FI95726B - Diagnostic processes and determination series which use hepatitis B virus surface antigens which have been prepared by recombinant DNA technology - Google Patents

Abstract

Bacterial plasmids, which contain a region which encodes pre-S1-pre-S2-S- protein but lack chains which encode hepatitis B virus core antigen, are used for transfecting eucaryotic cell lines for the purpose of producing particles which contain polypeptides which are encoded by the pre S1-pre-S2-S- protein-encoding region.

Description

- 95726

This invention relates to plasmids of bacterial origin comprising the PreS2-PreS2-S protein coding region but lacking the hepatitis B virus core antigen coding chains, and the assays to the hepatitis B virus surface antigen. which plasmids are used to transfect eukaryotic cell lines to produce particles containing polypeptides encoded by the PreS1-PreS2-S protein coding region.

Recent advances in genetic engineering make it possible for numerous peptides and proteins to be expressed in increasing amounts in bacterial, yeast, and mammalian cells. Although many proteins and peptides have been expressed in significant amounts in bacteria, there is a particular desire to express high levels of proteins and polypeptides used in human medicine in mammalian cells to avoid the disadvantages of bacterial cell-derived, potentially contaminating products.

Of particular interest is the expression of hepatitis B virus surface antigen proteins in high amounts in mammalian cells. The level of expression of these proteins in mammalian cells has so far not been so high that economic production of these polypeptides would have been possible.

The hepatitis B virus is transmitted from person to person and causes a chronic and debilitating infection that results in severe damage to the liver, mainly carcinoma, and death. In most cases, complete recovery from hepatitis B virus infection is expected. However, in many African and Asian countries hepatitis 2 / -. r * r1 - yo // .υ The infection caused by the B virus is endemic. A very large number of individuals in the population of these countries are chronic carriers of the hepatitis B virus, with the risk that they may potentially spread the disease further.

Vaccination is the only known means of protection against hepatitis B virus. Recently, many companies (e.g., Merck, Sharp & Dohme, USA, and Pasteur Institute, France) have introduced a plasma-derived vaccine against the hepatitis B virus. This vaccine contains hepatitis B virus proteins as an antigen, which are usually located on the surface of the viral particle housing. Such an antigen is commonly referred to as hepatitis B virus surface antigen (HBsAg) and the viral gene encoding this antigen is called HBsAG gene. The above vaccines contain a surface antigen isolated from human plasma infected with hepatitis B virus. Although the surface antigen itself is not pathogenic, it nevertheless stimulates the production of antibodies against hepatitis B virus particles in humans.

The only commercially available source of hepatitis B virus surface antigen is the blood of people infected with hepatitis B virus. Isolation and purification of surface antigen from human serum is cumbersome and time consuming and therefore relatively expensive. In addition, as long as human serum is the only commercially available source of surface antigen, the amount of surface antigen available for vaccines remains limited.

Considering large-scale vaccinations, especially in areas where hepatitis B virus is endemic, it would be very important to have a cheap and virtually inexhaustible source of hepatitis B virus surface antigen, due to the risk of contamination with pathogenic agents when surface antigen is isolated from human serum, it is desirable that 3,95726 human sera not be used as a source of surface antigen. At present, there is also no known biological system other than humans and chimpanzees in which the hepatitis B virus could grow and be propagated.

Recent advances in molecular biology have made it possible to clone the sequence in the complete genome of the hepatitis B virus (Siddiqui, A. et al., Proc. Natl. Aca. Sci., USA, Vol. 76, p. 4664, 1979; Sninsky, JJ et al., Nature, Vol. 279, p. 346, 1979; and Charnay, P. et al., Nucl. Acids Res., Vol. 7, p. 335, 1979). In addition, regions encoding different viral proteins of the hepatitis B virus have been identified (see, for example, European Patent Applications Nos. 13828, 20251 and 38765 and Galibert et al., Nature,

Butter. 281, pages 646-650, 1979; Pasek et al., Nature,

Butter. 282, pages 575-579, 1979; and Valenzuela et al.,

Nature, Vol. 280, pages 815-819, 1979).

In line with this development, numerous host systems have been tested to express the portion of the viral genome that encodes hepatitis B virus surface antigen proteins.

It has been shown on many occasions that in the case of certain eukaryotic products, bacteria can act as a cheap production system. However, many difficulties are encountered when eukaryotic products are synthesized in bacteria. For example; 1) the eukaryotic structural gene may not be efficiently replicated in bacteria because the use of codons in bacteria differs from the use of codons in eukaryotes; 2) the eukaryotic gene product may be toxic to the host bacterial cell; 3) the structure and function of a eukaryotic gene product may depend on certain post-reading processes, such as 4 95726 glycosylation or specific coupling of disulfide bonds, neither of which is achieved in a bacterial host; 4) the gene product is rarely secreted from the host bacterial cell; 5) eukaryotic promoters do not normally function in bacteria and must be replaced by a bacterial-derived promoter, and such replacement may result in modification of the eukaryotic gene product, e.g., the N-terminal portion of the product is derived from the bacterium and comprises N-formylmethionine as its first amino acid. , and which may serve as a novel immunogenic determinant for the mammalian immune system; and 6) during the purification step, components derived from the cell walls of the bacterium may be cleared with the gene product and may cause severe allergic reactions or may lead to anaphylactic shock in the mammal receiving the gene product.

Hepatitis B virus surface antigen produced in bacteria has been associated with difficulties. Firstly, the level of production in the bacteria is very low and in addition to this the purification has to start from the bacterial lysate, because the product is not secreted outside the bacterial cells. Another problem is the absence of certain post-reading processes in the bacteria, for example glycosylation of the surface antigen, which affects the level of specificity of the immune response. For all of these reasons, it is desirable that bacteria not be used as hosts in protein production.

Yeast cells transformed with an appropriate recombinant vector containing a chain encoding a hepatitis B virus surface antigen synthesize said surface antigen, which accumulates in significant amounts in yeast culture. This host system also has some significant disadvantages, such as 1) the surface antigen is not secreted from yeast cells and must be isolated from the cell lysate of these cells, and 2) the surface antigen monomers formed in the yeast cells do not form covalently linked dimers such as mammalian antigen secreted cells.

Many attempts have been made in the art to provide mammalian cell lines that produce surface antigen. These cell lines have been derived from human hepatocellular (liver cell) carcinomas (Alexander, J.J. et al.,

Afr. Med. J., Vol. 50, p. 2124, 1976) as well as from cells transfected with cloned hepatitis B virus DNA. In addition, monkey kidney cells have been infected with recombinant DNA vectors based on simian virus 40 (SV40) comprising 40% of the hepatitis B virus genome (Laub, O. et al., J. of Virol., Vol. 48, p. 271 , 1983). Similarly, methods based on co-transfection have been used to select cell lines expressing surface antigen (Standring, D.N. et al., J. of Virol., Vol. 50, p. 563, 1984). The dihydrofolate reductase (DHFR) gene has been used to generate large amounts of antigen-producing mammalian cell lines (Michel et al., Proc. Natl.

Aca. Sci., Vol. 81, p. 7708, 1984). Likewise, eukaryotic viral vectors with selectable labeling. a transformed phenotype is used (Hsiung, N.

et al., Molec. and Applied Genetics, Vol. 2, p. 497, 1984) has been used to transfer the surface antigen gene into mammalian cells. In these cases, oncogenic DNA strand and containing DNA constructs, or DNA strands derived from oncogenic viruses, were used to select surface antigen-producing cell lines. The use of an oncogenic chain as a marker of selection again poses new safety concerns if the surface antigen of these cells is used in vaccinations.

Many publications look at the expression of polypeptides synthesized by the hepatitis B virus coding chain.

6 95726

European patent application no. 013 828-A1 states that nucleotide strands encoding a fragment of 163 amino acid residues (PreSr coding region) located in the HBV genome immediately before the S-protein coding region may also be included in those fragments used for the use of useful recombinant DNA molecules. to produce polypeptides having hepatitis B virus surface antigen antigenicity. It is further disclosed that gene fragments comprising both the HBsAg-associated precursor chain and the associated structural gene can be excised using one or more of a number of restriction endonucleases before or during the construction of the cloning vector. It is further suggested that the 163 codon precursor preceding the structural gene encoding the HBsAg protein should be excised from the cloning vehicle containing the S protein coding chain before the vector is used for transformation.

European patent application no. 072 318-82 describes a method for producing HBsAgr by culturing yeast cells transformed with a vector comprising a yeast replicon, a yeast promoter, and a DNA portion encoding an S protein, and in particular a 163 codon precursor preceding a structural gene encoding an HBsAg protein. Also described is a vaccine comprising HBsAg antigen, and a method for obtaining an antibody to HBsAg antigen by purifying the antibody from the serum of animals immunized against HBsAg antigen. Also described is an antigen particle of 14 to 18 nm capable of forming an immune complex with an antibody to HBsAg.

Il 7 95726

In Feitelson et al., Virology, Vol. 130, pages 75-90, 1983, states that many surface antigen-related polypeptides can be partially encoded within the PreS protein coding chain, for example, 24,000, 28,000, 32,000, 43,000, and 50,000 dalton polypeptides.

In Laub et al., J. Virol., Vol. 48, No. 1, pages 271-180, 1983, is described as being based on simian virus. generation of an early replacement vector comprising a structural gene encoding an HBsAg antigen and a precursor chain of 163 codons immediately preceding that structural gene and expression of this coding chain in SV40-transformed CV-1 cells (COS cells) transformed with such a vector. Laub et al. also show that HBsAg antigen is expressed more in COS cells transformed with a vector containing only the S protein coding chain than in COS cells whose transformation vector contains a 163 codon precursor immediately upstream of the structural gene encoding HBsAg antigen.

JP patent application no. J5-8194-897-A (Takeda I) describes HBV DNA (adw subtype) encoding the entire PreS-S protein polypeptide and a vector containing this rwa *, and a host transformed with this DNA. In JP patent application no. J5-9080-615-A (Takeda II) describes HBV DNA (adw subtype) encoding the entire PreS-S protein polypeptide, as well as the polypeptide produced by this DNA and its use as a vaccine. In JP patent application no. J5-9074-985-A (Takeda III) describes a DNA fragment containing one or more chains encoding the entire adw-type PreS-S protein, a chain encoding S protein 8 95726, or a hepatitis B virus core antigen (HBcAg ), a vector containing such DNA, and host cells transformed with this DNA.

Takeda III states that the 43,000 dalton polypeptide encoded by the PreS-S protein coding chain "can be used as a vaccine to prevent HBV infections". Takeda III describes the cloning of a chain encoding a PreS-S protein into E. coli and the identification of a polypeptide produced by this chain.

At a presentation given by the European Association of Clinical Microbiology in Bologna on 18 October 1983, Gerlich stated that four possible genes for HBV had been inferred from the DNA strand of cloned HBV DNA; that the HBV virus surface protein gene (S gene) consists of a single uninterrupted coding chain that is counted as at least three polypeptides; that the chain of the major protein, P24, and its glycosylated form, GP27, begins at the third conserved reading-related initiation signal of the S gene; that the smaller surface proteins, GP33 or GP36, start at the second trigger signal; that only the HBV P41 polypeptide is likely to use the full-length coding chain of the S gene; that P41 contains the major antigenic determinant of HBV; and that it is present only in complete viral particles, but not in the 20 nm particles of excess surface antigen from which current hepatitis B vaccines are derived.

Gerlich does not specifically address the PreS1 region of the P41 polypeptide or the fact that this PreS1 region specifically contains an antigenic determinant that could be useful in an HBV vaccine.

In Stibbe et al., Develop. Biol. Standard, Vol.

'54, pages 33-43, 1983, presented at the Second WHO / IABS Symposium on 9 95726 Viral Hepatitis in Athens: Standardization in Immunoprophylaxis of Infections by Hepatitis Viruses, Athens, Greece, 1982, states that HBV-infected people the 20 nm particles of serum HBsAg antigen contain at least three minor proteins, GP33, GP36, and P41, as confirmed by electrophoresis on an SDS gel. Stibbe et al. conclude that GP33 and GP36 are unlikely to be essential components of the HBV vaccine. Stibbe et al. do not specifically interfere with the PreS1 region of the P41 protein or that this region specifically contains an antigenic determinant that could be useful in an HBV vaccine.

In Stibbe et al., J. Virol., Vol. 46, no. 2, pages 626-628, 1983, discloses that minor glycoproteins derived from the coding region of the HBsAg antigen, abbreviated GP33 and GP36, are encoded by the PreS2-S protein coding chain. The PreS2 region is part of the PreS coding region in the hepatitis B virus genome and encodes the first 55 amino acids immediately before the S protein.

Neurath et al., Science, 224, pp. 392-394, 1984, discloses that a polypeptide having an sequence identical to the 26 amino acids at the amino terminus of the PreS2 region acts as a highly potent immunogen, and suggests that antibodies formed by this immunogen substances can be used in diagnostic tests.

In Heerman et al., J. Virol., Vol. 52, no. 2, pages 396-402, 1984, describes the entire 389 amino acid coding chain containing both the S protein coding chain and the PreS protein coding chain, encoding polypeptide P39 present in naturally occurring HBV particles and viral surface antigen strands, its glycosylated 95 in addition to Form G? 42, as well as other HSV surface antigen-related polypeptides P24, GP27, GP33 and GP36. Heerman et al. also show that a unique part of the P39 / P42 protein, i.e. its PreS1 region, bound monoclonal antibodies induced by immunization with HBV particles. They suggest that this PreS 2 region is likely to be highly immunogenic. The PreS2 region is the portion of the PreS protein coding region immediately preceding the PreS2 domain and comprises chains encoding amino acids 1-108 (or 1-122, depending on the virus subtype) that amino acids immediately form in PreS2 ~. a fragment preceding the chain encoding the protein. Heerman et al. also note that the chains of the PreS region may be of interest in the search for immunogenic and protective poly- or oligopeptides that act as an alternative vaccine against HBV.

In Michel et al., Proc. Natl. Acad. Sci. U.S,

Butter. 81, pages 7708-7712, 1984, discloses the synthesis of HBsAg antigen carrying human serum polyalbumin receptors in Chinese hamster ovary (CHO) cells transfected with a plasmid comprising the chain encoding the PreS2-S protein.

In Cattaneo et al., Nature, Vol. 305, pages 335-338, 1985, discloses that the S gene of the HBV genome initiates reading at the beginning of the PreS region (i.e., 489 nucleotides or 163 codons upstream of the S gene), and that the mRNA is modified / polyadenylated at a site within this core gene. .

In Persing et al., Proc. Natl. Acad. Sci. U.S,

Butter. 82, pages 3440-3444, 1985, discloses that mouse L cells transformed with the chain encoding the PreS2 “S protein produce three HBsAg antigen-related polypeptides with molecular weights of 24,000, 27,000, and 35,000 daltons, and which all are organized into multifilament immunoreactive HBsAg particles 22 nm in diameter that bind to polymerized human serum albumin (HSA; human serum albumin); whereas, in the vicinity of the 3 "end of the PreS2 region, mouse L cells transformed with a chain encoding a PreS2-S protein encoding a framework transition mutation produce only 24,000 and 27,000 daiton polypeptides organized into 22 nm diameter immunoreactions. Persing et al conclude that the PreS2-S protein coding chain encodes a 35,000 daiton polypeptide, the PreS2 protein coding moiety conferring the ability of the HBsAg antigen to bind to human serum albumin, but does not require it. For the formation and secretion of HBsAg particles, and that the HBsAg antigen-dominant polypeptide (i.e., a 24,000 daiton polypeptide) is not obtained by cleavage of larger precursors (i.e., 27,000 and 35,000 daiton polypeptides) encoded primarily by the PreS2-S protein coding chain.

In Milich et al., Science, Vol. 228, pages 1195-1199, 1985, discloses that vaccines containing HBsAg particles comprising both PreS2 and HBsAg amino acids, which HBsAg particles were secreted from a Chinese hamster ovary transfected with a plasmid containing a chain encoding the PreS2-S protein, (CHO cells), inactivity to HBsAg-only vaccines can be avoided because the immunogenic response induced by HBsAgm is independent of the immunogenic response elicited by PreS2 and that the 33,000 daiton polypeptide encoded by the PreS2-S protein coding chain the 26 amino acid residues at the amino terminus form an antibody-bound binding site in the PreS1 region.

In Neurath et al., Nature, Vol. 315, pages 154-156, 1985, discloses that the PreS2 region encodes a HBV envelope surface 12,957,726 protein, the immunological regions of which are specifically recognized by liver cells; The chain encoding the PreS2-S protein encodes a protein present in HBV particles; The synthetic peptides corresponding to the gene encoding the PreS2 protein are highly immunogenic and the publication concludes that HBV vaccines should contain the PreS2 protein.

At the Bio-Expo-5 Congress in Boston on May 15, 1985, Valenzuela published the expression of the entire PreS2 protein coding chain in yeast, and he argued that such yeast cells indeed synthesize particles containing both HBsAg and PreS2 peptide, which are well found by electron microscopy and deposition. similar to HBsAg-only particles, and the PreS2 region does not interfere with the ability to form 22-nanometer HBsAg particles. Valenzuela also argues that it has been hypothesized that HBV enters the liver by binding polyalbumin to its polyalbumin receptor, which in turn binds to the polyalbumin receptor in the liver, thereby internalizing the virus. The PreS2 region encodes the HBV polyalbumin receptor. Valenzuela concludes that the PreS2-containing protein produces antibodies that, in addition to inactivating the HBV virus by a normal mechanism, may affect the mechanism by which the virus invades liver cells. See also Valenzuela et al., Biotechnology, Vol. 3. pp. 317-320, 1985.

In Valenzuela et al., Biotechnology, Vol. 3, pages 323-327, 1985, discloses the use of the HBsAg antigen-associated polyalbumin receptor encoded by the PreS2 protein coding region for the preparation of polyvalent vaccines. Valenzuela prepared a hybrid particle from the HBsAg antigen and and from Herpes simplex 1 virus glycoprotein D (HSV1gD) by expressing the entire HSV1gD-PreS2-S protein coding chain in yeast.

I! 95726 1 3

European patent application no. 0 154 902-A2 describes a hepatitis B vaccine comprising a peptide comprising an amino acid chain of at least six contiguous amino acids belonging to the region encoded by the PreS gene in the housing of the hepatitis B virus.

This vaccine does not contain amino acid chains corresponding to the naturally occurring envelope proteins of the hepatitis B virus, nor a physiologically acceptable diluent. The peptide may be free or may be coupled to a carrier.

In Kent et al., Pept. Chem., Vol. 22, pages 167-70, 1984, discloses that a chemically synthesized peptide comprising 26 amino acids of the N-terminus from the PreS2 region is a very good antigen and that it is a possibility for a synthetic vaccine.

In Lo et al., Biochem. Biophys. Res. CONUN. ,

Butter. 129, No. 3, pages 797-803, 1985, for the different subtypes of HBV virus (adw, adr, ayw and ayw), show the characteristics of a map obtained from full-length HBV DNA with restriction endonucleases, including a map obtained from the entire PreS region with restriction endonucleases. characteristic features. Lo et al. also disclose the cloning and expression of full-length HBV DNA in E. coli using the expression vector pUC8 and state that they intend to use such an HBV gene product expressed in either prokaryotic or eukaryotic cells as a diagnostic agent and vaccine source.

In Wong et al., J. Virology, Vol. 55, No. 1, pages 223-231, 1985, discloses the identification of two HBV polypeptides encoded by the entire open reading frame of the PreS protein, i.e., 42 and 46 kilodaltons of glycosylated polypeptides, which polypeptides contain 14,957,726 determinants from both the HBsAg and PreS regions. Wong et al. also show the expression of a triple fusion protein containing 108 amino acids corresponding to amino acids 27-133 of the N-terminus of the 174 amino acids of the PreS region (adv ^ subtype) and the β-galactosidase and chloramphenicol acetyltransferase chains. This peptide contains 15 amino acids from the PreS2 region and 93 amino acids from the PreS2 region. Wong et al. also show that (a) the polyclonal antiserum formed by this triple fusion protein was able to recognize 42 and 46 kilodalton polypeptides from preparations of partially purified viral particles, and (b) the glycosylated 42 and 46 kilodalton polypeptides appear to correspond to the aforementioned Heerman et al. the 39 and 42 kilodalton non-glycosylated polypeptides described in the publication.

In Offensperger et al., Proc. Natl. Acad. Sci.

USA, Vol. 82, pages 7540-7544, 1985, discloses the expression of a cloned DNA strand encoding a fusion protein between a PreS2 peptide and a β-galactosidase in E. coli cells.

Numerous literature references consider plasmids containing the promoter of the mouse metallothionein gene.

As well as in U.S. Patent Application no. 452,783 that Pavlakis et al., Proc. Natl. Acad. Sci. USA, Vol. 80, page 397, 1983, discloses a recombinant plasmid based on bovine papillomavirus containing the human growth hormone (hGH) gene and the metallothionein gene (MMT) promoter.

: European Patent Application No. EP 0 105 141A2 discloses recombinant plasmids comprising a chain encoding S-protein 95726 and both bovine papillomavirus type 1 DNA or Maloney mouse sarcoma virus DNA.

Hofschneiderin et al. plasmids preferably use a natural promoter linked to the S-protein coding chain, but the Hofschneider reference also states (without giving an example) that "/ as another example of a preferred natural eukaryotic expression signal, a metallothionein signal from a mouse cell" may be mentioned.

European patent application no. 0 096 492A2 discloses the use of plasmids containing the entire metallothionein gene chain, including the promoter region, to induce strong expression of genes downstream of the MMT gene in host mammalian cells transformed with such a plasmid.

PCT Patent Application No. WO 83/01783 and Palmiter et al., Cell, Vol. 29, page 701, 1982, discloses a plasmid comprising a promoter of the murine MT-1 gene fused to a structural gene (preferably a thymidine kinase gene from herpes simplex virus) and microinjection of these plasmids into mouse fetuses and states that the result genetic of the fusion polypeptide product. expression in specialized cells of adult mice formed from these fetuses can then be regulated by administering heavy metal ions to the mouse. Palmiter et al. likewise disclose plasmids containing the murine MT-1 promoter fused to rat growth hormone, microinjection of these plasmids into mouse fetuses, and heavy metals for regulating the genetic expression of the resulting fused polypeptide product.

95726 16 The present invention utilizes a recombinant particle comprising at least one protein encoded by the entire PreS1 PreSj coding region.

The present invention also uses a recombinant DNA vector comprising the PreS, PreS2 protein coding region and the mouse metallothionein (MMT) promoter. It is desirable that this vector further comprises a copy termination site and a selection marker.

The present invention also uses a host-transfected eukaryotic cell transfected with a recombinant DNA vector comprising the PreS, PreS2 protein coding region and the MMT promoter. It is recommended that this vector further include a copy termination site and a selection marker. The mammalian cell is the best host. Also provided is a method of producing such a transfected host cell, the method comprising transfecting a eukaryotic cell with a recombinant DNA vector of the present invention.

Also provided is a method of making particles comprising at least one protein encoded by the entire PreS1-PreS2 coding region, the method comprising (a) culturing the transfected host eukaryotic cells of this invention under conditions such as that of the host. such a protein; and (b) isolating these particles. Preferably, the transfected host is capable of secreting proteins accumulated into these particles into the medium. This method preferably further comprises adding heavy metal ions or steroid hormones to such a culture medium, which promotes the expression of proteins.

This invention relates to a method for detecting the presence of 17,957,26 antibodies to proteins encoded by the PreS1 PreSj protein coding region in a sample obtained from mammalian blood serum, the method comprising the steps of: a) contacting the sample with an unlabeled particle coated solid of the invention; (b) incubating and washing said contacted sample; c) contacting said contacted sample with the labeled particles of this invention to obtain a labeled, contacted sample; d) incubating and washing said labeled, contacted sample; and e) determining the number of labeled particles in the labeled, contacted sample.

The present invention also relates to a method for detecting the presence of proteins encoded by the PreS1-PreSj-S coding region in a sample obtained from mammalian blood serum, the method comprising the steps of: a) preparing a composition comprising an antibody produced by an immunogen comprising the particles of the invention; (b) contacting the sample with the first portion of this mixture and the labeled immunogen, incubating the first portion and washing; (c) contacting the antigen-free reference sample with the second portion of this mixture and the labeled immunogen, incubating the second portion and washing; d) adding the same amount of staphylococcus comprising protein A to the mixtures of steps b) and c) above, incubating both mixtures and separating the liquid from the solid; and e) determining the amount of labeled immunogen in each of the resulting mixtures in step d) above.

The present invention is also directed to the packaging ("putty") of ready-to-use diagnostic agents for the PreS, PreS2-S protein. 95726 for detecting the presence of antibodies to proteins encoded by the 18-region region from a sample obtained from mammalian blood serum, the kit comprising: a) unlabeled proteins comprising a particle of the present invention attached to a solid support; and b) labeled antibodies against human IgG or IgM, for example.

The present invention is also directed to a diagnostic kit for detecting the presence of proteins encoded by the coding region of the PreS, PreS2-S protein from a sample obtained from mammalian blood serum, said kit comprising: a) antibodies supported by the particles of this invention attached to a solid support; and b) labeled antibodies produced by the particles of this invention.

The essential features of the invention are set out in the appended claims.

The present invention uses a co-transfected eukaryotic host cell transfected with both the recombinant DNA vector disclosed herein and another recombinant DNA vector comprising the PreS2-S protein coding region or the S protein-only coding region and the MMT promoter. This second recombinant vector preferably further comprises a copy end point and optionally a selection marker. Optionally, this co-transfected host is transfected with both a recombinant DNA vector of the present invention, a second recombinant DNA vector, and a third recombinant DNA vector comprising an MMT promoter and a selection marker. This third recombinant vector preferably further comprises an end point for copying.

Figure 1 shows a partial map of plasmid pBPV342-12 obtained with restriction endonucleases. Figure 1 also shows the location of plasmid pML2-derived DNA, bovine papilloma virus (BPV) DNA, MMT promoter, and copy termination region sv-PAS-t in plasmid pBPV342-12. Figure 1 also shows the digestion of plasmid pBPV342-12 with the restriction endonuclease BamHI.

Figure 2 shows a partial map of restriction endonucleases of plasmid pAO1 containing the complete linear genome of hepatitis B virus.

Similarly, Figure 2 illustrates the cleavage of plasmid pAO1 with the restriction endonuclease EcoRI, the ligation of a linear HBV product obtained with the enzyme EcoRI with T4 DNA ligase to form concatamers, and the cleavage of the resulting concatamer product -product-S an intact coding DNA strand associated with the coding region.

Figure 3 shows a partial map of plasmid pDM1 obtained by restriction endonucleases and likewise illustrates its construction by ligating a BamHI-derived DNA fragment comprising plasmid pMMT-neo to Ball1-derived. hepatitis B virus genomic fragment encoding the PreSj-PreS2-S protein coding chain.

Figures 4A and 4B show a partial map of plasmid pDM2 obtained with restriction endonucleases and illustrate its construction by ligating a fragment obtained with restriction endonuclease BamHI and a fragment obtained with restriction endonucleases BamHI and BglII, both from plasmid pDM1.

Figure 5 shows a partial map of plasmid pDM3 obtained by restriction endonucleases and illustrates the plasmids pDM1 and PMMT-neo formed by it.

Figure 6 is a graph illustrating the elution of particles of this invention from a BioRad column A5m.

20 95726

Figure 7 is a graphical representation of typical isopycnic CsCl centrifugation of the particles of this invention, starting with about 30 fractions from the first peak obtained from the BioRad column A5m.

Figures 8A, 8B and 8C are curves illustrating the seropositive conversion induced by different dilutions of the purified particles of this invention in mice.

Figures 9A and 9B show a partial map of plasmid pENDO-1 obtained by restriction endonucleases and illustrate its multistep construction.

Figure 10 shows a partial map of plasmid pENDO-2 obtained with restriction endonucleases and illustrates its generation by ligating DNA fragments obtained from plasmids pENDO1 and pDM2 with restriction endonucleases.

Figure 11 shows a partial map of plasmid pENDO-O obtained by restriction endonucleases and illustrates its construction.

The term "PreS, PreS2-S protein coding region" refers to that region of the HBV virus DNA genome that encodes the entire polypeptide known as the PreS, PreS2-S polypeptide, and that region comprises all codons from the first methionine codon to the final termination codon. (TAA), which does not determine the incorporation of any amino acid but which results in the termination of the reading, or any functional derivative of such a coding region. Proteins encoded by this region include, for example, PreS, -PreS2-S polypeptide (389 amino acid residues in HBV subtype adw for example), PreS2-S polypeptide (281 amino acid residues in HBV subtype adw, for example), and S polypeptide (226 amino acid residues in HBV subtype adw, for example). The most preferred regions encoding the PreSi-PreS2-S protein are from the following subtypes: adr, ayw, adyw, and adw. The term "functional derivative" refers to any derivative of the coding region of the PreS1-PreS2-S protein whose encoded polypeptides, when assembled into particles, function in substantially the same manner as the coding region of the native PreS1-PreS2-S protein. a particle formed by aggregation of polypeptides. These derivatives include partial chains of the coding region of the PreSj-PreSj-S protein, as well as derivatives obtained by modification from such a coding region. Techniques for modifying such a coding region are known in the art and include, for example, chemical or biological mutagenic treatment, irradiation, or direct genetic manipulation, such as insertion, deletion, or replacement of nucleic acids using enzymes or other methods of recombinant DNA technology and molecular biology.

The term "PreS2-S protein coding chain" refers to that region of the HBV virus DNA genome that encodes the entire polypeptide known as the PreS2-S polypeptide and that region comprises all codons from the first methionine codon to the final termination codon (TAA) that does not determine the incorporation of any amino acid, as described above, or any functional derivative of such a coding region. Proteins encoded by this region include, for example, the PreS2-S polypeptide (218 amino acid residues in the HBV subtype adw) and the S polypeptide (226 amino acid residues in the HBV subtype adw, for example). The most preferred coding regions for the PreS2-S protein are from the following subtypes: adr, ayw, adyw, and adw. The term "functional derivative" refers to any derivative of the PreS2-S protein coding region whose polypeptides, when assembled into particles, function in substantially the same manner as a particle formed by aggregation of polypeptides repaired by the native Pres2-S protein coding region. Such derivatives include, for example, partial chains of the PreS2-S protein coding region and derivatives obtained from such a 22 9 5 7 2 6 coding region by modification. Techniques that can be used to transform such a coding region are known in the art and some of these have been described above.

The term "S-protein coding chain" refers to that region of the HBV virus DNA genome that encodes the entire polypeptide known as the S-polypeptide and that includes all codons from the first methionine codon to the final termination codon (TAA), which does not specify any amino acid insertion as described above, or any functional derivative of such a coding region. Proteins encoded by this region include, for example, the S-peptide (226 amino acid residues in the HBV subtype adw, for example). The most preferred S protein coding regions are from the following HBV subtypes: adr, ayw, adyw, and adw. The term "functional derivative" refers to any derivative of the S protein coding region that, when assembled into a particle, encodes the polypeptides in substantially the same manner as a particle formed by the accumulation of polypeptides encoded by the native S protein coding region. These derivatives include, for example, partial chains of the S protein coding region, as well as derivatives obtained by modification of such a coding region. Techniques that can be used to transform such a coding region are known in the art and some of them have been described above.

The term promoter refers to a DNA strand upstream of a gene in a DNA molecule that directs the attachment of the appropriate host cell RNA polymerase complex to a specific site on the DNA molecule so that the RNA polymerase complex is correctly positioned in the DNA to initiate transcription of the gene. resulting in the synthesis of a single DNA strand RNA copy.

Il 95726 23 The term "transcription" refers to a process performed by a host cell biosynthesis mechanism, including RNA polymerase complexes, in which, using one of two complementary strands of DNA as a template, ribonucleotides polymerize sequentially in the 5 'to 3' direction (3 'to 5'). with respect to the template DNA strand) to give an exact copy of this single strand of DNA, which, however, contains ribonucleotides instead of deoxyribonucleotides.

The term "transcription termination chain" refers to the region of a DNA molecule denoted by t that signals the RNA polymerase complex involved in the transcription process to terminate this transcription process, whereby the resulting RNA molecule can be further processed appropriately, including, for example, polyadenylation and RNA transport. in the case of molecules which RNA molecules are to be used as messenger RNA molecules in the cytoplasm of the host cell.

The term "polyadenylation" refers to the process by which a host cell biosynthesis machinery recognizes a specific chain from an RNA molecule, usually 5'-AATAAA-3 ', termed a polyadenylation signal, PAS, and directs the insertion of a non-model polyriboadenylate group at the 3' end of said molecule. 20 nucleotides downstream (3'-direction) of the signal, this coupling taking place in particular by the enzyme poly-A polymerase.

The term "selection marker" refers to a gene determinant which, when expressed in a cell, confers on the cell certain properties that allow such a cell to be identified or selected from other cells that do not contain or express said gene determinant.

Preferred selection markers are, for example, markers based on drug resistance. The term "drug resistance marker" refers to a particular class of selectable markers that, when expressed by cell 95726 24, provide the ability of a cell to resist the lethal effects of a drug or antibiotic that does not normally inhibit or kill cell growth. comprise or express said drug resistance labeling.

Preferred markers based on drug resistance include, for example, the coding chain of the neomycin resistance gene, neo; Chain encoding the Eco-gpt gene (Mulligan, RC and Berg. P., Science, Vol. 209, page 1422, 1980): the chain encoding the dihydrofolate reductase (DHFR) gene (Ringold, G. et al., J. of Molec ., and Appld. Genet., Vol.

1, page 165, 1981).

The term "particles comprising at least one protein encoded by the entire PreS, PreS2-S coding region" refers to a hepatitis B particle that contains no nucleic acid at all and is formed by aggregation throughout the PreS2, PreS2 and S regions. to a lysate (lysate) of a culture of a transfected eukaryotic cell, such a particle containing subunits composed mainly of S polypeptide (dimer), which are also formed of smaller amounts of whole PreS, PreS2-S polypeptide, optionally, PreS2-S polypeptide .

The present invention uses a recombinant DNA vector comprising the coding region of the PreS, PreS2-S protein and the MMT promoter. The MMT promoter can be included in the DNA vector in addition to either the natural promoter of the DNA strand (hepatitis B virus promoter) or the hepatitis B virus promoter. The MMT vector is preferably placed in the DNA vector immediately upstream of the coding region of the PreS, PreS2-S protein. Such a vector preferably also comprises a copy termination chain and a selection marker. Such a selection marker is preferably a marker based on drug resistance, such as the neomycin gene. Such a 95726 copy termination terminus is preferably the SV40 virus termination site (sv-PAS-t) or more preferably the DEF region (mg-PAS-t) of the murine globin gene. The SV40 termination chain is well known in the art and is described in many publications, such as Mulligan and Berg, Science, Vol. 209, page 1422, 1980. The DEF region of the mouse globin gene is described in Falck-Pederson et al., Cell,

Butter. 40, page 897, 1985. Such a vector can be generated by conventional recombinant DNA techniques and other methods of molecular biology. Most preferably, using the mg-PAS-t region, this vector contains no fragments of viral DNA at all and is not oncogenic, i.e., it does not transform (make carcinogenic) any host cell into which it has been implanted. When such a vector is transfected into a host, if it does not contain an autonomous replication chain (replicon) capable of functioning in the host transfected with this vector, it integrates into the host chromosome and replicates passively with the host genome.

The recombinant DNA vector used in the present invention should preferably have the following characteristics: 1) the coding region of the PreS, PreS2-S protein; 2) an MMT promoter located immediately upstream of the PreSj-PreSj-S protein coding region; 3) this vector should be capable of growing, amplifying, and producing large amounts of the recombinant vector when replicated in bacteria or another prokaryotic host into which it has been transformed. Thus, such a vector should comprise a bacterial or other prokaryotic replicon, i.e., a DNA fragment that contains all the functions required for autonomous replication and maintenance of the vector outside the chromosomes in a host prokaryotic cell, such as a host bacterial cell transformed with the vector. Such replicons are well known in the art; 4) the vector replicon should be small (i.e., less than 6-8 kilobase pairs) to allow for easy genetic and molecular biological manipulation; 95726 26 5) the vector should comprise a selection marker, preferably a marker based on the resistance of a drug such as ampicillin, for use in host bacterial cells transformed with this vector; 6) the vector should comprise another marker of choice, preferably a marker based on the resistance of a drug such as neomycin, for use as such in eukaryotic host cells transfected with this vector; 7) the vector should contain appropriate endonuclease restriction sites for cloning; 8) the vector should contain a transcription termination chain and a polyadenylation chain.

Preferably, the vector does not comprise an autonomous replication chain (replicon) capable of operating in a eukaryotic host cell transfected with this vector. The main reason for using a non-replicating vector system in eukaryotic host cells is that all vector systems capable of autonomous and extrachromosomal replication in a host eukaryotic mammalian cell transfected with such a vector comprise. It is desirable that vectors whose DNA is not derived from oncogenic viruses be used to express DNA strands encoding pharmaceutically interesting polypeptides, such as those encoded by the coding region of the PreS1-PreS2-S protein.

The vector used in the present invention comprises the MMT promoter. The MMT promoter is not viral and is a potent replication promoter. The coding chain for the MMT promoter is disclosed in Pavlakis and Hamer, Proc. Natl. Acad.

Sci., Vol. 11, page 397, 1983. The MMT promoter can be regulated by heavy metal ions such as zinc and cadmium ions, and steroid hormones such as dexamethasone.

Such regulation is well known (see, e.g., Yagle and Palmiter, Molecular and Cellular Biol., Vol.

5, page 291, 1985}.

27 9572.6

Also disclosed is a transfected eukaryotic host cell transformed with a recombinant DNA vector of this invention. This host is preferably a mammalian cell, preferably a Chinese hamster ovary (CHO) cell line, a tax cell line, an L cell line, or a fibroblast cell line derived from a mouse or rat. Such a host can be prepared by transfecting a eukaryotic cell with a recombinant DNA vector of this invention using conventional techniques, such as the method described in Graham and van der Eb, Virology, Vol. 52, page 456, 1973, or Wigler, M. Cell, Vol. 141, page 725, 1978.

Also provided is a method of making a particle comprising proteins encoded by the PreSj-PreSj-S protein coding region, wherein at least one of these proteins corresponds to the entire PreS1-PreS2-S protein coding region polypeptide, the method comprising the steps of: a) and the b transfected host is cultured under conditions prevailing in the culture medium such that such a host is capable of expressing these proteins, and b) such a particle is isolated.

Such a co-transfected host is preferably capable of secreting proteins accumulated into such particles into the medium. Heavy metal ions or steroid hormones such as dexamethasone are preferably added to the medium, | To induce the MMT promoter, thus thus promoting the expression of its coding region. The ions of heavy metals used are preferably cadmium or zinc. The optimal concentration of heavy metal ions or steroid hormone in the medium can be determined by conventional techniques.

If the transfected host cell secretes the particles directly into the culture medium, then these particles can be isolated from the culture medium of the transfected host by techniques conventionally used to isolate proteins. If these particles are not secreted by the transfected host cell, then they are obtained from the culture digest of this host by techniques commonly used to lyse the culture. 95726 28 koilla. These. the particles are obtained glycosylated and form a protein encoded by the PreS, -PreS2-S protein coding region, comprising at least one protein encoded by the entire PreS, -PreS2-S protein coding region.

Also provided is a vaccine comprising an immunologically protective amount of the particles of this invention. The term "immunologically protective amount" refers to the amount of particles of this invention (preferably 1-20 μg) required to induce antibodies and maintain their level in the host sufficient to neutralize the infectious agent and prevent the growth of said infectious agent and consequent disease.

The disclosed particle contains no viral DNA components at all and thus does not usually have the undesirable side effects associated with vaccines from natural sources, such as unintentional infection with a virus, allergic reactions, fever and the like. A vaccine comprising an immunologically protective amount of the present particles can be used to enhance the immune response elicited by HBV and to avoid unresponsiveness to hepatitis B virus vaccines that do not contain the proteins encoded by the entire PreS2 PreS2-S protein coding chain.

The vaccine may be prepared by mixing an immunologically protective amount of the particles of this invention in a suitable buffer such as phosphate buffered saline.

This vaccine may further comprise an excipient such as aluminum hydroxide or the like.

Alternatively, the polypeptides comprised by the disclosed particles may be detached from said particles and reattached to the lipid vesicle. A vaccine against hepatitis B virus can be prepared using said Lipi dihydrogen-containing polypeptides of this invention. Lipid vesicles in the appropriate concentration can be used as a vaccine with or without an excipient such as aluminum hydroxide.

Vaccine particles can be used in combination with a physiologically acceptable diluent (medium) such as phosphate buffered saline.

A vaccine comprising an immunologically protective amount of the disclosed particles can be prepared and used in a generally similar manner to that disclosed in U.S. Pat. 4,118,479, the entire contents of which are incorporated herein by reference.

The vaccine can be given by subcutaneous, intradermal or intramuscular injection. The most preferred route of administration depends on the particular vaccine, however, intramuscular injection is generally believed to be most appropriate. The frequency of administrations varies depending on the vaccine.

This invention relates to a method for detecting the presence of antibodies against proteins encoded by the PreS1-PreS2S protein coding region in a sample taken from a mammalian blood serum, the method comprising the steps of: a) contacting the sample with a solid label coated with the unlabeled particles of this invention; (b) incubating and washing said contacted sample; c) contacting said contacted sample with the labeled particles of this invention to obtain a labeled, contacted sample; d) incubating and washing said labeled, contacted sample; and e) determining the number of labeled particles in the labeled, contacted sample.

The present invention also relates to a method for detecting the presence of proteins encoded by the coding region of the PreSj-PreSj-S protein in a sample obtained from mammalian blood serum, the method comprising the steps of; a) preparing a mixture comprising an antibody produced by an immunogen comprising the particles of this invention; (b) contacting the sample with the first portion of this mixture and the labeled immunogen, incubating the first portion and washing; (c) contacting the antigen-free reference sample with the second portion of this mixture and the labeled immunogen, incubating the second portion and washing; d) adding the same amount of staphylococcus comprising protein A to the mixtures of steps b) and c) above, incubating both mixtures and separating the liquid from the solid; and e) determining the amount of labeled immunogen in each of the resulting mixtures in step d) above.

The present invention is also directed to a diagnostic kit for detecting the presence of antibodies to proteins encoded by the coding region of the PreS, PreS2-S protein from a sample obtained from mammalian blood serum, the kit comprising: a) unlabeled proteins comprising a particle of the invention attached to a solid support; and b) labeled antibodies against human IgG or IgM, for example.

The present invention is also directed to the diagnostic kit PreS, -! To detect the presence of proteins encoded by the coding region of the PreS2-S protein from a sample obtained from mammalian blood serum, this kit comprises: a) antibodies produced by the particles of this invention attached to a solid support; and b) labeled antibodies produced by the particles of this invention.

31 95726 The present invention likewise comprises diagnostic experiments for the direct detection of hepatitis B virus surface antigens and antibodies formed by the action of these antigens. A radioimmunoassay (RIA) or an enzyme-linked immunosorbent assay (ELISA) is used to detect HBV antigens containing proteins encoded by the coding regions of the PreS, PreS2-S protein from the serum of HBV-infected animals, such as humans. One diagnostic assay comprises the steps of: 1. coating a solid substrate having binding sites, such as a substrate formed by polystyrene beads, with antibodies formed by particles comprising amino acids corresponding to the amino acid chains of polypeptides comprising PreS, PreS2-S protein; 2. the coated beads are then washed with, for example, Tris-buffered saline to remove excess antibodies; 3. the beads are then contacted with a protein-containing solution, such as a solution containing bovine serum albumin (BSA) or gelatin, to saturate the protein binding sites on the surface of the beads (to reduce non-specific binding). For example, values of 1-50 mg / ml may be used as a suitable concentration of such a protein-containing solution; 4. the beads are then washed to remove excess BSA or gelatin; 5. the beads are then incubated with serum samples suspected of containing HBV viruses or HBV surface antigens (normal serum is used as a reference); 6. the beads are then washed as a solution, for example with Tris-buffered saline, and mixed with a radiolabeled antibody against HBV surface antigens, such as a 125 I-labeled antibody; 7. the beads are then incubated; and 8. the beads are washed and counted in a gamma counter.

The particles encoded by the PreS1-PreS2-S protein coding region disclosed herein can be used as a diagnostic tool to detect antibodies against the PreS1-PreS2S regions in the HBV surface antigen protein from a particular sample. Particles containing the PreS, -PreS2-S polypeptide are absorbed on a solid substrate having binding sites on the surface, for example on the surface of polystyrene beads. The substrate is then contacted with a substance, such as gelatin, BSA, or milk powder, to saturate the non-specific binding sites on the surface of the substrate. The substrate is then washed as a buffered solution and then the buffer is removed. A sample diluted with animal serum, for example a sample of human serum, is added to the substrate. The resulting mass is incubated and washed. Radiolabeled, e.g., iodinated (125I) antibodies against human IgG or IgM are then added to the pulp. The resulting mass is incubated and then washed and counted, for example with a gamma counter. If the result obtained with the counter is greater than the result obtained with the gamma counter from the normal serum used as a control, then the sample contains antibodies against the PreS, PreS2-S coding regions of the HBV virus.

. It is contemplated that the above sequence of procedures for detecting antibodies against proteins encoded by the coding region of the HBV virus PreS [-PreS2-S protein can be used as a diagnostic tool to detect hepatitis B virus infection.

A reagent kit for a diagnostic assay to detect antigens encoded by the coding regions of the PreS] -PreS2-S protein in the HBV genome may comprise the following components: 1. PreSj-PreS2-S regions in the HBV surface antigen particles of this invention; a solid substrate coated with antibodies against a particle comprising the corresponding 95726 33 amino acid chains; 2. a protein-containing solution for impregnating protein binding sites on the surface of this solid substrate; and 3. a certain amount of a radiolabeled antibody, for example an antibody against HBV surface antigen polypeptides,

Another reagent kit for a diagnostic test for detecting antibodies against proteins encoded by the PreSj-PreSj-S protein coding region in the hepatitis B virus genome comprises the following components: 1. A solid substrate adsorbed on the surface of the HBV virus surface of the present invention. particles containing amino acid chains corresponding to the coding regions of the PreSj-PreSj-S protein associated with the antigenic protein, and this substrate is treated as a protein-containing solution to saturate non-specific protein binding sites on the surface of this solid substrate; and 2. a certain amount of radiolabeled antibodies against human IgG or IgM.

The radiolabeled antibodies used in the reagent crystals described above can be packaged in the form of a solution or in a lyophilized form that can be restored to its original form. In addition, enzyme-linked or fluorescently labeled antibodies can be substituted for the radiolabeled antibodies described.

The reagent kit and kit described above for the detection of antibodies against polypeptides corresponding to the hepatisis B virus PreS, PreS2-S coding region can be used in some applications, such as determining HBV infection in a patient by taking serum from the patient and using the assay described above. or the reagent kit described above; and predicting the possibility of 34 9 5 7 2 6 recovery from HBV infection by taking serum from an infected patient and using the procedures described to detect the antibody.

Experimental procedures and reagent kits for antibody detection can be used for qualitative comparison of different HBV vaccines by taking serum from vaccinated patients, followed by the experimental procedures or kits described above for detecting antibodies. In general, all known immunological experiments using this antigen as a reagent can be performed using PreS, PreS2, or S protein-containing particles of this invention. In general, all known immunological experiments using antibody-containing serum or reagents can be performed using antibody serum produced using a peptide produced by the recombinant DNA techniques of this invention. These immunological experiments include all experiments presented by Lan-gone and Van Vunakis in Methods of Enzymology, Academic Press. Butter. 70, 73 and 74. The experiments disclosed in the following U.S. Patents: 4,459,359, 4,343,896, 4,331,761, 4,292,403, 4,228,2401, 4,157,280, 4,152,411, 4,169,012, 4,016 043, 3,839,153, 3,654,090 and Re 31,006 and Methods of Enzymology in volumes 70, 73 and 74 are incorporated herein by reference.

i

Also provided is a co-transfected eukaryotic host cell transfected with both the recombinant vector shown and another recombinant DNA vector comprising the PreS2-S protein coding region, or the S protein coding region alone, and the MMT promoter. This! the second recombinant vector preferably further comprises a copy endpoint and optionally a selection marker. Optionally, this co-transfected host is transfected with both the recombinant DNA vector shown, the second recombinant DNA vector, and a third recombinant DNA vector comprising an MMT promoter and a selection marker. This third recombinant vector preferably comprises a copy end point. The second and optional third recombinant DNA vector preferably also contain a replicon that allows for growth and replication in the prokaryotic host cell. as in a bacterial host cell, when such a host is transformed with said second or optional third recombinant DNA vector.

A method of making these co-transfected host cells comprises transfecting a eukaryotic cell with both the recombinant DNA vector shown, the second recombinant DNA vector described above, and optionally the third recombinant DNA vector described above. The second and optional third recombinant DNA vector described above can be generated by conventional techniques. If an optional third vector is not used, the second combination DNA vector will preferably further comprise a selectable marker, such as a drug resistance marker. If the second and / or optional third recombinant DNA vector comprises a transcription termination site, then this site is preferably a mg-PAS-t termination site.

In the second recombinant DNA vector described above, the MMT promoter is preferably located in this vector immediately upstream of the coding region of the PreS2-S protein.

In the optional third recombinant DNA vector described above, the MMT promoter is preferably located in this vector immediately upstream of the selection marker. It is desirable that neither the second recombinant vector described above nor the optional third recombinant vector contain any viral DNA fragments that are not derived from HBV, and that these recombinant vectors are not oncogenic. Thus, when these preferred vectors are transfected into a host, they integrate into the host chromosome and passively replicate together with the host genome.

The disclosed vector, the second recombinant DNA vector described above, and optionally the third recombinant DNA vector described above are co-transfected into a eukaryotic host 36. 95726 in paired combinations, or all three vectors together, using conventional methods. Alternatively, the vector, the second recombinant DNA vector, and optionally the third recombinant DNA vector are transfected into the eukaryotic host at various stages. The vector is first transfected into a eukaryotic host by the method of the present invention to obtain a transfected host of the present invention. This transfected host is then transfected with the second recombinant DNA vector described above and optionally with the third recombinant DNA vector described above, using conventional methods, to give the co-transfected host of this invention.

The disclosed vector, the second recombinant DNA vector, and the optional third recombinant DNA vector each comprise a selection marker that differs from each other, allowing the identification of a new transfected host in each successive transfection step leading to a final transfected host of this invention.

Such secondary transfection steps are performed to increase the number of gene copies of the coding region of the PreS1-PreS2-S protein contained in the multiple transfected host cell. It is preferred that neither the second recombinant vector nor the optional third recombinant vector comprises a replicon capable of functioning in a eukaryotic cell.

Also disclosed herein is a method of producing a particle produced by a co-transfected host comprising at least one protein encoded by the entire PreS, PreS2-S coding region, the method comprising: a) culturing a co-transfected eukaryotic host cell in a culture medium; to express these proteins; and b) isolating the particle. Such a co-transfected host is preferably able to secrete these proteins accumulated as such particles into the medium. Preferably, this method further comprises adding heavy metal ions or steroid hormones to such a culture medium, which promotes the expression of the coding region of the PreS1-PreS2-S protein contained in the co-transformed vectors. Preferably, heavy metal ions are used, especially zinc or cadmium ions. The optimal concentration of heavy metal ions or steroid hormones in the medium can be determined by conventional methods. If the co-transfected host secretes these particles directly into the culture medium, then these particles can be isolated from the culture medium of the co-transformed host of this invention by techniques conventionally used to isolate proteins. If the co-transfected host does not secrete these particles into the culture medium, then they are obtained from the disintegration of the culture of this co-transfected host by conventional culture digestion techniques.

These particles are isolated in glycosylated form and consist of proteins encoded by PreS, the PreS2-S protein coding region, the PreS2-S protein coding region, and the S protein coding region.

This application also provides a vaccine comprising an immunologically protective amount (preferably 1-20 μg) of particles produced by a co-transfected host disclosed herein.

The particle produced by the co-transfected host does not contain. no viral DNA components at all, and thus is not associated with the undesirable side effects normally associated with vaccines from natural sources, such as unintentional infection with a virus, allergic reactions, fever, and the like. The disclosed vaccine comprising an immunologically protective amount of particles produced by a co-transfected host can be used to enhance the immune response to HBV and to avoid unresponsiveness to hepatitis B virus vaccines that do not comprise at least one, whole PreS, -PreS A protein encoded by the chain encoding the S protein.

38 9 5 7 2 6

The vaccine can be prepared by adding an immunologically protective amount of particles produced by the co-transfected host to a suitable buffer, such as phosphate buffered saline. The vaccine may further comprise an excipient such as aluminum hydroxide and the like.

Alternatively, the polypeptides contained in the particles produced by the disclosed co-transfected host may be cleaved from said particles and reattached to the lipid vesicle. A vaccine against hepatitis B virus can be prepared using these Lipi dihydrogens comprising polypeptides derived from the particles of this invention. The vaccine comprising lipid vesicles may further comprise an excipient such as aluminum hydroxide.

The particles produced by the co-transfected host constituting the disclosed vaccine may be used in conjunction with a physiologically acceptable diluent (medium) such as phosphate buffered saline.

A vaccine comprising an immunologically protective amount of the disclosed particles can be prepared and used in the same general manner as described in U.S. Pat. 4,118,479.

The vaccine can be given by subcutaneous, intradermal or intramuscular injection. Although the preferred route of administration depends on the particular vaccine, it is believed that intramuscular injection is generally most suitable. The frequency of administration depends on the vaccine.

This invention relates to a method for detecting the presence of antibodies against proteins encoded by the PreSj-PreS ^ S protein coding region in a sample obtained from a mammalian blood serum, the method comprising the steps of: a) contacting the sample with a co-transfected host of the present invention; with a particle-coated solid substrate; (b) incubating and washing said contacted sample; c) contacting said contacted sample with the labeled particles of this invention to obtain a labeled, contacted sample; (d) incubating and washing said labeled and contacted sample; and e) determining the amount of labeled particle in the labeled, contacted sample.

The present invention also relates to a method for detecting the presence of proteins encoded by the coding region of the PreS, -PreS2-S protein in a sample obtained from mammalian blood serum, the method comprising the steps of: a) preparing an antibody-containing mixture produced by the particles of the invention; comprising an immunogen; (b) contacting the sample with the first portion of this mixture and the labeled immunogen, and incubating and washing this first portion; (c) contacting the antigen-free reference sample with the second portion of this mixture and the labeled immunogen, incubating the second portion and washing; d) adding the same amount of staphylococcus comprising protein A to the mixtures of steps b) and c) above, incubating both mixtures and separating the liquid from the solid; and e) determining the amount of labeled immunogen in each of the resulting mixtures in step d) above.

The present invention is also directed to a diagnostic kit for detecting the presence of antibodies to proteins encoded by the PreSi-PreS2-S coding region from a sample obtained from a mammalian blood serum, the kit comprising: a) unlabeled proteins forming a solid support of the invention; ; and b) labeled antibodies against human IgG or IgM, for example.

The present invention is also directed to a diagnostic kit for detecting the presence of proteins encoded by the coding region of the PreS1-PreS2-S protein in a sample obtained from mammalian blood serum, the kit comprising: a) antibodies supported by the particles of this invention attached to a solid support; and b) labeled antibodies produced by the particles of this invention.

This application provides a recombinant DNA concatamer comprising: a) a plasmid vector comprising the PreS1-PreS2-S protein coding region and at least one other plasmid vector comprising one of the following coding regions: PreSj-PreS2-S protein a coding region or a PreS2-S protein coding region or an S protein coding region; and b) the MMT promoter. Such a concatamer preferably further comprises a selection marker and a copy termination site.

Also provided is a method of producing a particle produced by a transfected host comprising at least one protein encoded by the entire PreS, PreS2-S coding region, comprising: a) culturing a transfected eukaryotic host cell comprising the disclosed concatamer in a culture medium in such a culture; this host is capable of expressing these proteins; and b) isolating said particle. This co-transfected host is capable of secreting these particles accumulated into particles into the medium. This method preferably further comprises adding heavy metal ions or steroid hormones to such a culture medium, which promotes the PreS, li 4i 55726 content of the transfected vectors.

Expression of the coding region of the PreS2-S protein. Preferably, heavy metal ions are used, especially zinc and cadmium ions. The optimal concentration of heavy metal ions or steroid hormones in the medium can be determined by conventional techniques. If the concatamer-transfected host secretes these particles directly into the culture medium, then these particles can be isolated from the culture medium of the transfected host by techniques commonly used to isolate proteins. If the transfected host does not secrete these particles into the culture medium, then they are obtained from the culture lysate of this transfected host by techniques conventionally used to lyse the cultures. These particles are isolated in Gly-cosylated form and consist of proteins encoded by the PreSj-PreS2-S protein coding region, the PreS2-S protein coding region, and the S protein coding region.

The particle produced by the host transfected with the disclosed concatamer does not contain any viral DNA components, so it is not associated with the undesirable side effects commonly encountered with vaccines from natural sources, such as inadvertent infection with the virus, allergic reactions, fever, and the like. A vaccine comprising an immunologically protective amount of particles produced by a concatamer-transfected host can be used to enhance the immune response to HBV and to avoid unresponsiveness to hepatitis B virus vaccines that do not comprise at least one whole of the PreS, PreS2-S protein. protein encoded by the chain.

42 9 5 7 2 6

A vaccine can be prepared by adding an immunologically protective amount of particles produced by a host transfected with a concatamer of this invention to a suitable buffer, such as phosphate buffered saline. The vaccine may further comprise an excipient such as aluminum hydroxide or the like.

Alternatively, polypeptides comprised of particles produced by a concatamer-transfected host may be cleaved from said particles and reattached to the lipid vesicle. A vaccine against hepatitis B virus can be prepared using these lipid vesicles comprising the polypeptides contained in the disclosed particles. The vaccine comprising lipid vesicles may further comprise an excipient such as aluminum hydroxide.

The vaccine-forming particles produced by the concatamer-transfected host can be used in conjunction with a physiologically acceptable diluent (medium), for example, phosphate-buffered saline.

A vaccine comprising an immunologically protective amount of the disclosed particles can be prepared and used in the same general manner as described in U.S. Pat. 4,118,497.

Il 43 95726 This vaccine can be given by subcutaneous, intradermal or intramuscular injection. Although the preferred route of administration depends on the vaccine in question, intramuscular injection is generally considered to be the most appropriate. The frequency of administration depends on the vaccine.

The present invention is also directed to a method for detecting the presence of antibodies to proteins encoded by the coding region of the PreS1-PreS2-S protein from a sample obtained from a mammalian blood serum, the method comprising the steps of: a) contacting the sample with a concatamer-transfected host of the invention; with a particle-coated solid substrate; (b) incubating and washing said contacted sample; c) contacting said contacted sample with the labeled particles of this invention to obtain a labeled, contacted sample; d) incubating and washing said labeled, contacted sample; and ·· (e) the amount of labeled particle in the labeled, contacted sample is determined.

The present invention also relates to a method for detecting the presence of proteins encoded by the coding region of the PreS1-PreS2-S protein in a sample obtained from mammalian blood serum, the method comprising the steps of: a) preparing an antibody-containing mixture produced by the particles of the invention; comprising an immunogen; (b) contacting the sample with the first portion of this mixture and the labeled immunogen and incubating and washing this first portion; 44 95726 (c) the antigen-free control sample is contacted with a second portion of this mixture and the labeled immunogen, and this second portion is incubated and washed; d) adding the same amount of staphylococcus comprising protein A to the mixtures of steps b) and c) above, incubating both mixtures and separating the liquid from the solid; and e) determining the amount of labeled immunogen in each of the resulting mixtures in step d) above.

The present invention is also directed to a diagnostic kit for detecting the presence of antibodies against proteins encoded by the coding region of the PreS1-PreS2-S protein from a sample obtained from a mammalian blood serum, the kit comprising; a) unlabeled proteins that form a particle attached to a solid support of this invention; and b) labeled antibodies against human IgG or IgM, for example.

The present invention is also directed to a diagnostic kit for detecting the presence of proteins encoded by the coding region of the PreS1-PreS2-S protein from a sample obtained from mammalian blood serum, the kit comprising: a) antibodies induced by the particles of this invention attached to a solid support; and b) labeled antibodies produced by the particles of this invention.

The first preferred embodiment

In a first preferred embodiment, one vector of the present invention comprises a vector construct containing gene chains from the recombinant plasmids pBPV342-12 (Law et al., Molecular and Cellular Biol., Vol. 3, page 2110, 45 95726 1983) and pAOI (Cummings, IW et al. , Proc. Natl. Aca.

Sci. USA, Vol. 77, page 1842, 1980). Some genetic elements derived from these plasmids have been combined to provide a vector of the present invention, abbreviated pDMI (see Figure 3). Plasmid pDM1, the gene segment of which comprises the coding region of the PreS1-PreS2-S protein under the control of a natural promoter system associated with said protein coding region, transfection of the neomycin resistance gene, the MMT promoter and the SV40 virus PAS-t function to any one of a plurality of eukaryotic cells, such as mammalian cells, for expressing and preferably secreting the particles of this invention in large amounts.

Plasmid pBPV342-12 (see Figure 1) contains gene chains comprising the MMT promoter, the neomycin resistance gene, the SV40 virus PAS-t function, and the bovine papillomavirus (BPV) genome. During the construction of plasmid pDM1, plasmid pBPV342-12 is cleaved by the enzyme BamHI, resulting in the cleavage of the plasmid into two pieces of DNA.

These fragments are separated, after which a 7.95 kilobase pair (kb) fragment comprising the entire BPV genome is discarded *. Elimination of BPV DNA is highly advantageous, as it avoids the inclusion of BPV DNA or BPV proteins in the particle of this invention to be used in the vaccine preparation. The remaining BamHI fragment (6.65 kb) from plasmid pBPV342-12, which contains the MMT promoter, neomycin resistance gene and SV40 virus PAS-t region gene chains, is then ligated to the DNA strand from plasmid pAOI using standard techniques. however, which contains the coding region of the intact PreS1-PreS2-S protein (discussed below; see also Figure 2).

46 95726

Plasmid pAOI (see Figure 2), which contains the entire hepatitis B virus genome, is digested with EcoRI to give a 3.2 kilobase pair fragment. This 3.2 kilobase pair fragment is ligated to itself to form successive replicas comprising both a hepatitis B virus core and a long concatameric DNA construct containing gene chains encoding surface antigens.

This method for such manipulation of hepatitis B virus gene chains, which is necessary to avoid permutation caused by molecular cloning of plasmid pAOI and to restore functional organization with respect to the coding region of the PreS1-PreS2_S protein, is described in Cummings et al.,

Proc. Natl. Acad. Sci. USA, Vol. 77, page 1842, 1980. This is followed by digestion with the enzyme BglII to eliminate the HBV virus core antigen gene segment, leaving a DNA fragment (2.78 kb) comprising the hepatitis B virus genome PreS1-PreS2-S The coding region of the protein and the natural promoter system of this region (ρ ^ β) · The linear BamHI fragment from plasmid pBPV342-12 (see Figure 1) and the * BglII fragment from plasmid pAOI (see Figure 2) are then ligated into the recombinant plasmid pDM1. (see Figure 3), which recombinant plasmid comprises the natural promoter of the coding region of the PreS1-PreS2-S protein (Put).

Well

Another Preferred Embodiment In another preferred embodiment of the present invention, the native promoter in plasmid pDM1 is cleaved by digestion with BglII and BamHI so that the MMT premotor is located immediately before the coding region of the PreS1-S protein, wherein the MMT promoter regulates said coding region. After digestion with BamHI and BglII, three separate DNA fragments (47,957,726) are obtained (see Figures 4A and 4B): 1) a 5.1 kilobase pair fragment containing a polyadenylation site and an MMT promoter; 2) a 3.0 kilobase pair fragment containing the neomycin resistance gene and a natural promoter; and 3) a 1.4 kilobase pair fragment containing the PreS2-S protein coding region.

After purification, the 5.1 and 1.4 kilobase pairs are ligated by conventional techniques to give recombinant plasmids (6.46 kb) containing the PreS2-S protein coding region, but now under the control of the MMT promoter. Because the relative orientations of the two ligated bodies are random, and because two different types of plasmids are generated, only one of which is correctly oriented for copy-reading, starting from the MMT promoter and continuing to the surface antigen gene chains, the correct functional plasmid pDM2 is cleaved. future plasmids with the enzymes EcoRI and XbaI. In this way, a 2.1 kilobase pair and a 4.4 kilobase pair fragment is obtained from the correctly oriented plasmid.

The bacterial strain HB101 containing plasmid pDM2 was deposited in the strain collection Deutsche Sammlung fur Mikroorganismen, Göttingen, under accession number DSM 3285, on 4 April 1985. In addition, other microorganisms were deposited, e.g. the microorganism pMMT neoplasmid containing a DNA strand encoding the PreS1-PreS2 ~ S protein, deposited with the American Type Culture Collection (ATCC), Rockville,

Maryland 11 April 1986 with the following deposit numbers: pBR322.G2 - φφ 67073 POLINK 23456 - φφ 67072. pBlg / 2.8 - φφ. 67075 pMMT neoplasmid - ΦΦ- 67074.

48 95726

Third preferred embodiment

In a third preferred embodiment, the MMT promoter is extended to an HBV gene segment containing the PreS1-PreS2-S protein coding region such that the native promoter system is eliminated and said coding chain is placed under the direct control of the MMT promoter (see Figure 9).

Fourth preferred embodiment

In a fourth preferred embodiment, the mg-PAS-t segment of the mouse globin gene from plasmid pBR322.G2, which serves as a polyadenylation termination signal (PAS-t), replaces the PAS-t region derived from SV40 virus. Replacement of the mg-PAS segment provides DNA transfer vectors that do not comprise genomic portions other than those derived from the HPV virus (see Figures 9, 10, and 11).

A fifth preferred embodiment

A fifth preferred embodiment is a method for preparing mixed concatamers of plasmid DNA, increasing the number of gene copies by ligating plasmids containing gene constructs encoding the PreS1-PreS2-S, PreS2-S or S protein coding region with large amounts of antibodies to the plasmids containing and which are then transfected into cell lines.

The following examples describe in more detail the preparation and incorporation of the recombinant DNA vectors, hosts, and particles of this invention into a mammalian cell line. The following examples are intended to illustrate the invention only and are not intended to limit it in any way.

Il 49 95726

eXAMPLES

Materials and Methods A. Origin and Description of Mammalian Cell Lines 1. L cells

Researchers K.K. Sanford, W.R. Earle and G.D. Likely (J. Nat.

Cancer Inst., Vol. 9, page 229, 1948) produced NCTC clone 929 in March 1948 from starting strain L, which was studied by the researcher W.R. Earle (J. Nat. Cancer Inst., Vol. 4, page 165, 1943) had formed 1940. Starting strain L was obtained from normal subcutaneous areolar and adipose (adipose) tissue of a 100-day-old male C3H / An, and clone 929 was obtained. from the 95th subculture generation of the starting strain (by Kapil lary technique to isolate a single cell).

Researchers D.R. Dubbs and S. Kit (S. Kit et al., Exp. Cell Res., Vol. 31, pp. 297-312, 1963; and DR Dubbs & S. Kit, Exp. Cells Res., Vol. 33, p. 19, 1964) isolated the mouse L cell subline LM (TK-), which is deficient in thymidine kinase. It is unable to grow in a medium containing HAT. No spontaneous recovery of HAT resistance has been observed in this cell line, and it seems highly probable that it has occurred; loss of this gene.

Number of consecutive subcultures from the source tissue: 648; clone, 553.

Freezer: Culture medium, 90% DNSO 10%; antibiotic-free.

Viability: 81-96% (inability to absorb color).

Culture medium: DMEM + 10% FBS (modified Eagle medium from Dulbecco and Vogt + 10% FBS).

Growth properties of molten cells: Inoculum, which; 5 comprises 6-8 x 10 cells per 5 ml of the above culture medium per T-25 flask, a 50-fold increase of 50 95726 is obtained in 7 days at 37 ° C, provided that the medium is renewed twice a week and the pH is adjusted to 7.3 with a moistened mixture of carbon dioxide (5 or 10%) and air. Subcultures are made by scraping or shaking. Cells also grow well in other media (Waymouth, Eagle, NCTC 135, etc.) supplemented with 10-30% horse serum.

Plating efficiency: 70%.

Morphology: Fibroblast-like.

Cariology: Chromosome frequency distribution per 100 cells: 2n = 40.

Cells: _2 2 1 4 2 9 4 1 2 16 17 4 13 2

Chromosomes: 56-58 59 60 61 62 63 64 65 66 67 68 69

Solut; _2 2 11_6

Chromosomes: 70 71-76-82-125-241

A long metacentric chromosome with secondary restriction (constriction) was detected in 77/100 cells.

Sterility: Mycoplasma, bacterial and fungi tests were negative.

Species: Confirmed from a mouse by mixed agglutination and haemagglutination experiments.

Viral susceptibility: Susceptible to pseudorabies virus and vesicular .stomatitis virus (Indian strain). When cells were cultured in the above culture medium, Herpes simplex B virus and vaccinia produced cytopathic effects only in the first stage. Susceptibility to certain viruses may vary depending on the culture medium used.

Not susceptible to poliovirus type 1, Coxsackie virus type B-5 or polyomavirus.

Tumor Geneticity: An inoculum comprising 1 x 10 ** cells per mouse was injected subcutaneously into nude mice. Non-irradiated mice developed 0/25 li to 95726 51 tumors. X-ray treated mice (425 r, whole body) developed 11/18 tumors (sarcoma) at the injection site.

Reverse transcriptase: positive.

Issuer, manufacturer and characterizer: American Type Culture Collection, Rockville,

Maryland.

2. Vero cells

Production of the Vero cell line began on the kidney of a normal, adult African maracam on March 27, 1962, and was manufactured by Y. Yasumuar and Y. Kawakita of Chiba University, Chiba, Japan (Nippon,

Rinsho, Oh. 21, page 1209, 1963).

Number of consecutive subcultures, starting from the source tissue:.

Freezer: Essential Minimum Medium (Eagle) comprising non-essential amino acids and Earle-BSS, 85%; fetal bovine serum, 5% dimethyl sulfoxide (DMSO), 10%; antibiotic-free.

Viability: Approximately 97% (inability to absorb; accept color).

Culture medium: DMEM, 5% FBS.

Growth properties of thawed cells: Inoculum comprising 3x10 4 viable cells per 3 ml of the above medium per T-25 flask provides a 30-fold increase in 7 days at 37 ° C, provided that the medium is renewed three times a week and that the pH is set at 7.4 with a moistened mixture of carbon dioxide (5 or 10%) and air. Subcultures are prepared by trypsinization.

Plating efficiency: Approximately 24% in the above medium.

52 95726

Morphology: Similar to epithelial fibroblasts.

Cariology: Chromosome frequency distribution 50 cells: 2n = 60.

Cells: _212 2345721 17 22

Chromosomes: 47-49 59 51 52 53 54 55 56 57 58 59 60

Sterility: Mycoplasma, bacterial and fungi tests were negative.

Species: Confirmed in a monkey by immunofluorescence assay.

Viral susceptibility: Prone to poliovirus type 3, Getah, NNdumu, Pixuna, Ross River, Semliki, Paramaribo, Kokobera, Modoc, Murutucu, Germiston, Guaroa, Pongola and Tacaribe Arboviruses. Not susceptible to Stratford, Apeu, Caraparu, Madrid, Nepuyo and Ossa Arboviruses.

Reverse transcriptase: not detectable.

Issuer, manufacturer and characterizer: American Type Culture Collection, Rockville,

Maryland.

3. CHO-KI Cells CHO-KI cells were obtained as a subclone from a parent CHO cell line prepared by T.T. Puck began with an adult Chinese hamster ovary tissue sample, in 1957 (J. Exp. Med., Vol. 108, page 945, 1958). CHO-KI cells require proline and have a modal chromosome number of 20 (Proc. Nat. Acad. Sci., Vol. 60, page 1275, 1968). These cells apparently lack the active gene form required for proline synthesis, and blockade in the biosynthetic chain occurs at the stage where glutamic acid is converted to glutamate for gamma-semialdehyde. The probability of recovery of proline self-sufficiency is 10 6 (Genetics, Vol. 55, page 513, 1967).

Number of consecutive subcultures from the source tissue: approximately 400; 7 in the ATCC strain collection.

Il 53 95726

Freezer: Culture medium, 92%; glycerol, 8%; antibiotic-free.

Viability: Approximately 90% (inability to absorb color).

Culture medium: F-12 medium (Ham) 90%; fetal bovine serum, 10%; antibiotic-free.

Growth properties of thawed cells: The inoculum comprising 105 living cells in 1 ml of the above-mentioned culture medium at 37 ° C increases 15-20-fold in 7 days.

Plating efficiency: approximately 90% in the above medium.

Morphology: epithelial.

Cariology: chromosome frequency distribution 50 cells: 2n = 22.

Cells: _2 2 35 3 4 1 1 1 1

Chromosomes: 18 19 20 21 22-24-32-39-42

Sterility: Mycoplasma, bacterial and fungi tests were negative.

Species: confirmed from Chinese hamster by cytotoxic: antibody, dye intolerance test and isoenzyme analysis.

Viral susceptibility: susceptible to vesicular stomatitis virus (Indian strain) and Getah arbovirus. Not susceptible to poliovirus type 2, Modoc and Button William arbovi.

Reverse transcriptase: not detected.

Special properties: reference cells need proline to grow.

Issued by: T.T. Puck, Eleanor Roosevelt Institute for

Cancer Research, University of Colorado Medical Center,

Denver, Colorado.

54 95726 4. NIH / 3T3 Cells NIH / 3T3, a continuous cell line from highly contact inhibited cells, was obtained from fetal cultures of NIH Swiss mice in the same manner as the original randomly transplanted 3T3 (ATCC CCL 92) and the seeded BALB / c3T3 (ATCC CCL 92). CCL 163). More than 5 consecutive subcloning steps were performed on the resulting NIH / 3T3 line to develop the subclone whose morphological properties are best suited for transformation experiments. The earliest available passages of this subclone are approximately 120 steps away from the first fetal culture. NIH / 3T3 is highly sensitive to sarcoma virus focus formation and leukemia virus proliferation and has been shown to be very useful in DNA transfection studies. J. Virol., Vol. 4, pages 549-553, 1969; Cell, Vol. 16, pages 63-75 and 347-356, 1979.

B. Media, Buffers, and Solutions 1. For mammalian cell cultures a. Dulbecco's modified glucose-rich Eagle's medium (DMEM).

*. Here, dry powdered GIBCO medium is used and supplemented with: 26 mM NaHCO 3 2 mM L-glutamine (Gibco) 1 mM Na-pyruvate (Gibco) 60 ug / ml gentamicin or 100 units / ml penicillin + 100 units / ml 1 streptomycin.

b. Ham F12 A dry powdered GIBCO medium is used here supplemented with: 14 mM Na HCO3: 60 ug / ml gentamicin 55 95726 c. Cell freezer 90% (v / v) FBS-DMEM 10% (v / v) dimethyl sulfoxide The freezer is prepared just before use. All media are sterilized by filtration through 0.45 and 0.2 micron filters (Gilman). The sterility of the media is confirmed by incubating a sample of the antibiotic-free medium at 37 ° C for 1 week. 10% FBS is added to the medium used for static culture. Fetal bovine serum (FBS) is heat inactivated at 56 ° C for 30 minutes. The sterile medium is stored at 40 ° C before use.

d. Trypsin solution 0.5 g / l trypsin 0.2 g / l EDTA (tetrasodium) in equilibrated saline

Because EDTA was found to be toxic to Vero cells, a trypsin-free EDTA solution is used with these cells.

e. PBS (phosphate buffered saline), GIBCO

183 mM NaCl 8.6 mM Na 2 HPO 4 2.2 mM KH 2 PO 4

f. TN E

160 mM NaCl 10 mM Tris, pH 7.5

1 mM EDTA

2. For molecular biological purposes a. Solutions for SDS-PAGE procedures

Acrylamide (stock): 30% (w / w) acrylamide (BioRad) 0.8% (w / w) N ', N-methylene bisacrylamide (BioRad) 56 95726 4 x buffer for separating gel 1.5 M Tris- Cl, pH 8.8 0.4 (w / v) sodium dodecyl sulfate (SDS) (Serva) 4 x buffer for intermediate gel

0.5 M Tris-Cl, pH 6.8 0.4 (w / v) SDS

3 x sample buffer 22.3% (v / v) glycerol 0.03% (w / v) bromophenol blue

6.7 (w / v) SDS

10 x electrode buffer

0.25 M Tris, pH 8.2 1.90 M glycine 1% (w / v) SDS

b. Solutions for silver staining procedures

Solution I 50% (v / v) methanol 10% (v / v) acetic acid

Solution II 10% (v / v) methanol 5% (v / v) acetic acid

Solution III 10% glutaraldehyde

Solution IV 20% AgNO 2 in water (stock solution)

Solution V 3% (w / v) Na 2 CO 2> 0.1% (v / v) formaldehyde c. Solutions are read at the open phosphodiester bridge ("nick") 10 x reaction buffer

500 mM Tris-Cl, pH 7.2 100 mM MgSO 4 1 mM DTT

li 57 95726

Nukleotidiseos:

100 mM dGTP 100 mM dATP 100 mM dTTP

In 10 mM Tris buffer, pH 7.5 d. Hybridization solutions 20 x SSC: 3 M NaCl 0.3 M Na 2 citrate 50 x Denhardt's solution 1% (w / w) Ficoll 400 (PL-Pharmacia) 1% (w / w) polyvinylpyrrolidone (Sigma)

1% (w / w) BSA

o

Sterilize by filtration and store at -20 ° C

Esihybridisaatioseos

50% (v / v) formamide 5 x Denhardt's solution 5 x SSC

50 mM Na phosphate pH 7.0 250 ug / ml denatured salmon sperm DNA

The hybridization:

50% formamide 5 x SSC

20 mM Na phosphate, pH 7.0 1 x Denhardt's solution 100 ug / ml denatured salmon sperm DNA e. Buffers for restriction enzymes

Either the buffers provided by the manufacturers, or: Low salt Medium salt High salt buffer Buffer

Sma I Bglll BamHI

Hpal PstI PvuI

Xbal EcoRI Sali

Mp BstEII (60 ° C) 58 95726

Restriction buffers: Low salt Average High salt salt

Tris, pH 7.4 10 mM 6.6 mM 6.6 mM

MgCl 2 10 6.6 6.6 salt 20 (KCl) 60 (NaCl) 150 (NaCl) β-mercaptoethanol 10 6.6 6.6 f. Substrates 1. L medium: 10 g Bactotrypton 5 g yeast extract 10 g NaCl 1 liters of water 2. L-medium agar plates: L-medium containing 15 g / l Difco agar 3. L-medium amp agar plates: L-medium agar containing 20-50 ug / ml ampicillin C Enzymes

The following enzymes are used: 1. Deoxyribonuclease I (Worthington) ‘2. DNA polymerase I (‘ Klenow fragment ’) (Boehringer Mannheim) 3. T4 DNA ligase (Boehringer Mannheim) 4. Restriction enzymes:

EcoRI, Xbal, BamHI ,. Bglll, BstEII, Spel,

Sali, Hpal, Smal, PvuI, PstI (Boehringer

Mannheim, BRL, New England BioLabs) 5. Lysozyme (SIGMA) 6. Pronase 11 59 95726 D. Analytical and Quantitative Measures 1. Color Binding Assay

The total protein content in the preparations of the purified particles of this invention is determined using a BioRad protein assay kit. This method uses the Bradford assay, in which the binding of Coomassie blue to a protein is measured spectrophotometrically. Ovalbumin is used as standard.

2. Radioimmunoassay (RIA) 1 25 In the "sandwich" NML RIA I radioimmunoassay, beads coated with a mouse antibody (anti-HBs) against hepatitis B virus surface antigen are incubated with serum or plasma and appropriate controls. Particles containing polypeptides encoded by the coding region of the PreS1-PreS2-S protein bind to a solid phase antibody. After uptake of unbound material and washing of the beads, human anti-HBs is reacted with a complex of antibody-antigen on the surface of the beads. The beads are then washed with si-125 unbound. To remove I-anti-HBs.

The radioactivity remaining in the beads is counted on a gamma scintillation counter. Samples are considered reactive if the number of beats per minute (cpm) obtained is greater than or equal to the cut-off value obtained by multiplying the average number of beats (NCx) of the negative control by a certain factor.

3. Immunoprecipitation

Cells are grown 100% together in a T75 flask. The culture medium is then changed to 5 ml of methionine-free medium. -3 5 - medium containing 400 yCi L- / S / -methionine and 400 -35 - ”. γCi L-^ S / -cysteine (NEN), and incubation is continued overnight. The medium is concentrated to 10-fold fraction fraction. 95726 60 clubs using polyethylene glycol. The concentrated protein (approximately 10 cpm) is incubated with 10 μl of guinea pig serum or 1 and 10 microliters of guinea pig anti-HBsAg serum obtained before immunization in 50 microliters of TEN-Liu (10 mM Tris, pH 7.4). 1 mM EDTA, 130 mM NaCl) comprising 0.5% Tween 20 for 1 hour at 37 ° C. Immunoglobulin is bound to 20 microliters of a mixture of protein A and Sepharose C1-4B gene (Pharmacia) for 1 hour at 37 ° C, washed once with TEN-Tween 20 and a solution comprising 500 mM LiCl, and again with TEN-Tween 20 Samples are electrophoresed using the SDS-PAGE system described below. The gels are fixed for 60 minutes in a solution comprising 10% trichloroacetic acid, 10% glacial acetic acid and 30% methanol and incubated in Enlightning solution (NEN) for 30 minutes. The gels are dried and auto-radiographed on KODAK XAR-5 Film.

4. SDS Polyacrylamide Gel Electrophoresis (PAGE) Sample and Gel Pretreatment: For PAGE analysis, the concentration of the purified particle samples of this invention is set at 10 μg / ml. 10 ul of each sample is taken and mixed with 10 microliters of 1 M DDT in 10% SDS and 10 microliters of sample buffer. This mixture is boiled for 5, 10 or 15 minutes just before being applied to the gel to break up 20 nanometer particles and produce monomeric molecules. After the addition of 10 ul of loading buffer, the mixture is electrophoretically treated on a 0.75 mm thick gel strip (12 x 18 x 0.1 cm) comprising 12.5% polyacrylamide and 0.4% bisacrylamide. using the Laemmli (1970) buffer system with values of 15 mA and 100 V for 6 h. Protein bands are visualized by silver staining (see the next section on silver staining).

K

61 95726 5. Silver Staining PAGE gel is stained with silver according to Merrilin et al. (1981). The protein is attached to the gel with a solution comprising 50% methanol and 10% acetic acid for 30 minutes. The gel is washed for 30 minutes with a solution comprising 10% methanol and 5% acetic acid. After incubation in 10% glutaraldehyde for 30 minutes, the gel is washed in deionized water overnight. After incubation in 0.1% AgNCl 2 solution for 30 minutes, the gel is washed briefly in water. The stained gel is developed in 100 ml of 3% Na 2 CO 2 solution and 30 microliters of formaldehyde and fixed with 1% acetic acid. The gel is sealed inside a plastic bag and photographed.

E. Genetic Manipulation 1. Recombinant DNA Procedures a. Cleavage of Purified DNA by Restriction Endonucleases

Carry out for each endonuclease according to the manufacturer's instructions.

b. Isolation of Plasmid DNA 1.1 liters of plasmid-containing cells are grown in L-medium to an optical density of ODgQ00.5, after which the culture is allowed to expand for 12-20 hours in the presence of 200 ug / ml chloramphenicol.

2. The culture is centrifuged in a Sorval centrifuge RC5b at 8000 rpm for 20 minutes.

3. Resuspend cells in 18 ml of cold solution containing 25% sucrose, 50 mM Tris, pH 8.0.

4. Transfer the suspension to a 250 ml Erlenmeyer. Keep on ice.

5. Add 6 ml of 5 mg / ml lysozyme in a solution of 250 mM Tris, pH 8.0 to the suspension and allow to stand for 10-15 minutes.

62 95726 6. Add 6 ml of 250 mM EDTA solution, pH 8.0 to the mixture and mix gently; the mixture is incubated for 15 minutes on ice.

7. Add 30 ml of detergent mixture to the mixture; 0.01% Triton X-100 60 mM EDTA, pH 8.0 50 mM Tris, pH 8.0.

8. Incubate the mixture for 30 minutes on ice.

9. It is centrifuged at 25,000 rpm, 4 ° C, for 90 minutes in a SW28 rotor.

10. Pronase is added to the supernatant at a concentration of 250 μg / ml, and incubated for 30 minutes at 37 ° C.

11. Extract the supernatant once with phenol, using 1/2 volume of phenol equilibrated with TE solution (10 mM Tris, pH 8.0, 1 mM EDTA).

12. The aqueous layer is removed; sodium acetate is added to a concentration of 300 mM; 2 volumes of cold 100% ethanol are added; mix thoroughly. Store at -20 ° C overnight.

13. The mixture is centrifuged and suspended in 6 ml of TE-10 solution (10 mM Tris, 10 mM EDTA, pH 8.0).

14. 9.4 g of CsCl and 0.65 ml of ethidium bromide at a concentration of 6 mg / ml are added to the suspension; the volume of the broadcast. 10 ml by adding sterile, doubly distilled water.

15. The solution is filled into Beckman heat-sealable gradient tubes; they are centrifuged at 48,000 rpm for 40 hours in a Ti70.1-Beckman rotor.

16. Plasmid zones are visualized by UV rays and plasmid DNA is removed by pushing through the wall of the tube using a syringe and a No. 18 needle.

17. Ethidium bromide is removed from the plasmid fraction by extraction three times in succession with equal volumes of isobutanol.

18. The DNA is dialyzed against one batch of 2 liters of solution comprising 10 mM Tris, pH 7.4, 1 mM EDTA, pH 7.5, 5 mM NaCl for 2 hours or more at 4 ° C.

li «3 SS726 19. DNA is extracted once with phenol using 1/3 volume of phenol equilibrated with the TE solution described above.

20. NaAc is added to the DNA to a concentration of 300 mM, and 2 volumes of 100% ethanol; precipitated at -20 ° C overnight, or at -70 ° C for 30 minutes.

c. Reading at the open phosphodiester bridge ("nick")

The reading for the open phosphodiester bridge is performed by Rigby et al. (J. Mol. Biol. Vol. 113, pp. 237-251, 1977). The reaction mixture for 32 P-labeling of DNA usually contains, for example, 0.5 μg of the EcoRI-XbaI fragment of the plasmid in a total volume of 30 μl, further comprising 50 mM Tris, pH 7.8, 5 mM MgCl 2, 10 mM mercaptoethanol, 0.1 mM dATP , 0.1 mM dGTP, 0.1 mM dTTP, 50 μCi 32 P-dCTP, 10 units of DNA polymerase I, 3 μl of a 2 x 10 3-fold dilution of 1 mg / ml DNase, and the mixture is incubated for 90 minutes at 15 ° At C to give a total of 3 x 10 6 to 12 x 10 8 cpm, i.e. 1 x 10 6 to 5 x 10 7 cpm / μg DNA.

d. Transformation of capable bacterial cells

From a dense overnight culture, take 1 ml of a suspension of bacterial cells inoculated into 100 ml of medium (L medium). The cells are grown at 37 ° C to an optical density OD ^ q = 0.7, which is reached in 2 hours with vigorous shaking in 500 ml Erlenmeyer flasks. Growth is stopped by cooling the culture on ice for 10 minutes. 3 ml of this culture is taken, from which the bacterial cells in the exponential growth stage are recovered by centrifugation at 3000 rpm for 5 minutes. The cells are resuspended in 1.5 milliliters of a solution comprising 50 mM CaCl 2 in 10 mM Tris buffer, pH 8.0, and incubated again on ice for 15 minutes. The cells are again harvested by centrifugation at 3000 rpm for 5 minutes and resuspended in 200 microliters of a solution comprising 50 mM CaCl 2 in 10 mM Tris buffer, pH 8.0, and maintained at 4 ° C overnight. .

The total volume of the ligation mixture was then made to 70 microliters with a solution comprising 10 mM Tris, pH 7.5, 1 mM EDTA, and added to 200 microliters of bacterial cell suspension to transfer DNA to the cells.

The mixture was incubated on ice for 30 minutes, after which 1 ml of L medium was added, and the mixture was incubated at 42 ° C for 2 minutes and at 37 ° C for 40 minutes. After incubation, the cells were plated on agar plates containing 50 μl ampicillin / ml agar so that the volume of cell suspension applied to the plate was 50-300 μl. The agar plates were incubated at 37 ° C overnight. After this incubation period, single, distinct bacterial colonies had formed on the plates.

e. Southern blot analysis

In order to determine the organization of the vectors of this invention in the genome of the host cell, chromosomal DNA from cell lines producing the particles of this invention is isolated and digested with appropriate restriction enzymes, and analyzed by the Southern method (J.

Mol. Biol., Vol. 98, pages 503-517, 1975) using a 3β-labeled DNA probe. After digestion of chromosomal DNA (20 μg) with the restriction enzymes EcoRI and XbaI, the resulting fragments are separated electrophoretically on a 0.7% agarose gel. The DNA is then denatured by treatment with 366 nanometers of UV rays for 10 minutes, and incubation for 45 minutes in a solution comprising 0.5 N NaOH and 1 M NaCl. The gels are neutralized by incubation for 60 minutes in a solution of 0.5 M Tris, 1.5 M NaCl, pH 7.5. The DNA is transferred to a nitrocellulose filter by wetting it for 20 hours with a solution of 3 M NaCl, 0.3 M Na citrate (20 x SSC) through a gel 11 65 95726 by placing a stack of dry paper towels on top of the nitrocellulose filter. The nitrocellulose filter is kept for 2 hours in a vacuum oven at 80 ° C.

A radioactive DNA probe from the EcoRI-XbaI fragment of plasmid pDMI (4.3 kb) is prepared by nick reading.

For hybridization with the DNA probe, the nitrocellulose filter is sealed in a plastic bag containing 10 ml of pre-hybridization mixture: 50% formamide, 5 x £ SC, 50 mM sodium phosphate, pH 7.0, 5 x Denhardt's solution, 250 μg / ml of denatured salmon sperm DNA. The filter is incubated in this mixture for 4 hours at 45 ° C, after which the pre-hybridization mixture is replaced by the hybridization mixture: 50% formamide, 5 x SSC, 20 mM Na phosphate, pH 7.0, 1 x Denhardt's solution, 100 μg / ml denatured salmon sperm DNA 5 x 103 cpm / ml "^ P probe. After incubation of the filter in the hybridization mixture for 18 hours at 45 ° C, it is washed three times for 5 minutes at 50 ° C with a solution of 0.1 x SSC, 0.1% SDS.

The filter is dried at 60 ° C for 10 minutes and exposed to two X-ray films (XAR-5, KODAK) between the two intensifying shaders, and kept at -80 ° C. The first X-ray film is developed after -3 days of exposure; the second film After 7 days of exposure, hybridization of the labeled DNA probe to a single restriction fragment derived from cellular DNA derived from transfectants producing the particles of this invention indicates that the cellular DNA does indeed contain a homogenized vector of this invention. n has the same restriction profile as the original plasmid construct, it can be seen that no significant rearrangement of the plasmid DNA occurred as it fused to the host cell ÖNA.

66 95726 2. Transfection of mammalian cell lines and identification of clones producing particles of this invention

Cells are transfected using the method of Wigler et al. (Cell, Vol. 14, page 725, 1978), a method based on calcium phosphate precipitation. The cells are then partitioned 1: 6 into new culture dishes, and those cells to which the drug resistance marker marker (neo) has been transferred are selected by growth in G418-containing medium. After the cells have grown for 10 days on selective medium, drug-resistant colonies are cloned into microtiter plates. After the cells have grown together, the expressed amounts of the particles of this invention are confirmed by RIA.

Tissue culture dishes (diameter 100 mm) are inoculated with 5x10 4 cells and incubated overnight at 37 ° C. Four hours before transfection, the culture medium is replaced with new medium. The DNA to be transfected is suspended in 1 ml of a solution containing 250 mM CaCl 2/140 mM NaCl, 25 mM Hepes, pH 7.1, and 0.75 mM NaHPO 4. This precipitate between calcium phosphate and DNA is added to the culture cells. The culture is incubated overnight, after which new medium is added to the cell culture and the cells are further incubated for two days.

F. Procedures for obtaining static cell culture of mammalian cells

The ampoule of cells kept at -196 ° C * in liquid nitrogen is rapidly thawed by placing the ampoule in a water bath at 37 ° C for 5 minutes. One ml of this freshly thawed cell suspension is diluted by slowly adding 10 ml of the appropriate culture medium. The cells are then harvested by centrifugation, resuspended in 10 ml of culture medium. The cells are then harvested by centrifugation and resuspended in 10 ml of culture medium, transferred to T25 culture flasks and grown in an incubator at 37 ° C in the presence of 5% CO 2. Under these conditions, the time required for doubling of L cells and CHO cells is approximately 15-20 hours and in the case of Vero cells 30-40 hours. L cells and CHO cells are allowed to survive and grow even after they have grown 100% together, while Vero cells are transplanted after they have grown 100% together.

G. Procedures for Growing Mammalian Cells in an ACUSYST-P Device and Recovering Particles of This Invention 1. Inoculum Growth and Pretreatment

Cells are maintained in T75 or T150 flasks containing 2 DMEM-10% FBS. In rotatable flasks (850 cm), 10-15 x 10® cells obtained from T-flasks are incubated.

After culturing the cells for 3-5 days, a total of about 10 cells are harvested from six rotatable flasks and inoculated into six hollow fiber cores (HFCs) in an ACUSYST-P manufactured by Endotronics, Inc., Minneapolis, Minnesota, USA.

2. ACUSYST-P culture and recovery of particles of this invention

After inoculation, the HFC cores are placed in an ACUSYST-P culture system and the flow rate of the medium passing through the cores is set at and maintained at 50 ml / hour. The pH, pO 2, glucose and lactate are determined daily from the medium. After 2-3 weeks of growth, a volume of 600 milliliters of fluid is taken twice a week from outside the capillary space of each hollow fiber sleeve in the ACUSYST-P. The formation of the particles of this invention is detected by radioimmunoassay (RIA). Since freezing destroys the activity determined by the RIA assay, the collected samples are stored at 4 ° C before purification. No protease activity was observed under these conditions as determined by proteolysis of the Azo-coll substrate (SIGMA).

3. Quality control measures a. Tests for the presence of bacteria and fungi

The presence of bacteria and fungi is determined from a set of cells containing about 5x10 6 cells / ml suspended in the cell culture medium from which they were harvested. One ml of cells is plated on plates containing trypticase-soy agar (BBL), and another 1 ml is inoculated into thioglycollate medium (DIFCO) to detect the presence of aerobic as well as anaerobic bacteria. Fung contamination is expressed by drawing 1 ml of cells on plates containing Sabouraud agar (DIFCO). These experiments were performed regularly to ensure the sterility of the medium and that the cell cultures were not contaminated with bacteria or fungi.

b. Tests for the presence of mycoplasma

Fluorescent staining. The presence of mycoplasma DNA in the cell cytoplasm is determined by a staining method using fluorochrome, Hoechst 33258. This DNA staining dye fluoresces under ultraviolet light and serves as the basis for a very rapid and sensitive experiment indicating the presence of mycoplasmas.

This method uses cover glass cultures of the cells to be tested, which are used when the cells have grown 50-70% together. After attachment and staining, coverslips are examined by fluorescence microscopy. Cytoplasmic fluorescence indicates the presence of mycoplasma.

Hoechst 33258 bisbenzamide fluorochrome stock solution *. is prepared by dissolving 5 mg of fluorochrome in 100 ml of PBS using a magnetic stirrer. It is sterilized by filtration through a 0.22 micron membrane, stored in the dark at 4 ° C, and diluted 1,000-fold with PBS before use. For coverslip cultures grown 50-70%, the medium is separated from the cells by suction and fixed at 4 ° C by changing twice the mixture of ethanol and acetic acid in a ratio of 3: 1. The coverslips are washed once with deionized water and incubated for 30 minutes at 37 ° C with dilute fluorochrome bisbenzamide (Hoechst 33258), after which the coverslips are rinsed with deionized water. The coverslips are placed cell side down on a microscope slide using glycerol (22.2 ml of 2% citric acid; 1 ml of H 2 O; 27.8 ml of 2.8% Na 2 HPO 4; 50 ml of glycerol, pH 5.5) as an immersion liquid.

C. Tests for the presence of viruses 1) Tests in cell cultures.

The test cells are examined for normal morphology during an incubation period of at least 14 days, after inoculation with the suspension of the test cell line.

In addition to this, 3-5. day and again after day 12, at least 4% of the inoculated test cultures are washed and assayed for hemadsorption using sheep and human erythrocytes. The results are read after incubating the cultures for 30 minutes at 3-4 ° C, and again after 30 minutes at 34-37 ° C. The results of experiments to determine the presence of virus-infected erythrocyte-absorbing cells showed the absence of viral contamination.

2) Experiments on animals.

The test cells are suspended in a solution comprising 140 mM NaCl, 2.7 mM KCl, 8.1 mM Na 2 HPO 4, pH 7.2 to a concentration of 10 μl / ml and inoculated into different groups of animals. In one group, at least 10 animals from at least two washes of sucking mice receive inoculum. Cells are transplanted into each animal 0.1 ml intraperitoneally and 0.01 ml intracerebrally. Mice are observed daily for at least 14 days. Any mouse that dies after the first 24 hours of the experiment or is killed due to disease will have an autopsy and look for traces of viral infection. This study involves further testing performed by subculturing appropriate tissue suspensions intracerebrally and intraperitoneally into an additional group of at least five sucking mice, which is monitored for 14 days. In addition, a blank test is performed on pooled, emulsified tissue (excluding skin and organs (viscus)) obtained from mice that survived the initial 24-day test.

In the second group, 10 adult mice also receive inoculum. Each animal is inoculated with 0.5 ml of cells intraperitoneally and 0.03 ml of cells intracerebral. The animals are observed for four weeks, and any animal that becomes ill or has an abnormality is examined to determine the cause of the disease. Results from animal experiments showing the presence of contaminating viruses did not indicate viral contamination.

d. Test for tumorigenicity.

In a suitable tumorigenicity test using nude mice (nu / nu), 20 animals are inoculated within 24 hours of birth with 0.1 ml of strong serum. This injection is given either intramuscularly or subcutaneously and is repeated on days 2, 7 and 14 of life.

One million reference tumor cells produce regularly growing tumors and metastases. One million living cells from the cell line under study are inoculated subcutaneously at any site where developing tumors can erupt

II

71 95726 (limbs are suitable). Animals are observed for 21 days to determine if nodules form at the injection site, and measurements are made periodically to detect gradual growth. At the end of the 21-day observation period, all animals are sacrificed and traces of tumor formation at the injection site and other organs such as the lymph nodes, lungs, kidneys, and liver are searched. All tumor-like changes and all inoculation sites are examined histopathologically. In addition, because some cell lines can form metastases in the absence of local tumor growth, however, the lungs and regional lymph nodes of all animals are examined histologically.

For the purposes of this experiment, a progressively growing tumor is defined as a tactile node that increases in size over a 21-day observation period and in which live and mitotically active inoculum cells can be detected by histological examination. The presence of microscopically living cells associated with an unchanged or regressive node is not considered a progressive tumor.

H. Purification of the Particles of This Invention I. Fractionation with Polyethylene Glycol (PEG)

The medium is recovered from the space outside the capillaries, the ACUSYST-P culture system, and combined into 3,000 milliliter volumes. To each volume is added 180 g of PEG 8000 product (SIGMA), which is dissolved by stirring at room temperature for 20 minutes, and stirring is continued for 3 hours at 4 ° C. The precipitate is collected by centrifugation in 500 ml flasks on a GS 3 rotor at 4500 rpm (3000 x g) for 30 minutes at 10 ° C. The supernatant is collected and 180 g of PEG 8000 are again added, which is dissolved at room temperature as described above 72 95726. The solution is stirred at 4 ° C for a further 3 hours. The precipitate of this solution is collected as described above, except that centrifugation is performed at 9,000 rpm (15,000 x g) for 60 minutes. The pellet is resuspended in phosphate buffered saline (PBS).

2. Gel Filtration Chromatography The material obtained by PEG precipitation and redissolved in PBS is chromatographed by gel filtration using BioRad's A-5m resin at 4 ° C. The dimensions of the column are 25 x 1000 mm and the volume of the bed is 480 ml. When the material is typically divided into fractions, 1000 ug of PEG-precipitated particles of this invention in a volume of 10-15 ml are applied to the column and eluted with PBS or TNE solution at a flow rate of 6 drops per minute (18 ml / h) and 3 ml fractions are collected from the eluate. Figure 6 shows the profile of RIA-detectable material eluted from the A-5m column. The solid line indicates the absorbance of each fraction at 280 nm, and the dots indicate the amount of material calculated from the RIA results.

3. Isopycnic Centrifugation in CsCl 30 fractions covering the first peak from gel permeation column chromatography and containing the partially purified particles of this invention are pooled (approximately 100 mL). The density of this solution 3 is set at 1.30 g / cm with CsCl, after which the solution is transferred to nitrocellulose tubes suitable for a SW 27/28 rotor (Beckman).

Gradients are obtained by applying 4 ml of a solution of Cs35 solution with a density of 1,35 g / cm * to the bottom and 4 ml of a solution of CsCl solution with a density of 1.25 g / cm and 4 ml of CsCl solution with a density of The gradients are centrifuged at 28,000 rpm for 50 hours at 10 ° C, divided into fractions, and the purified particles are recovered from a layer having a density of 1.20 g / cm 2, from the surface of the gradient. (Figure 7) The purified particles are well separated from the small amount of contaminating protein that forms a zone in the center of the grandient, and the solution is desalted by dialysis, first against water, then against 3 portions of saline over a period of 24 hours.

As an additional quality control measure, a portion of this gradient-purified material is recentrifuged using a linear CsCl gradient. As expected, a single peak of purified particles with a density of 1.2 g / cm 2 is obtained.

1. Preparation of the excipient of the purified particles of this invention and stability test To prepare the excipient for use in the vaccine of this invention in sterile saline to the desired concentration of antigen, 1/10,000 volume of Thimerosol and 1/10 volume of sterilized 0.2 M AIK (SO) 2:12 L O solution, the pH is adjusted to 5.0 with sterile 1 N NaOH solution, and the suspension is stirred at room temperature for 3 hours. The alum-precipitated antigen is recovered by centrifugation at 200 rpm for 10 minutes, resuspended in sterile normal saline containing 1: 10,000 Thimerosol, and aliquoted under sterile conditions.

To determine the stability of the alum absorbed particles of this invention, the antigen was recovered by redissolving the alum in 3% sodium citrate followed by sequential dialysis against 3% sodium citrate and PBS. The number of 74,95726 particles of the invention is then determined by a parallel-line radioimmunoassay against dilutions of purified HBsAg standard, these dilutions comprising PBS-50% freshly born calf serum.

table 1

Stability test parameters Samples: two samples as such and two absorbed in alum Sample concentration: 5 ug / ml Container: glass ampoule

Storage temperature: 2-8 ° C

Experiments: (a) qualitative: SDS-PAGE

(b) quantitative: radioimmunoassay

Example 1

Expression of Particles Containing Polypeptides Encoded by the Coding Region of the PreS1-PreS2 ~ S Protein A. Preparation of the Recombinant Plasmid pMMT-neo

Plasmid pBPV342-12 was digested with restriction endonuclease BamHI (see Figure 1 and Materials and Methods). Two DNA molecules were obtained: one molecule (7.95 kb) comprises the entire genome of bovine papillomavirus (BPV); the second molecule (6.65 kb) contains part of the bacterial pi plasmid pML2 (pBR322 depleted of the "chain"), the mouse metallothionein promoter (pMMT), the neomvinin resistance gene (neo), and the SV40 PAS-t region (see Figure 1) . When this fragment is ligated to itself (made annular), the plasmid pMMT-neo is obtained (see also Figure 5).

The reaction was performed in reaction buffer (see Materials and Methods) with a total volume of 400 μl and a final concentration of 0.2 μg / μl pBPV342-12; and 80 units of BamHI, and the reaction was performed at 37 ° C.

II

75 95726 mode for 4 hours. The completeness of the digestion was confirmed electrophoretically on an agarose gel using a 0.7% agarose gel (see Materials and Methods). The reaction was stopped by the addition of 40 μl of 8 M LiCl solution and the DNA was precipitated with 1 ml of ethanol at -80 ° C for 30 minutes. The precipitated DNA was resuspended in 100 microliters of 10 mM Tris buffer, pH 7.8.

B. Isolation of the entire PreS1-PreS2-S protein coding region and the copy-containing natural promoter fragment The preparation and cloning of the adw subtype of the HBV genome is described in Cummings, I.W. et al., Proc. Natl. Aca.

Sci. USA, Vol. 77, page 1842, 1980. The annular HBV genome is made linear from a single EcoRI site to bacteriophage for cloning into lambda and subcloning of the bacterial plasmid to give plasmid pA01 (see Figure 2). Because the EcoRI restriction site is located in the coding region of the PreS1-PreS2 ~ S protein, this region is cleaved in the linear EcoRI form. To obtain the intact PreS. | -PreS2-S protein coding region, a 3.2 kilobase pair EcoRI insert of plasmid pA01 was isolated and separated from plasmid DNA by digesting 100 micrograms of plasmid pA01 in a total of 400 ul of reaction buffer (see Materials and Methods). , and containing 200 units of EcoRI, for 4 hours at 37 ° C. A 3.2 kilobase pair DNA insert was isolated from plasmid DNA by preparative electrophoresis using a 0.7% agarose gel (see Materials and Methods). DNA was electrically eluted from an agarose gel onto a DE 81 Whatman ion exchange filter, from which the DNA is removed to a high salt solution. The DNA was purified by extraction once with a mixture of phenol and chloroform and precipitation twice with ethanol. The purified linear 3.2 kb EcoRI fragment encoding the complete HBV genome was then ligated to itself using a high concentration of 76 9 5 7 2 6 DNA that favors the formation of concatamers: 30 μg of EcoRI fragment DNA was ligated in reaction buffer. , with a total volume of 50 μl »and containing 1.8 units of T4 DNA ligase and 2 mM ATP, at 15 ° C for 1 hour, and at 4 ° C overnight; the DNA was then purified by extraction twice with a mixture of phenol and chloroform, extraction once with chloroform, followed by precipitation twice with ethanol. The DNA pellet was resuspended in 20 microliters of 10 mM Tris buffer, pH 7.8, and digested with restriction enzyme BglII in reaction buffer (see Materials and Methods) with a total volume of 50 μl and containing 50 units of BglII, 37 °. At C for 4 hours.

The DNA fragments formed in this reaction were separated electrophoretically using a 1.5% agarose gel. A 2.78 kilobase pair BglII fragment containing the intact PreS1-PreS2 ~ S protein coding region and its natural promoter system required for expression of surface antigen polypeptides was isolated from an agarose gel and purified as described above (see figure). 2).

C. Insertion of a fragment containing the coding region of the PreS1-PreS2 ~ S protein into the pMMT neo plasmid: construction of plasmid pDM1

1 ul of the DNA solution prepared as described in Part A above was taken and mixed with 5 microliters of 2.78 kilobase pair BglII (0.25 ug / ul) as described in Part B above.

The mixture was subjected to a ligation reaction in a total of 10 microliters of reaction buffer containing 0.9 units of T4 DNA ligase at 15 ° C for 1 hour and at 4 ° C overnight.

77 95726

Bacterial cells, preferably HB101 cells, were treated to be able to receive DNA in a transformation reaction carried out according to the method described in Materials and Methods. The ligation mixture comprised 10 mM Tris, pH 7.5 1 mM EDTA, with a total volume of 70 μl, and was added to 200 microliters of a suspension of bacterial cells capable of transferring DNA into the cells.

The mixture was incubated on ice for 30 minutes, then 1 ml of L-medium was added thereto, and the mixture was incubated at 42 ° C for 2 minutes and at 37 ° C for 40 minutes. After incubation, cells were plated on LB agar plates containing 50 μg ampicillin / ml to give 50-300 μl of cell suspension per plate. The agar plates were incubated at 37 ° C overnight. After this incubation period, individual isolated colonies were screened for the presence of the desired bacterial plasmid pMMT-neo containing a 2.78 kilobase pair BglII-derived insert (see Figure 3).

Screening is preferably performed by a method based on colony hybridization. For this purpose, individual colonies were raised with a toothpick and transferred to an ampicillin-containing LB agar plate in the shape of a lattice that allows clones to be identified. The plate was incubated overnight at 37 ° C.

The colonies were transferred to a nitrocellulose filter by placing the filter on the agar surface and keeping it on the agar surface until it was wet. The filter was carefully removed from the agar surface, followed by sequential transfer to three layers of Whatman 3M paper, each soaked in a solution comprising either 0.5 M NaOH or 1 M Tris, pH 7.0, 1.5 M NaCl / O , 5 M Tris, pH 7.4, or 2 x SSC. Filters were placed vs 95726 colony side up on wetted papers for cell lysis and subsequent neutralization and fixation procedures.

After air drying, the filters were heated in vacuo at 80 ° C. The nitrocellulose filters were then subjected to DNA hybridization using a radiolabeled DNA probe obtained from a 2.78 kilobase BglII fragment containing the coding region of the PreS1-PreS2 ~ S protein prepared as described in Part B above and reading an open phosphodiester bridge. (see Materials and Methods).

The nitrocellulose filter was incubated in a prehybridization mixture containing 50% formamide, 20 mM sodium phosphate buffer, pH 6.6; 1 x Denhardt's solution; 100 μg / ml denatured salmon sperm DNA and 1x10 cpm P-labeled DNA thawed in 0.2 N NaOH at 68 ° C for 10 minutes.

This filter was incubated in this mixture for 16 hours at 45 ° C. The filter was then washed twice in a solution comprising 2 x SSC, 0.1% SDS, each time at room temperature for 5 minutes, and twice in a solution comprising 0.1 x SSC, 0.1% SDS, for 15 minutes, each time .50 ° C. The filters were exposed to X-ray film (preferably 3M) between the two shades at -80 ° C for two days.

Colonies containing a recombinant plasmid containing a cloned 2.78 kilobase pair BglII fragment were seen as black dots. Four of the 50 colonies were identified, and plasmid DNA from these colonies was isolated as minipreps by the method described in Birnboim and Doly, Nucl. Acids Res., Vol. 7, page 1513, 1979, and its n 79 95726 was analyzed by double digestion with restriction endonucleases BglII and XbaI. The analyzes confirmed the expected structure described above (see Figure 3).

D. Replacement of the natural promoter of the coding regions of the PreS1-PreS2 ~ S protein with the metallothionein promoter: construction of plasmid pDM2

Plasmid pDM1 described above was completely digested with restriction enzymes BglII and BamHI in a reaction volume of 100 ul containing 20 ug of plasmid DNA and first 50 units of enzyme BglII, the reaction buffer comprising 6.7 mM Tris, pH 7.8; 6.7 mM MgCl 2 / 6.7 mM

8-mercaptoethanol, at 37 ° C for 4 hours; the salt concentration was then raised to 150 mM NaCl, and digestion was completed by the addition of 40 units of BamHI, and the mixture was incubated at 37 ° C overnight. Three pieces were obtained, the largest piece being 5.1 kb, the next piece being 2.97 kb, and the smallest piece being 1.4 kb. These fragments were separated by preparative electrophoresis using a 0.7% agarose gel, from which the fragments (5.1 kb and 1.4 kb) were isolated electrophoretically using an Whatman DE 81 ion exchange filter.

DNA was removed from this filter by incubation in high salt buffer for 4 hours at 4 ° C, and the DNA was purified by extraction with a mixture of phenol and chloroform and precipitation twice with ethanol. The DNA was resuspended in 20 microliters of 10 mM Tris buffer, pH 7.8. Purity was determined for one microliter and the amount of DNA was evaluated electrophoretically using an agarose gel.

A large (5.1 kb) fragment containing a metallothionein promoter at the BglII end was ligated to a small fragment (1.4 kb) containing the coding region of the PreS2-S protein, i.e. 95726, which did not, however, contain the natural promoter of this gene or the PreS2-S protein. parts. The large body also contained the natural termination polyadenylation signal (hb-PASs) necessary to express the coding region of the hepatitis B virus PreS2-S protein (see also Figure 4).

The large fragment of debris also contains a bacterial plasmid, so it is possible that this fragment will automatically ligate to itself without the compact BamHI fragment being included in the ligation product. Therefore, a large aliquot of the preparation totaling 20 μl was taken from 10 μl and treated with alkaline phosphatase by adding 28 units of this enzyme and incubating at 37 ° C for 20 minutes. The reaction was stopped by the addition of 1 μl of 50 mM EGTA, and incubated at 68 ° C for 10 minutes. DNA was purified by precipitation twice with ethanol in 0.8 M LiCl solution.

The DNA pellet was resuspended in 10 microliters of 10 mM Tris buffer, pH 7.8, and 5 ul of this buffer was taken as a control to determine the ligated self, and another 5 microliters was mixed with 5 microliters of electroeluted small (1.4 kb) BamHI.

Ligation of both samples was performed in a total volume of 20 microliters as described above. Transformation into HB101 bacteria was performed as described above.

Twelve separate colonies were taken and grown in 2 ml cultures, and plasmid DNA was isolated according to Birnboim and Doly, cited above. Plasmid DNA was assayed for the incorporation and orientation of a small BamHI fragment by double digestion with the restriction enzymes EcoRI and XbaI.

In two of these 12 plasmid DNAs, this small (1.4 kb) BamHI fragment has been inserted in the same orientation as the metallothionein promoter.

li no 95726 These plasmid DNAs are grown in mass culture and pretreated for transfer into eukaryotic cells by co-transfection.

Alternatively, the EcoRI / BglII fragment (1.9 kb) obtained from the plasmid comprising the metallothionein promoter pMMT-neo (1.9 kb) replaces the short (32 bp) EcoRI-BamHI fragment in front of the coding region of the pD? 11 PreS2-S protein to give plasmid pDM3, as shown in Figure 5.

E. Introduction of Recombinant DNA Vectors Obtained in C and D into Mammalian Cells and Generation of Particle-Producing Cell Lines of the Invention

The recombinant plasmids pDM1 and pDM2 were co-transfected into mouse L cells, vero cells (African maracella), CHO cells, and mouse 3T3 fibroblasts using standard transfection methods (Graham and van der Eb, Virology, Vol. 52, page 456, 1973, supra). (see Materials and Methods). Cells that receive plasmid DNA and retain plasmid DNA are resistant to G418 and survive on a selective medium containing this drug. Those cells that do not accept DNA do not survive on a selective medium. These cells are detected as separate clones on the surface of the culture dish. Cells were harvested on a cloning cylinder and grown for mass culture in a conventional manner using a standard medium such as Dulbecco's modified Eagle's medium supplemented with 10% calf serum and 500 ug G418 / ml (see Materials and Methods). From the five clones obtained, a cell line designated ENDO-I, -II, -III, -IV and -v was generated and prepared into frozen storage lines (see Materials and * Methods). The production rate of these cell lines in static culture was determined by radioimmunoassay (RIA? 82 95726 see Materials and Methods) and compared to the production rate of known cell lines. The cell lines of this invention produce an average of 500 to 1000 ng of particles of this invention per milliliter of culture medium per day.

F. Culturing the particle-producing cell lines of this invention in an Acusyst-P instrument

In six rotatable flasks grown in DMEM + 10% FBS medium (see Materials and Methods), a total of about 10 cells were seeded in six hollow fiber cores in an Acusyst-P culture system (see Materials and Methods). Approximately 600 ml of fluid was collected twice a week from the extrapillary space of each hollow fiber core of the Acusyst-P system, and stored at 4 ° C prior to purification. The concentration of the particles of this invention was determined by the RIA method (see Materials and Methods).

G. Purification of Particles of the Invention from the Culture Medium-P System The particles produced by these new cell lines containing the proteins encoded by the PreS1-PreS2-S protein coding region were purified by polyethylene glycol (PEG) precipitation, gel filtration, ultrafiltration, and isopyknation. see below).

1. Fraction precipitation with polyethylene glycol (PEG)

The medium outside the capillaries was recovered from the ACUSYST-P culture system and pooled in 3000 ml volumes. To each 3,000 milliliter volume was added 180 g of PEG 8000 (SIGMA), and it was dissolved by stirring at room temperature for 20 minutes, and stirring was continued for a further 3 hours at 83 ° C. The precipitate was collected by centrifugation in 500 ml flasks, GS 3 rotor, at 4500 rpm (3000 x g) for 30 minutes at 10 ° C. The supernatant was collected, and 180 g of PEG 8000 was added again, and dissolved at room temperature as described above. The solution was further stirred at 4 ° C for 3 hours. The precipitate was recovered from this solution as described above, except that centrifugation was performed at 9,000 rpm (15,000 x g) for 60 minutes. The pellet was resuspended in 20 milliliters of phosphate buffered saline (PBS).

2. Gel Filtration Chromatography The material redissolved in PBS buffer after PEG precipitation was chromatographed by gel filtration using BioRad A-5m resin at 4 ° C. The dimensions of the column were 25 x 1000 mm and the volume of the bed was 480 ml. When the material is typically divided into 1000 μg PEG-precipitated particles of this invention in a volume of 10-15 ml, the column is applied and eluted with PBS or TNE at a rate of 6 drops per minute (18 ml / h), and 3 ml fractions are collected from the eluate. Figure 6 shows the profile of the particles of this invention eluted from the A-5m column, the solid line represents the absorbance of each fraction at 280 nm, and the dots indicate the number of particles of this invention in each fraction, calculated from the RIA assay.

3. Isopycnic Centrifugation in CsCl Solution Gel filtration column chromatography covering the first peak (see Figure 6) containing about 30 fractions containing the partially purified particles of this invention was pooled (approximately 100 ml). The density of this solution was adjusted to 1.30 g / cm 2 with CsCl, after which it was transferred to 84,95726 nitrocellulose tubes suitable for a SW 27 or SW 28 rotor (Beckman). Gradients were obtained by placing 4 ml of a 1.35 g / cm 3 CsCl solution at the bottom of the tube and 4 ml of a 1.25 g / cm 3 density CsCl solution at the bottom of the tube and 4 ml of a 1 density 1 solution. .20 3 g / cm. The gradients were centrifuged at 28,000 rpm for 50 hours at 10 ° C, divided into fractions, and the purified antigen was recovered from a layer with a density of 1.20 g / cm, from the surface of the gradient. The particles of this invention were separated from a very small amount of contaminating proteins that formed a zone in the middle of the gradient (see Figure 7). The solution was desalted by dialysis for 24 hours against three batches of saline.

To ensure quality, a portion of this gradient-purified material was centrifuged using a linear CsCl gradient. Then, as expected, the particles of this invention formed a single peak at a density of 1.2 g / cm 2.

H. Characteristics of Particles of the Invention Produced by Cell Lines The purity and physical properties of the polypeptides contained in the particles of this invention in various preparations are determined by standard laboratory methods such as radioimmunoassay, immunoprecipitation, and SDS-PAGE (see Materials and Methods).

I. Determination of Purity a. Determination of Contaminating Plasma Protein

The concentrations of the various serum proteins in the preparations of the purified particles of this invention are determined by standard RIA techniques using specific antibodies. 85 95726 agents against bovine serum albumin, IgArta, IgG, IgM, etc. From the results shown in Table 2, it can be seen that no contamination with immunoglobulins could be detected and the contamination with albumin was only minor.

Table 2

Determination of contaminating plasma proteins by RIA

Protein% of total proteins

Albumin 0.05

IgG 0.2

IgA 0.2

IgM 0.2 b. Determination of Concentrations of Contaminating Host Cell-derived or PreS1-PreS2-S Nucleic Acid Chains from Purified Preparations of Particles of the Invention by the Spot-Point Method The purified particles of this invention are subjected to dot-spot hybridization (dot-hybridization). -j-PreS2-S DNA strands or host chromosomal DNA strands. For each spot, an amount of 100 nanograms of the purified particles of the invention was heated at 68 ° C for 10 minutes in 40 microliters of 0.25 N NaOH solution. As a positive control, 20 pg of pDM1 DNA of the recombinant plasmid of this invention in 40 microliters of 0.25 N • NaOH solution is treated in the same manner. Direct

After denaturation in NaOH solution, the solution is spotted onto a nitrocellulose filter. The following filter handling and hybridization procedures are analogous to the 32 procedures used in the Southern spotting method, except that the P-labeled probe · * is a 50:50 mixture of chromosomal DNA and plasmid DNA of this invention, this plasmid DNA including 86 95726

The coding region of the PreS1-PreS2-S protein. As expected, the hybridizing probe produces a strong signal with the DNA of the recombinant plasmid of this invention, but only with a weak background signal with the purified particle preparation. This hybridization pattern indicates the absence of PreS1-PreS2-S DNA or chromosomal DNA in the sample.

2. Immunoprecipitation and SDS-Polyacrylamide Gel Analysis To determine the proportions of PreS-j-PreS2-S polypeptides produced by the transfectants of this invention, the proteins produced by these transfectants are biosynthetically labeled, immunoprecipitated, and analyzed on SDS-PAGE gels (see Materials). . The electrophoretic pattern of proteins isolated from the culture medium by immunoprecipitation with antibodies against HBV virus obtained from a natural source was visualized by silver staining. The two major proteins correspond in size to the non-glycosylated and glycosylated polypeptide encoded by the S protein coding region (24 kd and 27 kd, respectively). The two smaller proteins, 33 kd and 36 kd, correspond in size to the two polypeptides encoded by the coding region of the PreS2-S protein. This method is not so sensitive that it could detect small amounts of polypeptides containing PreS1-PreS2-S polypeptides, but the presence of proteins encoded by the entire PreS1-PreS2-S coding region could be detected. By Western immunoblotting (see below).

The weak bands at the top of the gel are due to the accumulated protein and are also visible in the case of HBV particles obtained from natural sources. Thus, cells transfected in the coding region of the PreS1-PreS2-S protein secrete proteins that not only react with antibodies against the natural product, but are also similar in size to "95726". The presence of proteins similar in size to natural, glycosylated PreS-j-PreS2-S, PreS2-S, and S polypeptides derived from hepatitis B virus suggests that glycosylation pathways function normally in these cells.

3. Immunostaining (Western)

Western immunoblotting confirmed that each different polypeptide present in the silver-stained SDS-PAGE gel system reacted with a specific anti-HBV antibody. Proteins separated by SDS-PAGE gel were transferred to a nitrocellulose filter (Schleicher & Schull) by electroplating (BioRad) at 4 ° C,

100 V for 3 hours. After transfer, the filter is saturated with proteins to avoid non-specific binding of the peroxidase-labeled antibody. To this end, the filter is incubated for 1 hour at room temperature in a PBS solution comprising 20% neonatal calf serum, and the polypeptides comprised by the particles of the invention were visualized with peroxidase-conjugated HBV-specific antibodies. The filter is placed on top of the para-film and covered with a solution of conjugated antibodies for 3 hours at room temperature in a humid chamber. The filter is washed six times with a solution of 0.5% Tween, 10 mM Tris and 5 mM CaCl, then covered with chromogen, POD (o-phenyldiamine dihydrochloride) in hydrogen peroxide (0.3 g / l), citrate phosphate buffer. 0.5 N is used as the stop solution

sulfuric acid. The protein bands corresponding to all six viral polypeptides are displayed, i.e., all proteins encoded by the coding region of the PreS1-PreS2 ~ S protein are present.

88 95726 4. Amino acid composition in purified proteins comprised of the particles of this invention encoded by the PreS1-PreS2-S protein coding region

After acid hydrolysis, the amino acid composition of the coding region of the PreS2-PreS2-S protein in the purified proteins is determined and compared to the polypeptide composition obtained by calculating the nucleotide chain of the PreS2-S protein coding region, the PreS2-S protein coding region. The results shown in Table 3 correspond well to the predicted values for DNA strands as well as already published results (Shiraishi et al., J. Gen. Virol., Vol. 48, page 31, 1980). In particular, these polypeptides are characterized by relatively high percentages of serine, proline and leucine.

Table 3

Amino acid composition in the purified particles of this invention Percentage of residue

Expected

Amino Acids * Determined S. PreS2 ~ S PreS ^ -PreS2 ~ S

ASN + ASP 5.5 4.2 5.2 7.3 THR 7.5 8.0 7.9 7.8 SER 12.5 11.3 12.0 10.8 GLU + GLU 7.5 4.2 4.5 5.1 PRO 12.5 10.8 10.5 12.6 GLY 8.6 6.6 7.1 8.3 ALA 5.0 2.8 4.5 5.4 VAL 4.2 5 .2 5.2 4.8 CYS 3.2 6.6 5.2 3.8 MET 1.9 2.3 2.2 1.9 ILE 4.9 7.5 7.5 6.7 LEU 12, 8 15.5 13.9 12.1 TYR 2.0 2.8 2.6 1.9 PHE 5.6 7.5 6.0 5.4 LYS 2.1 1.9 1.5 1.3 HIS 0.9 0.5 1.1 1.9 AEG 2.1 .2.4 3.0 ... 3.0 98.8% 100.1% 99.9% 100.1% f * Tryptophan is lost with acid by hydrolysis 89 95726 I. Electron microscopic examination of the purified hepatitis B particles of this invention

It was found electron microscopically that the purified particles of this invention are spherical 22 nanometer particles similar to those typically formed by the accumulation of hepatitis B virus S protein polypeptides.

J. Preparation and Stability Testing of the Purified Particle Adjuvant of the Invention To prepare an adjuvant for use in the vaccine of this invention, 1/10,000 volume of Thimerosol and 1/10 volume of a sterilized, 0.2 M Al 12 H 2 O solution filtered by filtration are added to sterile saline containing antigen at the desired concentration. The pH is adjusted to 5.0 with sterile 1 N NaOH solution and the suspension is stirred at room temperature for 3 hours. The antigen precipitated with alum is recovered by centrifugation at 2000 rpm for 10 minutes, after which it is resuspended in sterile normal saline containing 1: 10,000 Thimerosol and aliquoted under sterile conditions.

To determine the stability of the alum absorbed particles of this invention, the antigen is recovered by redissolving the alum in 3% sodium citrate, followed by sequential dialysis against 3% sodium citrate and PBS. The number of particles of this invention was then determined by a parallel-line radioimmunoassay against dilutions of a purified standard in PBS-Liu containing 50% neonatal calf serum. The results obtained in the stability tests (Table 4) show that the purified particles (either as such or absorbed as alum) are stable at 2-8 ° C for at least 7 months.

90 95726

Table 4 SDS-PAGE stability tests:

Results of zonal formation Storage Sample as such Alum absorbed in months Sample _J_2_ _J_2_

Start normal normal normal normal

-j M II II II

2 teaspoons H 11 H

2 M II 11 II

^ tl II II II

2 I »tl tl II

g II II II II

-j II II II II

Quantitative determination by RIA method

Percentage (%) of activity_ Storage Sample as such Alum absorbed in months sample _ 1_2_ 1_2_

Start 101 101 1 101 101 100 100 2 99 99 99 100 3 100 100 99 101 4 99 100 101 99 5 102 99 99 98 6 100 101 100 100 7 99 98 98 101 11 91 95726 K. Seroconversion and ED5q of the particles of this invention -value

Seroconversion experiments are performed on five groups of ten adult white mice (Figures 8A, 8B, and 8C). The Gm 1CR strain of female Swiss mice is injected subcutaneously with 1 ml of the alum-containing vaccine containing the particles of this invention at the following dilutions: 1/1 (5.0 μg), 1/4 (1.3 μg), 1/16 (0.31 μg) yg), 1/64 (0.16 yg) and 1/256 (0.078 yg). Mice are bled after 28 days and antibody titer is quantified by the AUSAB assay using the HBIG standard as a control. A serum sample from each animal was serially diluted four-fold and tested in triplicate.

The percentage of serotype-positive mice decreased with increasing dilution of the particles of this invention. The dose at which a seropositive reaction (ED 2) is elicited in 50% of the animals is about 0.05 to 0.25 μg of the vaccine containing the particles of this invention. In general, the seroconversion results obtained with the vaccine of this invention cannot be distinguished from those obtained with a vaccine obtained from a natural source.

Example 2

Expression of particles comprising polypeptides encoded by the coding region of the PreS1-PreS2 ~ S protein. A. Preparation of recombinant plasmid pENDO-1

Of the recombinant plasmids pBglII2.8, pBR322.Sg2 (a plasmid prepared by subcloning a 7 kilobase pair EcoRI 8G2 fragment from plasmid pMB9.BG2 into the EcoRI site of plasmid pBR322, described in Tilghman, SM et al., Proceeding Natl. , Vol. 75, page 725, 1978, pDM2, POLINK 23456 (see below) and gene fragments from plasmid pMMT-neo 92 95726 are used in the steps of preparing vector constructs in order to obtain such expression vectors obtained by recombination which do not contain any viral elements other than HPV.

It can be seen from Figures 9A and 9B that plasmid pBglII2.8 contains a gene fragment containing the coding region of the PreS-j-PreS2-S protein (1.34 kilobase pair BstEII-HpaI fragment) and comprises the natural strong promoter PreS2-S-. for the transcription of the protein coding region, but lacks the natural (weak) promoter for the transcription of the PreS ^ PreS2 ~ S protein coding region, as well as the transcription termination functions and the polyadenylation signal. Plasmid pBglII2.8 was digested with BstEII and HpaI to give two DNA fragments. The fragments were separated electrophoretically on a 3.5% polyacrylamide gel, after which one of them (1.34 kb) containing the coding region of the PreS1-PreS2-S protein was purified and stored. The Hpal head is blunt. The BstEII end was blunt-ended by filling (making it double-stranded) using DNA polymerase I (Klenow fragment) and four dNTPs, as well as conventional techniques to obtain a DNA fragment with two blunt ends.

The polylinker plasmid POLINK 23456, in which the polylinker region contains numerous restriction sites (below), was used.

Xbal Bell Hpal Clal HindlXI Kani BamHI Sohi Sacl Sali

GAATTCTAGATCTGATCAGTTAACATCCATAAGCTTGGTACCGGATCCCGGGCATGCGAGCTCGAGTCGAC

EcoRI Belli Smal XhoI

Xnval Aval

Aval

The polylinker adapter is located in the EcoRI-SalI-restricted backbone (3.1 kb) of plasmid pBR328.

93 95726 POLINK 23456 is digested with the enzyme HpaI to make the plasmid linear. Such a plasmid linearized with HpaI has two blunt ends. The linear plasmid is then ligated at its blunt ends with a 1.34 kilobase pair DNA fragment containing the coding region of the PreS-j-PreS2-S protein from plasmid pBglII2.8 (above). Because the 1.34 kilobase pair fragment can be incorporated into the polylinker plasmid in either possible orientation, the correct orientation (clockwise with respect to the natural replication direction) is ensured by digestion with EcoRI, followed by size analysis on 1% agarose gels. When a plasmid comprising the coding region of the PreS1-PreS2-S protein in the correct orientation is digested with EcoRI, two 0.4 and 4.1 kilobase pairs are obtained; misalignment results in the formation of two 1.0 and 3.5 kilobase pairs. The novel plasmid containing the coding region of the PreS-j-PreS2-S protein is then digested with HpaI and "partially" digested with BamHI. The short chain (24 base pairs) between the restriction sites HpaI and BamHI is separated from the "partial" HpaI-BamHI backbone (5.0 kb), and discarded as a result of complete cleavage with the bodies in the reaction mixture.

Plasmid pBR322.8G2 is digested with the enzymes Ball (blunt end) and BglII ("infectious" end) to give a gene chain (1.6 kb) containing the polyadenylation termination chain from the mouse globin gene. The mg-PAS-t chain is then ligated to the opened plasmid linearized with HpaI-BamHI, described above, in the directions Ball-HpaI and BglII-BamHI (the "adhesive" BglII and BamHI ends are identical and thus compatible, and they can be ligated together) to give a new intermediate recombinant plasmid (6.0 kb) * containing both the PreS1-PreS2-S protein coding region 94 95726 and the mg-PAS-t chain in the correct orientation and order. The plasmid containing the coding region of the PreS1-PreS2_S protein and the mg-PAS-t chain is then digested with BglII and SalI, cleaving the plasmid into two pieces of DNA (2.95 kb and 3.05 kb), which is electrophoretically detected at 1%. agarose gel. The 3.05 kilobase pair fragment is digested with PvuI to give two smaller fragments (1.08 kb and 1.98 kb), followed by the remaining 2.95 kilobase pair BglII-SalI-restricted DNA fragment (which does not contain PvuI). which contains the PreS1-PreS2 ~ S protein coding region and the mg-PAS-t chain fused together are purified and stored.

Plasmid pMMT-neo, formed by ligating the 6.65 kilobase pair fragment from Example 1 of Part A (see Figure 9), is then digested with BglII and SalI, resulting in two DNA fragments (4.23 kb and 2.42 kb). A 2.42 kilobase pair containing the neo-mycin-based selection marker and the SV40 virus PAS-t chain is discarded. The remaining 4.23 kilobase pair fragment is purified by electrophoresis using a 0.8% agarose gel, after which it is ligated to the 2.95 kilobase pair containing BglII containing the PreS1-PreSj-S protein coding region and mg-PAS-t chain obtained above. -Sall-restricted DNA fragment to give a 7.15 kilobase pair recombinant plasmid containing the MMT promoter, the coding region of the PreS1-PreS2 ~ S protein, and the polyadenylation and termination mg-PAS-t chain, respectively, and the plasmid is called pENDO-1. Plasmid pENDO-1 does not contain parts of the non-HBV viral genome (see Figure 9).

B. Preparation of recombinant plasmid pENDO-2

As shown in Figure 10, plasmid pDM2, which comprises the MMT promoter, the PreS2 ** S protein coding region, and the protein X coding region, is digested.

II

95 95726 with the enzymes Spel and Sali. The SpeI restriction site is located in the S-protein region of the PreS2-S coding region and is the only SpeI site in plasmid pDM2, like the SalI site located later in the gene. Using these two enzymes, the plasmid is cleaved into two DNA-Kappa fragments (1.58 and 4.88 kb), and the 1.58 kilobase pair fragment containing the carboxy terminus of the PreS2-S protein coding region and the protein X coding region is discarded, while 4, The 88 kilobase pair piece is cleaned and stored.

Plasmid pENDO-1 is similarly digested with SpeI and SalI, cleaving the plasmid into two DNA fragments of 1.9 and 5.25 kb in size. A 1.9 kilobase pair fragment containing the carboxy terminus of the S protein region from the PreS2-S protein coding region, as well as the mg-PAS-t region, is purified and stored.

The two conserved DNA fragments (1.9 kb and 4.88 kb) are then ligated to form a new recombinant plasmid (6.8 kb), pENDO-2, which contains the MMT promoter, the PreS2-S protein. coding region and mg-PAS-t chain. Plasmid pENDO-2 does not contain parts of the non-HBV virus genome (see Figure 10).

C. Preparation of recombinant plasmid pENDO-O

The third new plasmid containing the neomycin selection marker, designated pENDO-0 (see Figure 11), is generated by digesting pMMT-neo generated by ligation of the 6.65 kilobase fragment obtained in Example 1 of Part A (see Figure 11) with the restriction enzymes SmaI. (blunt head) and BamHI. The plasmid breaks into two pieces of DNA (5.5 kb and 1.15 kb). A 5.5 kilobase pair fragment from the pMMT neo backbone of the plasmid containing the MMT promoter and the neomycin-based selection marker is retained. The latter fragment is then ligated to a 1.6 95726 96 kilobase pair DNA fragment containing the BalI-BglII-restricted mg-PAS-t chain, as shown for the construction of plasmid pENDO-1. The resulting 7.2 kilobase pair recombinant plasmid pENDO-0 contains the MMT promoter, a neomycin-based selection marker, and a mg-PAS-t chain, and no viral DNA strands at all (see Figure 11).

D. Introduction of Plasmid Vectors pENDO-0, pENDO-1 and pENDO-2 into Mammalian Cells by Co-Transfection

The resulting plasmid vectors pENDO-Ο, pENDO-1, and pENDO-2 are co-transfected into mammalian cells such as mouse L cells, Vero cells (African maracas), CHO cells, and mouse 3T3 fibroblasts using standard co-transfection procedures. Transfectants resistant to G418 are isolated and screened for production of the particles of this invention using the RIA method.

E. Preparation and transfection of mixed concatamers of DNA from plasmids pENDO-0, pENDO-1 and pENDO-2 into cell lines

Each of plasmids pENDO-1, pENDO-2, and pENDO-0 contains a unique restriction site, PvuI, located in the Amp gene, counterclockwise from the EcoRI restriction site (see Figures 9, 10, and 11). Each of these plasmids is separately digested with the enzyme PvuI to make them linear. These plasmids are then polymerized to form mixed concatamers in which different plasmids are present in different ratios. For example, when the linearized plasmids pENDO-1 and pENDO-Ο are polymerized using a ligase such as T4 DNA ligase, mixed concatamers may be formed in which the ratio of plasmids pENDO-1; pENDO-Ο is 10: 1 if plasmids made as lines 97 95726 are used as components in a ratio of pENDO-1: pENDO-O 10: 1. The resulting mixed concatamer formed from plasmids pENDO-1 and pENDO-O is transfected into a eukaryotic cell, such as a mammalian cell, and the cells are selected for drug G418 resistance. It is assumed that, on average, each G418-resistant (transfected) cell contains about ten copies of the coding region of the PreS1-PreS2-S protein per copy of the neo gene.

Similarly, the pENDO-O fragment is polymerized with the pENDO-2 fragment with a ligase, such as T4 DNA ligase, for plasmids pENDO-2: pENDO-0 at 10: 1, for example, to give mixed concatamers containing plasmids pENDO-2 and pENDO-O. This concatamer is then transfected into a eukaryotic cell, such as a mammalian cell. The cells are then selected for G418 resistance, and the G418-resistant (transfected) cell contains an average of ten copies of plasmid pENDO-2 per pENDO-O, in this example.

Similarly, plasmids pENDO-1, pENDO-2, and pENDO-O are polymerized with a ligase, such as T4 DNA ligase, to form a mixed concatamer in which the ratio of pENDO-1: pENDO-2: pENDO-O is, for example, 10: 10: 1. The resulting mixed concatamer is transfected into a eukaryotic cell, such as a mammalian cell, and the cells are selected for G418 resistance. Resistant (transfected) cells should contain an average of ten copies of plasmid pENDO-1, ten copies of plasmid pENDO-2 and one copy of plasmid pENDO-O.

Each resulting drug-resistant. the cell should produce in higher yields particles containing proteins encoded by the coding region of the PreS1-PreS2 'S protein.

98 95726

Use of non-replicating vectors comprising the mouse metallothionein promoter to express other proteins in transfected, eukaryotic host cells.

The present invention also encompasses transfer vectors obtained by recombinant DNA technology using any functional DNA strand to produce human or rat growth hormone in transfected, eukaryotic host cells.

The term functional DNA strand refers to a discrete DNA region obtained directly or indirectly from any source that functions as a fully expressed gene unit, structural gene, promoter, or regulatory region in a eukaryotic host cell transfected with a vector of this invention.

By a fully expressed gene unit is meant a structural gene, a promoter, and regulatory regions that are a prerequisite for its replication and reading.

By promoter is meant any region upstream of a structural gene that allows RNA polymerase to bind and copy.

By regulatory region is meant any region that regulates the rate of replication of a structural gene.

By structural gene is meant a coding chain that serves as a template for the synthesis of messenger RNA.

Preferred structural genes include, for example, structural genes encoding pharmaceutically interesting polypeptides, such as viral antigen, insulin, interferon, lymphokines, rat 99 95726 or human growth hormones, tissue plasminogen activator, alpha-1-antitrypsin, and the like. Most preferred is rat or human growth hormone.

This invention relates to a recombinant DNA vector comprising a functional DNA strand and an MMT promoter. The MMT promoter may be included in the DNA vector either in addition to or in place of the natural promoter of this DNA strand. The MMT promoter is preferably located in the DNA vector immediately upstream of the protein coding region of the DNA chain. Such a vector preferably also comprises a copy termination chain and a selection marker. Such a marker is preferably a marker based on drug resistance, such as the neomycin gene. Such a copy termination chain is preferably the SV40 termination site (sv-PASs) or more preferably the DEF region of the mouse globin gene (mg-PASs). Such a vector can be prepared by conventional recombinant DNA techniques and other methods of molecular biology. In the most preferred case, using the mg-PAS-t region, the vector contains no viral DNA fragments at all and is not oncogenic, i.e., it does not transform (make a cancer-forming) host cell into which it has been implanted. When such a vector is transfected into a host, it integrates into the host chromosome and replicates passively with the host genome if the vector does not contain an autonomous replication chain (replicon) capable of functioning in the host transfected with the vector.

The recombinant DNA vector of the present invention should preferably comprise the following characteristics: 1) the DNA strand of interest; 2) an MMT promoter located immediately upstream of the DNA strand of interest; 3) the vector should be able to replicate in bacteria or another prokaryotic host to which it is trans 100.

95726 formed, for growth and amplification, to produce large amounts of the recombinant vector. Thus, such a vector should comprise a bacterial or other prokaryotic replicon, i.e., a piece of DNA comprising all the functions necessary for autonomous replication of the vector and its retention outside the chromosomes in a prokaryotic host cell, for example a host bacterial cell transformed with the vector. Such replicons are well known in the art.

4) The vector replicon should be small (i.e., preferably less than 6-8 kilobase pairs) to facilitate its genetic and molecular biological manipulation.

5) The vector should comprise a selection marker / preferably a selection marker based on the resistance of a drug such as ampicillin / which can be used in a vector-transformed host bacterial cell.

6) The vector should also comprise another marker of choice, preferably a marker based on the resistance of a drug such as neomycin, which can be used in a host eukaryotic cell transfected with this vector.

7) The vector should contain appropriate endonuclease restriction sites for cloning.

8) The vector should contain a transcription termination chain and a polyadenylation chain.

9) The expressed gene unit does not contain any viral pe. and is not oncogenic.

In the most preferred case, the vector of the present invention does not comprise an autonomous replication chain (replicon) capable of functioning in a eukaryotic host cell transfected with the vector. The main reason for using a non-replicating vector system in eukaryotic host cells is that all vector systems capable of autonomous and extrachromosomal replication in a vector-transfected eukaryotic host mammalian cell transfected with the vector comprise oncogenes. It is desirable to use vectors whose DNA is not derived from oncogenic viruses to express DNA strands encoding polypeptides of pharmaceutical interest.

The present invention is also directed to a transfected eukaryotic host cell transformed with a recombinant DNA vector comprising a functional DNA strand of the present invention. Such a host is preferably a mammalian cell, preferably a cell line derived from a Chinese hamster ovary (CHO), a blood cell line, an L cell line, or a mouse or rat fibroblast cell line. Such a host can be obtained by transfecting a eukaryotic cell with a recombinant DNA vector of the present invention using conventional techniques.

The present invention is also directed to a method of producing a particle comprising proteins encoded by a DNA strand of interest, wherein at least one of said proteins corresponds to a polypeptide encoded by the DNA strand of interest, the method comprising: a) culturing a transfected host of the invention in such a culture medium; that this host is capable of expressing these proteins, and b) isolating such a particle. Such a transfected host is preferably capable of secreting these particulate proteins into the medium. Preferably, heavy metal ions or a steroid hormone such as dexamethasone are added to such a culture medium to induce the MMT promoter and thus promote the expression of such a coding region. The ions of heavy metals used are preferably cadmium or zinc. The optimal concentration of heavy metal ions or steroid hormone in the medium can be determined by conventional methods.

102 95726 The present invention likewise relates to particles prepared by this method. If the transfected host cell of the present invention secretes these particles directly from its culture medium, then these particles can be isolated from the culture medium of the transfected host of the present invention by conventional techniques for protein purification. If these particles are not secreted by the transfected host cell of the present invention, they are obtained from the culture digest of this host by techniques commonly used to lyse the culture.

Example 3

Expression of human growth hormone

Preparation of a recombinant DNA vector encoding human growth hormone, said vector comprising a metallothionein promoter A. Isolation of a DNA fragment containing the human growth hormone gene such that the DNA fragment does not comprise the natural promoter of replication

The recombinant plasmid pBR322, which contains a 2 kilobase pair of EcoRI-derived DNA fragment encoding the human growth hormone gene (counterclockwise), is digested with restriction endonuclease B in buffer (high salt buffer). In this case, two pieces are obtained, one of which is about 5.6 kb and the other 0.8 kb. These fragments are separated electrophoretically using a preparative 0/8% agarose gel. The larger body, which contains the structural gene for human growth hormone without the natural promoter of this gene, is electrically eluted from the gel and purified by extraction twice with a mixture of phenol and chloroform, extraction twice with chloroform and precipitation twice with 103 9 5 7 2 6 ethanol. The accumulated DNA is resuspended in 20 microliters of 10 mM Tris buffer, pH 8.0.

B. Isolation of a DNA fragment containing the metallothionein promoter and the vector pML2 backbone

Plasmid pMMT-neo (see Figure 5) is digested with restriction endonucleases BglII and BamHI to give two fragments, one of 4.5 kilobase pairs containing the MMT promoter and pML2 vector backbone and the other of 2.15 kilobase pairs, and it contains a neo gene linked to the sv-PAS-t region. To prevent self-ligation, the linear DNA is treated with alkaline phosphatase in a total volume of 100 microliters containing 25 ug of DNA and 28 units of alkaline phosphatase. The mixture is incubated for 20 minutes at 37 ° C, and the reaction is stopped by adding 10 μl of 50 mM EDTA solution and heating for 10 minutes at 68 ° C. The pieces are separated electrophoretically using a 0.8% agarose gel. The 4.5 kilobase pair body is electrically eluted from the gel as described and is purified by extraction twice with a mixture of phenol and chloroform, twice with chloroform and precipitation twice with ethanol. The accumulated DNA is resuspended in 20 microliters of 10 mM Tris buffer, pH 8.0.

C. Ligation of DNA fragments isolated in A and B above

An aliquot of 5.6 kilobase pairs isolated in A above is taken in an amount of 1.5 micrograms and mixed with 0.3 micrograms of the aliquot isolated in B above in a total volume of 10 microliters containing 0.9 units of T4 DNA ligase and 1x ligation buffer, and 100 mM ATP. The mixture is incubated for 1 hour at 15 ° C and overnight at 4 ° C. The ligation mixture is then introduced into the bacterial strain HB101 using the procedure described in Materials and Methods. Cells from the transformation mixture are plated on LB agar plates containing ampicillin, and isolated colonies are screened for those containing 10.1 kilobase pair plasmids that can be linearized with the restriction endonuclease BamHI. Orientation is determined by EcoRI digestion. Plasmids containing the implant in the correct orientation give two EcoRI fragments of 3.5 kb and 6.6 kb in size. These plasmids, termed pMMT-hGH, are grown on a large scale and purified as described.

D. Introduction of the Recombinant DNA Vector Obtained in C above into Mammalian Cells and Generation of Human Growth Hormone-Producing Cell Lines The vector pMMT-hGH is then transfected into eukaryotic host cells (mammalian cells) using conventional co-transfection techniques to obtain transfectants, resulting in transfection. polypeptide. Such transfectants are identified by RIA using antibodies against human growth hormone. Human growth hormone secreting transfectants are formed into a cell generation using conventional techniques.

Example 4

Expression of rat growth hormone

Preparation of a recombinant DNA vector encoding rat growth hormone, said vector containing the metallothionein promoter A. Conversion of the restriction endonuclease BglII site in the plasmid pMMT-neo XhoI to 200 micrograms in buffer, with a total reaction volume of 1000 ul. The ends of the 6.65 kilobase pair linear plasmid DNA are first blunt-ended by filling the BglII ends with DNA polymerase I (Klenow fragment) and using four dNTPs as previously described, followed by attachment of the restriction endonuclease XhoI recognition and cleavage site. -da-containing synthetic DNA linker (from PL Biochemicals, Milwaukee, Wisconsin 53205): 5'-CCTCGAGG-3 '3'-GGAGCTCC-5' The filling reaction is performed in a total volume of 30 microliters containing 2.5 μg of 6.65 kilobase pairs. pieces, 20 mM four dNTP molecules, 3 ul NT buffer, 1 ul Klenow. The mixture is incubated at room temperature for 30 minutes. The reaction is stopped by adding 2 μl of 0.25 mM EDTA solution and the DNA is washed once with an equal volume of a mixture of phenol and chloroform, and then with an equal volume of chloroform alone. The DNA contained in the aqueous phase is further purified by precipitation twice with ethanol. The precipitated DNA is resuspended in 10 microliters of 10 mM Tris buffer, pH 8.0, to a concentration of 50 ng / μl.

The coupling body is dissolved in 50 microliters of 10 mM Tris buffer, pH 8.1, to a concentration of 1 picomol / ul. A blunt-ended 6.65 kilobase pair is ligated to the coupling body in a total volume of 20 microliters containing 2 picomoles of coupling body, 0.5 μg of 6.65 kilobase pairs, 9 units of T4 DNA ligase (Boehringer Mannheim), 30 μl of 2 blunt-head ligation bag, and 100 mM ATP. The ligation reaction is allowed to proceed at 15 ° C for one hour and at 4 ° C overnight.

This ligation mixture is used to transform a bacterial strain HB101 that has been made receptive (compe- 1 06 95726 tent) as described in Materials and Methods. Cells obtained from the transformation mixture are plated on LB agar plates containing ampicillin. Bacterial colonies capable of growing on ampicillin-containing plates are harvested and grown in 2 ml cultures and the plasmid is isolated as described above.

Four of the 12 bacterial colonies (OK 3, OK 4, OK 11, and OK 12) were found to comprise a plasmid of the expected size after digestion with XhoI alone or with both BamHI and EcoRI. Plasmid DNA from clones OK 3 and OK 11 was allowed to propagate in strain HB101 to produce the plasmid on a large scale.

B. Isolation of a DNA fragment containing the metallothionein promoter and the backbone of the pML2 vector 100 micrograms of both clone OK 3 and clone OK 11 were digested with restriction endonucleases BamHI and XhoI to give two fragments, one of which (5.8 kb) comprised the MMT promoter XhoI. located near the end and at the BamHI end of the pML2 portion, and the second (0.85 kb) fragment contained the sv-PAS-t chain. The pieces were separated electrophoretically on a 0.8% agarose gel. The 5.8 kilobase pair was electrically purified by elution, then extracted twice with a mixture of phenol and chloroform, extracted twice with chloroform and precipitated twice with ethanol. The accumulated DNA was resuspended in 50 microliters of 10 mM Tris buffer, pH 8.0.

C. Isolation of a DNA fragment containing the rat growth hormone gene

Plasmid pBR322.rGH, which contained the genomic BamHI implant encoding the rat growth hormone gene (counterclockwise), was digested with BamHI and XhoI. The genomic BamHI-XhoI-Kap fragment containing the structural gene is isolated from a 0.8% preparative agarose gel as described above.

1 07 95726 D. Ligation of the bodies isolated in B and C above These bodies are ligated together so that the MMT promoter is linked directly to the structural gene via its adhesive XhoI end, in the correct orientation.

The ligation mixture is used to transform the bacterial strain HB101 as described above. Colony-forming transformants on LB agar plates containing ampicillin are harvested and grown in 2 ml cultures to prepare small amounts of plasmid. Plasmids yielding the two expected fragments by digestion with BamHI and XhoI, termed pMMT-rGH, are grown on a large scale in mammalian cells for transfection.

E. Introduction of the Recombinant DNA Vector Obtained in D above into Mammalian Cells and Generation of Rat Growth Hormone-Producing Cell Lines Such transfectants are identified by RIA using antibodies against rat growth hormone. Rat growth hormone secreting transfectants are formed into a cell line using conventional techniques.

Although the present invention has been described in terms of its preferred embodiments, it will be apparent to those skilled in the art that formal and detailed changes may be made therein without departing from the spirit and scope of the invention.

Claims (8)

108 95726 A method for determining the presence of hepatitis B virus infection, comprising performing quantitative immunoassays on a human sample to determine the amount of antibodies therein using a hepatitis B surface antigen particle prepared by recombinant DNA technology, wherein the particle comprises a PreS, PreS2-S protein, the recombinant DNA vector comprising the coding region of which does not contain other infectious viral DNA segments, and comparing the assay value to a known standard. 2. A method for determining antibodies against proteins encoded by the coding regions of the hepatitis B virus surface antigen PreS, PreS2-S protein from a sample taken from a mammalian blood serum, the method comprising the steps of: a. Contacting the sample with a solid substrate coated with unlabeled hepatitis B surface antigen particles prepared by recombinant DNA technology, the particle comprising a PreS] -PreS2-S protein, the recombinant DNA vector comprising the coding region of which does not contain other infectious viral DNA Segments; b. incubating and washing said contacted sample; c. contacting said sample with labeled hepatitis B surface antigen particles prepared by recombinant DNA technology, the particle comprising a PreS [-PreS2-S protein comprising a coding region. the recombinant DNA vector does not contain other infectious viral DNA segments, thus providing a labeled sample; d. incubating and washing said labeled sample; and e. determining the amount of labeled particle in the labeled sample. Il, 09 95 716 A method for determining antibodies against proteins encoded by the coding regions of the hepatitis B virus surface antigen PreS, PreS2-S protein from a sample taken from a mammalian blood serum, characterized in that the method comprises the steps of: a. Producing a composition comprising the antibody produced by an immunogen comprising particles prepared by recombinant DNA technology, wherein the particles comprise the PreS [-PreS2-S protein of the hepatitis B virus surface antigen, the recombinant DNA vector comprising the coding region of which does not contain other infectious viral derivatives DNA segments; b. contacting the sample with the first portion of the composition and the labeled immunogen, incubating and washing the first portion; c. contacting the antigen-free control with the second portion of the composition and the labeled immunogen, and incubating and washing the second portion; d. adding the same amount of staphylococcus comprising protein A in steps b. and c. compositions, incubating both compositions and separating the liquid from the solid; and e. determining the amount of labeled immunogen in step d. in both compositions obtained. . 4. A diagnostic assay kit for determining antibodies against proteins encoded by the coding regions of the hepatitis B virus surface antigen PreS, PreS2-S protein from a sample taken from a mammalian blood serum, characterized in that it comprises: 1a a unlabeled tower of protein particles comprising: prepared by recombinant DNA technology, wherein the particle comprises the hepatitis B virus surface antigen PreS, PreS2-S protein, the recombinant DNA vector comprising the coding region of which does not contain other infectious viral DNA segments, and which is solid carrier; and b. labeled antibodies to human IgG or IgM. no 95726 A diagnostic assay kit for detecting the presence of proteins encoded by the coding regions of the hepatitis B virus surface antigen PreS1-PreS2-S protein in a sample taken from a mammalian blood serum, characterized in that it comprises: a. Antibodies produced by particles which are prepared by recombinant DNA technology, wherein the particle comprises the hepatitis B virus surface antigen PreS ^ PreS ^ S protein, the recombinant DNA vector comprising the coding region of which does not contain other infectious viral DNA segments; and b. labeled antibodies produced by particles prepared by recombinant DNA technology, wherein the particle comprises a PreSj-PreS2-S protein of the hepatitis B virus surface antigen that is not encoded by a recombinant DNA vector comprising a coding region. within other infectious viral DNA segments. A method for detecting HBV antigens containing proteins encoded by the coding regions of the hepatitis B virus surface antigen PreS [-PreS2-S protein in the serum of HBV-infected animals, characterized in that the method comprises the steps of:. a. providing a solid substrate having binding sites on its surface with an antibody against particles prepared by recombinant DNA technology, the particle comprising a combination of the hepatitis B virus surface antigen PreS, -PreS2-S protein, the coding region The DNA vector does not contain other infectious viral DNA segments; b. washing the coated beads to remove excess antibody; c. contacting the beads with the protein-containing solution to reduce non-specific binding; d. washing the beads to remove excess proteinaceous solution; II 95726 e. Incubating the beads with serum samples suspected of containing HBV or HBV surface antigens; f. washing the beads with a solution mixed with labeled antibody; and g. determining the amount of labeled antibody. A method for detecting antibodies against the PreS, PreS2-S regions of hepatitis B virus surface antigen proteins in a sample, the method comprising the steps of: a. Adsorbing particles prepared from a combination of DNA; technique, wherein the particle comprises the hepatitis B virus surface antigen PreS, PreS2-S protein, the recombinant DNA vector of which comprises no other infectious viral DNA segments, on a solid substrate containing binding sites ; b. contacting the substrate with an agent that impregnates non-specific binding sites on the surface of the substrate; c. washing the substrate with a buffer solution and removing the buffer; d. adding the sample to the substrate; e. incubating and washing the sample containing the substrate; f. adding labeled antibodies against human IgG or IgM to the substrate; g. incubating and washing the substrate; and determining the amount of labeled antibody. Method according to one of the preceding claims, characterized in that the protein is glycosylated. 112 95726