FI112250B - DNA encoding xylose reductase and/or xylitol dehydrogenase - Google Patents

Abstract

DNA (I) encoding xylose reductase enzyme (A) is new. When (I) is transferred into a yeast strain it renders the strain capable of reducing xylose to xylitol. Pref. the yeast of (1) is capable of integrating to the yeast chromosome when transformed into a yeast strain. (I) and/or (II) is expressed under yeast gene regulatory regions, e.g. promoters of (A), (B), yeast alcohol dehydrogenase gene ADH1 or yeast phosphogylcerate kinase gene PGK1, and functional fragments. The yeast strain is a Saccharomyces cerevisiae strain (pref.), kluyveromyces strain, Schizosacchoromyces pombe strain or Pichia strain. The yeast vectors pUA103, pUA107, pJHXR22, pMW22, pJHXDH60 and pJHXDH70, and the yeast strains. S. cerivisiae H475, H477, H479, H481, VTT-C-91181, H949, H495, H496, H497, H492 and H493 are specifically claimed.

Description

112250

This application is divided by patent application No. 924461.

This invention relates to recombinant DNA technology. In particular, the present invention relates to novel recombinant yeast strains transformed with the genes for xylose reductase and / or xylitol dehydrogenase. The yeast strain transformed with the xylose reductase gene is capable of reducing xylose to xylitol and is thus capable of producing xylitol in vivo. If both of these genes are transformed into a yeast strain, the resulting strain is capable of producing ethanol in a xylose-containing medium during fermentation.

In addition, said new yeast strains are capable of expressing the two enzymes.

Xylose is abundant in nature. It can constitute up to 40% of ligno-cellulosic loose material (Ladisch et al., 1983). By fermentation, xylose can be converted into ethanol, which can be used as a liquid fuel or chemical raw material.

20 For the production of ethanol, which is a cheap product, it is important that the raw material can be * * directly upgraded with as little pretreatment as possible.

Natural xylose users are found among bacteria, yeasts and fungi. In all organisms, xylose is converted to xylulose, which is phosphorylated to xylulose-5- * x * phosphate (X5P) by xylulokinase. The X5P then proceeds to the Embden-Meyerhof-• · · pathway (glycolysis) via the pentose-phosphate pathway (shunt).

• *>

»I

. * *. Bacteria such as Escherichia mli, Bacillus sp., Streptomyces sp. and Actinoplanes sp. converts xylose directly to xylulose with xylose isomerase (XI). Thus, bacteria do not produce xylitol as an intermediate when they use xylose. Bacteria that ferment xylose to ethanol do so in poor yields, while at the same time producing numerous by-products (Skoog and Hahn-Hägerdal, 1988). Xylose using yeast ** 'such as Pichia stipitis, Candida shehatae and Pachysolen tannophiluksella this reaction 2 112250 reaction takes place in two steps: first xylose is reduced to xylitol ksyloosireduk-reductase (XR), and the xylitol is oxidized with a xylitol dehydrogenase (XDH) ksyluloosik-Si.

5 Xylose-using yeasts such as £. stipitis, £. shehatae and E. tannophilus (Slininger et al., 1987; Prior et al., 1989) ferment high purity xylose solutions with high yields. However, they generally do not survive in a control environment due to untreated raw material, such as sulfite waste broth or hydrofluorised and acid hydrolyzed wheat straw (Linden and Hahn-10 Hägerdal, 1989). One exception, E. tannophilus, produces mainly xylitol and glycerol in response to this environment. In order to efficiently ferment raw materials with yeast using xylose, such as E. stipitis, C. shehatae, and E. tannophilnk, the raw material must undergo expensive pretreatment with ion exchange resins (Clark and Mackie, 1984) or by steam stripping (Yu et al., 1987).

15

Saccharomyces cerevisiae. baking yeast, femientizes sulfite waste broth or wheat straw pretreated with hydrogen fluoride and acid hydrolyzed to ethanol (Linden and Hahn-Hägerdal, 1989).

S. cerevisiae is unable to efficiently utilize xylose and cannot grow xylose as the sole carbon source. However, in the presence of a bacterial enzyme, xylose isomerase, which converts xylose to xylulose, S. cerevisiae can ferment both pure xylose solutions (Hahn-Hägerdal et al., 1986) and crude crude (*). and Hahn-Hägerdal, 1989a, b) to ethanol, in yields and yields. · Of the same order of magnitude as those obtained with hexose fermentations. Similar results have been obtained for Schizosaccharomyces pomhella (Lastick et al., 1989). Both S. cerevisiae and 25 Sch. pomhella thus has a functional xylulokinase enzyme. It has also been found that xerose can be consumed by S. cere- * # * · '. * Visiae (Batt et al., 1986; van Zyl et al., 1989; Senac and Hahn- · · * Hägerdal, 1990).

Gong (1985) discloses a method for obtaining ethanol directly from D-xylose by means of yeast mutants that ferment xylose. According to Gong, a parent yeast strain is selected:: (e.g., Candida sp. Or Saccharomyces cerevisiae), which may initially have the ability to use 3,112,250 D-xylose, and this parent strain is then exposed, e.g., to UV radiation to induce a mutation. However, the reference does not provide any information as to why the resulting mutants are capable of using xylose. In addition, Gong did not introduce new coding and / or regulatory sequences into said strains by genetic engineering to enhance xylose-5 mentation.

Natural xylose-exploiting yeasts such as E. stipitis, Candida sp. and E. tan-nophihis are not suitable for ethanol and xylitol production for a variety of reasons. Fermentation to ethanol requires the pre-treatment of the raw material, which is too costly for a cheap end product such as ethanol. These species also lack GRAS status. The exploitation of xylose would thus preferably be based on the use of baking yeast with GRAS status.

In order to convert S. cerevisiae into an efficient xylose user for the production of xylitol and ethanol, an efficient enzyme system for converting xylose to xylitol and xylulose should be introduced into this yeast. To produce ethanol from xylose, the XI genes from E. coli (Sarthy et al., 1987), B. subtilis and Actinoplanes missouriensis (Amore et al., 1989) have been cloned into S. eerevisiae. The j v. Prot protein prepared in S. cerevisiae had very little (1/1000 of the bacterial enzyme) or no enzymatic activity. For some reasons, therefore, the bacterial enzyme cannot * * »·: **: be made functional in yeast. Another possibility would be to transfer the XR and: ': XDH genes of S. eerevisiae from another yeast. E. stipitis enzymes should be good candidates in light of the use of pure xylose solutions discussed above. It can be predicted that V · second yeast enzymes would perform better than bacterial enzymes when expressed in yeast. In addition, xylitol and ethanol could be produced by the same system, and the system would combine good use of E. stipitis xylose with inhibitory resistance and general acceptance of S. cerevisiae.

This invention describes xylose reductase (XR) and xylitol dehydrogenase:. Isolation of genes encoding (XDH) from certain yeasts bearing these genes, characterization of genes: ': and gene transfer and expression in Saccharomyces cerevisiae.

Thus, according to the present invention, novel recombinant yeast strains expressing the enzymes xylose reductase and xylitol dehydrogenase are disclosed.

The XR gene-transformed yeast strains of the invention are capable of reducing xylose to xylitol in vivo.

The present invention further provides novel yeast strains transformed with each of the two genes defined above. The co-expression of these genes gives 10 strains the ability to ferment xylose to ethanol from pure xylose solution or xylose-containing solutions such as lignocellulose hydrolyzates.

Brief Description of the Drawings Figure 1 shows the xylose reductase gene integrated into pMA91 and pRS305 to give plasmids pUA103 and pUA107, respectively.

Figure 2 shows the activity plate assay for XDH-positive kgt11 clone • · •; '; Figure 3 is an image of the xDh gene containing plasmid pJHXDH50 • *: Figure 4 shows the activity plate assay of the XDH-producing S. cerevisiae recombinant strain VTT-C-91181 with the original transformation dish (A) and alone

• · I

:,:> colonies derived from the transformant (B).

25 l. Fig. 5 shows a xylose reductase expression cassette flanked by ribosomal '· ·' sequences integrated with BS + to give vector pJHXR22.

i i »* · t ·

Figure 6 shows a Westem analysis of XR when produced by the following 30 plasmids in S.cerevisiae, or by P. stipitis. Lanes: 1 molecular weight standards (LMW, Pharmacia); 2 pRS305; 3 pUA107; 4 blank lane 5 pMA91; 6 pUA103; 7 purified XR enzyme; 8 5 112250 LMW; 9 Pichia stipitis. For lanes 2, 3, 5, 6 and 9, samples were taken from French press cell lysates.

Figure 7 shows XR-5 activity of S. cerevisiae strains transformed with pUA103 and pUA107, using either NADH or NADPH as a cofactor, and XR activity of control strains containing vector pRS305 or pMA91.

Figure 8 shows the xylitol dehydrogenase gene integrated into pKB102 to give plasmid pJHXDH60.

10

The xylose reductase (xrd) and xylitol dehydrogenase (xdh) genes used in accordance with the present invention are isolated from yeast containing these genes, e.g. from Pichia stipi. Also other suitable yeasts and other fungi, such as Pachysolen tannophilusta, Klnyveromyces spp., Petromvces alhertensis and Candida spp. may be used.

The yeast transformed by these genes can be any yeast, e.g., a yeast strain of Saccha-romyces cerevisiae (e.g., DBY746, AH22, S150-2B, GPY55-15Ba, VTT-A-63015, VTT-A-85068, VTT-C -79093), any Kluyveromyces sp. it is Schizosaccha-romyces pomhe. Transformation of genes into these yeasts can be effected by the use of example {: '; 20 using conventional methods described for these organisms. It is remarkable- *; ·; except that Pichia itself can also be transformed with these genes to provide: '.: increased or altered expression of these genes. Saccharomyces cerevisiae strains' are preferred for the purposes of the present invention.

• tl of the DNA sequence encoding the XR enzyme is isolated from E. stipitis by conventional methods:. cDNA is synthesized from mRNA and cloned into kgt11 vector. Using '· · ·' inummological screening with XR-specific antibodies, positive clones are isolated and subcloned into the BS + vector for sequencing. The gene encoding XR of E. stipitis can also be cloned by expression in S. cerevisiae, since it does not contain the law. · ,. 30 heaps of introns. Another possibility is to use oligonucleotides engineered into the ent: '': based on the amino acid sequence for gene bank hybridization.

6, 112250

To construct a plasmid suitable for transformation into yeast, the XR-encoding gene is cloned into a suitable yeast expression vector, such as pMA91 (Mellor et al., 1983), which contains suitable yeast regulatory regions. These regulatory regions can be obtained from chi-5 antigens such as PGK1, ADH1, GAL1, GAL10, CUP1, GAP, CYC1 and PH05. Alternatively, the Pichia gene encoding XR can also be used to express the gene in S. cerevisiae. The XR-encoding plasmid containing the xraf gene is capable of self-replication when transformed into the receiving yeast strain. The gene encoding XR can also be cloned into a single copy yeast vector such as pRS305 (Sikorski and Hietcr, 1989).

Alternatively, the gene encoding XR can also be linked to the yeast chromosome, the ribosomal RNA locus. For this purpose, ribosomal sequences of a suitable plasmid, e.g., plasmid pIRL9, are conveniently cloned and cloned into the BS + vector.

The gene encoding the XR, linked between the appropriate yeast promoter and terminator regions, is cleaved from the hybrid vector containing the gene and cloned into the plasmid obtained in an earlier step. The expression cassette, flanked by ribosomal sequences on both sides, can be isolated from this resulting plasmid. This fragment is transformed into yeast with a self-replicating plasmid with a suitable marker for transformation. The plasmid can be subsequently removed from:: cells containing the v / rZ gene integrated into the chromosome by culturing the cells under non-selective conditions. In this way, recombinant strains without any additional foreign DNA, such as bacterial vector sequences, can be obtained. If a polyploid yeast strain such as VTT-A-63015 is used, the gene may also be integrated into a necessary locus, such as the PGK1 or TD / 37 locus.

'·· *' This invention uses a specific xylose reductase gene. The sequence of the xrd gene can be determined from plasmids containing it, e.g., using the double-stranded dideoxynucleotide sequencing method (Zagursky et al., 1986). The XR of E. scholarship is encoded • '·,. The sequence of the 30 van xrd gene is given in Seq. n 2.

»I

7112250 The present invention also provides specific yeast vectors containing the xrd gene. Such a vector is either an independently replicating multiple copy or single copy plasmid or a vector capable of integrating into a yeast chromosome as described above.

One object of this invention is a yeast strain which contains a DNA sequence encoding XR and is capable of expressing this enzyme.

In a preferred embodiment, to isolate the "ra%" gene from E. stitches, the chromosomal gene bank is first made in E. coli in cosmid p3030 (Penttilä et al., 1984) or in another yeast vector and the recombinant plasmids are isolated and transformed into yeast. The xdh gene can be found by its yeast expression, which can be expressed by an activity plate assay. Similarly, a cDNA copy of this gene can be isolated from an expression plate of the λgt11 l cDNA in E. coli by activity plate assay.

15

An alternative method to isolate xdh-gccmn from E. stipit is to purify the XDH enzyme from donor yeast by chromatographic methods and determine its N-terminal amino acid sequence. An oligonucleotide mixture can be constructed based on the resulting N-terminal amino acid sequence of the XDH protein. This oligonucleotide mixture 20 can then be used in gene bank hybridization or in combination with an oligo dT primer to amplify specific sequences by PCR from an mRNA population. The resulting gene or cDNA is cloned into a BS + vector or the like, and the sequence of the xdh- 'gene is then obtained by conventional methods.

The xdh gene can be expressed in yeast from a chromosomal copy cloned *, for example, into the yeast cosmid p3030 (Penttilä et al., 1984). A plasmid containing xrd-gQsm can be transformed into such yeast containing the? X * xdh gene.

* »*» The full length xdh-cUHK can also be cloned into a suitable expression vector such as · * ·,. 30 yeast regulatory regions suitable for pMA91 or pKB102 (Blomqvist et al., 1991), preferably using the yeast PGK1 or ADH1 promoter and terminator. The ex 8112250 press cassette, which is inserted into pKB102, can be excised from the resulting plasmid and cloned into a self-replicating yeast multiple copy vector or a single copy yeast vector containing a suitable marker, e.g., URA3 or HIS3. for transformation. These resulting plasmids can then be transformed into appropriate host strains or strains containing the gene encoding XR.

The xdh gene can also be inserted into the yeast genome in the same manner as described above for the xrd gene.

The present invention thus further relates to a method of constructing new yeast strains capable of expressing xylose reductase or xylitol dehydrogenase or expressing both xylose reductase and xylitol dehydrogenase and xylitol dehydrogenase; (b) constructing a yeast vector containing either of said DNA sequences; and ·. (e) transforming either or both of the resulting vectors into a suitable one. 20 yeast hosts.

The present invention thus relates to a method for coexpressing active xylose reductase and: xylitol dehydrogenase in a yeast strain, comprising: (a) isolating DNA sequences encoding xylose reductase and xylitol dehydrogenase from a suitable donor yeast or yeast; (b) constructing yeast vectors, each containing one of said DNA sequences; ;; ' (e) transforming the resulting vectors into a suitable host to obtain a recombinant yeast strain; | (, 30 (d) cultivating said recombinant yeast strain in a medium containing xylose; O and 9 112250 (e) isolating and purifying the ethanol formed in the medium.

The recombinant yeast strains of the present invention which co-express xylose reductase and xylitol dehydrogenase enzymes are efficient ethanol producers by fermentation of a xylose-containing fraction from lignocellulosic hydrolyzates, such as by-products, e.g. by treatment at elevated temperatures in the presence or absence of chemicals such as sulfur dioxide and in combination with acid hydrolysis or enzymatic hydrolysis. Xylose consumption and product formation (ethanol, xylitol, acetic acid, etc.) are analyzed, e.g., by HPLC (Hahn-Hägerdal et al., 1986; Linden and Hahn-Hägerdal, 1989a and b).

Purification of xylose reductase from Pichia stipit 15 E. stipit was cultured in a 1 liter fermenter in xylose medium (0.3% yeast extract, 0.3% malt extract, 0.5% peptone, 1.9% KhbPO4, 0.3% (NH) (HPO 4, 0.1% MgSO 4 and 5% xylose, pH 5) and collected in a late logarithmic growth phase 30 g of wet weight cell mass was disrupted using freeze pressing (X-puff, 20 cross) and centrifuged 1500 g for 10 min to obtain a cell free extract.

«I t I ·> ·; ' * | The crude extract was concentrated twice and applied to a Sephadex G-200 (Pharmacia, Uppsala, · ·: * · Sweden) column (137 mL). Proteins were eluted at a flow rate of 6 ml / h and fractions (9: ml) containing XR activity were pooled.

25; The pooled fraction was applied to a DEAE-Sepharose (Pharmacia) column (37 mL) * * equilibrated with 0.02 M ammonium phosphate buffer pH 6.0 and eluted with a gradient of 0-0 250 mL; , 5 M NaCl in 0.02 M ammonium phosphate buffer at a flow rate of 12 »« »*; ml / min. Fractions containing XR activity were pooled (6 ml) and concentrated to 1 to 30 ml. 1 ml of the concentrated sample was applied to a 1 ml HPLAC column (cibacrom blue F36-A; Perstorp Biolytica, Lund, Sweden) equilibrated with 0.02 M ammonium phosphate buffer pH 6.0. The elution of XR was performed with a 0-2 M NaCl gradient in ammonium phosphate buffer at a flow rate of 1 mL / min. Fractions containing XR activity were pooled (6 mL) and dialyzed overnight at 4 ° C.

Purity and molecular weight were determined by SDS polyacrylamide gradient gel (T 8.8-21.3%, C 2.6%) electrophoresis (Laemmli, 1970) and native polyacrylamide gradient gel (Pharmacia pre-prepared gel, 4/30) electrophoresis (Pharmacian a vertical-lielektroforeesisysteemi). Pharmacia's picnolecular weight and high molecular weight standards were used. Gel staining was performed with 0.1% Coomassie 10 Blue R-250 (Sigma) in 25% methanol and 10% acetic acid. In SDS-PAGE gel and native PAGE gel, the XR fraction after HPLAC appeared as a single band (data not shown). Specific staining of XR by zymo gram showed that the single band of the native PAGE gel was XR (results not shown). Estimation of molecular weight by SDS-PAGE (see Figure 6) and na-15 by dense PAGE showed a molecular weight of 38000 ± 1000 for subunits and 76000 ± 1000 for native protein.

The purified enzyme was used to generate polyclonal antibodies and ent *, ·. to the syntheses to produce the N-terminal amino acid sequence (Marc Bauman, Department of Medical Chemistry, University of Helsinki) (SEQ ID NO: 1).

t t i # * t • ·; ' ·, F Example. 2 · ·: ': Cloning of the gene encoding the Xi of the stipitia * 1> 25 liters of E. stipitis culture was grown in xylose-containing medium (Example 1) and IV harvested at a late log stage. The harvested cells were transformed into spheroplasts

By means of Zymolyasem, 60 ml of GuSCN solution was suspended and RNA was isolated according to Chirg; · Winin et al., (1979). RNA was then passed through an oligo (dT) cellulose affinity column. Poly (A +) (mRNA) was eluted by lowering the elution buffer. 30 Ion strengths. The cDNA was synthesized from the mRNA using the Amersham cDNA synthesis kit and cloned into the Xgt11 vector using the Amersham cDNA 11112250 cloning kit. After 3 to 4 hours of culturing, plaques were replated on a nitrocellulose membrane soaked in IPTG and incubated overnight. Membranes were then used for immunological screening of transformants (Young and Davies, 1983) using rabbit antiserum against XR and goat anti-rabbit antibodies coupled to 5 alkaline phosphatase. Positive clones were picked from the plates and the DNA insert was amplified by PCR (Gussow and Clackson, 1989) using vector-specific primers. The resulting DNA fragments were used for restriction enzyme analysis and subsequent cloning after BamHI digestion into a BamHI digested BS + (Stratagene) vector. The longest cDNA clone of pJHXR20 was sequenced using the double-stranded dideoxynucleotide-10 method (Zagursky et al., 1986).

Confirmation of the cloning of the full-length cDNA encoding XR was obtained by comparing the N-terminal amino acid sequence of the protein with the sequenced gene (SEQ ID NO: 1, SEQ ID NO: 2).

A chromosomal copy of the 15 xrd gem was obtained by PCR (Cryer et al., 1979) of total chromosomal DNA isolated from E. coli CBS-6054 (Prior et al., 1989) using primers corresponding to the 5 'end of the coding region ( GCGGATCCTCTA-GAATGCCTTCTATTAAGTTGAACTCTGG) and 3'-ends (TTGGATCCTCTAGAT-; 20 TAGACGAAGATAGGAATCTTGTCCC), with BamHI and XbaI restriction sites> 1 Ί. The PCR product was digested with BamHI and cloned into plasmid pMA91 (Mellor et al., 1f al., 1983) at the BglII site to give plasmid pUA103 (Figure 1). The DNA sequence of the chromosomal copy was compared to that of the plasmid pJHXR20 cDNA and found to be free of introns.

25! > * «1 1 ♦ I t • I t»

| I

12 112250

Example 3

Pichia stipitis yeast was grown in xylose-containing medium as described in Example 1. 30 g of wet weight cell mass was disrupted using a freeze press (X-press) and centrifuged at 1500 g for 10 min. The centrifuged cell-free extract was concentrated three times, and 5 mL of gel was filtered at 6 mL / h through a 137 mL Sepharose 6B column equilibrated in 0.05M ammonium phosphate buffer, pH 6 containing 25% glycerol, 1 mM DTT, 1 mM EDTA: ta. Fractions containing XDH-10 activity, as measured by Smiley and Bolen (1982), were pooled and placed on a 37 ml ion exchange chromatography column (DEAE-Sepharose) equilibrated in 0.05 M ammonium phosphate buffer, pH 6, containing 25% glycerol, 1 mM DTT, 1 mM EDTA. The XDH fractions were eluted with 250 mL of a 0-0.5 M NaCl salt gradient at a flow rate of 12 mL / min. and gathered together. The partially purified enzyme was run on a poly-15 acrylamide gel and blotted onto a PVD membrane. The XDH corresponding band was excised and the N-terminal amino acid sequence was determined directly from the membrane.

EXAMPLE 4 Cloning and Expression of the gene encoding XDH in S. cerevisiae: 20 * .i · ', * ··; The same Xgl11 cDNA library as obtained and described in Example 2 was plated and repeated; _ '. were plated on a nitrocellulose membrane immersed in IPTG and incubated for 3 hours.

'/ ·' Membranes were then used to screen for specific XDH activity (zymogram)

· By immersing the membranes in 10 ml of zymogram solution (0.1 M phosphate buffer pH

7.0, 1.5 mM NAD, 0.25 mM nitroblue-tetrazolium, 65 μΜ phenazine methosulfate, 0.4 M xylitol). Positive clones (Fig. 2) were picked from plates and insert DNA of two clones by PCR Giissow and Clackson, 1989) using vector-specific primers (5'-GGTGGCGACGACTCCTGGAGCCCG, 5'-: *: TTGAC ACC AG ACCAACTGGT AAT G). . The resulting DN A fragments were of the same size and were used in restriction enzyme analysis to check for non-cleaving and cleaving enzymes and further cloning with BamHE after digestion with BamHE to 13112250 pSP72 vector (Promega). The plasmid pJHXDH50 has the longest cDNA clone (Figure 3).

To clone a chromosomal copy of the xdh gene, chromosomal DNA was isolated (Cryer et al., 1979) from E. stipitis strain CBS-6054 (Prior et al., 1989) and partially digested with Sau3A. The 35-45 kb fragments were purified by fractionating partially truncated DNA in a sucrose gradient (15% to 40%) and ligated into the yeast p3030 cosmic divector (Penttilä et al., 1984), which had been cut with BamH. The ligated molecules were packaged in λ particles using Amersham Ltd. (UK) in vitro packaging kit and transfected into E. coli HB101 (Maniatis et al., 1982). Recombinant cosmid DNA was isolated from about 15000 pooled gene bank clones obtained and transformed into S. Cere-visiae strain S150-2B (α, his3-dell, leu2-3, leu2-] 12, trpl-289, ura3-52, cir +, Gal + ) (Baldari et al., 1987) by selection for His + transformants on Sc-his plates. The gene bank was replated on nitrocellulose filters, cells were lysed by incubating the filters for 5 minutes in chloroform, and the activity assay was performed as described above for the kgtl library. Several positive clones were obtained (strains H494, H495, H496, H497 and VTT-C-91181), and strain VTT-C-91181 (Figure 4) was used for further studies.

The XDH activity of strain VTT-C-91181 was tested on a total cell lysate of 25% glycerol obtained by Smiley and Bolen (1982).

DNA from VTT-C-91181 was isolated and plasmid pMW22 was isolated by transformation. · DNA to E. coii DH5a.

25 S. cerevisiae strain VTT-C-91181 containing plasmid pMW22 was deposited under the Budapest Treaty under accession number NCYC 2352 National Collection of Yeast *; · 'Cultures (NCYC) Depository, United Kingdom, March 29, 1991.

i »i *» 14 112250

Example 5 Expression of XR The gene encoding XR of S. cerevisiae into its regulatory regions of the PGK gene was excised from pUA103 (pre-5 mark 2) by HindNE and cloned into the HindIII site of pRS305 (Sikorski and Hieter, 1989). The resulting plasmid pUA107 (Fig. 1), in which the XR-encoding gene was in the correct orientation with respect to the yeast PGK promoter, was transformed using the LiCl method (Ito et al., 1983) and selected for Leu + transformants, S. cerevisiae strains, S150. -2B (see Example 4) and GPY55-15Ba (leu2-3, 10 leu2-112, ura3-52, trpl-289, his4-519, prbl, cir +) to yield new recombinant strains, S. cerevisiae H481 and S. cerevisiae H479, respectively. Transformation of plasmid pUA103 into strains S150-2B and GPY55-15Ba gave H477 and H475, respectively.

The gene encoding XR was also integrated into the yeast chromosome at ribosomal RNA loci. Ribosomal sequences of plasmid pIRL9 were inoculated with EcoRI, flattened, and cloned into the flanking XbaI site of BS + to give vector pJHR21. XR coding gene, coupled between PG / G promoter and terminator, was removed · *; vector pUA103 as a HindIII fragment, blunt-ended and cloned into the blob: 20 Xba I to ribosomal sequences of plasmid pJHR21. From this resulting. '··: plasmid pJHXR22 (Fig. 5) was inoculated with an expression cassette adjacent to both. j has a ribosomal sequence by cleaving the BS + polylinker at the characteristic V 'restriction sites. This fragment was transformed with an autonomously replicating v · plasmid carrying a marker suitable for transformation. The resulting transformants were screened for the presence of the XR-encoding gene by enzyme activity assays as described above and the integration model was checked by Southern analysis. Independently replicate; The * 'plasmid was removed from cells containing the XR expression cassette by culturing the cell; * * and in non-selective YDP medium.

Transfomants were grown in selective minimal medium, and XR expression was analyzed by Western blotting using XR-specific antibody and Promega 15112250 alkaline phosphatase method (Figure 6), and extraction of crude yeast cell extracts with French extracts. Smiley and Bolen, 1989) (Figure 7).

Example 6 5 Co-expression of XR and XDH

Plasmids pUA103 and pUA107 were transformed into strain VTT-C-91181 containing the xdh gene in plasmid pMW22. Transformants were selected on Sc-Leu-his plates and subsequently maintained on the same plates. The maintenance of XDH activity was confirmed by the plate-10 activity assay and XR activity by the enzyme activity assay as described above. Two further clones, which contained plasmids pUA103 and pMW22, were named H492 and H493.

The full-length xdh cDNA from plasmid pJHXDH50 was cloned at the Hind III site into the vector pKB102 (Blomqvist et al., 1991) between the yeast ADH1 promoter and terminator. The expression cassette was excised from the resulting plasmid pJHXDH60 (Figure 8) and cloned independently into the replicating yeast vector p3030 at the BamHI site to give plasmid pJHXDH70. This resulting plasmid was transformed into strain H477 containing the XR coding gene (Example 5) and transformants were selected on Sc-Leu-I 20 His plates. Expression of the xdh gene in S. cerevisiae was tested by enzyme activity assay (Smiley and Bolen, 1982).

• · * »·« ·

• I

*> • t

I f I

: t * i »*

I I I

• · • · I 4 {* »• I« 16 112250

Xylose fermentation by S. cerevisiae

The S. cerevisiae strains H492 and H493 described in Example 6 were cultured in a rotating 5-well scaffold in Sc-Leu-his medium containing 20 g / L glucose. The rotation speed was 200 rpm. After both glucose and the ethanol formed had been consumed, the growth broths were used as inoculum for shaker fermentation in Sc-Leu-his medium containing 20 g / L xylose. The consumption of xylose and the formation of ethanol and xylitol were monitored during fermentation by taking samples which were analyzed by HPLC (Hahn-Hägerdal et al., 1986; 10 Linden and Hahn-Hägerdal, 1989a, b).

Example 8

Fermentation of xylose-containing raw materials by S. cerevisiae.

S. cerevisiae strains H492 and H493 were cultured as described in Example 7 in a fermentation medium in which xylose was replaced by sulfite broth. Xylose was converted into cells, ethanol and xylitol.

* *> * #)

I I • I

5 17 112250

reference Publications

Amore, R., Wilhelm, M. and Hollenberg, C.P. (1989) Appl. Microbiol. Biotechnol. 30: 351-357.

Baldari, C., Murray, J.A.H., Ghiara, P., Cesareni, G., and Galotti, C.L. (1987) EMBO J. 6: 229-234.

Batt, C.A., Carvallo, S., Easson, D.D., Akedo, M. and Sinskey, A.J. 1986. Metabolic pathway-10 in Saccharomyces cerevisiae. Biotechnology and Bioengineering 28, 549-553.

Bergmeyer, H.U., Gruber, W. and Gutmann, I. (1974), Methods of Enzymatic Analysis (Bergmeyer, H.U., ed.) 2nd edition, vol. 3, p. 1323-1330, Verlag Chemie, Weinheim and Academic Press, Inc., New York, London.

15

Blomqvist, K., Suihko, M.-L., Knowles, J. and Penttilä, M. Chromosomal integration and expression of two bacterial α-acetolactate decarboxylase genes in brewer's yeast. Ed. for publication, 1991.

20 Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294-5299.

Clark, T.A. and Mackie, K.L. (1984) J. Chem. Tech. Biotechnol. 34b: 101-110.

25

Cryer, D.R., Eccleshall, R. and Marmur, J. (1975) Isolation of yeast DNA. Methods Cell Biol. 12: 39-44.

T '.' Gong, C-S. (1985) U.S. Patent 4,511,656.

::: 30

Giissow, D. and Clackson, T. (1989) Direct Clone characterization from plaques and colo-. ' : nies by the polymerase chain reaction. Nucl. Acids Res. 17: 4000-.

V * Hahn-Hägerdal, B., Berner, S. and Skoog, K. 1986. Improved ethanol production from 35 xylose with glucose isomerase and Saccharomyces cerevisiae using the respiratory inhibitor azide. Appl. Microbiol. Biotechnol. 24, 287-293.

Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) Transformation of intact yeast cells treated with alkali cations. J. Bact. 153: 163-168.

; - '40,:. Ladisch, M.R., Lin, K.W., Voloch, M. and Tsao, G.T. (1983) Enzyme Microb. Technol. 5: ::: 82-102.

* »1»; Y Laemmli, U.K. (1970) Cleavage of structural proteins during assembly of the head of: 45 bacteriophage T4. Nature 227: 680-685.

♦ I

Lastick, S.M., Tucker, M.Y., Beyette, J.R., Noll, G.R. and Grohman, K. (1989) Appl. Mi- 18 112250 crobiol. Biotechnol. 30: 574-579.

Linden, T. and Hahn-Hägerdal, B. (1989a) Enzyme Microb. Technol. 11: 583-589.

5 Linden, T. and Hahn-Hägerdal, B. (1989b) Biotechnol. Techniques 3: 189-192.

Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982). Molecular Cloning. A laboratory manual. Cold Spring Harbor Laboratory, New York.

10 Mellor, J., Dobson, M.J., Roberts, N.A., Tuite, M.F., Emtage, J.S., White, S., Lowe, P.A.,

Patel, T., Kingsman, A.J. and Kingsman, S.M. (1983) Efficient Synthesis of Enzymatically Active Calf Chymosin in Saccharomyces Cerevisiae. Gene 24: 1-14.

Penttilä, M.E., Nevalainen, K.M.H., Raynal, A. and Knowles, J.K.C. 1984. Mol. Gen. Ge-15 net. 194: 494-499.

Prior, B.A., Kilian, S.G. and du Preez (1989) Process Biochemistry 2: 21-32.

Sarthy, A.V., McConaughy, B.L., Lobo, Z., Sundström, J.A., Furlong, C.E. and Hall, B.D.

1987. Expression of the E. coli xylose isomerase gene in Saccharomyces cerevisiae.

Appl. Environ. Microbiol. 53, 1996-2000.

Senac, T. and Hahn-Hägerdal, B. (1990) Appl. Environ. Microbiol, (in press) 25 Sikorski, R.S. and Hieter, P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19-27.

'! Skoog, K. and Hahn-Hägerdal, B. (1988) Enzyme Microb. Technol. 10: 66-78.

:.:: 30 •: ··; Slininger, P.J., Bolen, O.L. and Kurtzman, C.P. (1987) Enzyme Microb. Technol. 9: 5-15.

• · * »· '' · 'Smiley, K.L. and Bolen, P.L. (1982) Demonstration of D-xylose reductase and D-xylitol dehydrogenase in Pachysolen tannophilus. Biotechnol. Lett. 4: 607.

35

Van Zyl, C., Prior, B.A., Kilian, S.G. and Kock, J.L.F. 1989. D-xylose utilization by Sac-charomyr.es cerevisiae. J. Gen. Microbiol. 135, 2791-2798.

Young, R.A. and Davies, R.W. (1983) Yeast RNA polymerase II genes: isolation with '40 antibody probes. Science 222: 778-782.

* ;;; Yu, S., Wayman, M. and Parehk, S.R. (1987) Biotechnol. Bioeng. 29: 1144-1150.

Zagursky, R.J., Berman, M.L., Baumeister, K. and Lomax, N. (1986) Rapid and easy sequencing: * 45 quenching of large linear double stranded DNA and supercoiled Plasmid DNA. Gene: Anal. Techn. 2: 89-94.

19, 112250

Stored rnik-rn-nrganisrnit

The following yeast strain is deposited under the Budapest Treaty with the Na-5 National Collection of Yeast Cultures (NCYC), AFRC Institute of Food Research, Norwich Laboratory, Colney Lane, Norwich, NR4 7UA, United Kingdom

Stock Deposit Number Deposit Date 10

Saeeharomyces r.erevisiae NCYC 2352 29.3.1991 VTT-C-91181 harboring plasmid pMW22

In addition, the following strains of yeast were deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg lb, D-38124 Braunschweig, Germany, in accordance with the Budapest Treaty.

20 Stock Deposit number Date of deposit

Saeeharomyces cerevisiae 1. H475 (VTT C-97277) DSM 11546 16.5.1997 '25 Sacc.haromycfis cerevisiae. : H477 (VTT C-97278) DSM 11547 5/16/1997 »· t 1 · t I · lii ·» 20 112250 SEQ. N 0 1 5 sequence type: Peptide SEQUENCE LENGTH: 9 amino acids TOPOLOGY: linear ORIGINAL source organism Pichia stipitis CBS-6054 IMMEDIATE KOELÄHDE: protein purification and N-terminal sequencing of 10 DETAILS: amino acids 1-9 of the mature protein PROPERTIES: ksyloosireduktaasientsyymin (NADPH / NADH) N-terminal peptide 15

Pro Xaa Ile Lys Leu Asn Ser Gly Tyr 1 · 21 112250 Seq. N: 0 2 SEQUENCE TYPE: Nucleotide and corresponding protein 5 SEQUENCE LENGTH: 954 base pairs DRAINAGE: single-stranded TOPOLOGY: linear MOLECYL TYPE: from cDNA to mRNA, from genomic DNA to 10H: product from genomic DNA DETAILS: 1-954 bp, mature protein PROPERTIES: xylose reductase (NADPH / NADH) activity * »* · 1

* I

• »22 112250 ATG CCT TCT ATT AAC TTG AAC TOT GGT TAC GAC ATG CCA GCC GTC 45

Met Pro Ser lie Lys Leu Asn Ser Gly Tyr Asp Met Pro Ala Val 1 5 10 15 GGT TTC GGC TGT TGG AAA GTC GAC GTC GAC ACC TGT TCT GAA CAG 90

Gly Phe Gly Cys Trp Lys Val Asp Val Asp Thr Cys Ser Glu Gin 20 25 30 ATC TAC CGT GCT ATC AAG ACC GGT TAC AGA TTG TTC GAC GGT GCC 135 lie Tyr Arg Ala lie Lys Thr Gly Tyr Arg Leu Phe Asp Gly A). a 35 40 45 GAA GAT TAC GCC AAC GAA AAG TTA GTT GGT GCC GGT GTC AAG AAG 180

Glu Asp Tyr Ala Asn Glu Lys Leu Val Gly Ala Gly Val Lys Lys 50 55 60 GCC ATT GAC GAA GGT ATC GTC AAG CGT GAA GAC TTG TTC CTT ACC 225

Ala lie Asp Glu Gly lie Val Lys Arg Glu Asp Leu Phe Leu Thr 05 70 75 TCC AAG TTG TGG AAC AAC TAC CAC CAC CCA GAC AAC GTC GAA AAG 270

Ser Lys Leu Trp Asn Asn Tyr His His Pro Asp Asn Val Glu Lys 80 85 90 GCC TTG AAC AGA ACC CTT TCT GAC TTG CAA GTT GAC TAC GTT GAC 315

Ala Leu Asn Arg Thr Leu Ser Asp Leu Gin Val Asp Tyr Val Asp 95 100 105 TTG TTC TTG ATC CAC TTC CCA GTC ACC TTC AAG TTC GTT CCA TTA 3 60

Leu Phe Leu lie His Phe Pro Val Thr Phe Lys Phe Val Pro Leu 110 115 120 GAA GAA AAG TAC CCA CCA GGA TTC TAC TGT GGT AAG GGT GAC AAC 4 05

Glu Glu Lys Tyr Pro Pro Gly Phe Tyr Cys Gly Lys Gly Asp Asn 125 130 1 35 TTC GAC TAC GAA GAT GTT CCA ATT TTA GAG ACC TGG AAG GCT CTT 450

Phe Asp Tyr Glu Asp Val Pro He Leu Glu Thr Trp Lys Ala Leu 140 145 150 GAA AAG TTG GTC AAG GCC GGT AAG ATC AGA TCT ATC GGT GTT TCT 405

Glu Lys Leu Vai Lys Ala Gly Lys Ile Arg Ser He Gly Val Ser 155 160 165 AAC TTC CCA GGT GCT TTG CTC TTG GAC TTG TTG AGA GGT GCT ACC 54 0

Asn Phe r> ro Gly Ala Leu Leu Leu Asp Leu Leu Arg Gly Ala Thr HO 175 180 • I ATC AAG CCA TCT GTC TTG CAA GTT GAA CAC CAC CCA TAC TTG CAA 58 5

He Lys Pro Ser Val Leu Gin Val Glu His His Pro Tyr Leu Gin, 185 190 195 * · * CAA CCA AGA TTG ATC GAA TTC GCT CAA TCC CGT GGT ATT GCT GTC 630 • ·· Gin Pro Arg Leu He Glu Phe Ala Gin Ser Arg Gly He Ala val 200 205 210 '·',: ACC GCT TAC TCT TCG TTC GGT CCT CAA TCT TTC GTT GAA TTG AAC 67 5,, 1 Thr Ala Tyr Ser Ser Phe Gly Pro Gin Ser Phe Val Glu Leu Asn; ; 215 220 225,, CAA GGT AGA GCT TTG AAC ACT TCT CCA TTG TTC GAG AAC GAA ACT 7 20:: Gill Gly Arg Ala Leu Asn Thr Ser Pro Leu Phe Glu Asn Glu Thr 230 235 240 ATC AAG GCT ATC GCT GCT AAG CAC CGT AAG TCT CCA GCT CAA GTC 7 65. . He Lys Ala lie Ala Ala Lys His Gly Lys Ser Pro Ala Gin Val I 245 250 255 TTG TTG AGA TGG TCT TCC CAA AGA GGC ATT GCC ATC ATT CCA AAG 810 ... · Leu Leu Arg Trp Ser Ser Gin Arg Gly He Ala He He Pro Lys 260 265 270 TCC AAC ACT GTC CCA AGA TTG TTC GAA AAC AAG GAC GTC AAC AGC 855

Ser Asn Thr Val Pro Arg Leu Leu Glu Asn Lys Asp Val Asn Ser> '' '. 275 280 285 TTC GAC TTG GAC GAA CAA GAT TTC GCT GAC ATT GCC AAG TTG GAC 900 "The Asp Leu Asp Glu Gin Asp Phe Ala Asp lie Ala Lys Leu Asp: 1 ·· 290 295 300 ATC AAC TTG AGA TTC AAC GAC CCA TGG GAC TGG GAC AAG ATT CCT 94 5 lie Asn Lou Arg Phe Asn Asp Pro Trp Asp Trp Asp Lys He Pro 105 310 315 ATC TTC GTC He Phe Val

Claims (11)

A process for producing ethanol by expressing active xylose reductase and xylitol dehydrogenase jointly in a yeast strain, characterized in that one (a) is isolated from a suitable donor yeast or fungus DNA sequences encoding xylose reductase and xylitol dehydrogenase, (b) (c) transforming the obtained vectors into a suitable yeast host, obtaining a recombinant yeast strain, (d) culturing said recombinant yeast strain in a medium which allows expression of the yeast vectors. and (e) isolate and purify the ethanol formed in the medium. 15 A method according to claim 1, characterized in that the yeasts are Saccharomyces cerevisiae, Kluyveromyces spp., Schizosaccharomyces pombe or Pichia spp., Preferably Saccharomyces cerevisiae. 3. Recombinant yeast strain, characterized in that it contains a DNA sequence * coding for xylose reductase and a DNA sequence encoding xylitol dehydrogenase, which DNA sequences originate from a yeast or fungus. * · * · ♦ 5 · 1, 4. Recombinant yeast strain according to claim 3, which is Saccharomyces cerevisiae H492 * or H493, which strains are described in Example 8 of the specification. A method for constructing new recombinant yeast strains, which are labeled 1; "co-express xylose reductase and xylitol dehydrogenase, characterized in that one," (a) isolates from a suitable donor yeast or fungus DNA sequences encoding xylose reductase and xylitol dehydrogenase, which contains neonate of said DNA:. in the sequences, and 112250 (c) transforms the obtained vectors into a suitable yeast host. Method according to claim 5, characterized in that the values to be transformed are Saccharomyces cerevisiae, Kluyveromyces spp., Schizosaccharomyces pombe or Pichia spp., Preferably Saccharomyces cerevisiae. A process for constructing new recombinant yeast strains expressing either xylose reductase or xylitol dehydrogenase, characterized in that (a) isolates from a suitable donor yeast or fungus DNA sequences encoding xylose reductase and xylitol dehydrogenase, (b) which contains the nondecipheral of said DNA sequences, and (c) transforms the nondecipheral of the obtained vectors into a suitable yeast host. 8. Recombinant yeast strain, which exaggerates expressing xylitol dehydrogenase, characterized in that in the yeast strain, a DNA sequence encoding xylose reductase has been further transmitted and is derived from a yeast or fungus. 9. Recombinant yeast strain according to claim 8, characterized in that it is; : Saccharomyces cerevisiae H475 or H477, strains described in Example 5 of the specification. 10. Recombinant yeast strain, which exaggerates expressing xylose reductase, characterized in that it has further transmitted in the yeast strain a DNA sequence encoding xylitol dehydrogenase and derived from a yeast or fungus. 11. Recombinant yeast strain according to claim 10, characterized in that it is: Saccharomyces cerevisiae VTT-C-91181 (NCYC 2352). • *