FR2747131A1 - PROCESS FOR THE PRODUCTION OF AMINO ACID BY CORYNEBACTERIUM FERMENTATION EXPRESSING TREHALASE ACTIVITY - Google Patents

Abstract

A method for producing an amino acid, particularly glutamic acid, by fermenting a culture medium containing sugars by means of corynebacteria producing said amino acid, wherein a transformed corynebacterium strain is used to achieve a recombinant strain expressing a trehalose hydrolysing activity, is disclosed.

Description

PROCESS FOR PRODUCING AMINO ACID
BY FERMENTATION OF CORYNEBACTERIA EXPRESSING
A TREHALASE ACTIVITY
The present invention relates to a process for producing amino acid by fermentation using corynebacteria.

 Corynebacteria are the most commonly used bacterial species, including Corvnebacterium nlutamicum. for the production of amino acids by fermentation, in particular glutamic acid.

Generally, the final concentration of glutamate and its yield achievement determines the quality of the production strains.

The increase in production yield results from a more efficient use of the fermented substrate. In parallel with the consumption of the substrate for growth and bacterial maintenance, the use of this substrate for the synthesis of co-products other than that desired should be as minimal as possible. Thus, the degradation of a co-product into a consumable substance optimizes the use of the fermented substrate.

 The production of amino acid by corynebacteria (Corynebacterium or Brevibacterium sp.) From pure sugars (sucrose, glucose, fructose, etc.) or more complex nutritive media including (beet molasses, cane, etc.) ...), is generally accompanied by co-production up to several grams per liter of a non-reducing disaccharide, trehalose (α-Dglucopyranosyl α-D-glucopyranoside) (Marquet et al., 1986). The physiological function of this sugar is not clearly identified and is the subject of several scientific studies (Frings et al., 1993). In addition to the loss of assimilable carbon for the production of amino acid, the co-production of trehalose can possibly decrease the purification yields of the amino acid.

 Many strains of corynebacteria are unable to consume trehalose either as a sole source of carbon or in combination with another carbon source.

 Other microorganisms are however able to use trehalose for their growth. This is the case of Escherichia coli, where the enzyme trehalase has been shown to be able to hydrolyze trehalose into two glucose molecules (Becerra de Lares et al., 1977). In this microorganism, the localization of this enzyme is periplasmic (Boos et al., 1987). The DNA fragment governing the synthesis of this enzyme was isolated (treA gene) and its nucleotide sequence determined (Gutierrez et al., 1989). On this DNA, the sequences necessary for the secretion of the enzyme (signal peptide) have been identified. Furthermore, it has been shown that a number of these secretory sequences from microorganisms other than the corynebacteria may be functional in Corvnebacterium glutamicum (Liebl et al., 1992).

 Patent application JP 4004888 describes the preparation of an amino acid in a microbial culture containing trehalose.

 The present invention consists in expressing or overexpressing in corynebacteria an enzymatic activity which hydrolyzes trehalose, in particular via the expression of a treA gene, in particular the trhA gene from E. coli. Bacterial strains thus transformed acquire the ability to hydrolyze trehalose to glucose. This new enzymatic function makes it possible to significantly increase the yields of production of amino acids.

 More specifically, the subject of the present invention is a method for producing an amino acid by fermentation of a culture medium comprising sugars, using a corynebacterium producing said amino acid, characterized in that a strain is used. recombinant corynebacteria transformed to express an enzymatic activity hydrolyzing trehalose.

 By "trehalose hydrolyzing" activity is meant herein a functional definition which includes any trehalase activity capable of functioning in a host corynebacterium, conferring upon it an optionally increased activity and capable of functioning optionally as a selection marker. This definition therefore includes any trehalase capable of functioning in a given corynebacterium to increase the trehalase activity of said corynebacterium. This term therefore includes not only the specific endogenous enzyme of the specific corynebacterium to be treated, if it exists, but any other trehalase enzyme of other microorganisms or even eukaryotic species, if this trehalase is capable of functioning in the corynebacteria to be treated. .

Obtaining recombinant strains of corynebacteria expressing trehalose hydrolyzing activity can be obtained by different approaches by introducing genetic engineering methods.
1. one or more copies of an exogenous trehalase gene under conditions permitting its expression and secretion in said corynebacteria or;
2. an exogenous promoter stronger than the constitutive promoter of the trehalase gene when the corynebacterium possesses this endhalase activity endogenously.

 In the preferred embodiment according to the present invention, said strain of corynebacterium expresses and secretes in the culture medium trehalase activity hydrolyzing trehalose to glucose.

 Said strain of corynebacteria may be transformed by a replicative plasmid comprising an expression and secretion cassette of a DNA fragment coding for the trehalase enzyme.

 Here, the term "DNA fragment encoding the trehalase enzyme" means a functional gene encoding said trehalase which may correspond to the complete DNA sequence coding for said enzyme or a shorter sequence than the total coding sequence. In particular, the functional gene "may correspond to a partial coding sequence devoid of any introns.

 Recently, it has been possible to demonstrate the possibility of transforming corynebacteria by electroporation methods.

However, if the techniques of transformation by autoréplicatif vector are interesting, it is preferable most of the time, and at the industrial level, to have bacteria which were transformed by integration in the chromosome, that is to say of the strains which are stable over time, both in terms of the number of copies of the integrated element and its location. Said strain of corynebacterium can therefore advantageously be transformed by chromosomal integration of an expression and secretion cassette containing a DNA fragment coding for the trehalase enzyme.

 By expression and secretion cassette is meant a cassette containing a first functional DNA sequence for the expression in said strain of corynebacteria of a second DNA sequence which codes for the trehalase enzyme, and a third DNA sequence inserted between said first and second DNA sequences which encode elements of a protein which secrete trehalase by said corynebacterium strain.

 By functional sequence for expression is meant that the gene encoding trehalase is placed under the control of appropriate regulatory sequences for its transcription and translation such as promoter, star codons "and" stop ", enhancer, operator if any.

 In a particular embodiment, said DNA fragments ensuring the expression and secretion of the trehalase enzyme are constituted by the DNA fragments ensuring the expression and secretion of trehalase in a host of origin.

 According to one embodiment, the trehalase origin is the enzyme trehalase Ecoli.

 According to an appropriate variant, said strain is transformed by the E.coli treA gene in its entirety, that is to say which has its own elements of expression and secretion of trehalase.

 It should first be understood that in the context of the present invention the term "corynebacterium" refers to not only strains of the genus Corvnebacterium but also related bacteria, such as Brevibacterium.

Among the strains of corynebacteria that can be used, it is necessary to mention more particularly
- B. lactofermentum.

- B. flavum,
- C. rrlutamicum
- C. melassecola
- C. crenatum for their industrial interest.

 Among the amino acids that can be produced by the process of the invention, mention is more particularly glutamic acid and lysine.

 Preferably, a strain of C. nlutamicum is used, in particular the strain deposited at the CNCM of the Institut Pasteur under No. 1-1676.

 Preferably, said strain is transformed with a multi-copy DNA fragment coding for the trehalase enzyme.

In one embodiment, said corynebacterium strain is transformed by an integration vector comprising
a gene ensuring efficient selection of said corynebacterium;
an identical or homologous sequence of the genome of said
Corynebacteria, and
said expression cassette and secretion of the coding DNA fragment
for the trehalase enzyme and its secretion in the culture medium.

 By "integration vector" is meant a non-replicative vector having the property of integrating into the genome of a corynebacterium, this vector may be in linear or circular form.

However, the integration vector originates, in general, from a self-replicating plasmid that allows synthesis in a different host,
E.coli for example. But before the integration step, all the sequences involved in plasmid replication in Corynebacteria will preferably be deleted.

The selection genes effective in said corynebacteria are
- either genes for resistance to a particular substance,
antibiotic especially,
- genes conferring a clearly identifiable phenotype,
staining and / or complementation for example.

In this case, selection by resistance to an antibiotic is more particularly interesting. So we can use
the AphlII gene conferring resistance to kanamycin, denoted KmR,
or Neomycin, NeoR,
the Cat gene conferring resistance to chloramphenicol, denoted CmR.

But other genes can be used, including resistance to erythromycin, tetracycline, ampicillin, streptomycin, spectinomycin and bleomycin or their analogues.

 By "homologous sequence" is meant sequences which correspond to those present in the transformed corynebacterium or which have a homology level greater than 80%, they may be sequences of the same species or not, these sequences may be elsewhere be chemical.

 The sequences should be adapted or not, that is to say take into account the problems of restriction barriers existing in corynebacteria, by methods known to those skilled in the art.

 Thanks to the presence of homologous sequences present simultaneously in the integration vector and in the genome, the integration vector will insert by recombination into the chromosome. Thus, in the primary transformant, the trehalase gene is found integrated into a single copy in the bacterial chromosome. Since the structure of the primary integrant corresponds to a direct duplication of the homologous sequences surrounding the selection gene, it is possible to predict an amplification of this structure by selecting the growth of the primary integrator on a medium that makes it possible to detect strains overexpressing the selection gene. Thus, when the selection gene is the antibiotic resistance gene, the most resistant strains can be selected, on media with an increasing antibiotic content, which strains will overexpress genes corresponding to the homologous sequences, but also to any gene or DNA sequence which has been inserted into the integration vector, in particular the treA gene.

 The activity of the treA gene can also make it possible, by its higher expression, to select a strain having an amplification of the structure.

 In one embodiment, said strain is a genetically transformed C.glutamicum strain homologous to the gdhA locus of the chromosome of the strain using the integrative cassette containing the aphIII-treA-gdhA genes, so that the gdhA locus chromosome of the strains having integrated said cassette contains the genes: gdhA + aphIII-treA-gdhA n is an integer greater than or equal to 1.

 Other features and advantages of the present invention will become apparent in the light of the detailed description of the examples which follow. In these examples, reference is made to FIGS. 1 to 4.

 Figure 1 shows the construction of plasmid pFW3 from plasmids pTRE15 and pCGL426.

 Figure 2 represents the schematic diagram of integration and amplification in corynebacteria.

 Figure 3 shows the construction of an integrative cassette containing the aphIII-treAgdhA genes from pCGL548 and pFW3.

 Figure 4 shows the integration of an aphlII-treAgdhA cassette into the chromosome of strain COM1010 and the chromosomal structure of the resulting strains.

EXAMPLE 1 Construction of a Plasmid Dermetting the Expression of the TreA Gene
The plasmid pTRE15 (FIG. 1) (Gutierrez et al., 1989) carrying the entire E. coli treA gene has no origin of replication allowing it to be maintained in the corynebacteria. From this plasmid, a 2.6 Kb PstI-EcoRI fragment was therefore subcloned according to the techniques described by Ausubel et al. (1987) in plasmid pCGL426 (Figure 1) at Pst-EcoRI sites to form plasmid pFW3 (Figure 1). Plasmid pCGL426 is a pCGL243 derivative plasmid described by Reyes et al. (1991). This plasmid contains various origins of replication including ori p15A (Rose, 1988) and ori pBL1 (Santamamria et al., 1984), allowing its maintenance in free replicative form respectively in Ecoli and C zlutamicum. The plasmid pFW3 was thus selected in a strain of E. coli K12 with the aphlll gene conferring resistance to kanamycin.

After extraction and verification, the plasmid pFW3 was successively introduced into B. lactofermentum strains CGL2002 then
C. nlutamicum ATCC17965 and C. Glutamicum COM1010 by electrotransformation (Bonamy et al., 1990). The strains thus transformed were selected on complete medium (BHI) supplemented with kanamycin (25 μg / ml).

EXAMPLE 2 Phenotype of corvnebacteria transformed by plasmid DFW3
The presence of plasmid pFW3 in C. glutamicum strains confers on these strains the ability to grow on synthetic minimal medium (Liebl et al., 1989) BMCtre containing trehalose as sole carbon source (BMCGtre medium) (Table 1).

 On solid agar medium, it was observed that an untransformed strain of C nlutamicum could grow on BMCGtre medium if the latter was close (a few centimeters) to a strain transformed with the plasmid pFW3. This observation demonstrates the ability of transformed strains to excrete trehalase, the activity of which allows growth of a non-transformed strain on BMCtre medium.

The secretion of the product of the treA gene by the strain of C. glutamicum
ATCC17965 was demonstrated and quantified by measuring trehalase activity in the culture medium of this strain transformed with plasmid pFW3 (Table 2). The assay of this activity was carried out according to a protocol adapted from Kienle et al. (1993). The ATCC 17965 strain transferred by pFW3 was deposited at the CNCM of the Institut Pasteur under number 1-1676.

EXAMPLE 3 Fermentation Use of Corvnebacteria Transformed by DFW3 Dilasmide
A fermentation study makes it possible to demonstrate the improvement in the production of glutamic acid provided by the use of strains of C. rlutamicum transformed with the plasmid pFW3. The production capacities of different strains of C. elutamicum on different fermentation media are reported in Table 3.

Regardless of the strain of C. nlutamicum transformed with plasmid pFW3, all of the trehalose co-produced under these conditions is hydrolyzed and reconsomed. The same effect is observed regardless of the carbon source used for carrying out the fermentations. Thus, the gain of carbon assimilable by these different transformed strains makes it possible to increase the production yield of glutamic acid.

EXAMPLE 4: Multi-copy Interaction of the TreA Gene in the Chromosome of a Strain of C. Rutamicum
a) Need and principle of genomic integration
The maintenance of the plasmid pFW3 in the transformed strains requires the addition of kanamycin or neomycin in the culture media of these strains. However, this addition of antibiotic is not feasible industrially because the cost of antibiotics is on the one hand prohibitive and on the other hand their use in large quantities is undesirable for both health and environmental reasons.

 In order to avoid this use of antibiotics under industrial conditions, the treA gene is integrated into the genome of C. strains.

 glutamicum according to the method described by Reyes et al. (1991) and Labarre et al. (1993) and WO92 202627. Schematically, these authors have shown that the introduction into a corynebacterium of a circular DNA fragment, containing no origin of plasmid replication (homologous or heterologous) and having a significant homology with the genome of the strain in question can integrate into its chromosome via a homologous recombination mechanism. Experimentally, the selection of strains containing such insertions is carried out using an antibiotic resistance gene added to the integrated DNA fragment. The authors have also shown that from strains possessing a single integration, it can be isolated from bacterial colonies containing in their genome a tandem multiplication "of this integration, so-called amplified integration". The higher expression of the genes thus "multiplied" allows the selection of this type of colonies. The whole process is shown in Figure 2.

 The work of Reyes et al., 1991 and Labarre et al., 1993 have also shown that gene integrations are highly stable.

This stability is sufficiently great to allow the industrial use of bacterial strains thus transformed without maintaining a selection pressure.

 b) Integration of the treA gene in the genome of a strain of C.

elutamicum
Genome integration is based on the use of a DNA fragment with strong homology to the genome of C. glutamicum.

In the example presented here, this homology is provided by the plasmid pCGL548 (FIG. 3), derived from the plasmid pCGL100 (Reyes et al., 1991), carrying the entire gdhA gene of C. glutamicum ATCC17965 governing the synthesis of the glutamate dehydrogenase.

 In order to construct a circular structure capable of integrating into the C. glutamicum genome as previously described, the plasmid pFW3 (FIG. 3) was hydrolyzed by Bags, treated with T4 DNA polymerase and then again hydrolysed with EcoRI; the 4.08 Kb fragment thus obtained was gel purified (Ausubel et al., 1987). Plasmid pCGL548 was hydrolysed with PvuII and EcoRI and the 2.69 Kb fragment containing the gdhA gene was also gel purified. These two fragments were ligated by the action of a T4 DNA Ligase (FIG. 3) to give an integrative circular DNA structure.

 This ligation product was used to transform strain C glutamicum COM1010. After selection in complete medium (BHI) in the presence of kanamycin (25 Fg / ml), a few clones, including the strain COM2218, were selected. A growth test has shown that these clones are able to grow on BMCtre medium. Southern Blot analysis (Ausubel et al., 1987) from the genomic DNA of strain COM2218 confirmed the physical integration of the aphllI-treA-gdhA genes at the gdhA locus of the strain. The genomic structure thus created is shown in Figure 4.

 In order to obtain an amplified strain for the integration of aphllltrA-gdhA, strain COM2218 was cultured in complete medium containing neomycin at concentrations of between 0.5 and 10 mg / ml.

Although initially strain COM2218 hardly grows at these antibiotic concentrations, a few clones can be isolated after several days of growth.

 A measurement of trehalase activity present in the culture supernatant of the clones taken individually made it possible to select the strain COM2218A14. Indeed, the level of trehalase activity it expresses is higher than that found with the parental strain COM2218 (see Table 6). Southern blot analysis from the genomic DNA of strain COM2218A14 confirmed the six-copy amplification of the aphil / A-gdhA tandem at the gdhA locus of the strain.

EXAMPLE 5 Use in fermentation of a corvnebacterium
COM2218A14 before integrated treA gene in multi-copies
A fermentation study makes it possible to demonstrate the improvement in the production of glutamic acid provided by the use of C. glutamicum strains having integrated into their genome one or more copies of the treA gene (see Table 7). This fermentation is carried out as previously described except the absence of antibiotic in the various culture media used.

 The use of strain COM2218, which has only one integrated copy of the treA gene, co-produces a reduced but non-zero amount of trehalose. The production yield of glutamic acid relative to the carbon source used is however increased.

The use of the strain COM2218A14 which has six copies of the integrated treA gene, allows a production of glutamic acid without residual trehalose at the end of production despite its co-production in large quantities for the original strain. Thus, the production efficiency gain is optimal under these conditions.

EXAMPLE 6 Construction and use of a corvnebacterium
COM2386 before integrated the treA gene into multi-copies.

 The versatility of the invention is shown with the integration of the treA gene into the genome of another strain of corynebacteria. The example describes a variant of the integration and selection techniques that those used in Example 4.

Instead of constructing the DNA structure described in Example 4, a DNA fragment carrying the aphI1-treA-gdhA genes was directly "amplified" by the Polymerase Chain Reaction ™ technique or PCR (Ausubel et al. , 1987) from the genome of the COM2218 strain obtained in Example 4. For this, two oligonucleotides specifically homologous at the beginning of the aph III gene (sequence 5'GATTATCCCGGGGTATGAAAACGA3 ') and at the end of the gdhA gene (sequence 5 GCACCGCACAGATGCATTAACCCAT3 ') were used, the linear DNA fragment thus obtained was circularized (T4 DNA Ligase) and then introduced into the strain COM2262 by electrotransformation.After selection and isolation on complete medium supplemented with kanamycin, each colony was then cultured. individually on BMCtre medium.
COM2386 was chosen because it had a high growth rate on this medium. An assay of the trehalase activity on the culture supernatant of strain COM2386 confirmed the high expression of the treA gene (Table 8).

The gene structure of strain COM2386 has also been verified by the "Southern blot" technique. In addition to locating the integration of the aphIII-treA-gdhA genes at the gdhA locus of the strain, this analysis also demonstrated that the aphlll-treA-gdhA genes were amplified six times in a tandem structure as expected. So, the strain
COM2386 has similar characteristics to the strain
COM2218A14 constructed in Example 4.

 Fermentation capacities of strain COM2386 were tested as described for strain COM2218A14. The improvements brought about by the use of strain COM2386 are shown in Table 9 absence of residual trehalose in the culture medium after fermentation and increase of carbon yield of glutamate production. These results are identical to those obtained with the strain COM2218A14.

CONCLUSIONS
The different plasmid or integrative constructs carried out allow the expression of the E. coli treA gene in various strains of corynebacteria. Thanks to this new enzymatic function, the bacterial strains thus transformed have the capacity to hydrolyze trehalose to glucose, which is then consumed. As a result, glutamic acid production yields are significantly higher with such strains of corynebacteria.

TABLE 1
Growth of various C. glutamicum strains transformed or not by the DFW3 Dlasmide on synthetic minimal glucose medium as sole source of carbon (BMCglu) or trehalose (BMCtre).

<Tb>

Strain <SEP> and <SEP> plasmid / Growth <SEP> BMCglu <SEP> BMCtre
<tb><SEP> ATCC17965 <SEP>
<tb><SEP> ATCC17965 (pFW3) (l-1676) <SEP> 44+ <SEP>
<tb><SEP> COM1010 <SEP> | <SEP> i <SEP>
<tb><SEP> COM1010 (pFW3) <SEP> +++ <SEP> +++ <SEP>
<tb><SEP> COM2262 <SEP> +++ <SEP> + /
<tb><SEP> COM2262 (pFW3) <SEP> +++ <SEP><SEP> +++ <SEP>
<Tb>
no growth +++: maximum growth after one night of culture
residual growth after 3 nights of culture
BMCglu: BMC supplemented with glucose as the sole source of carbon
BMCtre: BMC supplemented with trehalose as sole source of carbon
TABLE 2
Specific trehalase activity present in the culture medium of the ATCC17965 strain transformed with the plasmid pFW3

<tb><SEP> Strain <SEP> Specific <SEP> Activity
<tb><SEP> ATCC17965 <SEP><3,628
<tb> ATCC17965 (pFW3) (I-1676) <SEP> 383.618 (1)
<tb><SEP> + <SEP> 10,830
<Tb>
The specific activity is expressed in nmol of hydrolysed trehalose per hour for 1 ml of culture at OD65Onm = 1.

(1): average of 6 measurements
TABLE 3
Fermentation performance of C. glutamicum strain ATCC 17965 transformed with plasmid pFW3 compared to the same non-transformed strain

<tb><SEP> Trehalose <SEP> Yield
<tb><SEP> Strain <SEP> in <SEP> g / l <SEP> in <SEP>%
<tb><SEP> ATCC17965 <SEP> 12.0 <SEP> 51.4
<tb> ATCC17965 (pFW3)
<tb><SEP> (I-1676) <SEP> 45 <SEP><SEP> 57.2
<Tb>
The fermentation medium contains beet molasses in the foot as well as in the diet. The yield of C12 is calculated on sucrose.

The surfactant used is Tween 40.

The fermentation is carried out in the following manner: 100 ml of medium, arranged in a 500 ml flask, are inoculated from a growing colony on Brain Heart Infusion medium supplemented or not with 25 Fg / l of kanamycin according to the presence of pFW3 in the strain. The medium is composed of beet molasses (80 g / l), 75% H3PO4 (4 g / l), (NH4) 2SO4 (2 g / l), MgSO4, 7H20 (1 g / l), urea (8 g / l), biotin (50 Fg / l), pH adjusted to 5.3, plus 100 μg / ml neomycin for strains transformed with pFW3. The preculture is carried out at 32 ° C and then stopped when the OD at 650 nm is between 25 and 30. From this preculture is seeded at 3% a new culture carried out under the same conditions of medium and growth. stopped as before.

This culture allows
The fermentation medium contains cane molasses at the bottom as well as in the feed at a level of 20%. The surfactant used is the
Tween 40.

The fermentation is carried out as described in Table 3 except for the following differences: beet molasses is substituted with cane molasses and biotin is omitted in the preculture and culture medium. In the fermenting medium, 240 g / l cane molasses replace the beet molasses and biotin is also omitted.

The diet consists of a glucose syrup supplemented with 20% cane molasses.

TABLE 5
Fermentation performance of C. glutamicum strain COM2262 transformed with plasmid pFW3 compared to the same non-transformed strain

<tb><SEP> Trehalose <SEP> Yield <SEP> in
<tb><SEP> Strain <SEP> in <SEP> g / l <SEP>%
<tb> (20M2262 <SEP> 13.8 <SEP> 44.9
<tb> CD0M2262 <SEP>
<tb><SEP> (pFW3) <SEP> d), 5 <SEP><SEP> 53.5
<Tb>
The fermentation is carried out as described in Table 3 except for the following differences: beet molasses is substituted with glucose 30 g / l and 30 g / l corn hydrolyzate HC1 and biotin is adjusted to 300 g / l in the preculture and culture medium. In the fermenting medium, 65 g / l of glucose and 20 ml / l of soy HCl hydrolyzate replace the beet molasses and the biotin is adjusted to 300 μg / l.

The diet consists of a pure glucose syrup.

TABLE 6
Trehalase specific activity present in the culture medium of the COM1010 strains. COM2218 and COM2218A14

<tb><SEP> Strain <SEP> Specific <SEP> Activity
<tb><SEP> COM <SEP> 1010 <SEP><10
<tb><SEP> COM2218 <SEP> 65
<tb> COM22 <SEP> 1 <SEP> 8A14 <SEP> 191
<Tb>
The specific activity is expressed in nmol of hydrolysed trehalose per hour for 1 ml of culture at D 650 nm = 1.

TABLE 7
Fermentation performance of COM1010 strains. COM2218 and COM2218A14 respectively having none. one and six copies of the treA gene integrated in their genome

<tb><SEP> Strain <SEP> Trehalose <SEP> Yield
<tb><SEP> in <SEP> g / l <SEP> in <SEP>%
<tb><SEP> GOM1010 <SEP> 16.9 <SEP> 47.9
<tb><SEP> COM2218 <SEP> 11.2 <SEP> 49.7
<tb> COM2218A14 <SEP> 51
<Tb>
The fermentation is carried out as described in Table 4 except that the
different media used do not contain antibiotics.

TABLE 8
Trehalase specific activity in the culture medium of the strains
COM2262 and COM2386

<tb><SEP> Strain <SEP> Specific <SEP> Activity
<tb><SEP><26.9
<tb> COM2262 <SEP> + <SEP> 4,5
<tb><SEP> 653
<tb> GON12386 <SEP> + <SEP> 226
<Tb>
The specific activity is expressed in nmoles of trehalose hyrdolysed per hour for 1 ml of culture at OD650nm = 1.

TABLE 9
Fermentation performance of strains COM2262 and COM2386 with respectively none and six copies of the treA gene integrated in their genome

<tb><SEP> Trehalose <SEP> Yield
<tb><SEP> Strain <SEP> in <SEP> g / l <SEP> in <SEP>%
<tb><SEP> 16.9 <SEP> 44.6
<tb> COM2262 <SEP> + <SEP> 2.9 <SEP> + <SEP> 1.4
<tb><SEP> 0.6 <SEP> 51.3
<tb> COM2386 <SEP> + <SEP> 0.8 <SEP> +09 <SEP>
<Tb>
The fermentation is carried out as described in Table 5 except that the different media used do not contain antibiotics.

REFERENCES 1. AUSUBEL, FM, BRENT, R., KINGSTON, RE, MOORE, DD, SEIDMAN, JG,
SMITH, JA and STRUHL, K. (1987). Current Protocols in Molecular Biology.

Published by Greene Publishing Associates and Wiley-Interscience, John
Wiley and Sons, New York.

2. BECERRA DE LARES, L., RATOUCHNIAK, J. and CASSE F. (1977).

Chromosomal Location of Gene Governing the Trehalose Use in Eschenchia coli K12. Mol. Gen. Genet., 152, 105-108.

3. BONAMY, C., GUYONVARCH, A., RELUES, O., DAVID, F. and LEBLON, G.

(1990). Interspecies Electrotransformation in Corynebacteria. FEMS
Microbiol. Letters, 66, 263-270.

4. BOOS, W., EHNMANN, U., BREMER, E., MIDDENDORF, A. and POSTMA, P.

(1987). Trehalase of Escherichia coli. Mapping and cloning of its structural gene and identification of the enzyme as periplasmic protein induced under high osmolarity growth conditions. J. Biol. Chem., 262, 13212-13218.

5. FRINGS, E, KUNTE, HJ and GALINSKI, EA (1993). Compatible with Brevibacterium and Corynebacterium:
Occurence of tetrahydropyrimidines and glutamine. FEMS Microbiol.

Letters, 109, 25-32.

6. GUTIERRE, C., ARDOUREL, M., BREIVE, E, MIDDENDORF, A., BOOS, W. and
EHMAN, U. (1989). Analysis and DNA sequence of the osmoregulated treA gene encoding the periplasmic trehalase of Escherichia coli K12. Mol.

Gen. Genet., 217, 347-354.

7. KIENLE, I., BURGERT, M. and HOLZER, H. (1993). Assay of Trehalose with
Acid Trehalase Purified from Saccharomyces cerevisia. Yeast, 9, 607-611.

8. LABARRE, J., REYES, O., GUYONVARCH, A. and LEBLON, G. (1993). Gene
Replacement, Integration and Amplification at the gdhA locus of Comiebacoenum glutamicum. J; Bact., 175, 1001-1007.

9. LIEBL, W., KLAMER, R. and SCHLEIFER, K.H. (1989). Requirements for chelating compounds for the growth of Corynebacterium glutamicum in synthetic media. Applied Microbiology and Biotechnology 32, 205-210.

10. LIEBL, W., SINSKEY, AJ and SCHLEIFER, K.-H. (1992). Expression,
Secretion, and Processing of Staphylococcal Nuclease by Corynebactenum glutamicum. J. Bact., 174, 1854-1861.

11. MARK, M., URIBELARREA, JL, HUCHENT, A., LANEELLE, G. and
GOMA, G. (1986). Glutamate excretion by Corynebacterium glutamicum: a study of glutamate accumulation during a fermentation course. Appl.

Microbiol. Biotechnol., 25, 220-223.

12. REYES, O., GUYONVARCH, A., BONAMY, C., SALTI, V., DAVID, F. and
LEBLON, C. (1991). Integron "- bearing vectors: a method for stable chromosomal integration in highly restrictive Corynebacteria.

Gene, 107, 61-68.

13. ROSE, R, E (1988). The nucleotide sequence of pACYC184, Nucleic Acids
Res., 16, 355.

14. SANTAMARIE, R., GIL, J., A., MESAS, J., M. and Martin, J., F. (1984).

Characterization of endogenous plasmid and development of cloning vectors and a transformation system in Brevibacterium lactofermentum.

J. Gen. Microbiol., 130, 2238-2246.

Claims (14)

 1. Process for producing an amino acid by fermentation of a culture medium comprising sugars, using a strain of corynebacterium producing said amino acid, characterized in that a recombinant strain of transformed corynebacteria is used. in order to express an enzymatic activity hydrolyzing trehalose.  2. Method according to claim 1, characterized in that said recombinant strain of corynebacterium expresses and secretes in the culture medium a trehalase activity hydrolyzing trehalose to glucose.  3. Method according to claim 2, characterized in that said strain of corynebacteria is transformed by a replicative plasmid comprising a cassette for the expression and secretion of a DNA fragment coding for a said trehalase enzyme.  4. Method according to claim 2, characterized in that said strain is transformed by a chromosomal integration vector of a cassette for expression and secretion of a DNA fragment coding for a said trehalase enzyme.  5. Method according to claim 3 or 4, characterized in that said DNA fragments ensuring the expression and secretion of the trehalase enzyme are constituted by the DNA fragments ensuring the expression and the secretion of trehalase in the original host of said trehalase.  6. Method according to one of claims 2 to 5, characterized in that the trehalase enzyme is an enzyme trehalase Ecoli.  7. Method according to claim 5, characterized in that said strain is transformed by the treA gene of Ecoli in its entirety.  8. Method according to one of claims 1 to 7, characterized in that said amino acid is glutamic acid.  9. Method according to one of claims 1 to 7, characterized in that said amino acid is lysine.  10. Method according to one of claims 1 to 9, characterized in that said strain is of the genus Corvnebacterium or Brevibacterium.  1. Process according to claim 10, characterized in that said strain is chosen from a strain of C. glutamicum. C. crenatum, C melassecola or B. lactofermentum.  12. Method according to claim 11, characterized in that said strain is a strain of C. nlutamicum deposited at the CNCM under No. 1676.  13. Method according to one of claims 3 to 12, characterized in that said strain is transformed by a multi-copy DNA fragment encoding the enzyme trehalase.  14. Method according to one of claims 4 to 13, characterized in that said strain of corynebacteria is transformed by an integration vector comprising  a gene ensuring efficient selection in said corynebacterium  an identical or partially homologous sequence of the genome of  said corynebacterium, and  said expression cassette of the DNA fragment coding for  the trehalase enzyme and its secretion in the culture medium.  15. Method according to claim 14, characterized in that said strain is a strain of C. zlutamicum transformed by homologous recombination at the gdhA locus of the chromosome of said strain using an integration vector containing the aphlll-treA genes. -gdhA.