ES2954008A1 - Antagonists of the human microRNAs miR-100, miR-20, miR-222, miR-181, and miR-92 and uses thereof (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

Antagonists of the human microRNAs miR-100, miR-20, miR-222, miR-181, and miR-92 and uses thereof. The invention provides inhibitors of the human microRNAs miR-100, miR-20a, miR-222, miR-181c, or miR-92a that are repressors of the MBNL1 and/or MBNL2 genes, and the use of said inhibitors as a medicine, especially against myotonic dystrophy type 1. (Machine-translation by Google Translate, not legally binding)

Description

Antagonists of the human microRNAs miR-100, miR-20, miR-222, miR-181, and miR-92 and uses thereof

DESCRIPTION

TECHNICAL FIELD

The invention relates to the field of biomedicine. In particular, the invention relates to molecules that are antagonists of the human microRNAs miR-100, miR-20, miR-222, miR-181, and miR-92 and to their use as a medicine, preferably as a medicine for the treatment of myotonic dystrophy type 1.

BACKGROUND OF THE INVENTION

Muscular dystrophy (MD) represents a group of more than 30 genetic diseases characterized by progressive weakness and degeneration of the skeletal muscles that control movement. Some forms of DM present in infancy or childhood, while others may not appear until middle age or later. The prognosis for people with DM varies depending on the type and progression of the disorder. Some cases may be mild and progress very slowly over the course of a normal life, while others cause severe muscle weakness, functional disability, and loss of the ability to walk. Within muscular dystrophies, those are distinguished in which patients have problems relaxing the muscles after a voluntary contraction, which is known as myotonia. There are two types of myotonic dystrophy, type 1 (DM1) and type 2 (DM2).

DM1 is further classified into three subtypes that sometimes have signs and symptoms in common: mild, classic, and congenital (present at birth). The symptoms of the mild form are the least severe, with a normal life expectancy. The classic form is characterized by muscle weakness and atrophy, inability of muscles to relax quickly after contracting (myotonia), cataracts, and abnormal heart function. Some adults with the classic form may have physical disabilities. Finally, the congenital form is characterized by severe generalized weakness at birth (hypotonia), which results in problems with breathing and can lead to premature death.

DM1 is caused by mutations in the DMPK gene and is inherited in an autosomal dominant manner. In particular, these mutations correspond to the expansion of a CTG trinucleotide repeat in the 3' non-coding region of the DMPK gene. A number of repeats greater than 34 CTG is considered abnormal, and molecular genetic testing They detect pathogenic variants in almost 100% of affected individuals. Expression of expanded alleles in DM1 results in nuclear retention of mutant DMPK mRNA. The mutant transcripts sequester splicing factors that are similar to the Dmsophila Muscleblind-like (MBNL ) protein, resulting in abnormal alternative splicing of a multitude of other transcripts and the expression of fetal forms of the corresponding proteins in adults suffering from DM1. The Dmsophila Muscleblind protein has vertebrate homologues called MBNL1-3, which are also known for their ability to regulate splicing. MBNL1 is strongly expressed in skeletal and cardiac muscle tissue and during myoblast differentiation. Its expression is lower in other tissues such as the brain, placenta, lungs, liver, kidney and pancreas. MBNL2 has largely overlapping expression and is detected in heart, brain, placenta, lungs, liver, skeletal muscle, kidneys, and pancreas. MBNL3, for its part, is expressed in placenta and satellite cells.

Although abnormalities in the splicing mechanism are considered the main factor underlying the pathogenesis of DM1, it has been seen that other mechanisms may also be involved in this disease, such as additional changes in gene expression, antisense transcripts, sequestration of other RNA binding proteins or miRNAs, translation efficiency, deregulation of alternative polyadenylation and miRNA deregulation.

Currently there is no specific treatment for progressive weakness in people with DM1 and therefore it is of interest to explore new therapeutic strategies. Among the therapeutic approaches carried out in animal models of DM1, the most interesting results derive from the blocking of the interaction between MBNLs and toxic RNA using small molecules, peptides, morpholinos or antisense oligonucleotides, and spacemers (“gapmers”) to degrade DMPK transcripts. mutants. However, a less explored alternative in DM1 is the therapeutic modulation of the expression of the MBNL1 and MBNL2 genes, in particular the overexpression of these genes to increase the levels of these proteins, especially in the tissues where they are normally transcribed. It is also preferable that said increase in level occurs, at least, in one or more of the relevant tissues and organs where especially significant symptoms of the disease appear, such as skeletal and smooth muscle, heart and nervous system. In particular, the authors of the present invention have previously described that antagonists against the human microRNAs miR-23-3p and miR-218-5p have therapeutic potential in the treatment of DM1 as they are capable of modulating endogenous MBNL proteins (patent ES2659845B1 ).

Therefore, since microRNAs (commonly abbreviated as miRs) are known to be involved in numerous important biological processes such as metabolism, cell cycle, migration, epithelial-mesenchymal transition (EMT), differentiation and cell survival, and pathological such as cancer, and given that its regulation can be achieved with the use of antagonist molecules, the present invention describes antagonists of the microRNAs miR-100, miR-20, miR-222, miR-181, and miR-92 for increase the levels of MBNL1 and MBNL2 protein, and proposes the use of said inhibitors in the treatment of DM1.

SUMMARY OF THE INVENTION

In one aspect, the present invention relates to an antagonist of the human microRNA miR-100 capable of increasing intracellular levels of MBNL1 and/or MBNL2 proteins. Preferably, the intracellular levels of MBNL1 and/or MBNL2 proteins are increased in a muscle cell, preferably in a muscle cell exhibiting a muscular dystrophy phenotype, preferably muscular dystrophy type 1. In a preferred embodiment, the antagonist is a molecule of oligonucleotide nature and/or an oligonucleotide analogue, preferably an antimiR, a blockmiR, or a microRNA sponge.

Preferably, the antagonist comprises a region of at least 7 contiguous units of nucleotides or nucleotide analogues that is at least 100% identical to the complementary sequence of SEQ ID NO: 1.

Preferably, the antagonist comprises a region of at least 15 contiguous units of nucleotides or nucleotide analogues that is at least 90% identical to the sequence complementary to any region present in SEQ ID NO: 1.

Preferably, the antagonist comprises a region of at least 7 contiguous units of nucleotides or nucleotide analogues that is 100% identical to the sequence complementary to the seed region of the human microRNA miR-100 as defined in the SEQ ID NO: 2.

Preferably, the antagonist comprises a first region of at least 7 contiguous units of nucleotides or nucleotide analogues that is 100% identical to the sequence complementary to the seed region of the human microRNA miR-100 as defined in SEQ ID NO: 2, and where said antagonist further comprises a second region of at least 7 contiguous units of nucleotides or nucleotide analogues adjacent to the first region, where said second region is at least 90% identical to the sequence complementary to any region present in SEQ ID NO: 1.

Preferably, the antagonist comprises a region of at least 7 contiguous units of nucleotides or nucleotide analogues that is at least 95% identical to SEQ ID NO: 3. Preferably, the antagonist comprises a region of at least 15 contiguous units. of nucleotides or nucleotide analogues that is 100% identical to any region present in SEQ ID NO: 3. Preferably, the antagonist consists of SEQ ID NO: 3.

Preferably, the antagonist:

i) comprises a region that is at least 95% identical to SEQ ID NO: 3,

ii) comprises at least one nucleotide which in turn comprises one or more chemical modifications in the ribose residue, in the phosphate bond, or in both, and iii) optionally, has at the 5' end and/or at the 3' one or more additional molecules, where preferably said one or more additional molecules are not deoxyribonucleotide or ribonucleotide derivatives, and where preferably it is cholesterol.

Preferably, the antagonist comprises a region of at least 8 contiguous nucleotide or nucleotide analog units that is at least 95% identical to any region present in SEQ ID NO: 8 or 13. Preferably, the antagonist comprises a region of at least 15 contiguous units of nucleotides or nucleotide analogs that is at least 95% identical to any region present in SEQ ID NO: 8 or 13. Preferably, the antagonist consists of SEQ ID NO: 8 or 13 .

In another aspect, the present invention relates to a composition comprising at least one antagonist of the human microRNA miR-100 as defined in the previous aspect or any of its preferred embodiments. Preferably, said composition is a pharmaceutical composition that additionally comprises a carrier and/or one or more pharmaceutically acceptable excipients.

In another aspect, the present invention relates to an antagonist as defined in the previous aspect or any of its preferred embodiments, or to a composition as defined in the previous aspect or any of its preferred embodiments, for its use as medicine. Preferably, the use is in the treatment of myotonic dystrophy, preferably myotonic dystrophy type 1

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 : Expression levels of genes of interest in HeLa cells. Logarithmic representation in base 2 (log2) of the relative expression level of MBNL1 (left) and MBNL2 (right) transcripts in HeLa cells treated with (A) the mimetics from the initial screening performed with the miRNA SureFind Transcriptome PCR Array plates and (B) selection of those microRNAs of interest, as well as miR-23b and -218 for comparison. For both genes, the reference value is that detected in HeLa cells treated without any mimetics and the endogenous gene used for normalization is GAPDH. *p<0.05,**p<0.01,***p<0.001 (Student's t test).

Figure 2 : Toxicity measurements in the cellular model of the disease . Graphic representation of the percentage of inhibition of cell viability at 72 h, obtained in patient cells caused by the toxicity associated with a dose-response assay with increasing amounts of the antagomiRs miR100, miR-20a, miR-181c, miR-222 and miR-92a, with respect to the base 10 logarithm of the nanomolar concentration of the compound. The amounts tested in the cells are indicated at the bottom of the corresponding curves. The dotted line indicates the dose corresponding to TC50. Test Z-factor: 0.64. Symbols represent mean ± SEM

Figure 3 : Protein levels of interest in the cellular model of the disease.

Relative quantification of MBNL1 protein levels, measured by Quantitative Dot Blot, in DM1 muscle cells transfected with the indicated concentrations and antagomiRs and compared with the levels detected in control muscle cells (CNT). Bars represent the mean ± SEM. GAPDH was used as an endogenous control for normalization of expression. * p <0.05, ** p <0.01, *** p <0.001 (one-way ANOVA test)

Figure 4. Evaluation of the activity and toxicity of the different antagomiRs in the cellular model of the disease. Representation of toxicity (percentage of inhibition of cell viability, black line) and activity (percentage of increase in MBNL1 expression, gray line and bars) in DM1 cells after transfection with the different antagomiRs at the different concentrations tested (each in triplicate). Each symbol and bar represents the mean ± SEM

Figure 5: Expression of the microRNAs of interest in different tissues. Expression levels of miR-23b-3p, miR-218-5p-1, miR-218-5p-2, miR-20a-5p, miR-92a-3p, miR-100-5p, miR-181c-5p and miR-222-3p in transcripts per million (TPMs), in the different tissues of interest: trachea, thyroid, testes, stomach, spleen, different types of muscle cells, skeletal muscle, liver, kidney, heart, bladder, esophagus, diaphragm , colon, cervix, brain and blood. The data comes from the sequencing of the 100 samples.

Figure 6: Demonstration of the overexpression of the different miRNAs in the cellular model of the disease. The expression levels of the indicated miRNAs in DM1 muscle cells and controls from Dr. Denis Furling are shown (Arandel et at.

2017), These levels have been quantified by quantitative PCR and have been normalized to the expression of the endogenous controls U1, U6 and miR-103. Bars represent mean ± SEM. p<0.05,**p<0.01,***p<0.001 (Student's t test).

DEFINITIONS

It should be noted that, as used herein, the singular forms "a", "an" and "the", include plural references unless the context clearly indicates otherwise. Furthermore, unless otherwise indicated, the term "at least" preceding a series of elements should be understood to refer to each element of the series. Those skilled in the art will recognize, or be able to determine using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is intended that said equivalents be covered by the present invention.

As used herein, the term "and/or" set among multiple listed items is understood to encompass both individual and combined options. For example, when two elements are joined by "and/or", a first option refers to the applicability of the first element without the second. A second option concerns the applicability of the second element without the first. A third option concerns the applicability of the first and second elements together. Any of these options are understood to fall within the meaning and therefore satisfy the requirement of the term "and/or" as used herein. It is also understood that the simultaneous applicability of more than one of the options falls within the meaning and therefore satisfies the requirement of the term "and/or".

Throughout this specification and the claims that follow, unless the context otherwise requires, the word "comprises" shall be understood to imply the inclusion of an established integer or step or group of integers. or steps, but not the exclusion of any other integer or step or group of integers or steps. When used herein, the term "comprising" may be replaced by the term "containing" or "including" or "having." The terms “comprising,” “containing,” “includes,” “has,” whenever used herein in the context of an aspect or embodiment of the present invention, may be substituted by the term “consisting of,” although it is less preferred. When used here "consisting of" excludes any element, step or ingredient not specified in the claim element.

The term “hybridization” is used to refer to the structure formed by 2 or more independent strands of RNA or DNA that form a double or triple strand structure through base pairing from one strand to the other. These base pairs are considered G-C, A-U/T, and G-U/t. (A-Adenine, C-Cytosine, G-Guanine, U-Uracil, T-Thymine). As in the case of complementarity, hybridization can be total or partial.

The terms "complementary" and "complementarity" are interchangeable and refer to the ability of oligonucleotides to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide chains or regions. Complementary polynucleotide strands or regions may form base pairs, for example, as in the Watson-Crick form (e.g., A to T, A to U, C to G). 100% (or fully) complementary refers to the situation in which each nucleotide unit of an oligonucleotide chain or region can form hydrogen bonds or bonds with each nucleotide unit of a second polynucleotide chain or region. Partial or non-full complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can form hydrogen bonds with each other and can be expressed as a percentage. The terms "sequence identity" or "percentage identity" in the context of two or more nucleotides, polypeptides or proteins refer to two or more sequences or subsequences that are the same ("identical") or have a specific percentage of nucleobases or amino acids. that are identical ("percent identity") when compared and aligned to obtain maximum correspondence to a second molecule, as measured using a local sequence comparison algorithm (e.g., by a BLAST alignment or any other algorithm location known to experts), or alternatively, by visual inspection. It should be noted that the percentage of identity as used here is measured in the context of a local alignment, that is, it is based on the alignment of regions of local similarity between sequences, as opposed to a global alignment, which aims to align two sequences along their entire length. Therefore, in the context of the present invention, the percent identity is calculated solely based on a local alignment comparison algorithm.

In the context of the present invention, complementarity is considered to occur under strict hybridization conditions. By “stringent hybridization conditions” is meant conditions under which nucleotides that have homology to the target sequence hybridize preferentially to the target sequence, and nucleotides that have no homology to the target sequence do not hybridize substantially. The stringent conditions depend on the sequence, as longer sequences specifically hybridize at higher temperatures. Generally speaking, stringent conditions are chosen to be approximately 5 °C lower than the thermal fusion temperature (Tm) of the specific sequence. Tm is the temperature at which 50% of the nucleotides complementary to the target sequence hybridize to the target sequence at equilibrium at a prescribed ionic strength, pH, and nucleic acid concentration.

By “fragment” or “region” of a sequence is meant a portion of a polypeptide or nucleic acid molecule that preferably contains at least 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80%, 90%, 95% or more of the total length of the reference nucleic acid or polypeptide molecule. A fragment may contain at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides with respect to the reference sequence.

By “MBNL1” we mean the Muscleblind Like Splicing Regulator 1 protein encoded by the MBNL1 gene. The term “MBNL1” as used herein includes all variants encoded by this gene.

By “MBNL2” we mean the Muscleblind Like Splicing Regulator 2 protein encoded by the MBNL2 gene. The term “MBNL2” as used herein includes all variants encoded by this gene.

“Myotonic dystrophy” (MD) refers to a group of inherited disorders called muscular dystrophies. There are two main types of myotonic dystrophy: type 1 (DM1) and type 2 (DM2). Myotonic dystrophy type 1 (DM1), as defined herein, is a multisystem disorder that affects skeletal and smooth muscle, as well as other tissues, such as the eye, heart, endocrine system, and nervous system. central. The Clinical manifestations of DM1 span a continuum from mild to severe and have been broadly categorized into three phenotypes: mild, classic, and congenital. Mild MD1 is characterized by cataracts and mild myotonia (sustained muscle contraction); life expectancy is normal. Classic DM1 is characterized by muscle weakness and atrophy, myotonia, cataracts, and often cardiac conduction abnormalities; Adults may become physically disabled and may have a shorter lifespan. Congenital T1DM is characterized by hypotonia and severe generalized weakness at birth, often with respiratory failure and premature death; intellectual disability is common.

By “treatment of myotonic dystrophy” refers to the treatment of symptomatic or asymptomatic myotonic dystrophy, at least partially restoring the phenotype of a patient with said disease to a non-pathological state. “Prevention of myotonic dystrophy” involves measures taken to prevent the development of myotonic dystrophy (i.e., prevent the appearance of myotonic dystrophy associated with histopathology and/or symptomatology).

An "effective dose" or "therapeutically effective dose" is an amount sufficient to achieve a beneficial or desired clinical result. In the context of the present invention, the following definitions of TC50, EC50, Emax and TIndex have been applied:

TC50 refers to the dose at which antagomiR produces toxic effects (lack of cell viability) in 50 percent of the cells being tested over a period of 72 hours.

EC50 refers to the concentration of antagomiR required to reach 50 percent of its maximum activity within a 72-hour period.

Emax: refers to the maximum activity (in this case, expression of the MBNL1 or MBNL2 proteins measured in number of times or fold change) that the antagomiR has in a period of 72 hours.

Tindex: refers to a measure of the safety margin of a medication and its effectiveness. It is expressed numerically as a relationship between the concentration of the antagomiR that causes cell death (TC50) taking into account its Emax and the dose that causes the desired therapeutic effect (EC50).

“Expression vector” is a nucleic acid molecule (generally a plasmid), a virus, an RNA molecule, a minichromosome, liposome, exosome, or a cell, designed to express or convey a specific biomolecule, in the present case an antagonist. The expression vector is introduced into a host cell using well-known techniques such as infection or transfection, including calcium phosphate transfection, liposome-mediated transfection, electroporation and sonoporation. Expression constructs and methods for their generation and use to express a desired protein are known to one skilled in the art.

DETAILED DESCRIPTION OF THE INVENTION

It is widely accepted that myotonic dystrophy type 1 (DM1) originates, among other molecular defects, from the sequestration and consequent lack of function of the MBNL1 and 2 proteins, which are abnormally sequestered by CUG expansions in the causative mutant DMPK transcripts. of the illness. In the present invention we propose to identify the miRNAs that endogenously repress the expression of MBNL1 and 2 in order, through their inhibitors (antagomiRs and blockmiRs), to find those molecules that could avoid said inhibition and thereby increase the levels of the MBNL1 and 2 proteins. 2, whose function is reduced in pathological conditions. AntagomiR and antimiR are used synonymously in the present description.

To do this, a screening was performed in HeLa cells in which a set of 90 agomiRs (miRNA mimetics) were overexpressed and the levels of MBNL1 and MBNL2 transcripts were quantified by real-time PCR. A total of 5 miRNAs were found capable of repressing the expression of MBNL1 and/or MBNL2 under these conditions: hsa-miR-20a-5p (SEQ ID NO: 4), hsa-miR-181c-5p (SEQ ID NO: 5 ), hsa-miR-222-3p (SEQ ID NO:6), hsa-miR-100-5p (SEQ ID NO:3), hsa-miR-92a-3p (SEQ ID NO: 7). Next, antisense oligonucleotides were designed against each of the identified miRNAs, known as antagomiRs, and tested in muscle cells derived from patients. The relative quantification of MBNL1 protein levels can be seen in Figure 3, which shows that while most only cause less notable increases, some antagomiRs are active at lower concentrations than others, for example, antagomiR-20a or -100, which at 10 nM already recovers to normal levels (see control), and others are capable of doubling the expression in DM1 cells (antagomiR-92a).

Next, the toxicity was evaluated in the cellular model of the disease. Table 3 shows the values of TC50, EC50, Emax and TIndex of the antagonists described in the present invention, where a very high TIndex can be observed in the case of antagomiR-100, derived from its low toxicity (TC50) and EC50.

In view of these results mentioned above, and taking into account that other antagonists that increase MBNL1 levels are known in the state of the art and that are used for the treatment of DM1 (ES2659845B1), it can be concluded that antagonists of the miR-100-5p, miR-20a-5p, miR-222-3p, miR-181c-5p, and miR-92a-3p, have important therapeutic potential by increasing MBNL1 levels, and can be used as medicine, particularly in the treatment in patients with DM1. In addition, results were also obtained on the ability of these antagonists to decrease the relative expression levels of MBNL2, as shown in Figure 1.

Therefore, a first aspect of the invention refers to an antagonist of a human microRNA, where said human microRNA is selected from the group of miR-100, miR-20a, miR-222, miR-181c, and miR-92a, and where said antagonist is capable of increasing the intracellular levels of the MBNL1 and/or MBNL2 protein, and/or the intracellular levels of transcripts (mRNA) of the genes that encode the MBNL1 and/or MBNL2 proteins. In a preferred embodiment, the antagonist of a human microRNA is an antagonist of the human microRNA miR-100.

In another preferred embodiment, the human microRNA antagonist miR-100 is capable of increasing the intracellular levels of the MBNL1 and/or MBNL2 protein and/or the intracellular levels of transcripts of the genes encoding the MBNL1 and/or MBNL2 proteins in a muscle cell, preferably in a muscle cell that exhibits a muscular dystrophy phenotype, preferably type 1. As used herein the term "capable of increasing the levels of the MBNL1 and/or MBNL2 protein or their transcripts" is refers to an increase, preferably statistically significant, in the intracellular levels of said proteins (or any of their variants) or in the intracellular levels of the mRNAs that encode them caused by treatment with the antagonists of the present invention, where said increase is in comparison to the levels of a control or untreated cell or cell population. By control cell or cell population refers to cells not treated with the antagonists of the invention and that present MBNL1 and/or MBNL2 function abnormally decreased by the type 1 muscular dystrophy disease or by the presence of at least one of the miRNAs that act negatively on its expression. In statistics, a result or effect is statistically significant when it is unlikely to have been due to chance. The level of significance of a statistical test is a statistical concept associated with the verification of a hypothesis. This test is defined as the probability of making the decision to reject the null hypothesis when it is true (a decision known as type I error, or false positive). The decision is often made using the p-value: if the p-value is less than the level of significance, then the null hypothesis is rejected. The smaller the p-value, the more significant the result. Preferably, the increase in intracellular levels of proteins or their transcripts is considered to be statistically significant compared to the levels of said proteins or transcripts in control cell(s) when the significance levels p are equal to or less than 0.05, 0.01 and 0.001.

Preferably, the control cells are muscle cells that present a type 1 muscular dystrophy phenotype. Preferably, the increase in intracellular protein and/or transcript levels of MBNL1 and/or MBNL2 is at least 1.2, 1.3, 1.4 , 1.5, 1.6, 1.7, 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times ( fold change) with respect to the levels of said proteins/transcripts present in a cell or cells control or untreated.

Thus, the present inventors propose the modulation of endogenous MBNL proteins causing the sequestration of at least one of the miRNAs that act negatively on their expression, thereby giving rise to an upregulation and, as a consequence, an increase in levels. intracellular effects of endogenous MBNL1 and/or MBNL2 proteins, or their transcripts (mRNA). Therefore, it is about modulating the endogenous protein by silencing or decreasing the activity of the human microRNAs miR-100, miR-20a, miR-222, miR-181c, or miR-92a.

As used herein, "antagonist" refers to any molecule capable of blocking the action of human microRNAs, preferably miR-100, miR-20a, miR-222, miR-18c1, and miR-92a, that is, compounds, regardless of their nature, that are capable of producing a decrease in the endogenous activity of said miRNAs, and therefore increasing the intracellular levels of the MBNL1 and/or MBNL2 proteins and/or their transcripts. Since the present invention focuses on reducing the activity of the human microRNAs miR-100, miR-20a, miR-222, miR-181c, and miR-92a, said repressive capacity will be decreased by the presence of their inhibitors, silencers or blockers: all called antagonists. Therefore, similarly, the effect produced by an inhibitor, silencer or blocker entails and means an antagonism of its action. Preferably, miR-100, miR-20a, miR-222, miR-181c, and miR-92a whose action is blocked by the antagonist of the present invention are specifically miR-100-5p, miR-20a-5p, miR -222-3p, miR-181c-5p, and miR-92a-3p.

In one embodiment, the antagonist capable of blocking the action of human microRNAs, preferably miR-100, miR-20a, miR-222, miR-18c1, and miR-92a is a molecule, preferably an organic compound, of low molecular weight.

In a preferred embodiment, the antagonist is an oligonucleotide molecule and/or an oligonucleotide analogue. As used herein, the term "oligonucleotide molecule" or "oligonucleotide" refers to the molecules that result from the union of usually a maximum of 50 units of the monomers that give rise to the molecules known in abbreviated form as DNA or RNA, which are monomers or oligomers that are composed of a phosphate group, the nitrogenous bases adenine (A), cytosine (C), guanine (G) or uracil (U) or thymine (T), and the pentose known as ribose (in the case of oligoribonucleotides in the case of RNA) or deoxyribose (in the case of oligodeoxyribonucleotides, or DNA). Oligodeoxynucleotides (DNA) and oligoribonucleotides (RNA) are therefore considered included within oligonucleotides. Due to its common use, molecules whose units include the nucleotide inosine and molecules that are a mixture of DN N RNA are also considered included within this definition because they contain regions of both types.

In a preferred embodiment, the antagonist is a molecule of oligoribonucleotide nature (an oligoribonucleotide) and/or an oligoribonucleotide analogue. As used herein, molecules that result from the union of usually a maximum of 50 units of the monomers that give rise to the molecule known in abbreviated form as RNA, monomers that are composed of a phosphate group, the nitrogenous bases adenine (A), cytosine (C), guanine (G) or uracil (U), and pentose. Due to its common use, molecules whose units include the nucleotide inosine are also considered included within this definition.

As used herein, the terms "oligonucleotide analog" and "oligoribonucleotide analog" encompass molecules derived from oligonucleotides and oligoribonucleotides, respectively, that incorporate artificially introduced chemical modifications, such as those described in Antisense part III: chemistries. Aug 28, 2018 ericminikel • Cambridge, MA. (https://www.cureffi.org/2018/08/28/antisense-part-iii-chemistries/). Preferably, the modifications are among one of the following modifications: i) some chemical modification in at least one of the units that compose them, either in the phosphate group, the pentose or one of the nitrogenous bases or ii) that one or several of the basic components that constitute the oligonucleotide are replaced by a different chemical structure but with the same function. In the case of ii), the use of morpholino rings replacing pentoses to arrange the nitrogenous bases in their appropriate spatial arrangement, or the substitution of intemudeosidic phosphodiester bonds with phosphorothioates. Furthermore, other modifications iii) also include those consisting of the addition of groups of non-nucleotide nature at the 5' and/or 3' ends, and/or iv) the addition of additional oligonucleotide sequences or oligonucleotide analogues (i.e. not complementary to the target microRNA) at said ends. Some of the common chemical modifications by which oligonucleotide and oligoribonucleotide molecules are modified include modification of part or all of the nucleotides with 2'-methoxy (2'-O-methyl: 2'-OMe), 2'-Omethoxyethyl ( 2'-MOE), and/or phosphorothioate bonds.

In particular, for the purposes of the invention, those modifications, valid for oligonucleotides and oligoribonucleotides that give rise to analogues, are of special interest (and are considered included within the modifications that give rise to the antagonists included within the scope of the invention). of DNAs and RNAs with increased resistance to hydrolysis, and which are generally modifications in the pentose, such as those that result in: 2'-O-methyl-substituted (the 2'-methoxy modifications); 2'-O-methoxyethyl-substituted; LNAs ("locked nucleic acids": locked nucleic acid, in which the pentose residue is modified with an extra bridge that connects the 2' oxygen and the 4' carbon and locks the pentose in the 3'-conformation. endo); BNAs (“bridged nucleic acid”); PMOs (nucleic acids where the ribose has been replaced by a morpholino group), or PNAs (“peptide nucleic acid”: peptide nucleic acid, where the pentose group -phosphate is replaced by an amino acid residue, so that the nucleotide analogue has as its skeleton a structure of repeating units of N-(2-aminoethyl)-glycine linked by peptide bonds. Recently, nucleotides with different modifications have also been used. , such as CRNs (“Conformationally Restricted Nucleotides”), in which the pentose residue is locked in a conformation governed by a chemical residue that acts as a connector, a modification that is being used mainly to obtain antagomiRs with new properties, or the cETs (cET = constrained ethyl).

Also considered included within the possible modifications that give rise to oligonucleotide or oligoribonucleotide analogues of the invention are modifications that give rise to phosphorothioate bonds, which are modifications that affect phosphate groups that are part of the "skeleton" of the chain of nucleotides, leading to the introduction of a sulfur atom to replace an oxygen atom of the phosphate group that is not acting as a bridge between nucleotides; These modifications make the bonds between nucleotides resistant to degradation by nucleases, so it is common to introduce between the last 3-5 nucleotides located at the 5' or 3' ends of the antagonist oligonucleotide to inhibit its degradation by exonucleases, increasing its stability. Phosphorothioate linkages also appear to increase binding to serum proteins, such as albumins, to improve the distribution of molecules containing them. Also included among the chemical modifications that give rise to oligonucleotide and oligoribonucleotide analogues of the invention is 5' methylation of the nitrogenous base cytosine (C), which appears to increase the stability of the complexes formed with the target.

Other chemical modifications are also possible and known, which are also included within the possible modifications that give rise to analogues of oligonucleotides or oligoribonucleotides. As can be deduced from the definition of "molecules of an oligonucleotide/oligoribonucleotide nature" and that of "oligonucleotide/oligoribonucleotide analogues", molecules in which some units present modifications and others are also included within the definition of oligonucleotide analogues or oligoribonucleotides. no, as well as hybrids between analogues of nucleic acids and peptides or even hybrid molecules in which some of the nucleotide units are ribonucleotides (or analogues thereof) and others are deoxyribonucleotides (nucleotides where the sugar is deoxyribose), as well as the analogues of the latter, that is, the RNA-DNA hybrids and their analogues.

Preferably, the oligonucleotide molecule and/or oligonucleotide analogue is an antagonist of a human microRNA selected from the group of miR-100, miR-20, miR-222, miR-181 and miR-92, and where said antagonist is an antimiR, a blockmiR, or a miRNA sponge.

As used herein, "blockmiR" refers to small oligonucleotides of special chemistry designed against the sequence of a particular miRNA, in this case miR-100-5p, miR-20a-5p, miR-222-3p, miR -181c-5p, and miR-92a-3p, recognize their target messenger RNA (mRNA), so each of them should only derepress the effect of that miRNA on that transcript, a very specific effect being expected. Therefore , are designed so that they have a sequence that is complementary to that of a fragment of the sequence of an mRNA that serves as a binding site for a miRNA, in such a way that they usually bind in the 3' untranslated region (3 '-UTR) of an mRNA, that is, in the area where endogenous miRNAs usually bind.

In a preferred embodiment, the antagonist is an antimiR. AntimiRs are generally used to silence endogenous miRNAs. Therefore, as used herein, "antimiR", which is synonymous with "antagomiR", refers to small synthetic oligonucleotides, preferably synthetic oligoribonucleotides, that are complementary to a target miRNA, in this case miR-100-5p. , miR-20a-5p, miR-222-3p, miR-181c-5p, and miR-92a-3p and, therefore, act as antagonists of said miRNAs. Typically, antimiRs include chemical modifications such as 2-O-methyl groups, phosphorothioates and conjugated fatty acids, preferably cholesterol.

As used herein, "miRNA sponge" or "miRNA sponge" refers to molecules whose main constituent are oligonucleotide repeats placed in tandem, with the particularity that each of said oligonucleotides are themselves or contain a binding site for miR-100-5p, miR-20a-5p, miR-222-3p, miR-181c-5p, and miR-92a-3p that antagonize.

To design the antagonist molecules, it is important to take into account that there is sufficient complementarity with the sequence of the target miR, in the case of antimiRs and miRNA sponges, or of its target mRNA, in the case of blockmiRs, to which they must bind to that the desired inhibition/antagonism effect actually occurs. In this sense, examples can be taken into account that the "typical" complementarity between an antagonist and its target can be 50%. Therefore, in a preferred embodiment, the antagonist of oligonucleotide or oligoribonucleotide nature of the invention comprises a fragment of sequence of nucleotide or ribonucleotide units, or analogues thereof, in which the sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogues is at least 50%, 55%, 60%, 65 identical %, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%, to the complementary sequence of the endogenous molecule with which it has to hybridize, that is, to the sequences of miR-100-5p, miR-20a-5p, miR-222-3p, miR-181c- 5p, and miR-92a-3p with which it must bind (in the case of antagomiRs and the repetitive sequence of miRNA sponges) or the sequence of the messenger mRNA fragment (in the case of blockmiRs). of the present invention, the nitrogenous bases T and U are considered to be interchangeable, and therefore sequences that include T can also be considered sequences with U, and vice versa.

In the event that the oligonucleotide or oligoribonucleotide antagonist of the invention is an antimiR, in a preferred embodiment, said antimiR comprises a sequence fragment of nucleotide or ribonucleotide units, or analogues thereof. same, in which the sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogues is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% identical , 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%, to the complementary sequence of any of the sequences of human microRNAs SEQ ID NO: 1 (miR-100-5p), SEQ ID NO: 14 (miR-20a-5p), SEQ ID NO: 15 (miR-222-3p), SEQ ID NO: 16 (miR -181c-5p), or SEQ ID NO: 17 (miR-92a-3p).

Furthermore, endogenous miRNAs typically bind in the 3'-untranslated region (3'-UTR) of the mRNA they regulate. However, the binding between the miRNA and its target mRNA does not have to be perfect and is mainly dominated by the so-called seed region of the miRNA. The seed region sequence is a conserved sequence that is mainly located at positions 2-8 of the 5' end of the miRNA. Although the base pairing of miRNA and its target mRNA does not match perfectly, with the "seed sequence" it has to be perfectly, that is, 100%, complementary. In the case of miR-100-5p, its sequence corresponds to SEQ ID NO: 1, of which the seed region is composed of SEQ ID NO: 2. In the case of miR-20a-5p, its sequence corresponds to SEQ ID NO: 14, of which the seed region is composed of SEQ ID NO: 18. In the case of miR-222-3p, its sequence corresponds to SEQ ID NO: 15, of which the seed region is composed by SEQ ID NO: 19. In the case of miR-181c-5p, its sequence corresponds to SEQ ID NO: 16, of which the seed region is composed of SEQ ID NO: 20. In the case of miR- 92a-3p, its sequence corresponds to SEQ ID NO: 17, of which the seed region is composed of SEQ ID NO: 21.

From the above it can be deduced that when designing the antagonists of the human microRNAs miR-100-5p, miR-20a-5p, miR-222-3p, miR-181c-5p, and miR-92a-3p of nature oligonucleotide or oligoribonucleotide or their analogues, it is advisable to consider the seed region of these, and include the region highly complementary to said seed region in the antagonist that is being designed. Therefore, in a preferred embodiment, the oligonucleotide or oligoribonucleotide antagonist of the invention is an antimiR that comprises a sequence fragment of nucleotide or ribonucleotide units, or analogues thereof, in which the sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogues is at least 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%, identical to the sequence complementary to the seed region of any of the human microRNAs miR-100-5p, miR-20a-5p, miR-222-3p, miR-181c-5p, or miR-92a-3p, determined by SEQ ID NO: 2, 18, 19, 20 , 0or 21, respectively. Preferably, the identity to the sequence complementary to the seed region is 100%.

The length of the sequence of antagonists of an oligonucleotide or oligoribonucleotide nature or their analogues is at least 8 nucleotides, with no established maximum. Preferably, the length of the sequence of said antagonists is at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, or 50 nucleotides. In a preferred embodiment, the length of said antagonists is between 10 15, 10-20, 20-30, 30-40 or 40-50. In another preferred embodiment, the length of said antagonists is 15-25 nucleotides. In one embodiment of the present invention, the antagonist is an antimiR comprising or consisting of a region of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22 or 23, preferably between 20 and 23, contiguous units of nucleotides or nucleotide analogues that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91% identical , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the complementary sequence of any of the sequences SEQ ID NO: 1 (miR -100-5p), SEQ ID NO: 14 (miR-20a-5p), SEQ ID NO: 15 (miR-222-3p), SEQ ID NO: 16 (miR-181c-5p), or SEQ ID NO: 17 (miR-92a-3p), preferably SEQ ID NO: 1. In a preferred embodiment, the antagonist is an antimiR that comprises or consists of a region of at least 5, 6, 7, or 8 contiguous nucleotide units or nucleotide analogues that are 100% identical to the sequence complementary to the seed region of any of the human microRNAs as defined in SEQ ID NO: 2 (miR-100-5p seed), SEQ ID NO: 18 (miR-20a-5p seed), SEQ ID NO: 19 (miR-222-3p seed), SEQ ID NO: 20 (miR-181c-5p seed), or SEQ ID NO: 21 ( miR-92a-3p seed), preferably SEQ ID NO: 2.

In another preferred embodiment, the antagonist is an antimiR that comprises a first region of at least 5, 6, 7, or 8 contiguous nucleotide or nucleotide analog units that is 100% identical to the sequence complementary to the seed region. of any of the human microRNAs miR-100, miR-20, miR-222, miR-181 or miR-92, as these have been defined in SEQ ID NO: 2 (miR-100-5p seed), SEQ ID NO: 18 (miR-20a-5p seed), SEQ ID NO: 19 (miR-222-3p seed), SEQ ID NO: 20 (miR-181c-5p seed), and SEQ ID NO: 21 (miR-92a-3p seed), and wherein said antagonist further comprises a second region of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous units of nucleotides or nucleotide analogues adjacent to the first region, where said second region is identical in at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the sequence complementary to any region present in the SEQ ID NO: 1 (miR-100-5p), SEQ ID NO: 14 (miR-20a-5p), SEQ ID NO: 15 (miR-222-3p), SEQ ID NO: 16 (miR-181c-5p) , or SEQ ID NO: 17 (miR-92a-3p), respectively.

As described in the examples, the authors of the present invention found that antagonists of the human microRNAs miR-100-5p, miR-20a-5p, miR-222-3p, miR-181c-5p and miR-92a- 3p, are able to increase the levels of the MBNL1 protein and the expression levels of the MBNL2 protein in a muscle cell. Therefore, a series of specific antimiRs were designed against these miRs. The sequences of human microRNAs, in 5' to 3' orientation, are (the seed region is indicated in underlined):

hsa-miR-100-5p (SEQ ID NO: 1): AACCCGUAGAUCCGAACUUGUG

hsa-miR-20a-5p (SEQ ID NO: 14): UAAAGUGCUUAUAGUGCAGGUAG

hsa-miR-181c-5p (SEQ ID NO: 16): AACAUUCAACCUGUCGGUGAGU

hsa-miR-222-3p (SEQ ID NO: 15): AGCUACAUCUGGCUACUGGGU

hsa-miR-92a-3p (SEQ ID NO: 17): UAUUGCACUUGUCCCGGCCUGU

The sequences of the designed antagomiRs are, in 5' 3' orientation:

AntagomiR-100-5p (SEQ ID NO: 3): CACAAGTTCGGATCTACGGGTT

AntagomiR-20a-5p (SEQ ID NO: 4): CTACCTGCACTATAAGCACTTTA

AntagomiR-181c-5p (SEQ ID NO: 5): ACTCACCGACAGGTTGAATGTT

AntagomiR-222-3p (SEQ ID NO: 6): ACCCAGTAGCCAGATGTAGCT

AntagomiR-92a-3p (SEQ ID NO: 7): ACAGGCCGGGACAAGTGCAATA

In the case of antimiRs, the antagonist of oligonucleotide or oligoribonucleotide nature of the invention comprises or consists of a sequence fragment of nucleotide or ribonucleotide units, or analogues thereof, in which the sequence of the nitrogenous bases of the units of nucleotides or nucleotide analogues is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94 identical %, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%, to any of the sequences SEQ ID NO: 3, 4, 5, 6, or 7, preferably SEQ ID NO: 3. In a preferred embodiment, the antagonist consists of the sequence SEQ ID NO: 3, 4, 5, 6, or 7, preferably SEQ ID NO: 3.

In one embodiment of the present invention, the antagonist is an antimiR comprising or consisting of a region of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22 or 23, preferably between 20 and 23, contiguous units of nucleotides or nucleotide analogues that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91% identical , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to any region present in any of the sequences SEQ ID NO: 3, 4, 5, 6, or 7, preferably SEQ ID NO: 3.

Furthermore, the antagomiRs developed may present certain chemical modifications common in this type of oligonucleotide or oligoribonucleotide analogues, among which are:

- 2'-O-methyl (2'-methoxy) modifications on all pentose residues,

- the replacement of some phosphate bonds between the analogous monomeric units of nucleotides with phosphorothioate, and

- the incorporation of fatty acid molecules at one end of the molecule, preferably at the 3' end.

Thus, in a preferred embodiment, the antagonist presents at least one chemical modification in its structure, where:

Yo. said antagonist comprises a region of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22 or 23, preferably between 20 and 23, contiguous units of nucleotides or nucleotide analogues that is identical in at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98%, 99% or 99.5%, or 100% to any region present in any of the sequences SEQ ID NO: 3, 4, 5, 6, or 7, preferably SEQ ID NO: 3,

ii. at least one of the nucleotide or nucleotide analog units that make up said antagonist is a nucleotide analog that has one or more chemical modifications in the pentose residue, preferably ribose, in the phosphate bond, or in both, and

iii. optionally, said antagonist has at the 5' end and/or at the 3' end one or more additional molecules, preferably one or more molecules that are not derivatives of deoxyribonucleotide or ribonucleotides.

In another preferred embodiment, the antagonist has at least one chemical modification in its structure, where:

Yo. said antagonist comprises a region of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22 or 23, preferably between 20 and 23, contiguous units of nucleotides or nucleotide analogues that is identical in at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98%, 99% or 99.5%, or 100% to any region present in any of the sequences SEQ ID NO: 3, 4, 5, 6, or 7, preferably SEQ ID NO: 3,

ii. at least one of the nucleotide or nucleotide analog units that make up said antagonist is a nucleotide analog that presents one or more chemical modifications, selected from the group of: methylations, phosphorothioate bonds, LNAs, BNAs, constrained ethyl (cEt) nucleosides, PMOs, PNAs, 2'-O-methyl-substituted, 2'-O-methoxyethyl-substituted, 2'-fluoro, and

iii. optionally, said antagonist has at the 5' end and/or at the 3' end one or more additional molecules, preferably one or more molecules that are not derivatives of deoxyribonucleotide or ribonucleotides.

In another preferred embodiment, the antagonist has at least one chemical modification in its structure, where:

Yo. said antagonist comprises a region of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22 or 23, preferably between 20 and 23, contiguous units of nucleotides or nucleotide analogues that is identical in at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98%, 99% or 99.5%, or 100% to any region present in any of the sequences SEQ ID NO: 3, 4, 5, 6, or 7, preferably SEQ ID NO: 3,

ii. at least one of the nucleotide units or nucleotide analogue units that make up said antagonist is a nucleotide analogue that has one or more chemical modifications in the ribose residue, in the phosphate bond, or in both, preferably selected from the group from: methylations, phosphorothioate bonds, LNAs, BNAs, constrained ethyl (cEt) nucleosides, PMOs, PNAs, 2'-O-methyl-substituted, 2'-O-methoxyethyl-substituted, 2'- fluoro, and

iii. optionally, said antagonist has at the 5' end and/or at the 3' end one or more additional molecules, preferably one or more molecules that are not derivatives of deoxyribonucleotide or ribonucleotides, preferably cholesterol.

In this way, the following oligonucleotide analogues or oligoribonucleotide antagonists of the human microRNAs miR-100, miR-20, miR-222, miR-181 and miR-92 are produced:

AntagomiR-100-5p (SEQ ID NO: 8): C*A*CAAGTTCGGATCTACGG*G*T*T* AntagomiR-20a-5p (SEQ ID NO: 9): C*T*ACCTGCACTATAAGCACT*T*T*A* AntagomiR-181c-5p (SEQ ID NO: 10): A*C*TCACCGACAGGTTGAAT*G*T*T* AntagomiR-222-3p (SEQ ID NO: 11): A*C*CCAGTAGCCAGATGTA*G*C*T* AntagomiR-92a-3p (SEQ ID NO: 12): A*C*AGGCCGGGACAAGTGCA*A*T*A*

where:

- an asterisk (*) indicates the presence of a phosphorothioate bond,

- A, C, T, G in bold indicates that that nucleotide is modified with 2'-Omethoxyethyl, and - optionally, a fatty acid is conjugated at the 3' and/or 5' end of the molecule.

Therefore, all the nitrogenous bases of the sequences SEQ ID NO: 8, 9, 10, 11, and 12 are modified with 2'-Omethoxyethyl (2' OMe).

In a preferred aspect, the sequences SEQ ID NO: 8, 9, 10, 11, and 12 have a fatty acid, preferably cholesterol, conjugated to their 3' end.

AntagomiR-100-5p (SEQ ID NO: 13): C*A*CAAGTTCGGATCTACGG*G*T*T* -Chol AntagomiR-20a-5p (SEQ ID NO: 22): C*T*ACCTGCACTATAAGCACT*T*T* A* -Chol AntagomiR-181c-5p (SEQ ID NO: 23): A*C*TCACCGACAGGTTGAAT*G*T*T* -Chol AntagomiR-222-3p (SEQ ID NO: 24): A*C*CCAGTAGCCAGATGTA* G*C*T* -Chol AntagomiR -92a-3p (SEQ ID NO: 25): A*C*AGGCCGGGACAAGTGCA*A*T*A* -Chol

where:

- an asterisk (*) indicates the presence of a phosphorothioate bond,

- A, C, T, G in bold indicates that that nucleotide is modified with 2'- Omethoxyethyl, and - "- Chol” indicates that the oligonucleotide is conjugated to cholesterol at its 3' end.

Therefore, all the nitrogenous bases of the sequences SEQ ID NO: 13, 22, 23, 24 and 25 are modified with 2'-Omethoxyethyl (2' OMe) and conjugated to cholesterol.

In a preferred embodiment, the oligonucleotide or oligoribonucleotide antagonist of the invention is an antimiR that comprises or consists of a sequence fragment of nucleotide or ribonucleotide units, or analogues thereof, in which the sequence of the nitrogenous bases of the nucleotide units or nucleotide analogues is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93 identical %, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%, to any of the sequences SEQ ID NO: 8, 9, 10, 11, or 12, preferably SEQ ID NO: 8.

In a preferred embodiment, the antagonist consists of SEQ ID NO: 8, 9, 10, 11, or 12, preferably SEQ ID NO: 8.

In one embodiment of the present invention, the antagonist is an antimiR comprising or consisting of a region of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22 or 23, preferably between 20 and 23, contiguous units of nucleotides or nucleotide analogues that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91% identical , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to any of the sequences SEQ ID NO: 8, 9, 10, 11 , or 12, preferably SEQ ID NO: 8.

In a preferred embodiment, the oligonucleotide or oligoribonucleotide antagonist of the invention is an antimiR that comprises or consists of a sequence fragment of nucleotide or ribonucleotide units, or analogues thereof, in which the sequence of the nitrogenous bases of the nucleotide units or nucleotide analogues is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93 identical %, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%, to any of the sequences SEQ ID NO: 13, 22, 23, 24 or 25, preferably SEQ ID NO: 13; where a cholesterol molecule is conjugated to the 3' end of the antagonist. In a preferred embodiment, the antagonist consists of any of the sequences SEQ ID NO: 13, 22, 23, 24 or 25, preferably SEQ ID NO: 13, where a cholesterol molecule is conjugated to the 3' end of said antagonist.

In one embodiment of the present invention, the antagonist is an antimiR comprising or consisting of a region of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22 or 23, preferably between 20 and 23, contiguous units of nucleotides or nucleotide analogues that are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91% identical , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to any of the sequences SEQ ID NO: 13, 22, 23, 24 or 25, preferably SEQ ID NO: 13, where a cholesterol molecule is conjugated to the 3' end of said antagonist.

A possible embodiment of the invention may be considered a molecule of oligonucleotide nature and/or an oligonucleotide analog that is an antagonist of a human microRNA, where said human microRNA is selected from the group of miR-100, miR-20, miR-222. , miR-181 and miR-92, or a mixture of two or more of said molecules, which is capable of increasing the intracellular levels of the MBNL1 and/or MBNL2 proteins or the levels of their transcripts in a muscle cell. Said muscle cell may be one or more cells of skeletal muscle tissue, cardiac tissue, or smooth muscle tissue, or their precursors. In a preferred embodiment, said muscle cell is a cardiomyocyte, myoblast, myocyte, striated muscle cells, or smooth muscle cells. In another preferred embodiment, the antagonist is capable of increasing the levels of the MBNL1 and/or MBNL2 proteins or the intracellular levels of their transcripts in a cell found in one or more organs selected from the group of brain, cerebellum, hippocampus or other organ of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testicle, uterus, gastrointestinal tract, breast, bladder, prostate, skin, or in one or more cells from a primary culture of one of said organs or from an established cell line derived from one of said organs (including induced pluripotent stem cells, known by their acronym iPSCs: induced pluripotent stem cells) or stem cells of one of said organs.

In a second aspect , the present invention refers to a composition comprising at least one antagonist as defined in the first aspect or in any of its embodiments, and at least one pharmaceutically acceptable excipient. Furthermore, the antagonist can be transported in a vector. Said vector may be an expression vector. The vector can be selected from the list that includes DNA, RNA, viral, liposome or exosome vectors. Thus, the present invention also includes any means of delivery or expression that comprises the inhibitors or antagonists defined in the first aspect or in any of its embodiments.

It is common to prepare compositions that comprise more than one active ingredient. For example, it would be possible to prepare a composition that comprises the combination of the antagonists of the present invention with other antagonists of other human microRNAs that also intercede or have an effect on the production of MBNL proteins. Thus, in a preferred embodiment of the second aspect, the composition comprises a combination of antagonists, among which is the antagonist as defined in the first aspect or in any of its embodiments. In a preferred aspect, the composition according to the second aspect comprises at least one antagonist as defined in the first aspect or in any of its embodiments, and at least one antagonist of human microRNA-218-5p or microRNA -23b-3p human. Human microRNA-218-5p or human microRNA-23b-3p are defined in patent ES 2 659 845 A1. In another embodiment, the composition according to the second aspect comprises at least one antagonist as defined in the first aspect or in any of its embodiments, and other molecules of a nucleotide nature, preferably antisense oligonucleotides (ASOs).

Preferably, the composition according to the second aspect comprises at least one antagonist against the human microRNA miR-100, preferably an antagonist comprising or consisting of SEQ ID NO: 8 or 13, or an antagonist whose sequence is identical at least in 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, 99% or 99.5%, or 100%, to any of the sequences SEQ ID NO: 8 or 13.

For clinical application, the compositions of the present invention, which will then be considered pharmaceutical compositions of the present invention, can be prepared in a form suitable for the desired application. As stated in publications also related to the clinical application of microRNA inhibitors / antagonists, such as international application WO2012148373A1, generally this will involve the preparation of compositions that are essentially free of pyrogens, as well as other impurities that may be harmful to the human beings or animals. Said international application WO2012148373A1 has as its object compounds analogous to those of the present invention and therapeutic applications thereof, therefore the information on forms of preparation and presentation of pharmaceutical compositions, possible suitable administration vehicles, or forms and routes of administration can considered applicable to the present invention and can be taken as a reference for the compositions of the present invention.

Colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes, can be used as inhibitor/delivery vehicles. antagonists of the present invention, with which the pharmaceutical composition of the invention is formed, but the possibility that the antagonists are administered without the help of other pharmacological agents is also included.

Another possibility, as already discussed, is to prepare the pharmaceutical compositions of the invention using appropriate salts and buffers to make the delivery vehicles stable and assist in capture by target cells. The compositions of the present invention can be aqueous compositions that comprise an effective amount of the administration vehicle and that comprise either the oligonucleotide molecules of the invention, independently or forming liposomes or other complexes, or expression vectors of the themselves, dissolved or dispersed in a pharmaceutically acceptable vehicle or aqueous medium. The The terms "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse reactions, allergic or otherwise, when administered to an animal or a human being. As used herein, "pharmaceutically acceptable carrier" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retarding agents and the like acceptable for use in formulation pharmaceuticals. , such as pharmaceutical products suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Except to the extent that any conventional media or agent is incompatible with the active ingredients of the present invention, their use in the pharmaceutical compositions of the invention is contemplated. Supplementary active ingredients may also be incorporated into the compositions, provided that they do not inactivate the molecules of the present invention or their expression vectors.

The active compositions of the present invention can be administered by any of the common routes, provided that the target tissue is available through that route. This includes oral, nasal, or buccal routes and also, preferably, administration can be by intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous route.

Dosage forms suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid as long as there is easy injectability. The preparations must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Suitable solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Appropriate fluidity can be maintained, for example, by the use of a coating, such as lecithin, by maintaining the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases it will be preferable to include isotonic agents, for example sugars or sodium chloride. Prolonged absorption of injectable compositions may be caused by the use in the compositions of agents that delay absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions may be prepared by incorporating the active compounds in an appropriate amount in a solvent together with any other ingredients (for example, as specified above) as desired, followed by sterilization by filtration. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle containing the basic dispersion medium and the other desired ingredients, for example, as specified above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation include vacuum drying and lyophilization, techniques that produce a powder of the active ingredient(s) plus any desired additional ingredients from a solution. of the same previously sterilized by filtration. The compositions of the present invention can generally be formulated in a neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric), or from organic acids (e.g., acetic, oxalic, tartaric, mandelic), and the like. Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine and similar).

In any case, it is recommended that the preparation of the compositions of the present invention follow practices that guarantee a minimum quality for use in humans, such as those included in the Guide to Good Manufacturing Practices for Active Pharmaceutical Ingredients of Working Group Q7. of the International Conference on the Harmonization of Technical Requirements for the Registration of Pharmaceutical Agents for Human Use.

Preferably, other quality guidelines from the same source will also be taken into account, such as Q8, relating to Pharmaceutical Development, or Q10, on the Pharmaceutical Quality System.

Following formulation, the solutions are preferably administered in a form compatible with the dosage formulation and in such an amount as to be therapeutically effective. The formulations can be easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution is usually appropriately buffered and the liquid diluent must first be made isotonic, for example, with sufficient saline or glucose. Such aqueous solutions can be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are used, as is known to those skilled in the art, selected particularly in light of the present description. Preferably, chemical buffers are used, which are buffer or regulatory solutions that keep the pH of the composition stable. Examples of buffers are PBS. By way of illustration, a single dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of hypodermoclysis fluid or injected at the proposed infusion site, (see for example, "Remington Pharmaceutical Sciences" 15th edition, pages 1035-1038 and 1570-1580). Some variations in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any case, determine the appropriate dose for the individual subject. On the other hand, for human administration, the preparations must meet the biological standards of sterility, pyrogenicity, general safety and purity as required, for example, by the ICH Quality Guidelines cited above or by FDA regulations.

Furthermore, the significant increase in MBNL1 and/or MBNL2 proteins demonstrated in the present invention leads to considering the possible use of these antagonists as medicine. Therefore, a third aspect of the invention relates to the antagonist according to the first aspect or any of its embodiments, or to the composition according to the second aspect or any of its embodiments, for use as a medicine. In a preferred embodiment, the use is as a treatment for myotonic dystrophy, preferably myotonic dystrophy type 1.

The administration of the antagonist through a possible expression vector may allow directing the expression to a specific tissue or group of tissues depending on the tropism of the base vector itself and/or by choosing control elements that give rise to the expression. of the coding sequence linked to them only in specific tissues. As for the organs or tissues to be treated, preferably they are those tissues or organs affected by DM1, in particular those selected from the group of skeletal muscle, heart, smooth muscles, diaphragm, respiratory muscles, or muscles of the pharynx or stem cells of one or more of said organs.

In addition, some specific dosage forms may promote greater access to certain organs. The concentration tests carried out in the examples show that the antagomiRs, at different doses, are capable of increasing the expression and the concentration of MBNL1 and/or MBNL2 proteins, which supports their use for the preparation of a medication for the treatment of myotonic dystrophy 1, in particular to alleviate symptoms of the disease, especially symptoms that correspond to muscle dysfunction. In a possible embodiment, the pharmaceutical composition comprises an effective dose of an inhibitor or antagonist of at least one of the human microRNAs miR-100, miR-20, miR-222, miR-181 and miR-92. More preferably, the inhibitor(s)/antagonist(s) will be present at a concentration that allows administration of a therapeutically effective dose.

An "effective dose" or "therapeutically effective dose" is an amount sufficient to effect a beneficial or desired clinical result. Furthermore, the effective dose may vary in organisms of different species and/or sizes. Thus, an effective dose of an inhibitor/antagonist of a microRNA in rodents, according to previous results obtained with molecules directed against other microRNAs, can be from approximately 1 mg/kg to approximately 100 mg/kg, approximately 2.5 mg /kg to approximately 50 mg/kg, or approximately 5 mg/kg to approximately 25 mg/kg. It is necessary to take into account that therapeutic doses tested in mice must be converted to their equivalent in humans. To do this, the person skilled in the art can consult the well-known common practice guide for dose conversion between animals and humans, see, for example, Nair AB, Jacob S. A simple practice guide for dose conversion between animals and humans. J Basic Clin Pharma 2016;7:27-31. Briefly, therapeutic doses in mouse models can be converted to humans by dividing them by approximately 12.3, although the corresponding clinical trial would have to be done. Calculating and obtaining an effective dose for humans falls within routine practice and therefore within the knowledge of the expert in the field. Furthermore, the precise determination of what is considered an effective dose may be based on individual factors for each patient, including their size, age, and the nature of the inhibitor or antagonist (for example, whether it is an expression construct, an oligoribonucleotide analog). antagomiR or antimiR type). Therefore, dosages can be easily determined by those of ordinary skill in the art from this description and knowledge in the art. It may be necessary or desirable to administer multiple doses to the subject during a particular treatment period, administering doses daily, weekly, monthly, every two months, every three months or every six months. In certain embodiments, the subject receives an initial dose at first that is greater than one or more subsequent or maintenance doses.

Given the stability of antagomiRs, it is possible to consider their administration to humans directly, for example subcutaneously or systemically, preferably intravenously, for example dissolved or suspended in a pharmaceutically acceptable vehicle, such as water or some aqueous solution such as , for example, saline or phosphate buffer.

Each embodiment described herein is contemplated as applicable to each of the other embodiments described. Therefore, all combinations of the various elements described herein are within the scope of the invention.

LIST OF SEQUENCES

Sequence of human microRNA miR-100-5p: SEQ ID NO: 1:

AACCCGUAGAUCCGAACUUGUG

Seed sequence of the human microRNA miR-100-5p: SEQ ID NO: 2: CCCGUAG Sequence of the antagonist hsa-miR-100: SEQ ID NO: 3:

CACAAGTTCGGATCTACGGGTT

Sequence of hsa-miR-20a-5p antagonist: SEQ ID NO: 4:

CTACCTGCACTATAAGCACTTTA

Sequence of the antagonist hsa-miR-181c-5p: SEQ ID NO: 5:

ACTCACCGACAGGTTGAATGTT

Sequence of the antagonist hsa-miR-222-3p: SEQ ID NO: 6:

ACCCAGTAGCCAGATGTAGCT

Sequence of the hsa-miR-92a-3p antagonist: SEQ ID NO: 7:

ACAGGCCGGGACAAGTGCAATA

Sequence of the hsa-miR-100-5p antagonist with modifications: SEQ ID NO 8:

C*A*CAAGTTCGGATCTACGG*G*T*T*

Sequence of the antagonist hsa-miR-20a-5p with modifications: SEQ ID NO 9:

C*T*ACCTGCACTATAAGCACT*T*T*A*

Sequence of the antagonist hsa-miR-181c-5p with modifications: SEQ ID NO 10:

A*C*TCACCGACAGGTTGAAT*G*T*T*

Sequence of the antagonist hsa-miR-222-3p with modifications: SEQ ID NO 11:

A*C*CCAGTAGCCAGATGTA*G*C*T*

Sequence of the antagonist hsa-miR-92a-3p with modifications: SEQ ID NO 12:

A*C*AGGCCGGGACAAGTGCA*A*T*A*

where:

- an asterisk (*) indicates the presence of a phosphorothioate bond,

- A, C, T, G in bold indicates that that nucleotide is modified with 2'- OMe, and - optionally, a fatty acid is conjugated at the 3' and/or 5' end of the molecule.

Sequence of the antagonist hsa-miR-100-5p with modifications: SEQ ID NO 13:

C*A*CAAGTTCGGATCTACGG*G*T*T*-Chol

Sequence of the antagonist hsa-miR-20a-5p with modifications: SEQ ID NO: 22:

C*T*ACCTGCACTATAAGCACT*T*T*A* -Chol

Sequence of the antagonist hsa-miR-181c-5p with modifications: SEQ ID NO: 23: A*C*TCACCGACAGGTTGAAT*G*T*T* -Chol

Sequence of the antagonist hsa-miR-222-3p with modifications: SEQ ID NO: 24:

A*C*CCAGTAGCCAGATGTA*G*C*T* -Chol

Sequence of the hsa-miR-92a-3p antagonist with modifications: SEQ ID NO: 25:

A*C*AGGCCGGGACAAGTGCA*A*T*A* -Chol

where:

- an asterisk (*) indicates the presence of a phosphorothioate bond,

- A, C, T, G in bold indicates that that nucleotide is modified with 2'- OMe, and - - Chol indicates that the oligonucleotide is conjugated to cholesterol.

Sequence of human microRNA miR-20a-5p: SEQ ID NO: 14:

UAAAGUGCUUAUAGUGCAGGUAG

Sequence of human microRNA miR-222-3p: SEQ ID NO: 15:

AGCUACAUCUGGCUACUGGGU

Sequence of human microRNA miR-181c-5p: SEQ ID NO: 16:

AACAUUCAACCUGUCGGUGAGU

Sequence of human microRNA miR-92a-3p: SEQ ID NO: 17:

UAUUGCACUUGUCCCGGCCUGU

Seed sequence of the human microRNA miR-20a-5p SEQ ID NO: 18: AAGUGCU Seed sequence of the human microRNA miR-222-3p: SEQ ID NO: 19: CUACAUC Seed sequence of the human microRNA miR-181c-5p: SEQ ID NO: 20: CAUUCAA Seed sequence of the human microRNA miR-92a-3p: SEQ ID NO: 21: UUGCACU The invention will now be illustrated in more detail with the help of the Examples and Figures shown below.

EXAMPLES EXAMPLE 1: Screening based on libraries of mimetic microRNAs (SureFIND Transcriptome PCR Array, Quiagen).

This is a method for identifying regulators of gene expression.

In this study, the "Cancer miRNA SureFind Transcriptome PCR Array" kit was used to identify possible regulatory miRNAs of MBNL1 and 2. These arrays include cDNA from HeLa cells treated with mimetics of defined miRNAs, in 96-well plate format (90 different microRNAs and 6 controls) in which the target mRNAs of the miRNAs are expected to be detected significantly reduced or increased by real-time PCR. The multiplex qPCR assay was carried out by using commercial Taqman probes (QuantiFast Probe PCR Kits, Qiagen) to quantify the expression of MBNL1 and 2 (genes of interest, labeled with FAM) and GADPH (as reference endogenous expression, labeled with MAX). The changes in the expression of MBNL1 and 2 as a result of treatment with each specific microRNA mimetic were calculated with respect to the negative control mimetic (a microRNA that does not exist in nature) and normalized with respect to GADPH. The observed changes were represented in log2 form and subjected to AACt (MAD) statistical analysis for the selection of positive candidate miRNAs (Figure 1).

Bioinformatics predictions binding to the 3UTR

Starting from those microRNAs that had repressive activity on MBNL1 and MBNL2 at the messenger level, we looked for possible direct binding targets of these microRNAs to the 3'UTR of MBNL1 and MBNL2. To do this, we have used 2 databases, mirDIP and miRecords, which collect information from a total of 9 prediction programs, including TargetScan and miRanda, providing information on the existence of the targets of a specific microRNA in the transcripts. of a given gene suggesting direct regulation.

DM1 fibroblasts were cultured in Dulbecco's Modified Eagle Medium-high glucose (DMEM 4500 mg/l, Gibco) supplemented with 1% penicillin/streptomycin and 10% inactivated fetal bovine serum in cell culture bottles. Given their adherent growth, to pass them, they were washed with PBS and trypsinized for 2 min at 37°C, then fresh medium was added to inhibit the action of trypsin.

Cells for this assay were seeded at a density of 105 cells/ml in 96-well plates (10,000 cells per well). The plate was seeded following the following template, in the case of column 1 (blank), no cells were seeded, since this column is the target of the colorimetry analysis, the rest of the plate was seeded with DM1 fibroblasts, which were subsequently seeded. treated as described below. About 16 hours after seeding the cells and with them at 80% confluency, the transfection was carried out with the commercial antagomiRs provided by Biomers (antagomiR-miR-100-5p (SEQ ID NO: 3): CACAAGTTCGGATCTACGGGTT, antagomiR-20a-5p (SEQ ID NO: 4): CTACCTGCACTATAAGCACTTTA, antagomiR-181c-5p (SEQ ID NO: 5): ACTCACCGACAGGTTGAATGTT, antagomiR-222-3p (SEQ ID NO: 6): ACCCAGTAGCCAGATGTAGCT and antagomiR-miR-92a -3p (SEQ ID NO: 7): ACAGGCCGGGACAAGTGCAATA) using X-tremeGENE HP reagent (Roche) according to the manufacturer's instructions.

Table 1. Representation of the 96-well plate used.

All antagomiRs were transfected into patient fibroblasts (Arandel et al 2017), using increasing amounts of these: 10 nM, 50 nM, 200 nM, and 1000 nM and 5000 nM (C1, C2, C3, C4 and C5, respectively) , and as a control only transfection reagent was used but not antagomiR, the transfection medium was left together with the cells for 4 hours and after this time it was changed to transdifferentiation medium. To transdifferentiate fibroblasts into myoblasts, the expression of MyoD was induced. To do this, the complete medium was replaced with muscle differentiation medium (MDM), which consisted of DMEM supplemented with 1% P/S, 2% horse serum (Gibco), 0.1 mg/ml apotransferrin, 0.01 mg/ml insulin, and 0.02 mg/ml doxycycline (Sigma) for 60 h.

After 72 hours, the transdifferentiation medium was replaced with 100 µl of fresh medium in all wells of the plate including column 1, and 20 µl of the MTS/PMS solution (CellTiter 96® Aqueous Non-Radioactive Kit) was added. Cell Proliferation Assay) to each well and incubated for 2 hours at 37 °C. After the incubation time, the colorimetric assay was read in the Infinite 200 PRO Microplate Reader, Tecan, following the manufacturer's instructions. The data obtained with the reader were processed and analyzed in order to obtain the TC50 that allows us to know what amount of antagomiR we should work with so that it is not toxic in the cellular model (Figure 2).

Activity assay of antagomiR on the MBNL1 protein (EC50)

Fibroblasts from DM1 patients and healthy controls were cultured in Dulbecco's Modified Eagle Medium-high glucose (DMEM 4500 mg/l, Gibco) supplemented with 1% P/S and 10% inactivated fetal bovine serum in cell culture bottles. The cells were seeded in 6-well plates, at a density of 100,000 cells/well, placing 2.5 ml of cells in each well. After about 16 hours after seeding the cells and with them at 80% confluency, they were seeded. proceeded to transfect these with the commercial antagomiRs provided by Biomers (antagomiR-miR-100-5p (SEQ ID NO: 3): CACAAGTTCGGATCTACGGGTT, antagomiR-20a-5p (SEQ ID NO: 4): CTACCTGCACTATAAGCACTTTA, antagomiR-181c- 5p (SEQ ID NO: 11): CTCACCGACAGGTTGAATGTT, antagomiR-222-3p (SEQ ID NO: 6): ACCCAGTAGCCAGATGTAGCT and antagomiR-miR-92a-3p (SEQ ID NO: 7): ACAGGCCGGGACAAGTGCAATA), using X-tremeGENE HP reagent (Roche).

The antagomiRs were transfected into patient fibroblasts, using increasing amounts 10 nM, 50 nM, 200 nM, 1000 nM and 5000 nM. As a control, only transfection reagent was placed but not antagomiR in both healthy and DM1 cells. Subsequently, the transfection medium was left together with the cells for 4 hours and after this time it was changed to transdifferentiation medium (DMEM supplemented with 1 % P/S, 2% horse serum (Gibco), 0.1 mg/ml apotransferrin, 0.01 mg/ml insulin and 0.02 mg/ml doxycycline (Sigma)). Fibroblasts were transdifferentiated into myoblasts for 72 hours.

After 72 h, the total protein used for QDB assays was extracted using RIPA buffer (Thermo Scientific), plus protease and phosphatase inhibitors (Roche Applied Science). The samples were quantified using the BCA protein assay kit (Pierce) using bovine serum albumin as a standard. Samples were prepared at a concentration of 1 ^g/well along with 4x loading buffer (0.8 ml 3 M Tris-HCl pH 6.8, 4 ml glycerol, 0.8 g SDS, 0.04 g Bromophenol blue, 4 ml p-mercaptoethanol, ddH ² O up to 10 ml). Samples were denatured by boiling at 100°C for 5 minutes and loaded onto QDB plates (Quanticision Diagnostics Inc). Each sample was loaded in quadruplicate on two different plates (5 ^l/well), one to detect MBNL1 and the other to detect GAPDH, used as an endogenous control, following the protocol described in Moreno-Cervera et al., 2022. After this, They were allowed to dry and incubated with transfer buffer (14.4 g glycine, 3 g Tris base, 700 ml ddH ² O, 200 ml methanol, ddH ² O up to 1 l) with shaking for 1 minute. Subsequently, three washes were performed with 1x TBS-T (100 ml 10x TBS, 5 ml Tween 20, ddH ² O up to 1 l) and incubated for one hour with blocking buffer (5 g skimmed milk powder, 1x TBS-T up to 100 ml). The plates were incubated at 4°C overnight with the primary antibodies anti-MBNL1 (1:1000, ab77017, Abcam) and anti-GAPDH (1:500, clone G-9, Santa Cruz). All primary antibodies were detected using HRP ( Horseradish peroxidase )-conjugated anti-Mouse IgG secondary antibody at a concentration of 1:5000 (Sigma-Aldrich). Immunoreactivity was detected using Pierce ECL Western Blotting Substrate reagent (Thermo Scientific) and chemiluminescence levels were determined with the Inifinite M200 Pro plate reader (Tecan).

Expression of candidate miRNAs in relevant tissues

The expression levels of miR-100-5p, miR-20a-5p, miR-181c-5p miR-222-3p and miR-92a-3p in transcripts per million (TPM), originating in the different tissues of interest (trachea , thyroid, testicles, stomach, spleen, different types of muscle cells, skeletal muscle, liver, kidney, heart, bladder, esophagus, diaphragm, colon, cervix, brain and blood) were obtained through the use of the ZEMBU database, which is created using data from the FANTOM5 project. Fantom houses a large number of samples from more than 100 different types of tissue, which is why those that could be of interest for the disease have been filtered.

Table 2. Therapeutic index of the different oligonucleotides used in DM1 cells . Parameters TC50, EC50, Emax and therapeutic index obtained for each of the antagonists tested in DM1 cells.

Expression of candidate miRNAs in disease model cells

The relative expression levels of the microRNAs miR-23b, miR-218, miR-92a, mirR-100, miR-181c, miR-222, miR-20a, miR-17 and miR-let17a were measured by RT-qPCR both in control cells and in DM1 model cells at 4 days of differentiation. The levels of miR-1 were also measured as a positive control, since it has been described (Rau et al., 2011) that it is decreased in DM1 cells. All levels were obtained using U1, U6 and miR-103b as normalizers.

Table 3. Compilation of data obtained on the different study miRNAs . The different parameters of interest analyzed in the study are shown: confirmation of the decrease in MBNL1 and 2 in the screening of overexpression of the miRNAs under study; number of programs predicting the binding of miRNAs to MBNL1 and 2 and confirmation by TarBase v7.0; validation of the decrease in MBNL1 and 2 by qPCR when the miRNAs of interest are overexpressed; confirmation of the expression of miRNAs in tissues of interest for DM1 (muscle); and confirmation of the overexpression of miRNAs in DM1 myotubes model of the disease.

As can be seen in Table 2, the antagomiR-100 showed the best Tindex values with respect to the rest of the antagomiRs, which demonstrates that this antagomiR presents the better balance between toxicity, Emax and EC50. However, it is also worth noting that antagomiR-20b has good EC50 and Emax values, antagomiR-181c has good Emax value; antagomiR-92a has good TC50 and Emax value comparable to antagomiR-23b. Note that low EC50 values indicate greater antagonistic potency of the miRNA in question, while higher TC50 indicates less toxicity on the cellular model of the disease.

Furthermore, protein expression levels were studied in the cellular model of the disease (Fig. 3) finding, first of all, that DM1 muscle cells express significantly less MBNL1 protein than the control. Taking as reference the expression detected in DM1 cells, it was found that in all cases an increase in the total levels of the protein occurs, although some antagomiRs are active at lower concentrations than others and the activation levels may be different. For example, for antagomiR-20a or -100, at 10 nM (the lowest concentration tested) the recovery in MBNL1 expression reaches normal levels, while other antagomiRs are capable of doubling expression in DM1 cells (antagomiR-92a and -100). 222). This indicates that some antagomiR are more effective than others, such as antagomiR-181c, whose activation of MBNL1 expression is discrete, and requires a higher concentration to achieve levels similar to those of the rest of the molecules.

Figure 4 shows the evaluation of the activity and toxicity of the different antagomiRs in DM1 cells after transfection with them at the different indicated concentrations. The different graphs visually show the given Tindex metric of those antagomiR in which the EC and TC curve are furthest apart are those that show the greatest difference between the concentrations at which they are active and those at which they show toxic effects (therapeutic window ). For example, antagomiR-100 shows activity at low concentrations and quickly reaches the maximum possible activity while only at concentrations almost two orders of magnitude higher they present a halving in the viability of DM1 muscle cells. This behavior is similar to that of antagomiR-23b and 218, which are shown in comparison. In contrast, antagomiR-222 can markedly increase MBNL1 expression, but does so at concentrations at which the toxicity curve is already above 50% dead cells. The rest of antagomiRs show an intermediate behavior, AntagomiR-20a also shows an interesting behavior because at the lowest concentration tested it already reaches the maximum activity in terms of activation of MBNL1, its TC50 being at least an order of magnitude higher. In antagomiR-181c the difference between activity and toxicity is low. Taking both curves together, observes that antagomiR-100 presents a similar pattern to the previously patented antagomiRs, -23b and -218, since its activity levels are very high from the second dose tested, but its toxicity level exceeds the TC50 only at high doses, That is, it has a broader therapeutic window and therefore more suitable for its pharmacological development.

Next, determinations were made of the expression of the microRNAs of interest in different human tissues (Figure 5). As can be seen, the microRNA miR-100 is expressed almost exclusively in skeletal muscle and its satellite cells, with only some expression in fibroblasts, which is of particular interest because skeletal muscle is a tissue highly affected in DM1. so that the antagonistic effect of antimiR-100 is anticipated to be specific, avoiding eventual undesirable consequences due to repression of this miRNA in tissues not altered in the disease. For example, since antimiRs accumulate in the liver and kidney, the fact that the target of antimiR-100 is not expressed in these organs will prevent a situation of lack of function of this miRNA in these organs, which which is desirable from a therapeutic point of view. On the other hand, the expression of miR-100 in satellite cells is also of great interest because these are the muscle stem cells from which muscle regeneration can be promoted. In fact, it has been shown (Song KY, et al. MBNL1 reverses the proliferation defect of skeletal muscle satellite cells in myotonic dystrophy type 1 by inhibiting autophagy via the mTOR pathway. Cell Death Dis. 2020 Jul 18;11(7):545 doi: 10.1038/s41419-020-02756-8. PMID: 32683410; PMCID: PMC7368861.) that an increase in MBNL1 in these cells reverses the proliferative defects that these cells have in DM1, so acting at the level of satellite cells Through a specific target, potential therapeutic potential in vivo is anticipated. Finally, detecting miR-100 in mature skeletal muscle confirms the relevance of the observations made in vitro with cellular models of the disease, which may differ markedly from the in vivo expression pattern in adult humans.

Finally, an assay was carried out to quantify the possible differences in expression of the different target miRNAs in cellular models of the disease compared to their healthy controls. The results in Figure 6 show that the majority of the selected miRNAs are detected overexpressed in an in vitro model of the disease, this characteristic being desirable in a therapeutic target because it reduces the risk of deleterious effects due to lack of function of the target. That is, the preferable therapeutic objective is not only to reduce the expression of a miRNA below its normal values but to bring it to levels similar to those of healthy controls, thus preserving its functions. natural endogenous. As a control, note that miR-218, previously described as overexpressed in DM1 (see Cerro-Herreros E et al. Preclinical characterization of antagomiR-218 as a potential treatment for myotonic dystrophy. Mol Ther Nucleic Acids.

2021 Jul 29;26:174-191. doi: 10.1016/j.omtn.2021.07.017. PMID: 34513303; PMCID: PMC8413838), is detected increased in this cell model, as well as miR-23b, while miR-17 and others do not significantly change their expression and serve as a control that it is not a general effect on all miRNAs analyzed.

Claims (15)

1. Antagonist of the human microRNA miR-100 capable of increasing the intracellular levels of MBNL1 and/or MBNL2 proteins. 2. Antagonist of the human microRNA miR-100 according to claim 1, wherein the intracellular levels of the MBNL1 and/or MBNL2 proteins are increased in a muscle cell, preferably in a muscle cell that presents a muscular dystrophy phenotype, preferably myotonic dystrophy of Type 1. 3. Antagonist of the human microRNA miR-100 according to any of claims 1 or 2, wherein said antagonist is an oligonucleotide molecule and/or an oligonucleotide analogue. 4. Antagonist of the human microRNA miR-100 according to any of claims 1 to 3, wherein said antagonist is an antimiR, a blockmiR, or a microRNA sponge. 5. Antagonist of the human microRNA miR-100 according to any of claims 1 to 4, wherein said antagonist comprises a region that is at least 85% identical to the complementary sequence of SEQ ID NO: 1. 6. Antagonist of the human microRNA miR-100 according to any of claims 1 to 5, wherein said antagonist comprises a region of at least 7 contiguous units of nucleotides or nucleotide analogues that is 100% identical to the sequence complementary to the seed region of the human microRNA miR-100 as defined in SEQ ID NO: 2. 7. Antagonist of the human microRNA miR-100 according to any of claims 1 to 6, wherein said antagonist comprises a first region of at least 7 contiguous units of nucleotides or nucleotide analogues that is 100% identical to the sequence complementary to the seed region of the human microRNA miR-100 as defined in SEQ ID NO: 2, and where said antagonist also comprises a second region of at least 7 contiguous units of nucleotides or nucleotide analogues adjacent to the first region, where said second region is at least 90% identical to the sequence complementary to any region present in SEQ ID NO: 1. 8. Antagonist of the human microRNA miR-100 according to any of claims 1 to 9, wherein said antagonist comprises a region of nucleotides or nucleotide analogues that is at least 90% identical to SEQ ID NO: 3. 9. Antagonist of the human microRNA miR-100 according to any of claims 1 to 8, where: i) said antagonist comprises a region that is at least 95% identical to SEQ ID NO: 3, ii) at least one of the nucleotide units or nucleotide analogue units that make up said antagonist is a nucleotide analogue that presents one or more chemical modifications in the ribose residue, in the phosphate bond, or in both, and iii) optionally, said antagonist has at the 5' end and/or at the 3' end one or more additional molecules, preferably cholesterol. 10. Antagonist of the human microRNA miR-100 according to any of claims 1 to 9, wherein said antagonist comprises a region of nucleotides or nucleotide analogues that is at least 95% identical to any of the sequences SEQ ID NO: 8 or 13. 11. Antagonist of the human microRNA miR-100 according to any of claims 9 or 10, wherein said antagonist consists of SEQ ID NO: 8 or SEQ ID NO: 13. 12. Composition comprising at least one antagonist of the human microRNA miR-100 as defined in any of claims 1 to 11. 13. Composition according to claim 12, wherein said composition is a pharmaceutical composition that additionally comprises a vehicle and/or one or more pharmaceutically acceptable excipients. 14. Antagonist according to any of claims 1 to 11, or composition according to any of claims 12 or 13, for use as a medicament. 15. Antagonist according to any of claims 1 to 11, or composition according to any of claims 12 or 13, for use in the treatment of myotonic dystrophy, preferably myotonic dystrophy type 1.