clones, OCs <2 cycles, wild-type clones, 10 cycles). The plasmid DNA of the representative clones is purified and the inserts sequenced. Sequencing data confirm the identification of wild-type mutant clones in all cases (27 clones).

II. <U> Results </ U>.

 II-1. <U> Detection of resistance mutations in </ U> <U> using </ U> PCR <U> in real time </ U>.

The presence of mismatches between the primer and target in part 3 'of the oligonucleotide decreases the efficiency of PCR amplification (Huang et al., 1992, Nucleic Acids Res., Vol 20, pp. 4567-73; <I> A1, </ I> 0, Nucleic Acids Res., Vol 18, pp. 999-1005). By using real-time PCR, it is possible to accurately measure differences in amplification efficiency by determining the number of cycles (threshold cycle or Cs) required to generate a specific fluorescent signal. Cleavage allows the physical separation of the fluorescent group (FAM) and the quencher (TAMRA) present in the uncleaved probe. This approach is used to quantify the proportion of viral sequences in clinical samples containing V82A and L90M mutations in the protease gene associated with protease inhibitor resistance.

In initial studies, oligonucleotides that allow for adequate discrimination between wild-type and mutated sequences have been identified. When a primer paired perfectly with the sequences containing the V82A resistance mutation (and thus producing an AC 3 'mismatch with the wild-type sequence) is used, the amplification of the wild-type sequence, as expected, is delayed but the difference of 1, 2 cycles in the Cs (corresponding to a decrease of a factor, 3 of the amplification efficiency) does not allow a good discrimination between the two sequences. As previously described (Larder et al., 1991, AIDS, vol 5, pages 137-44, Cha <I> et al., </ I> 92, PCR Methods Appl., Vol. 2, pages 14-22), the addition of additional mismatch at the -2 position relative to the 3 'end of the oligonucleotide greatly destabilizes the amplification of the wild sequences, whereas this single mutation has little effect on the amplification of the V82A sequence. Using this oligonucleotide, an OCs greater than 10 cycles is observed by comparing the wild-type amplification and V82A, which corresponds to a decrease in the efficiency of amplification of the wild-type sequence by a factor greater than 1000. Using a similar approach, an oligonucleotide allowing preferential amplification of sequences containing the L90M mutation has been identified. The mismatch with the wild-type sequence produced by alignment of the oligonucleotide recognizing the L90M sequence is inherently more destabilizing than that produced by the V82A recognizing oligonucleotide, resulting in better discrimination (ACs = 15 cyc, corresponding to a decrease in efficiency of amplification of the wild-type sequence by more than 30000). These oligonucleotides are used to quantify minority populations of mutated sequences in clinical samples.

 RNA was purified from plasma and RNA corresponding to the protease gene was amplified by PCR. These amplification products were diluted and quantified in real time using a primer pair that does not differentiate between wild-type and mutated sequences (Figure 1A). When these products were analyzed using a pair of primers that preferentially amplify the L90M mutation-containing sequences, samples from untreated patients gave results that follow the curve obtained using the standard containing the wild-type sequence ( Figure 1B, solid circles), whereas the virologically failed patient samples that have been demonstrated by standard genotyping to contain many resistance mutations including L90M overlap with the curve obtained with the L90M standard (Figure solid squares). This and other results demonstrate that, under the reaction conditions used in this study, the presence of polymorphisms or other resistance mutations in most clinical samples does not affect the efficiency of amplification of wild sequences and sequences with the V82A or L90M mutation (Christopherson et al., 1997, Nucleic Acids, Vol 2, pages 14-20). In contrast, when the samples containing a minority population of viral sequences with the L90M mutation are analyzed, the results are between those obtained for the samples containing only either the wild sequences or the mutated sequences (Figure 1B, triangles), and correspond to quite well to the values determined by evaluating the clones derived from parallel PCR reactions performed on these samples. It should be noted that the samples containing about 0.05% of the sequences with the L90M mutation can be distinguished with this approach of the samples containing only wild sequences. Identical results are obtained for the detection of V82A mutants, except for the sensitivity of the assay which is approximately 1% of mutated sequences.

I1-2. <U> evaluation of the kinetic disappearance </ U> <U> of the resistant forms during </ U> the IT.

Patients infected with -1 with viral strains highly resistant to antiretrovirals following an IT were identified. Plasma samples from these patients were analyzed according to the technique of the invention before and after interruption of any antiretroviral treatment. The proportion of viral strains containing the L90M and / or V82A strains as a function of time is shown in FIG. 2. Before stopping the therapy a large proportion of mutant strains are present. One month after stopping the therapy, the resistant strains remained predominant in the 3 patients tested. As a result, the proportion of mutant strains decreases in most patients. When samples obtained 3 months after stopping the therapy are analyzed by standard genotyping, an apparent conversion to wild sequences is observed in 4 of the 5 patients. When the samples obtained more than 3 months after stopping the therapy are analyzed by real-time PCR, resistant viral strains are still present in 3 of 5 patients, although only one of these patients presents more than 5% of resistant strains. The mutant viral strains became undetectable by real-time PCR in 3 patients, but the duration of the necessary treatment interruption is rather variable (less than 2 months, between 2 and 4 months between 3 and 5 months respectively for patients 3, 5 and). In the other two patients, the viral mutant sequences are still present when the therapy is resumed after 5 to 6 months of interruption.

I1-3. <U> Genotyping of resistant strains </ U> <U> present during </ U> IT.

To confirm these results and to evaluate the genotype of minority viral populations expressing the V82A and L90M mutations, aliquots of RT-PCR reactions performed on the samples of two patients before and at different times after stopping the therapy are amplified again using primers that do not differentiate between wild-type and mutant sequences (F4 / R1). The amplification products are cloned and the proportion of clones containing mutant sequences determined. As shown in Table 1, the results obtained by selective-sequence real-time PCR and those obtained by the evaluation of the clones are concordant. In addition, representative wild and mutant clones are sequenced. All clones derived from samples obtained prior to discontinuation of therapy contain all resistance mutations identified by standard genotyping (Table 1). Conversely, most clones from samples obtained 5 months after stopping therapy that do not have the V82A or L90M mutation show a wild-type genotype in both patients.

Surprisingly, the clones containing resistance mutations identified in the samples 5 months (patient 1) or 3 months (patient 2) after the are not homogeneous and most have an intermediate genotype between that of a highly mutant population present before the interruption of therapy and a majority wild population that emerges after IT. For example, 3 to 4% of the viral population present in the patient 2, 3 months after IT have V82A and / or L9 mutations, but results obtained by cloning indicate that these mutations are present in partially non-overlapping populations . Among the 5 minority clones identified, one clone has all 7 mutations (clone F), the second has 5 of 7 mutations including L90M but not V82A (clone, and a third has 4 of 7 mutations including L90M and V82A (clone H) and the other clones contain L90M in combination with another mutation (clone I) or alone (clone Genetic analysis indicates that these viruses with an intermediate resistance genotype have appeared by two distinct mechanisms: reemergence of selected viral genomes in the early stages of resistance The first mechanism is illustrated by clone B (patient 1, Table 1) which carries only 2 of the resistance mutations present in the strains before the IT 154V and V82A.The phylogenetic analysis of this clone closer to the post-IT wild-type viruses than pre-IT resistant viruses, which strongly suggests that it was generated by a selective reversion of resistance mutations. Similarly, genotype analysis excludes recombinant production. The clinical history of this patient agrees with the idea that this clone results from reemergence of selected viral genomes in the early stages of antiretroviral resistance. Indeed, clone B contains the typical resistance mutations of indinavir resistance but does not show the G48V mutation. This latter, highly typical mutation of saquinavir resistance had to be selected later after the patient was changed for treatment with saquinavir following initial failure with treatment with indinavir. The re-emergence of pre-existing species is certainly the explanation for clone G of patient 2 although a selective reversion of A71V and V82A mutations is more difficult to exclude, because this virus with intermediate resistance is closer to viruses On the contrary, the sequence analysis strongly suggests that several of the other clones are generated via recombinations, for example, clone C (patient 1) and clones HI (patient 2). For each case, one end of the protease carries motifs of the nucleic acid sequence that are typical of post-IT wild-type viruses while the rest of the sequence contains a polymorphism characteristic of pre-IT resistant viruses. Several elements indicate that these recombinations occurred <I> in </ I> <I> vivo </ I> and not during the amplification before cloning.

I1-4.<U>Quantification des souches exprimant</U> <U>mutations de résistance après une</U> IT <U>de 3 mois</U>. for example, clone C of patient 1 contains several 5 'polymorphisms which are not typical of pre-IT resistant viruses, but this recombinant is present in a sample which contains no detectable resistant virus which could serve as a source for these motifs during the PCR.

I1-4. <U> Quantification of strains expressing </ U><U> mutations of resistance after </ U> IT <U> of 3 months </ U>.

To evaluate whether a commonly used 3-month IT is sufficient to completely eliminate resistant viruses, the proportion of viruses expressing V82A and L90M mutations has been quantified in patients who have been on an IT for 3 months and for whom a Conventional genotyping reveals an apparent total reconversion to wild-type virus. For the 13 patients with V82A or L90M mutations before treatment interruption, minority populations expressing these resistance mutations are still detectable after 3 months of IT in 9 cases (Table II). The proportion of viral strains expressing V82A and L90M decreased in patients with both mutations before IT. However, it should be noted that the proportion of residual populations with V82A is greater than that of the L90M populations in the 3 patients with resistant populations detectable after IT, which is in agreement with the presence of strains with genotypes of intermediate resistance, as described above. The specificity of the sequence-selective PCR method appears valid since viruses with V82A or L90M mutations are never detected in individuals who do not have the corresponding mutation before IT.

<U> Table <SEP> 2 <SEP>: <SEP> Detection <SEP> of <SEP> minority <SEP> viral <SEP> populations </ U>
<tb><U> expressing <SEP> the <SEP> mutations <SEP> of <SEP> resistance <SEP> V82A <SEP> and / or <SEP> L90M <SEP> in </ U>
<tb><U> the <SEP> plasma <SEP> of <SEP> patients <SEP> after <SEP> a <SEP> IT <SEP> of <SEP> 3 <SEP> months <SEP> t </ U >.
<tb> Technique <SEP> Time <SEP><SEP> Results <SEP> genotyping <SEP> or
<tb> evaluation <SEP> quantification <SEP> of <SEP> strains <SEP> viral <SEP> mutants <SEP> by
<tb> Genotype <SEP> Before <SEP> IT <SEP> 82A <SEP> 90M <SEP> 82A <SEP> 90L <SEP> 82V <SEP> 90M
<tb> After <SEP> 3 <SEP> months <SEP> 82V <SEP> 90L <SEP> 82V <SEP> 90L <SEP> 90L
<tb> PCR <SEP> After <SEP> 3 <SEP> months <SEP> Patient <SEP>% <SEP>% <SEP> Patient <SEP>% <SEP>% <SEP> Patient <SEP>%
& numsp & num / B><SEP> L90M
<tb> 17 <SEP> 21 <SEP> 13 <SEP> 8 <SEP> 9 <SEP> sld <SEP> 23 <SEP> sld <SEP> 9
<tb> 2 <SEP> 15 <SEP> 6 <SEP> 13 <SEP> 4 <SEP> sld <SEP> 1 <SEP> 5
<tb> 3 <SEP> 9 <SEP> 0.1 <SEP> 12 <SEP> 3 <SEP> sld <SEP> 15 <SEP> sld <SEP> 2
<tb> 21 <SEP> sld * <SEP> sld <SEP> 19 <SEP> sld <SEP> sld <SEP> 14 <SEP> sld
<tb> t <SEP><SEP> patients <SEP> infected <SEP> with <SEP><SEP> HIV <SEP> have <SEP> been
<tb> tested <SEP> after <SEP> one <SEP> IT <SEP> of <SEP> 3 <SEP> months <SEP> and <SEP> have <SEP> been <SEP> identified <SEP>
<tb> patients <SEP> for <SEP> which <SEP><SEP> genotyping <SEP> standard <SEP> reveals <SEP> one
<tb> reversal '<SEP> apparently <SEP> complete <SEP> in <SEP> wild <SEP> virus. <SEP> The
<tb> proportion <SEP> of <SEP><SEP> viral <SEP> sequences containing <SEP><SEP> mutation <SEP> of
<tb> resistance <SEP> V82A <SEP> and / or <SEP> L90M <SEP> is <SEP> determined <SEP> by <SEP> a <SEP> PCR
<tb> selective-sequence <SEP> for <SEP> all <SEP><SEP> patients <SEP> including <SEP> genotype
<tb> before <SEP> IT <SEP> contains <SEP><SEP> mutation <SEP> of <SEP> resistance <SEP> V82A <SEP> and / or
<tb> L90M. <SEP> * <SEP> sld <SEP> means <SEP><SEP> under <SEP> the <SEP><SEP> limit of <SEP> detection <SEP><SEP> which
<tb> is <SEP> lower <SEP> than <SEP> 1% <SEP> for <SEP> V82A <SEP> and <SEP> lower <SEP> than <SEP> 05% <SEP> for
<tb> L90M.

Claims (24)

1) Method for detecting and / or quantifying minority variants carrying at least one mutation within a heterogeneous population of viruses contained in a biological sample, characterized in that it comprises the following steps: a) the extraction of nucleic acids contained in the biological sample, b) the PCR amplification of the nucleic acids of step (a) with a pair of primers flanking a viral nucleic acid sequence capable of carrying the mutation, c) the preparation of a standard PCR amplification with the same pair of primers as in the nucleic acid sequence step (b) carrying the mutation, d) the real-time PCR amplification of the amplification products of the step (b) and the standard of step (c) with a pair of highly conserved primers that do not discriminate sequences with or without the mutation, and quantifying the number of viral nucleic acid sequences with or without the mutate. present in the sample, e) real-time PCR amplification of the amplification products of step (b) and the standard step (c) with a pair of sequence-specific primers bearing the mutation, and quantifying the number of mutation-carrying viral nucleic acid sequences present in the sample, f) comparing the quantifications of steps (d) and (e) to determine the proportion of virus carrying the mutation in the sample . 2) Method according to claim, characterized in that the minority variants belong to all families of viruses. 3) Method according to one of claims 1 2, characterized in that the minority variants are RNA viruses and in that step (b) is an RT PCR in the presence of a pair of primers flanking the sequence nucleic acid capable of carrying the mutation. 4) Method according to any one of claims 1 to 3, characterized in that the primer pairs flanking a viral nucleic acid sequence capable of carrying the mutation of steps (b) and are chosen so as to amplify with the same the sequences that carry the mutation and those that do not. 5) Method according to any one of claims 1 to 4, characterized in that the sequence carrying the mutation used to achieve the standard of step (c) is a nucleic acid sequence of a virus carrying the mutation, or a nucleic acid sequence of a wild-type virus in which the mutation has been introduced by site-directed mutagenesis or any other sequence capable of providing by amplification with the same primers as for stage (b) a product having the same characteristics as the sequence nucleic acid virus carrying the mutation. 6) Method according to any one of claims 1 to 5, characterized in that steps (d) and (e) are carried out with a conjugate probe at its 5 'and 3' ends, respectively, with a fluorescent dye reporter and a fluorescence intensity reduction compound, said probe being specific for a sequence present both in amplification products of steps (d) and (e). 7) Method according to any one of claims 1 to 6, characterized in that the fluorescence emitted during steps (d) and (e) measured continuously and the number of amplification cycles necessary for the fluorescence exceeds a given threshold (Cs) is determined in said steps (d) and (e) in that the quantification of the total number of viral nucleic acid sequences carrying or not the mutation in the sample of step (d) and that of the number of Mutated nucleic acid sequences present in the sample of step (e) are performed by comparing the Cs with a Cs standard curve obtained with standard dilutions subject to amplifications under the conditions of steps (d) and (c). e). 8) Method according to any one of claims 1 to 7, characterized in that in step (e) the specific sense primer of the mutated sequence has at least one or two additional mismatches other than. 9) Method according to claim 8, characterized in that in step (e) the specific sense primer of the mutated sequence has a moderately destabilizing mismatch, other than the mutation, in position -2 with respect to the end 3 'of said sense primer. 10) Method according to any one of claims 1 to 9, characterized in that the real-time PCR of steps (d) and () are carried out in the presence of 3 to 5 mM MgCl 2, with more than 100 mM each dNTPs, advantageously 200 mM of each of the dNTPs and at a temperature equivalent to the primers used. 11) Method according to any one of claims 1 to 10, characterized in that it comprises an additional control corresponding to a standard identical to that prepared in step (c) but not having the mutation which is amplified by PCR in time real under the same conditions as those of steps (d) and (e). 12) Application of a method according to any one of the preceding claims to the detection and / or quantification of minority variants of HIV carrying at least one antiretroviral resistance mutation. 13) Method for detecting and / or quantifying minority variants carrying at least one mutation, according to any one of Claims 1 to 11, characterized in that the said minority variants are HIV viruses and in that the said mutation is a resistance mutation. antiretrovirals present in the protease sequence. 14) Method according to claim 13, characterized in that said mutation is the V82A or L90M resistance mutation. 15) Method for the detection and / or quantification of minority variants of HIV carrying at least one V82A L90M antiretroviral resistance mutation in the protease sequence, within a heterogeneous viral population contained in a biological sample, according to one of any one of claims 13 or characterized in that it comprises the following steps: a) the extraction of the RNAs contained in the biological sample, b) the amplification by RT of the RNAs of step (a) with a pair of primers flanking a viral nucleic acid sequence capable of carrying the V82A or L90M mutation, this primer pair being ID No. 1 and SEQ ID No. 2 in the attached sequence listing, c) the preparation of a standard by PCR amplification with the same pair of primer as in step (b) of a nucleic acid sequence carrying the mutation V82A or L90M, d) real-time PCR amplification of the amplification products of step (b) and Step (c) standard with a pair of highly conserved primers not discriminating sequences with or without the V82A or L90M mutation. This pair of primers being SEQ ID No. 3 and SEQ ID No. 4 in the list of appended sequences, and quantification of the number of viral nucleic acid sequences carrying or not the V82A or L90M mutation present in the sample, e) the real-time PCR amplification of the amplification products of step (b). ) and the standard of step (c) with a pair of primers specific for a sequence carrying the V82A or L90M mutation, and quantifying the number of viral nucleic acid sequences carrying the V82A or L90M mutation present in the sample, f) comparing the quantifications of steps (d) and (e) to determine the proportion of virus carrying the V82A or L90M mutation in the sample. 16) Method according to claim 15, characterized in that the mutation is the V82A resistance mutation in the protease sequence and in that step (e) is carried out with the pair of primers of sequence ID No.4 and SEQ ID No.6 in the attached sequence listing. 17) Method according to claim 15, characterized in that the mutation is the L90M resistance mutation in the protease sequence and in that step (e) is carried out with the pair of primers of sequence ID No.4 and SEQ ID No.7 in the attached sequence listing. 18) A pair of primers capable of being implemented in step (b) of a method according to any one of claims 13 to 17, characterized in that it comprises the primers of sequences SEQ ID No. and SEQ ID No.2 in the attached sequence listing. 19) A pair of primers that can be used in step (d) of a method according to any one of claims 13 to 17, characterized in that it comprises the primers of sequences SEQ ID No. and SEQ ID No.4 in the attached sequence listing. 20) A pair of primers that can be used in step (e) of a method according to any one of claims 13 to 17, characterized in that it comprises the primers of sequences SEQ ID No. .4 SEQ ID No.6 in the attached sequence listing. 21) A pair of primers capable of being used in step (e) of a method according to any one of claims 13 to 17, characterized in that it comprises the primers of sequences SEQ ID No. .4 and SEQ ID No.7 in the attached sequence listing. 22) A probe that can be implemented in steps (d) and (e) of a method according to any one of claims 13 to 17, characterized in that its sequence corresponds to SEQ ID No.5 in the list of sequences in annex. 23) A kit for carrying out a method according to any one of claims 1 to 11 and 13 to 17, characterized in that it comprises the following reagents. a pair of primers surrounding a segment capable of carrying a mutation, a pair of highly conserved primers that do not discriminate mutated and non-mutated sequences, a pair of primers specific for the mutated sequences, a conjugate probe at its ends; 5 'and 3' ,. respectively, with a reporter fluorescent dye and a fluorescence intensity reducing compound, specific for the amplification products of steps (c) and (d) of a method according to any one of claims 1 to 11 and 13 to 17, - a nucleic acid sequence carrying the mutation for the preparation of a standard by PCR amplification with the pair of primers surrounding the segment likely to carry a mutation, - the reagent products necessary to carry out the various amplifications by PCR. 24) A kit according to claim 23, for the detection and / or quantification of minority variants of HIV carrying the V82A or L90M antiretroviral resistance mutation in the protease sequence, characterized in that it comprises - the pair of primers surrounding the segment capable of carrying a mutation of sequence SEQ ID No. 1 and SEQ ID No. 2 in the list of sequences in the appendix, the pair of highly conserved primers not discriminating the mutated and non-mutated sequences of sequence SEQ ID No. 3 and ID No. 4 in the attached sequence listing, - the pair of sequence-specific primers carrying the V82A mutation of sequence SEQ ID No.4 and SEQ ID No.6 in the attached sequence listing and the pair of primers specific for the sequences carrying the L90M mutation of sequence SEQ ID No.4 and SEQ ID No.7 in the attached sequence listing, - the probe conjugated at its ends <B> 51 </ B> and <B> 31,., </ B> respectively, with a fluorine dye escent reporter and one. fluorescence intensity reduction compound of SEQ ID No.5 sequence in the attached sequence listing.