CN114395578A - Preparation method and application of recombinant trehalase - Google Patents
Preparation method and application of recombinant trehalase Download PDFInfo
- Publication number
- CN114395578A CN114395578A CN202210062138.9A CN202210062138A CN114395578A CN 114395578 A CN114395578 A CN 114395578A CN 202210062138 A CN202210062138 A CN 202210062138A CN 114395578 A CN114395578 A CN 114395578A
- Authority
- CN
- China
- Prior art keywords
- trehalase
- recombinant
- trehalose
- trl
- corynebacterium glutamicum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/54—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving glucose or galactose
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01028—Alpha,alpha-trehalase (3.2.1.28)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/924—Hydrolases (3) acting on glycosyl compounds (3.2)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Emergency Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a preparation method of recombinant trehalase, belonging to the technical field of biological engineering. The invention expresses trehalase coding gene derived from Escherichia coli BL21 in Corynebacterium glutamicum ATCC13032 to obtain recombinant trehalase. The invention utilizes the safe strain corynebacterium glutamicum to express the trehalase, has good expression effect, simple strain culture condition and short culture time, and the prepared recombinant trehalase has good safety and wide available range, can specifically hydrolyze trehalose to generate glucose, has better stability under the conditions of low temperature and freezing preservation, and can be stored for a long time. The enzyme solution containing the recombinant trehalase prepared by the invention can be used for quickly detecting the content of the trehalose in a sample, and has the advantages of simple sample treatment, less time consumption, low equipment requirement and high detection accuracy.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to recombinant trehalase and application thereof in trehalose detection.
Background
Trehalose is disaccharide linked by two molecules of glucose through alpha, alpha-1, 1 glycosidic bonds, and has the characteristics of no reducibility, stable chemical properties and the like. Trehalose is widely distributed in nature, and is contained in bacteria, fungi, plants and invertebrates such as insects, nematodes, shrimps and the like. Research shows that trehalose can protect biological macromolecules such as cell membranes, proteins and the like, help organisms to tolerate severe environments such as high temperature, freezing, high osmotic pressure and the like, and is a stress synthetic metabolite in organisms. Trehalase can break down trehalose into two molecules of glucose, and is widely present in animals, plants and microorganisms. In recent years, the application of trehalase to the fermentation industry has been gaining increasing attention. In the corn ethanol industry, trehalose is one of main components of fermentation residual sugar, and a glucoamylase suite with trehalase activity is declared to be provided by Novixin in 2017, 2 months and 22 days, so that the fermentation residual sugar can be reduced by 70%, and the ethanol yield is improved; during the fermentation process of the glutamic acid, certain amount of trehalose is synthesized and accumulated by strains at the later fermentation stage, so that the residual sugar amount is increased, the extraction of the glutamic acid is influenced, and the yield and the saccharic acid conversion rate of the glutamic acid are improved by adding trehalase at the later fermentation stage of the glutamic acid.
The key point of producing trehalase is to obtain enzyme-producing microorganisms, which can be screened from nature to obtain trehalase-producing microorganisms, and can also be used for obtaining recombinant strains for producing trehalase by constructing genetic engineering strains. The gulf of south Jiangnan university, et al, screened and obtained the Erwinia rhapontici (Erwinia rhapontici) C2 producing trehalase from the soil sample acclimatized with trehalose; the trehalase coding gene of Escherichia coli str.K-12 substr.MG1655 is recombined and expressed in E.coli BL21 in Lingang and the like at Jiangnan university; the trehalase coding gene of thermophilic fungus Thermosaccharomyces is subjected to codon optimization and expression in Pichia pastoris by Huangjiang, a Guangdong Yiduoli biological science and technology company, Inc.; the trehalase coding gene trl also exists in E.coli BL21, the similarity of the trehalase coding gene trl to the reported trehalase coding gene of E.coli str.K-12 substr.MG1655 is 98.42%, 26 different nucleotides exist in the sequence, an amino acid residue difference exists in the coding protein, and related research and report of trehalase in E.coli BL21 do not exist at present. Corynebacterium glutamicum (Corynebacterium glutamicum) is a safe strain, and has low proteolytic enzyme activity, thereby facilitating the stability of recombinant proteins; at the same time, the background of the glycohydrolase is low, and the intracellular lactohydrolase activity is very low compared with that of Escherichia coli. The expression of trehalase by corynebacterium glutamicum can expand the application range of trehalase, such as fermentation production of products with high safety requirements, such as food additives. At present, no report is available on the expression of trehalase by Corynebacterium glutamicum.
On the other hand, in the production process of trehalose, the trehalose concentration needs to be continuously detected, so that a simple and rapid trehalose content analysis method is very important in the production process. At present, the trehalose detection is mainly carried out by HPLC (high performance liquid chromatography), such as the method recommended by the national standard GB/T23529-2009, but the analysis of trehalose by HPLC requires the use of an acetonitrile reagent with certain toxicity, and the sample treatment requirement is high and is limited by specific equipment conditions. At present, trehalose production is mainly an enzymatic method. For example, trehalose, maltose and glucose are mainly present in the reaction system when trehalose synthase is used for catalyzing the conversion of maltose into trehalose. The trehalose is synthesized by catalyzing maltooligosaccharide through the combined action of maltooligosaccharide-based trehalose synthetase and maltooligosaccharide-based trehalose hydrolase, and trehalose, glucose and maltooligosaccharide mainly exist in a reaction system. Therefore, the trehalose is hydrolyzed into glucose which is easy to detect by utilizing the trehalase, so that the application potential of simply and quickly analyzing the trehalose is realized, and the trehalase which has high catalytic activity, good hydrolysis specificity of the trehalose and is easy to prepare and store is the key of enzyme method analysis of the trehalose.
Disclosure of Invention
The present invention aims to solve the above-mentioned deficiencies of the prior art and to provide a method for producing recombinant trehalase.
Technical scheme
A preparation method of recombinant trehalase comprises the steps of inserting trehalase coding genes into an expression plasmid pXMJ19 to construct pXMJ19-trl, electrically shocking the pXMJ19-trl plasmid to transform Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13032 to obtain recombinant Corynebacterium glutamicum, and carrying out expression synthesis on the recombinant Corynebacterium glutamicum to obtain the recombinant trehalase. The method comprises the following specific steps:
(1) taking a genome of Escherichia coli (Escherichia coli) BL21 as a template, and carrying out PCR amplification on a trehalase coding gene trl to obtain a trl gene fragment; the nucleotide sequence of the trehalase coding gene is shown in SEQ ID NO. 1; the primers for PCR amplification are shown as SEQ ID NO.2 and SEQ ID NO. 3;
19-trl-HindIIIF:CCCAAGCTTAAAGGAGGGAAATCATGCTCAATCAGAAAATTCAAAACC(SEQ ID NO.2)；
19-trl-EcoRI：CCGGAATTCTTATGGTTCGCCGTACAAACC(SEQ ID NO.3)；
(2) carrying out double digestion and connection on the trl gene fragment and the pXMJ19 plasmid by adopting HindIII and EcoRI restriction endonucleases, and carrying out electric shock transformation on a connection product to obtain E.coli DH5 alpha competence to obtain a recombinant expression plasmid pXMJ 19-trl;
(3) transforming Corynebacterium glutamicum ATCC13032 by adopting recombinant expression plasmid pXMJ19-trl through electric shock to obtain recombinant Corynebacterium glutamicum;
(4) and (3) carrying out induction culture on the recombinant corynebacterium glutamicum to synthesize and accumulate the recombinant trehalase in cells, then collecting the cells, crushing and centrifuging to obtain an enzyme solution containing the recombinant trehalase.
Further, in the step (2), the conditions for the electric shock conversion are as follows: 1800V, 5 ms.
Further, in the step (4), the conditions of the induction culture are as follows: the IPTG induction concentration is 0.5mM, the induction temperature is 22-30 ℃, and the induction time is 10-15 h.
The application of the recombinant trehalase prepared by the method in the detection of the content of trehalose is to rapidly detect the content of trehalose in a sample by using an enzyme solution containing the recombinant trehalase.
Preferably, the application method of the recombinant trehalase in the detection of the content of trehalose comprises the following steps: diluting a sample to be detected to the trehalose concentration of 0.125-2 g/L, adding 4000U/L of trehalase, reacting for 5min at 45 ℃, and calculating the trehalose concentration in the sample by analyzing the increase of the glucose concentration.
The invention has the beneficial effects that:
(1) the safe strain corynebacterium glutamicum is used for expressing trehalase, the expression effect is good, the strain culture condition is simple, and the culture time is short; the recombinant trehalase has good safety and wider available range; the activity of the protein hydrolase of the corynebacterium glutamicum is low, and the recombinant trehalase can be stored for a long time without being purified; the background of the corynebacterium glutamicum glucohydrolase is small, and the recombinant trehalase can specifically catalyze the decomposition of trehalose into glucose without purification.
(2) The trehalose content in the sample can be rapidly detected by using the enzyme solution containing the recombinant trehalase, the sample is simple to process, the time consumption is less, the equipment requirement is low, and the detection accuracy is high; and the enzyme solution containing the recombinant trehalase can be used without purification, the enzyme solution is easy to obtain, and the enzyme cost is low.
(3) The glycerol with the volume of 10 percent of the enzyme liquid is added into the enzyme liquid containing the recombinant trehalase, the enzyme activity can be preserved for 90 days at the temperature of 20 ℃ below zero without obvious reduction, the enzyme activity can be preserved for 5 days at the temperature of 5 ℃, 3 days at the temperature of 20 ℃ and 32 hours at the temperature of 30 ℃ without obvious reduction, the half life of the enzyme activity of the enzyme liquid is 1 hour at the temperature of 40 ℃, and the half life of the enzyme activity is 10 minutes at the temperature of 45 ℃.
(4) The enzyme solution containing the recombinant trehalase prepared by the invention can catalyze the hydrolysis of the trehalose at the optimum temperature of 45 ℃ and the optimum pH of 6.6, and can effectively catalyze the hydrolysis of the trehalose at the temperature of 30-55 ℃ and at the pH of 5.8-7.8.
Drawings
FIG. 1 shows the results of activity test of the recombinant trehalase prepared in example 1 at various temperatures;
FIG. 2 shows the results of activity test of the recombinant trehalase prepared in example 1 at various pHs.
Detailed Description
The technical solution of the present invention is further described with reference to the accompanying drawings and specific embodiments. The following examples are only for illustrating the technical solutions of the present invention more clearly, and the protection scope of the present invention is not limited thereby.
In the following examples, the formulation of LBG solid medium used was: 5g/L of yeast powder, 10g/L of peptone, 10g/L of sodium chloride, 5g/L of glucose, 20g/L of agar powder and pH7.0; the LBG liquid medium formula is as follows: 5g/L of yeast powder, 10g/L of peptone, 10g/L of sodium chloride, 5g/L of glucose and pH 7.0.
Example 1
A preparation method of recombinant trehalase comprises the following steps:
(1) taking a genome of Escherichia coli (Escherichia coli) BL21 as a template, and performing PCR amplification on a trehalase encoding gene trl by using a Shanghai worker Sanpfu PCR Mix kit to obtain a trl gene fragment; the nucleotide sequence of the trehalase coding gene is shown in SEQ ID NO. 1; the primers for PCR amplification are shown as SEQ ID NO.2 and SEQ ID NO. 3;
19-trl-HindIIIF:CCCAAGCTTAAAGGAGGGAAATCATGCTCAATCAGAAAATTCAAAACC(SEQ ID NO.2)；
19-trl-EcoRI：CCGGAATTCTTATGGTTCGCCGTACAAACC(SEQ ID NO.3)；
(2) cutting and connecting the trl gene fragment and the pXMJ19 plasmid by adopting HindIII and EcoRI restriction endonuclease double enzymes (Shanghai worker), converting the connecting product into E.coli DH5 alpha competence, picking a transformant and extracting a plasmid for verification to obtain a recombinant expression plasmid pXMJ 19-trl;
(3) the recombinant expression plasmid pXMJ19-trl is electrically shocked to transform corynebacterium glutamicum ATCC13032, after being shocked by 1800V for 5ms, the recombinant expression plasmid is coated on an LBG solid culture medium plate containing chloramphenicol (10mg/L), the culture is carried out for 36h at 30 ℃, grown transformant strains are cultured and plasmids are extracted for verification, and the strains which are verified to be correct are the recombinant corynebacterium glutamicum and are named as pXMJ 19-trl/13032;
(4) the method comprises the following steps of (1) carrying out induction culture on recombinant corynebacterium glutamicum to synthesize and accumulate recombinant trehalase in cells, and specifically comprises the following steps: recombinant Corynebacterium glutamicum pXMJ19-trl/13032 was streaked onto LBG solid medium plates containing chloramphenicol (10mg/L), and cultured at 30 ℃ for 36 h; the lawn on the plate is scratched by an inoculating needle and inoculated into 10mL of LBG liquid culture medium, the culture is carried out for 12h at 30 ℃ and 180r/min, then 1mL of culture solution is taken to be inoculated into 50mL of LBG liquid culture medium, the culture is carried out for 3h at 30 ℃ and 180r/min, and IPTG with the final concentration of 0.5mM is added to continue the culture for 12h at 22 ℃ and 180 r/min. And (3) centrifuging to collect thalli, suspending by using 50mM potassium phosphate buffer solution with pH7.0 and the volume of 50% of the volume of the original culture solution, ultrasonically breaking cells under the ice bath condition, and finally centrifuging to take supernatant to obtain enzyme solution containing the recombinant trehalase.
One test of the relevant Performance of the recombinant trehalase enzyme solution obtained in example 1
1. Method for detecting enzyme activity of trehalase
50 μ L of the recombinant trehalase solution prepared in example 1, diluted appropriately, was added to 5mL of a solution having a trehalose concentration of 10g/L, reacted at 30 ℃ for 10min, and then subjected to a boiling water bath for 5min, and the concentration of the resulting glucose was measured using a biosensor analyzer.
Trehalase enzyme activity definition: the amount of enzyme required to hydrolyze 1. mu. mol of trehalose to 2. mu. mol of glucose per minute was defined as one unit of enzyme activity (1U).
The experimental results are as follows: the activity of the trehalase contained in the recombinant trehalase solution was measured to be 18.2U/mL (18200U/L).
2. Research on substrate selectivity of recombinant trehalase enzyme solution
10g/L of trehalose, maltose, sucrose, lactose, cellobiose solutions were prepared using 50mM potassium phosphate buffer solution of pH7.0, 5mL of each solution was added to 50. mu.L of the recombinant trehalase enzyme solution obtained in example 1, and after reaction at 30 ℃ for 10min, the resulting solution was subjected to boiling water bath for 5min, and the concentration of glucose produced was measured using a biosensor analyzer.
The experimental results are as follows: after the addition of the recombinant trehalase solution of example 1, the glucose concentration in the reaction system of trehalose was measured to be 0.66g/L, and the glucose concentration in the reaction system of maltose, sucrose, lactose, cellobiose was measured to be 0g/L, indicating that the recombinant trehalase solution can only catalyze the hydrolysis of trehalose to produce glucose, but cannot hydrolyze maltose, sucrose, lactose, and cellobiose to produce glucose, and also demonstrating that the enzyme solution obtained by synthesizing trehalase expressed by Corynebacterium glutamicum has better substrate specificity.
3. Study on stability of recombinant trehalase enzyme solution
Taking 6ml of the recombinant trehalase liquid obtained in the example 1, adding 10% of glycerol by volume of the liquid, evenly dividing into 6 parts, respectively storing at-20 ℃, 5 ℃, 20 ℃, 30 ℃, 40 ℃ and 45 ℃, sampling at different times to detect the activity of the trehalase, wherein the enzyme activity analysis conditions are as follows: adding 50 μ L of enzyme solution into 5mL of 10g/L trehalose solution, reacting at 30 deg.C for 10min, boiling in water bath for 5min, and detecting the concentration of glucose by biosensor analyzer.
The results show that: the enzyme activity of the recombinant trehalase added with glycerol is not obviously reduced after the recombinant trehalase is frozen and stored for 90 days at the temperature of-20 ℃, the enzyme activity is not obviously reduced after the recombinant trehalase is frozen and stored for 5 days at the temperature of 5 ℃, stored for 3 days at the temperature of 20 ℃ and stored for 32 hours at the temperature of 30 ℃, the half-life period of the enzyme activity is 1 hour when the enzyme solution is stored at the temperature of 40 ℃, and the half-life period of the enzyme activity is 10 minutes when the enzyme solution is stored at the temperature of 45 ℃.
4. Effect of reaction temperature on trehalase Activity
5mL of 10g/L trehalose solution was preheated in 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃ and 70 ℃ water bath for 30min, 25. mu.L of the recombinant trehalase enzyme solution obtained in example 1 was added and preheated at 30 ℃ for 30min, after 10min of reaction, the resultant glucose concentration was measured with a biosensor analyzer in a boiling water bath for 5 min. The results are shown in FIG. 1.
As can be seen from figure 1, the optimal temperature of the enzyme solution containing the recombinant trehalase for catalyzing the hydrolysis of the trehalose is 45 ℃, and the enzyme solution can effectively catalyze the hydrolysis of the trehalose at the temperature of 30-55 ℃.
5. Effect of reaction pH on trehalase Activity
Dissolving trehalose in 50mM potassium phosphate buffer solution with pH of 5.8-7.8 to prepare 10g/L trehalose solutions with different pH values, adding 5mL of 10g/L trehalose solutions with different pH values into 25 μ L of the recombinant trehalase enzyme solution obtained in example 1, reacting at 45 ℃ for 10min, boiling water bath for 5min, and detecting the concentration of generated glucose by using a biosensor analyzer. The results are shown in FIG. 2.
As can be seen from FIG. 2, the results show that the enzyme solution containing recombinant trehalase can catalyze the hydrolysis of trehalose with optimum pH of 6.6, and can effectively catalyze the hydrolysis of trehalose in the pH range of 5.8-7.8.
6. Research on hydrolysis degree of trehalose catalyzed by recombinant trehalase enzyme liquid
0.25g/L, 0.5g/L, 1g/L, 2g/L and 4g/L of trehalose solution prepared by 50mM potassium phosphate buffer solution with pH6.6 are respectively added with 0.5mL of 8000U/L of recombinant trehalase solution, the concentration of trehalose in the reaction system is respectively 0.125g/L, 0.25g/L, 0.5g/L, 1g/L and 2g/L, after 5min reaction at 45 ℃, boiling water bath is carried out for 5min, the concentration of generated glucose is detected by a biosensor analyzer (note: the activity of the trehalose enzyme in the reaction system is 4000U/L, theoretically, 4000. mu.M trehalose can be hydrolyzed per minute to generate 8000. mu.M glucose, and 1.368g/L trehalose can be hydrolyzed per minute to generate 1.44g/L glucose, therefore, the trehalose enzyme in the reaction system of 5min is excessive, this also ensures that trehalose in the reaction system is hydrolyzed relatively thoroughly).
And detecting the concentration of the generated glucose as g and the original trehalose concentration of the reaction system as t by using a biosensor analyzer. The calculation formula of the trehalose hydrolysis rate is as follows: 100 × (g × 342 ÷ 360 ÷ t)%, 342 is the molecular weight of trehalose, and 360 is the molecular weight of trehalose hydrolyzed to two molecules of glucose. The test results are shown in table 1:
TABLE 1 glucose assay results and trehalose hydrolysis rates
| Trehalose concentration (g/L) | Glucose concentration (g/L) | Hydrolysis rate of trehalose |
| 0.125 | 0.13 | 98.8％ |
| 0.25 | 0.26 | 98.8％ |
| 0.5 | 0.51 | 96.9％ |
| 1 | 1.03 | 97.9％ |
| 2 | 2.03 | 96.4％ |
The result shows that the concentration of trehalose in the reaction system is 0.125-2 g/L, the activity of trehalase is 4000U/L, and more than 96% of trehalose in the reaction system is decomposed into glucose in 5min of reaction at 45 ℃.
Secondly, the recombinant trehalase enzyme solution obtained in example 1 is used for rapidly analyzing the content of trehalose
Trehalose synthase is utilized to catalyze maltose to convert and synthesize trehalose, and trehalose, maltose and glucose mainly exist in a reaction system. Preparing 3 groups of mixed solution containing trehalose, maltose and glucose to simulate the process of synthesizing trehalose by catalyzing the conversion of maltose by trehalose synthase. The trehalose concentrations in the 3 solutions A, B, C were 10g/L, 50g/L, and 80g/L, respectively. The reagent maltose contains a certain amount of glucose and has low purity, so that the concentration of the maltose and the glucose in the 3 groups of solutions A, B, C is about 150g/L and 10 g/L; 100g/L and 15 g/L; 60g/L and 20 g/L. The A, B, C3 group solution was diluted n times (n in this example 40) with 50mM ph6.6 potassium phosphate buffer, and the glucose concentration g1 that had been present in the diluted solution was measured with a biosensor analyzer. Meanwhile, 0.5mL of the diluted solution is taken and added with 0.5mL of 8000U/L recombinant trehalase solution respectively, the solution reacts for 5min at 45 ℃, then a boiling water bath is carried out for 5min, and a biosensor analyzer is utilized to detect the concentration g2 of the glucose after the reaction. The trehalose concentration in the original solution was: (2 Xnxnxg 2-nxg 1). times.342/360, 342 is the molecular weight of trehalose, 360 is the molecular weight of trehalose hydrolyzed to two molecules of glucose. The results of the trehalose concentration analysis in the solution are shown in table 2:
TABLE 2 analysis of trehalose concentration in solution
| Sample (I) | g1(g/L) | g2(g/L) | Trehalose analysis result (g/L) | Trehalose detection recovery rate |
| A | 0.45 | 0.36 | 10.26 | 102.6％ |
| B | 0.50 | 0.89 | 48.64 | 97.3％ |
| C | 0.59 | 1.33 | 78.66 | 98.3％ |
As can be seen from Table 2, the trehalose content in the sample can be rapidly detected by using the enzyme solution containing the recombinant trehalase, the sample treatment is simple, the time consumption is short, the equipment requirement is low, and the detection accuracy is high. And the enzyme solution containing the recombinant trehalase can be used without purification, the enzyme solution is easy to obtain, and the enzyme cost is low.
The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.
A sequence table:
SEQ ID NO.1
nucleotide sequence of trehalase coding gene of escherichia coli BL21
atgctcaatcagaaaattcaaaaccctaatccagacgaactgatgatcgaagtcgatctctgctatgagctggacccgtatgaattaaaactggatgagatgatcgaggcagaaccggaacccgagatgattgaagggctgcccgcctctgatgcgctgacgcctgccgatcgctatctcgaactgttcgagcatgttcagtcggcgaaaattttccccgacagtaaaacctttcccgactgcgcacccaaaatggacccgctggatattttaatccgctaccgtaaagtgcgccgtcatcgtgattttgacttgcgcaagtttgttgaaaatcacttctggctgccggaggtctactccagcgagtatgtatcggacccgcaaaattccctgaaagagcatatcgaccagctgtggccggtgctaacccgcgaaccacaggatcacattccgtggtcttctctactggcgctgccgcagtcatatattgtcccgggcggccgttttagcgaaacctactattgggactcctatttcaccatgctggggctggcggaaagtggtcgggaagatttactgaaatgcatggccgataacttcgcctggatgatcgaaaactatggtcacatccccaacggcaaccgcacctattatttgagccgatcgcaaccaccggtttttgcgctgatggtggagttgtttgaagaagatggtgtacgcggtgcgcgccgctatctcgaccaccttaaaatggaatatgccttctggatggacggtgcagaatcgttgatccctaatcaggcctatcgccatgttgtgcggatgccggacggatcgctgctcaaccgttattgggacgatcgcgacacgccgcgtgacgaatcctggcttgaggacgttgaaaccgcgaaacattctggtcgcccgcccaacgaggtgtaccgcgatttacgcgcgggagcggcctcaggttgggattactcttcccgttggctgcgtgatactggtcgtctggcgagcattcgtaccacccagttcatccccatcgatctgaatgccttcctgtttaaactggagagcgccatcgccaacatctcggcgctgaaaggcgagaaagagacagaagcgctgttccgccagaaggccagtgcccgtcgcgatgcggtaaaccgttacctctgggatgatgaaaacggcatctaccgcgattacgactggcgacgcgaacaactggcgctgttttccgctgccgccattgtgccgctctatgtcggcatggcgaaccatgaacaggccgatcgtctggcaaacgccgtacgcagccggttactgacacctggcgggattctggcaagcgagtacgaaaccggtgaacagtgggataaacccaatggctgggcaccgttacaatggatggcaattcagggatttaaaatgtatggcgatgaccttctgggtgatgaaatcgcgcgcagctggctgaaaacggtgaatcagttctatctggaacagcacaaaatgatcgagaaataccatattgccgatggtgttccccgcgaaggcggcggtggcgagtatccgttgcaggatgggtttggctggactaacggtgtggtacgccgtttaattggtttgtacggcgaaccataa
SEQ ID NO.2
PCR amplified primer 19-trl-HindIIIF
cccaagcttaaaggagggaaatcatgctcaatcagaaaattcaaaacc
SEQ ID NO.3
PCR amplified primer 19-trl-EcoRI
ccggaattcttatggttcgccgtacaaacc
Sequence listing
<110> Shandong Henren Industrial and trade Co Ltd
<120> preparation method and application of recombinant trehalase
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1650
<212> DNA
<213> Recombinant trehalase (Recombinant trehalase)
<400> 1
atgctcaatc agaaaattca aaaccctaat ccagacgaac tgatgatcga agtcgatctc 60
tgctatgagc tggacccgta tgaattaaaa ctggatgaga tgatcgaggc agaaccggaa 120
cccgagatga ttgaagggct gcccgcctct gatgcgctga cgcctgccga tcgctatctc 180
gaactgttcg agcatgttca gtcggcgaaa attttccccg acagtaaaac ctttcccgac 240
tgcgcaccca aaatggaccc gctggatatt ttaatccgct accgtaaagt gcgccgtcat 300
cgtgattttg acttgcgcaa gtttgttgaa aatcacttct ggctgccgga ggtctactcc 360
agcgagtatg tatcggaccc gcaaaattcc ctgaaagagc atatcgacca gctgtggccg 420
gtgctaaccc gcgaaccaca ggatcacatt ccgtggtctt ctctactggc gctgccgcag 480
tcatatattg tcccgggcgg ccgttttagc gaaacctact attgggactc ctatttcacc 540
atgctggggc tggcggaaag tggtcgggaa gatttactga aatgcatggc cgataacttc 600
gcctggatga tcgaaaacta tggtcacatc cccaacggca accgcaccta ttatttgagc 660
cgatcgcaac caccggtttt tgcgctgatg gtggagttgt ttgaagaaga tggtgtacgc 720
ggtgcgcgcc gctatctcga ccaccttaaa atggaatatg ccttctggat ggacggtgca 780
gaatcgttga tccctaatca ggcctatcgc catgttgtgc ggatgccgga cggatcgctg 840
ctcaaccgtt attgggacga tcgcgacacg ccgcgtgacg aatcctggct tgaggacgtt 900
gaaaccgcga aacattctgg tcgcccgccc aacgaggtgt accgcgattt acgcgcggga 960
gcggcctcag gttgggatta ctcttcccgt tggctgcgtg atactggtcg tctggcgagc 1020
attcgtacca cccagttcat ccccatcgat ctgaatgcct tcctgtttaa actggagagc 1080
gccatcgcca acatctcggc gctgaaaggc gagaaagaga cagaagcgct gttccgccag 1140
aaggccagtg cccgtcgcga tgcggtaaac cgttacctct gggatgatga aaacggcatc 1200
taccgcgatt acgactggcg acgcgaacaa ctggcgctgt tttccgctgc cgccattgtg 1260
ccgctctatg tcggcatggc gaaccatgaa caggccgatc gtctggcaaa cgccgtacgc 1320
agccggttac tgacacctgg cgggattctg gcaagcgagt acgaaaccgg tgaacagtgg 1380
gataaaccca atggctgggc accgttacaa tggatggcaa ttcagggatt taaaatgtat 1440
ggcgatgacc ttctgggtga tgaaatcgcg cgcagctggc tgaaaacggt gaatcagttc 1500
tatctggaac agcacaaaat gatcgagaaa taccatattg ccgatggtgt tccccgcgaa 1560
ggcggcggtg gcgagtatcc gttgcaggat gggtttggct ggactaacgg tgtggtacgc 1620
cgtttaattg gtttgtacgg cgaaccataa 1650
<210> 2
<211> 48
<212> DNA
<213> Recombinant trehalase (Recombinant trehalase)
<400> 2
cccaagctta aaggagggaa atcatgctca atcagaaaat tcaaaacc 48
<210> 3
<211> 30
<212> DNA
<213> Recombinant trehalase (Recombinant trehalase)
<400> 3
ccggaattct tatggttcgc cgtacaaacc 30
Claims (5)
1. A preparation method of recombinant trehalase is characterized by comprising the following steps:
(1) taking a genome of escherichia coli BL21 as a template, and carrying out PCR amplification on a trehalase coding gene trl to obtain a trl gene fragment; the nucleotide sequence of the trehalase coding gene is shown in SEQ ID NO. 1; the primers for PCR amplification are shown as SEQ ID NO.2 and SEQ ID NO. 3;
(2) carrying out double digestion and connection on the trl gene fragment and the pXMJ19 plasmid by adopting HindIII and EcoRI restriction endonucleases, and carrying out electric shock transformation on a connection product to obtain E.coli DH5 alpha competence to obtain a recombinant expression plasmid pXMJ 19-trl;
(3) transforming Corynebacterium glutamicum ATCC13032 by adopting recombinant expression plasmid pXMJ19-trl through electric shock to obtain recombinant Corynebacterium glutamicum;
(4) and (3) carrying out induction culture on the recombinant corynebacterium glutamicum to synthesize and accumulate the recombinant trehalase in cells, then collecting the cells, crushing and centrifuging to obtain an enzyme solution containing the recombinant trehalase.
2. The method for preparing recombinant trehalase according to claim 1, wherein in step (2), the conditions for shock transformation are: 1800V, 5 ms.
3. The method for producing recombinant trehalase according to claim 1 or 2, wherein in step (4), the conditions for the induction culture are: the IPTG induction concentration is 0.5mM, the induction temperature is 22-30 ℃, and the induction time is 10-15 h.
4. Use of the recombinant trehalase prepared by the method of claim 1 or 2 or 3 for the detection of trehalose content.
5. The application of claim 4, wherein the application method is as follows: diluting a sample to be detected to the trehalose concentration of 0.125-2 g/L, adding 4000U/L of trehalase, reacting for 5min at 45 ℃, and calculating the trehalose concentration in the sample by analyzing the increase of the glucose concentration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210062138.9A CN114395578A (en) | 2022-01-19 | 2022-01-19 | Preparation method and application of recombinant trehalase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210062138.9A CN114395578A (en) | 2022-01-19 | 2022-01-19 | Preparation method and application of recombinant trehalase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114395578A true CN114395578A (en) | 2022-04-26 |
Family
ID=81230738
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210062138.9A Pending CN114395578A (en) | 2022-01-19 | 2022-01-19 | Preparation method and application of recombinant trehalase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114395578A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116121225A (en) * | 2022-09-17 | 2023-05-16 | 石河子大学 | Low-temperature trehalase, coding sequence thereof, high-yield recombinant strain and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997038111A1 (en) * | 1996-04-09 | 1997-10-16 | Orsan | Method for producing an amino acid by fermenting corynebacteria expressing trehalase activity |
| CN102559507A (en) * | 2010-12-14 | 2012-07-11 | 财团法人工业技术研究院 | Cell for preparing competent cell and use thereof, novel escherichia coli and use thereof, and method for preparing competent cell |
| CN106754601A (en) * | 2016-12-21 | 2017-05-31 | 江南大学 | A kind of application phospholipase C by intracellular protein extracellular expression method |
-
2022
- 2022-01-19 CN CN202210062138.9A patent/CN114395578A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997038111A1 (en) * | 1996-04-09 | 1997-10-16 | Orsan | Method for producing an amino acid by fermenting corynebacteria expressing trehalase activity |
| CN102559507A (en) * | 2010-12-14 | 2012-07-11 | 财团法人工业技术研究院 | Cell for preparing competent cell and use thereof, novel escherichia coli and use thereof, and method for preparing competent cell |
| CN106754601A (en) * | 2016-12-21 | 2017-05-31 | 江南大学 | A kind of application phospholipase C by intracellular protein extracellular expression method |
Non-Patent Citations (4)
| Title |
|---|
| XIUXIA LIU 等: "Expression of recombinant protein using Corynebacterium Glutamicum: progress, challenges and applications", CRITICAL REVIEWS IN BIOTECHNOLOGY, vol. 36, no. 4, pages 652 - 664 * |
| 于林港 等: "Escherichia coli str.K-12 substr.MG1655海藻糖酶Tre F的重组表达及性质研究", 生物技术通报, vol. 33, no. 4, pages 177 - 184 * |
| 无: "Escherichia coli BL21(DE3) chromosome, complete genome", GENBANK: CP053602.1, pages 3532078 * |
| 谢俊飞: "海藻糖含量测定方法", pages 2, Retrieved from the Internet <URL:https://www.jianshu.com/p/8962bd3c0fef> * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116121225A (en) * | 2022-09-17 | 2023-05-16 | 石河子大学 | Low-temperature trehalase, coding sequence thereof, high-yield recombinant strain and application |
| CN116121225B (en) * | 2022-09-17 | 2024-04-26 | 石河子大学 | Low-temperature trehalase, coding sequence, recombinant strain and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110438136B (en) | Beta-glucosidase and mutant gene, amino acid sequence and application thereof | |
| CN110066777B (en) | Endo-inulase and application thereof in production of fructo-oligosaccharide | |
| CN106566823B (en) | Cloning and application of glutamate decarboxylase gene | |
| CN112941089B (en) | Alginate lyase mutant gene, alginate lyase mutant, engineering bacterium containing mutant, construction method and application | |
| CN115960875A (en) | Alginate lyase mutant enzyme with improved thermal stability | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN114395578A (en) | Preparation method and application of recombinant trehalase | |
| CN113337495B (en) | Method for improving sialic acid yield and application | |
| CN116676296A (en) | Beta-1, 3-glucanase mutants with improved enzymatic activity | |
| KR20100040438A (en) | A novel agarase and an enzymatic production method of agarooligosaccharide from agarose using the same | |
| CN112575007B (en) | Application of ganoderma lucidum pyruvic acid transport protein gene in regulation and control of ganoderma lucidum cellulase activity | |
| US11760988B2 (en) | L-aspartate alpha-decarboxylase mutant and application thereof | |
| CN110592055B (en) | Creatine hydrolase mutant with improved thermal stability | |
| CN113913399A (en) | Ketopantolactone reductase derived from Candida maltosa Xu316 | |
| CN112921025A (en) | Mutant of epimerase, coding gene, amino acid sequence and application thereof | |
| CN112175974A (en) | Chitin deacetylase gene, chitin deacetylase and preparation method and application thereof | |
| CN101407820B (en) | Gene of encoding glycosyl hydrolase family 32 sucrase and use thereof | |
| CN114672522B (en) | Method for producing 2-keto-3-deoxy-D-gluconic acid by catalyzing N-acetyl-D-gluconolactone with double enzymes | |
| CN114196659B (en) | Amidase mutant, coding gene, engineering bacteria and application thereof | |
| CN114015673B (en) | Lipase Sv-lip5 and application thereof in hydrolysis of astaxanthin ester | |
| CN113621548B (en) | Method for producing levodopa based on vibrio natrii | |
| AU2021100409A4 (en) | Recombinant low-temperature catalase, recombinant vector and engineered strain thereof | |
| CN102409033B (en) | N-carbamyl-L-cysteine (L-NCC) amidohydrolase, encoding gene and application of recombinant expressed protein of L-NCC amidohydrolase | |
| JP3557276B2 (en) | DNA encoding an enzyme, recombinant DNA containing the same, and transformant | |
| CN118222540A (en) | Heat-resistant plastic hydrolase AtPETase mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |