EA043761B1 - MODIFIED OLIGONUCLEOTIDES FOR THE TREATMENT OF POLYCYSTIC KIDNEY DISEASE - Google Patents

Description

Cross reference to related applications

This application claims priority to US Provisional Application No. 62/430139, filed December 5

2016, which is incorporated herein by reference in its entirety for all purposes.

Field of technology

Presented herein are compositions and methods for treating polycystic kidney disease.

State of the art

Polycystic kidney disease is characterized by the accumulation of numerous fluid-filled cysts in the kidney. These cysts are lined by a single layer of epithelial cells called the cyst epithelium. Over time, the size of the cysts increases due to increased cell proliferation and active secretion of fluid by the cyst epithelium. Enlarged cysts compress surrounding normal tissue, leading to deterioration of kidney function. The disease eventually progresses to end-stage renal failure requiring dialysis or a kidney transplant. At this stage, cysts may be surrounded by areas of fibrosis containing atrophied tubules.

A number of genetic disorders can lead to polycystic kidney disease (PKD). The different forms of PPD vary in their mode of inheritance, such as autosomal dominant or autosomal recessive inheritance;

organ involvement and manifestation of phenotypes outside the kidney;

age of onset of end-stage renal disease, such as at birth, childhood, or adulthood; and the underlying genetic mutation that is associated with the disease.

See, for example, Kurschat et al., 2014, Nature Reviews Nephrology, 10:687–699.

Brief description of the invention

Embodiment 1. A compound containing a modified oligonucleotide consisting of 9 linked nucleosides, wherein the modified oligonucleotide has the following nucleoside structure in a 5' to 3' orientation:

wherein nucleosides followed by a subscript M are 2'-O-methylnucleosides, nucleosides followed by a subscript F are 2'-fluoronucleosides, nucleosides followed by a subscript S are S-cEt nucleosides, and all the bonds are thiophosphate bonds, and wherein the nucleobase sequence of the modified oligonucleotide contains the nucleobase sequence 5'-CACUUU-3', each cytosine independently selected from unmethylated cytosine and 5-methylcytosine, or a pharmaceutically acceptable salt thereof.

Embodiment 2. The compound of Embodiment 1, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence 5'-GCACUUU-3', each cytosine independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 3. The compound of Embodiment 1, wherein the nucleobase sequence of the modified oligonucleotide is 5'-AGCACUUUG-3', each cytosine independently selected from unmethylated cytosine and 5-methylcytosine.

Embodiment 4. The compound of any one of Embodiments 1, 2 or 3, wherein each cytosine is an unmethylated cytosine.

Embodiment 5. The compound of any one of embodiments 1-4, wherein the compound consists of a modified oligonucleotide or a pharmaceutically acceptable salt thereof.

Embodiment 6. The compound of any one of Embodiments 1 to 5, wherein the pharmaceutically acceptable salt is a sodium salt.

- 1 043761

Embodiment 7. Modified oligonucleotide having the structure

or a pharmaceutically acceptable salt thereof.

Embodiment 8. The modified oligonucleotide of Embodiment 7, which is a pharmaceutically acceptable salt of the above structure.

Embodiment 9. The modified oligonucleotide of Embodiment 7, which is a sodium salt of the specified structure.

- 2 043761

Embodiment 10. Modified oligonucleotide having the structure

Embodiment 11. A pharmaceutical composition comprising the compound of any one of Embodiments 1 to 6 or the modified oligonucleotide of any of Embodiments 7 to 10 and a pharmaceutically acceptable diluent.

Embodiment 12: The pharmaceutical composition of Embodiment 11, wherein the pharmaceutically acceptable diluent is an aqueous solution.

Embodiment 13: The pharmaceutical composition of Embodiment 12, wherein the aqueous solution is a saline solution.

Embodiment 14. A pharmaceutical composition comprising the compound of any one of Embodiments 1 to 6 or the modified oligonucleotide of any of Embodiments 7 to 10, which is a lyophilized composition.

Embodiment 15. A pharmaceutical composition consisting essentially of the compound of any one of embodiments 1-6 or the modified oligonucleotide of any of embodiments 7-10 in saline solution.

Embodiment 16. A method of inhibiting the activity of one or more miR-17 family members in a cell, comprising contacting the cell with a compound of any of Embodiments 1-6 or a modified oligonucleotide of any of Embodiments 7-10.

Embodiment 17. A method of inhibiting the activity of one or more miR-17 family members in a subject, comprising administering to the subject a pharmaceutical composition according to any one of embodiments 11-15.

Embodiment 18. The method of Embodiment 17, wherein the subject has a miR-17 related disease.

Brief description of graphic materials

In fig. Figure 1A shows the activity of RG4326 in the miR-17 luciferase assay.

In fig. 1B - RG4326 activity in luciferase assays of miR-17 family members.

In fig. Figure 2 shows the value of a characteristic set of PD parameters in IMCD3 cells after treatment with RG4326 or the control RG5124.

In fig. 3A, 3B show miPSA (microRNA polysome shift assay) demonstrating miR-17 target interaction in (A) kidneys of wild-type mice and (B) kidneys of treated mice

- 3 043761

RG4326.

Fig. 4A-4C show the effectiveness of RG4326 in the Pkd2-KO PBP model. Effect of treatment on (A) kidney weight-to-body weight ratio, (B) blood urea nitrogen (BUN), and (C) cystic index.

Fig. 5A-5C show the performance of the RG4326 in the Pcy PBP model. Effect of treatment on (A) kidney weight-to-body weight ratio, (B) blood urea nitrogen (BUN), and (C) cystic index.

Detailed description of the invention

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention relates. Unless specific definitions are given, the nomenclature used in connection with the analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry procedures and methods described herein is well known and widely used in the art. To the extent that multiple definitions exist in this document, those set forth in this section shall prevail. Standard methods can be used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery, and processing of subjects. Some such methods and procedures can be found, for example, in Carbohydrate Modifications in Antisense Research, Edited by Sanghvi and Cook, American Chemical Society, Washington D.C., 1994; and Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 18th edition, 1990, which are incorporated herein by reference for all purposes. To the extent applicable, all patents, patent applications, published applications and publications, GENBANK sequences, websites and other published materials referred to in the specification of this document, unless otherwise indicated, are incorporated by reference in their entirety. If reference is made to a URL or other such identifier or address, you should understand that such identifiers may change and specific information on the Internet may change, but equivalent information may be found by using an Internet search function. A link to them indicates the availability and open dissemination of such information.

Before these compositions and methods are disclosed and described, it should be understood that the terminology used herein is provided solely for the purpose of describing specific embodiments of the invention and is not intended to be limiting. It should be noted that, in the context of the description of this invention and the accompanying claims, singular nouns include plural nouns unless the context clearly indicates otherwise.

Definitions.

Polycystic kidney disease or PKD is a cystic kidney disease characterized by the accumulation of numerous fluid-filled cysts in the kidney. Multiple cysts form in at least one kidney, often leading to enlargement of the affected kidney(s) and progressive loss of kidney function.

Polycystic kidney disease marker means a medical parameter that is used to assess the severity of polycystic kidney disease, kidney function and/or the response of a subject suffering from polycystic kidney disease to treatment. Non-limiting examples of markers of polycystic kidney disease include total kidney volume, hypertension, glomerular filtration rate, and kidney pain.

Kidney function marker means a medical parameter that is used to evaluate the kidney function of a subject. Non-limiting examples of markers of kidney function include glomerular filtration rate, blood urea nitrogen level, and serum creatinine level.

Autosomal dominant polycystic kidney disease, or ADPKD, is polycystic kidney disease caused by one or more mutations in the PKD1 and/or PKD2 gene. 85% of ADPKD is caused by mutations in PKD1, which is located on chromosome 16, and most of the remaining cases of ADPKD are caused by mutations in PKD2, which is located on chromosome 4.

Autosomal recessive polycystic kidney disease, or ARPKD, is polycystic kidney disease caused by one or more genetic mutations in the PKHD1 gene, which is located on chromosome 6. Up to 50% of newborns with ARPKD die from complications of intrauterine kidney disease, and about a third of survivors develop end-stage kidney disease. stage renal failure (ESRD) for 10 years.

Nephronophthisis or NF refers to an autosomal recessive cystic kidney disease that is characterized by corticomedullary cysts, rupture of the tubular basement membrane, and tubulointerstitial nephropathy.

Total kidney volume or TVR is a measurement of the total volume of the kidneys, which can be determined by magnetic resonance imaging (MRI), computed tomography (CT), or ultrasound (US) imaging, as well as volume calculated using a standard technique such as the ellipsoid volume formula (for ultrasound) or using quantitative stereology or edge tracing (for CT/MRI).

Height-adjusted total kidney volume, or HtTKV-Height-adjusted total kidney volume, is a measure of total kidney volume per unit of height. In patients with a TPR value >600 ml/m, the development of stage 3 chronic renal failure is predicted within 8 years.

Kidney pain refers to clinically significant kidney pain requiring sick leave, pharmacological treatment (narcotics or painkillers of last resort) or invasive intervention.

Progression of hypertension means a change in blood pressure that requires initiation or intensification of hypertension treatment.

Fibrosis means the formation or development of excess fibrous connective tissue in organs or tissues. In certain embodiments of the invention, fibrosis occurs as a restorative or reactive process. In certain embodiments of the invention, fibrosis occurs in response to damage or injury. The term fibrosis should be understood as the formation or development of excess fibrous connective tissue in an organ or tissue as a regenerative or reactive process, as opposed to the formation of fibrous tissue as a normal component of the organ or tissue.

Hematuria means the presence of red blood cells in the urine.

Albuminuria refers to the presence of excess albumin in the urine and includes, but is not limited to, normal albuminuria, high/normal albuminuria, microalbuminuria, and macroalbuminuria. Typically, the glomerular filtration barrier, which consists of podocytes, glomerular basement membrane, and endothelial cells, prevents the leakage of serum protein into the urine. Albuminuria may reflect damage to the glomerular filtration permeability barrier. Albuminuria can be calculated from a 24-hour urine sample, an overnight urine sample, or a spot urine sample.

High/normal albuminuria means increased albuminuria characterized by (i) excretion of 15 to <30 mg of albumin in urine per 24 hours; and/or (ii) an albumin/creatinine ratio of 1.25 to <2.5 mg/mmol (or 10 to <20 mg/g) in men or 1.75 to <3.5 mg/mmol (or from 15 to <30 mg/g) in women.

Microalbuminuria means increased albuminuria, characterized by (i) excretion of 30 to 300 mg of albumin in urine per 24 hours; and/or (ii) an albumin/creatinine ratio of 2.5 to <25 mg/mmol (or 20 to <200 mg/g) in men or 3.5 to <35 mg/mmol (or 30 to < 300 mg/g) in women.

Macroalbuminuria means increased albuminuria, characterized by (i) excretion of more than 300 mg of albumin in urine in 24 hours; and/or (ii) albumin/creatinine ratio >25 mg/mmol (or >200 mg/g) in men or >35 mg/mmol (or >300 mg/g) in women.

Albumin/creatinine ratio refers to the ratio of urine albumin (mg/dL) to urine creatinine (g/dL) and is expressed in mg/g. In certain embodiments of the invention, the albumin/creatinine ratio can be calculated from a spot urine sample and can be used as an estimate of albumin excretion over a 24-hour period.

Glomerular filtration rate or GFR refers to the rate at which filtered fluid flows through the kidney and is used as a measure of a subject's kidney function. In certain embodiments, a subject's GFR is determined by calculating the estimated glomerular filtration rate. In certain embodiments, the GFR of a subject is measured directly from the subject using an inulin method.

Estimated glomerular filtration rate, or eGFR, is a measurement of how well the kidneys filter creatinine and is used to roughly estimate glomerular filtration rate. Because direct measurement of GFR is difficult, eGFR is often used in clinical practice. Normal results may range from 90 to 120 ml/min/1.73 ^m2 . Levels below 60 ml/min/1.73 ^m2 for 3 months or more may indicate chronic kidney disease. Levels below 15 ml/min/1.73 ^m2 may indicate renal failure.

Proteinuria means the presence of excess whey proteins in the urine. Proteinuria may be characterized by the excretion of >250 mg of protein in the urine in 24 hours and/or the ratio of protein to creatinine in the urine >0.20 mg/mg. Serum proteins that are elevated due to proteinuria include, but are not limited to, albumin.

Blood urea nitrogen level or BUN level is a measure of the amount of nitrogen in the blood in the form of urea. The liver produces urea in the urea cycle as a waste product from protein digestion, and the urea is excreted from the blood by the kidneys. Normal adult blood may contain 7 to 21 mg of urea nitrogen per 100 ml (7 to 21 mg/dL) of blood. Measuring blood urea nitrogen levels is used as an indicator of kidney health. If the kidneys are unable to properly remove urea from the blood, the subject's BUN levels will increase.

Increased means an increase in a medical indicator that is considered clinically significant. A healthcare professional can determine whether the increase is clinically significant.

End-stage renal disease (ESRD) means complete or near complete loss of kidney function.

Quality of life refers to the degree to which a subject's physical, psychological and social functioning is impaired by a disease and/or treatment for a disease. Quality of life may be reduced in patients with polycystic kidney disease.

Impaired kidney function means a decrease in kidney function relative to normal kidney function.

Slow progression and slow progression mean a decrease in the rate at which a pathological condition progresses to a progressive state.

Delaying time to dialysis means maintaining sufficient kidney function, thereby delaying the need for dialysis treatment.

Delaying the timing of a kidney transplant means maintaining sufficient kidney function, thereby delaying the need for a kidney transplant.

Increasing life expectancy means increasing the life expectancy of a subject by treating one or more symptoms of a disease in the subject.

Subject means a human or non-human animal selected for treatment or therapy.

A subject in need means a subject who is identified as being in need of therapy or treatment.

A subject suspected of being present means a subject demonstrating one or more clinical indicators of disease.

miR-17-related disease means a disease or condition that is modulated by the activity of one or more members of the miR-17 family.

Administration means the provision of a pharmaceutical substance or composition to a subject and includes, but is not limited to, administration of the drug by a medical professional and self-administration.

Parenteral administration means administration by injection or infusion. Parenteral administration includes, but is not limited to, subcutaneous administration, intravenous administration, and intramuscular administration.

Subcutaneous administration means administration directly under the skin.

Intravenous administration means insertion into a vein.

Concomitant administration means the coadministration of two or more agents in any form in which the pharmacological effects of both occur in the patient at the same time.

With concomitant administration, it is not necessary that both substances be administered in the same pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both substances do not have to occur at the same time. The effects only need to overlap in time and do not need to be of the same duration.

Duration means the period of time during which an action or phenomenon continues. In certain embodiments of the invention, the duration of treatment is the period of time during which doses of the pharmaceutical substance or pharmaceutical composition are administered.

Therapy means a method of treating a disease. In certain embodiments of the invention, therapy includes, but is not limited to, administering one or more pharmaceutical substances to a subject having a disease.

To treat means the application of one or more specific procedures used to alleviate at least one indicator of the disease. In certain embodiments of the invention, the specific procedure is the administration of one or more pharmaceutical agents. In certain embodiments, treating PKD includes, but is not limited to, reducing total kidney volume, improving kidney function, reducing hypertension, and/or reducing kidney pain.

To alleviate means to reduce the severity of at least one indicator of a pathological condition or disease. In certain embodiments of the invention, relief includes delaying or slowing the development of one or more indicators of a pathological condition or disease. The severity of indicators can be determined by subjective or objective measures that are known to those skilled in the art.

At risk for development means a condition in which a subject is predisposed to developing a pathological condition or disease. In certain embodiments of the invention, a subject at risk of developing a condition or disease exhibits one or more symptoms of the condition or disease, but does not exhibit a sufficient number of symptoms to warrant a diagnosis of the condition or disease. In certain embodiments of the invention, a subject at risk of developing a pathological

- 6 043761 condition or disease, exhibits one or more symptoms of the pathological condition or disease, but to a lesser extent than required to make a diagnosis of the pathological condition or disease.

Preventing the occurrence means preventing the development of a pathological condition or disease in a subject who is at risk of developing a disease or pathological condition. In certain embodiments of the invention, a subject at risk of developing a disease or condition receives treatment similar to the treatment received by a subject who already has the disease or condition.

Delaying onset means delaying the development of a condition or disease in a subject who is at risk of developing the disease or condition. In certain embodiments of the invention, a subject at risk of developing a disease or condition receives treatment similar to the treatment received by a subject who already has the disease or condition.

Dose means a specific amount of a pharmaceutical substance provided in a single administration. In certain embodiments of the invention, the dose may be administered in the form of two or more boluses, tablets, or injections. For example, in certain embodiments of the invention in which subcutaneous administration is desired, the desired dose requires a volume that is not easily provided by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments of the invention, the dose may be administered in two or more injections to minimize injection site reaction in the individual. In certain embodiments of the invention, the dose is administered as a slow infusion.

Unit dosage refers to the form in which a pharmaceutical substance is provided. In certain embodiments of the invention, the unit dosage is a vial containing a lyophilized oligonucleotide. In certain embodiments of the invention, the unit dosage is a vial containing a resuspended oligonucleotide.

A therapeutically effective amount refers to the amount of a pharmaceutical substance that provides a therapeutic effect to the animal.

Pharmaceutical composition means a mixture of substances suitable for administration to an individual, which includes a pharmaceutical agent. For example, the pharmaceutical composition may contain a sterile aqueous solution.

Pharmaceutical agent means a substance that provides a therapeutic effect when administered to a subject.

Active pharmaceutical ingredient means the substance in a pharmaceutical composition that provides the desired effect.

Pharmaceutically acceptable salts mean physiologically and pharmaceutically acceptable salts of a compound provided herein, i.e., salts that retain the desired biological activity of the compound and do not have undesirable toxicological effects when administered to a subject.

Non-limiting exemplary pharmaceutically acceptable salts of the compounds provided herein include sodium and potassium salt forms. As used herein, the terms compound, oligonucleotide and modified oligonucleotide include pharmaceutically acceptable salts thereof unless specifically stated otherwise.

Saline means a solution of sodium chloride in water.

Improved organ function means a change in organ function within normal limits. In certain embodiments of the invention, organ function is assessed by measuring molecules found in the subject's blood or urine. For example, in certain embodiments of the invention, improvement in kidney function is measured by a decrease in blood urea nitrogen, a decrease in proteinuria, a decrease in albuminuria, etc.

An acceptable safety profile means a range of side effects that are within clinically acceptable limits.

A side effect means a physiological response due to treatment that is different from the desired effects. In certain embodiments, side effects include, but are not limited to, injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system disorders, and myopathies. Such side effects may be detected directly or indirectly. For example, elevated serum aminotransferase levels may indicate hepatotoxicity or liver dysfunction. For example, elevated bilirubin may indicate hepatotoxicity or liver dysfunction.

As used herein, the term blood includes whole blood and blood fractions such as serum and plasma.

- 7 043761

Anti-miR means an oligonucleotide having a nucleobase sequence complementary to the microRNA. In certain embodiments, the anti-miR is a modified oligonucleotide.

Anti-miR-17 means a modified oligonucleotide having a nucleobase sequence complementary to one or more members of the miR-17 family. In certain embodiments, anti-miR-17 is fully complementary (ie, 100% complementary) to one or more members of the miR-17 family. In certain embodiments, anti-miR-17 is at least 80%, at least 85%, at least 90%, or at least 95% complementary to one or more miR-17 family members.

miR-17 means a mature microRNA having the nucleobase sequence 5'-CAAAGUGCUUACAGUGCAGGUAG-3' (SEQ ID NO: 1).

miR-20a means a mature microRNA having the nucleobase sequence 5'-UAAAGUGCUUAUAGUGCAGGUAG-3' (SEQ ID NO: 2).

miR-20b means a mature microRNA having the nucleobase sequence 5'-CAAAGUGCUCAUAGUGCAGGUAG-3' (SEQ ID NO: 3).

miR-93 means a mature microRNA having the nucleobase sequence 5'-CAAAGUGCUGUUCGUGCAGGUAG-3' (SEQ ID NO: 4).

miR-106a means a mature microRNA having the nucleobase sequence 15'- AAAAGUGCUUACAGUGCAGGUAG-3' (SEQ ID NO: 5).

miR-106b means a mature microRNA having the nucleobase sequence 5'-UAAAGUGCUGACAGUGCAGAU-3' (SEQ ID NO: 6).

The core sequence of miR-17 refers to the nucleobase sequence 5' -AAAGUG-3, which is present in each of the miR-17 family members.

A member of the miR-17 family means a mature microRNA having a nucleobase sequence containing the core sequence of miR-17, and which is selected from miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR-106b.

The miR-17 family refers to the following group of microRNAs: miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR-106b, each of which has a nucleobase sequence including the core sequence of miR-17.

Target nucleic acid means the nucleic acid with which the oligomeric compound is intended to hybridize.

Targeting refers to the process of designing and selecting a nucleic acid sequence that will hybridize to a target nucleic acid.

Targeting means having a nucleotide sequence that will allow hybridization with the target nucleic acid.

Modulation means a change in function, quantity or activity. In certain embodiments, modulation means increasing/increasing a function, amount, or activity. In certain embodiments, modulation means decreasing/weakening a function, amount, or activity.

Expression refers to any functions and steps by which the encoded information of a gene is converted into structures present and functioning in the cell.

Nucleic base sequence means the order of contiguous nucleic bases in an oligomeric compound or nucleic acid, usually listed in a 5' to 3' orientation and independent of any sugar, bond and/or nucleobase modifications.

Contiguous nucleic bases mean nucleic bases immediately adjacent to each other in a nucleic acid.

Nucleic base complementarity means the ability of two nucleic bases to pair non-covalently through hydrogen bonding.

Complementary means that one nucleic acid is capable of hybridizing with another nucleic acid or oligonucleotide. In certain embodiments, complementary refers to an oligonucleotide capable of hybridizing to a target nucleic acid.

Fully complementary means that each nucleic base of the oligonucleotide is capable of pairing with a nucleic base at each corresponding position in the target nucleic acid. In certain embodiments, the oligonucleotide is fully complementary (also referred to as 100% complementary) to the microRNA, i.e. each nucleic base of the oligonucleotide is complementary to the nucleic base at the corresponding position in the microRNA. The modified oligonucleotide may be fully complementary to the microRNA and contain a number of linked nucleosides that is shorter than the length of the microRNA. For example, an oligonucleotide with 16 linked nucleosides, in which each nucleic acid base of the oligonucleotide is complementary to the nucleotide base at the corresponding position in

- 8 043761 microRNA, is completely complementary to microRNA. In certain embodiments, the oligonucleotide in which each nucleobase is complementary to a nucleic base in the miRNA hairpin sequence region is fully complementary to the miRNA hairpin sequence.

Percent complementarity refers to the percentage of nucleic bases in an oligonucleotide that are complementary to a region of equal length of the target nucleic acid. Percent complementarity is calculated by dividing the number of nucleic acid bases in the oligonucleotide that are complementary to the nucleic acid bases at corresponding positions in the target nucleic acid by the total number of nucleic acid bases in the oligonucleotide.

Percent identity means the number of nucleic bases in the first nucleic acid that are identical to nucleic bases at corresponding positions in the second nucleic acid, divided by the total number of nucleic bases in the first nucleic acid. In certain embodiments of the invention, the first nucleic acid is a microRNA and the second nucleic acid is a microRNA. In certain embodiments of the invention, the first nucleic acid is an oligonucleotide and the second nucleic acid is an oligonucleotide.

Hybridize means the annealing of complementary nucleic acids, which occurs due to the complementarity of nucleic bases.

Mispaired means a nucleic base of the first nucleic acid that is not capable of Watson-Crick pairing with a nucleic base at the corresponding position of the second nucleic acid.

Identical, in the context of nucleic acid sequences, means having an identical nucleic acid sequence, regardless of the sugar, linkage and/or modifications of the nucleic acid base and regardless of the methylation state of any pyrimidines present.

MicroRNA refers to an endogenous non-coding RNA between 18 and 25 nucleobases in length, which is the product of pre-microRNA cleavage by the Dicer enzyme. Examples of mature miRNAs are found in the miRNA database known as miRBase (microma.sanger.ac.uk/). In certain embodiments, microRNA is abbreviated as miR.

MicroRNA-regulated transcript means a transcript that is regulated by microRNA.

Core complementary sequence means a sequence of nucleic bases that is complementary to the core sequence and has the same length as the core sequence.

An oligomeric compound means a compound that contains a plurality of linked monomeric subunits. Oligomeric compounds include oligonucleotides.

Oligonucleotide means a compound containing a plurality of linked nucleosides, each of which may be modified or unmodified, independently of each other.

A naturally occurring internucleoside bond means a 3'-5' phosphodiester bond between nucleosides.

Natural sugar means sugar found in DNA (2'-H) or RNA (2'-OH).

Internucleoside bond means a covalent bond between adjacent nucleosides.

Linked nucleosides means nucleosides linked by a covalent bond.

Nucleic base means a heterocyclic moiety capable of non-covalent pairing with another nucleic base.

Nucleoside means a nucleic base linked to a sugar moiety.

Nucleotide means a nucleoside containing a phosphate group covalently linked to the sugar moiety of the nucleoside.

A compound containing a modified oligonucleotide consisting of a number of linked nucleosides means a compound that includes a modified oligonucleotide having a specified number of linked nucleosides. Thus, the compound may include additional substituents or conjugates. Unless otherwise indicated, the modified oligonucleotide does not hybridize to the complementary strand, and the compound does not include any additional nucleosides other than those of the modified oligonucleotide.

Modified oligonucleotide means a single-stranded oligonucleotide having one or more modifications related to a naturally occurring terminal moiety, sugar, nucleobase, and/or internucleoside linkage.

The modified oligonucleotide may contain unmodified nucleosides.

Modified nucleoside means a nucleoside having any change compared to a naturally occurring nucleoside. The modified nucleoside may contain a modified sugar and an unmodified nucleobase. The modified nucleoside may contain a modified sugar and a modified nucleic base. The modified nucleoside may contain a natural sugar and a modified nucleobase. IN

- 9043761 In certain embodiments of the invention, the modified nucleoside is a bicyclic nucleoside. In certain embodiments of the invention, the modified nucleoside is a non-bicyclic nucleoside.

Modified internucleoside linkage means any change in a naturally occurring internucleoside linkage.

Thiophosphate internucleoside bond means a bond between nucleosides in which one of the non-bridging atoms is a sulfur atom.

Modified sugar component means substitution and/or any modification of natural sugar.

Unmodified nucleobase means the naturally occurring heterocyclic bases of RNA or DNA: the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C) (including 5-methylcytosine) and uracil (U).

5-methylcytosine means a cytosine containing a methyl group attached at the 5 position.

Unmethylated cytosine means cytosine that does not contain a methyl group attached at the 5 position.

Modified nucleic base means any nucleic base that is not an unmodified nucleic base.

Sugar component means a naturally occurring furanosyl or modified sugar component.

Modified sugar component means a substituted sugar component or a sugar substitute.

2'-O-methyl sugars or 2'-OMe sugars means a sugar containing an O-methyl modification at the 2' position.

2'-O-methoxyethyl sugar or 2'-MOe sugar means a sugar containing an O-methoxyethyl modification at the 2' position.

2'-fluorine or 2'-F means a sugar having a fluorine modification at the 2' position.

Bicyclic sugar component means a modified sugar component containing a 4-7 membered ring (including, but not limited to, furanosyl) containing a bridge linking two atoms of the 4-7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments of the invention, the 4-7 membered ring is a sugar ring. In certain embodiments of the invention, the 4-7 membered ring is a furanosyl. In certain embodiments of the invention, the bridge connects the 2' carbon and the 4' carbon of the furanosyl.

Non-limiting exemplary bicyclic sugar components include ZNA, ENA, cEt, S-cEt and R-cEt.

Locked nucleic acid sugar moiety (LNA-locked nucleic acid) means a substituted sugar moiety containing a (CH ₂ )-O bridge between the 4' and 2' atoms of the furanose ring.

Sugar component ENA (ethylene bridged nucleic acid) means a substituted sugar component containing a (CH ₂ ) ₂ -O bridge between the 4' and 2' atoms of the furanose ring.

A hindered ethyl (cEt) sugar moiety means a substituted sugar moiety containing a CH( _CH3 )-O bridge between the 4' and 2' atoms of the furanose ring. In certain embodiments of the invention, the CH(CH ₃ )-O bridge is sterically hindered in the S orientation. In certain embodiments of the invention, CH(CH ₃ )-O is sterically hindered in the R orientation.

Sugar component S-cEt means a substituted sugar component containing

S-sterically hindered CH(CH ₃ )-O bridge between the 4' and 2' atoms of the furanose ring.

Sugar component R-cEt means a substituted sugar component containing

R-sterically hindered CH(CH ₃ )-O bridge between the 4' and 2' atoms of the furanose ring.

2'-O-methyl nucleoside means a 2'-modified nucleoside having a 2'-O-methyl sugar modification.

2'-O-methoxyethyl nucleoside means a 2'-modified nucleoside having a 2'-O-methoxyethyl sugar modification. The 2'-O-methoxyethyl nucleoside may contain a modified or unmodified nucleic acid base.

A 2'-fluoro nucleoside means a 2'-modified nucleoside having a 2'-fluoro sugar modification. The 2'-fluoro nucleoside may contain a modified or unmodified nucleic acid base.

Bicyclic nucleoside means a 2'-modified nucleoside having a bicyclic sugar moiety.

A bicyclic nucleoside may have a modified or unmodified nucleobase.

- 10 043761

Nucleoside cEt means a nucleoside containing a cEt sugar moiety. The cEt nucleoside may contain a modified or unmodified nucleic base.

Nucleoside S-cEt means a nucleoside containing the sugar component S-cEt.

Nucleoside R-cEt means a nucleoside containing the sugar component R-cEt. β-O-deoxyribonucleoside means a naturally occurring DNA nucleoside. β-D-ribonucleoside means a naturally occurring RNA nucleoside.

LNA nucleoside means a nucleoside containing a LNA sugar component.

Nucleoside ENK means a nucleoside containing the sugar component ENK.

Review.

Polycystic kidney disease (PKD) is an inherited form of kidney disease in which fluid-filled cysts develop in the kidneys, leading to kidney failure and often advanced kidney disease. Some PKDs are also characterized by enlarged kidneys. Excessive proliferation of cysts is a hallmark of PBP pathology. In the treatment of PKD, the main goal of treatment is to treat symptoms such as hypertension and infections, maintain kidney function, and prevent the onset of end-stage renal disease (ESRD), which in turn improves the life expectancy of subjects with PKD.

The miR-17-92 microRNA cluster of miR-17 family members is elevated in a mouse model of PPD. Genetic deletion of the miR-17-92 cluster in a mouse model of PKD reduces the growth of renal cysts, improves kidney function and prolongs survival (Patel et al., PNAS, 2013, 110(26):10765-10770). Inhibition of miR-17 by an experimental compound has been shown to reduce the kidney weight-to-body weight ratio and improve kidney function in an experimental model of PKD. In addition, inhibition of miR-17 also suppressed the proliferation and growth of primary cultures derived from human donor cysts.

To identify inhibitors of one or more members of the miR-17 family that would be sufficiently effective, safe, and convenient to administer to subjects with PLD, approximately 200 modified oligonucleotides were developed containing a nucleobase sequence complementary to the core sequence of miR-17, which were of varying lengths and chemical composition. The lengths of the compounds ranged from 9 to 20 linked nucleosides, and the compounds varied in the number, type, and placement of chemical modifications. Because pharmacology, pharmacokinetic behavior, and safety cannot be predicted simply based on the chemical structure of a compound, compounds were evaluated both in vitro and in vivo for potency, potency, pharmacokinetic behavior, safety, and metabolic stability in a series of assays , designed to eliminate compounds with unfavorable properties. As described herein, each of the nearly 200 compounds was first tested in multiple in vitro assays (e.g., potency, toxicology, metabolic stability) to identify a smaller set of compounds suitable for further testing in more complex in vivo assays (e.g. pharmacokinetic profile, efficacy, toxicology). This screening process identified a candidate pharmaceutical agent, RG4326, for the treatment of PPD. As shown herein, changes in the type and arrangement of sugar moieties resulted in significant effects on the properties of the test compounds, including activity and tissue distribution. RG4326 was selected as a potential pharmaceutical agent because this compound exhibited the most favorable pharmacodynamics, safety and pharmacokinetic profiles compared to other compounds having the same length and nucleobase sequence but different sets of sugar modifications.

Certain compounds of this invention.

Presented herein are compounds containing a modified oligonucleotide consisting of 9 linked nucleosides, wherein the modified oligonucleotide has the following nucleoside structure in a 5' to 3' orientation:

wherein nucleosides followed by the subscript M are 2'-O-methylnucleosides, nucleosides followed by the subscript F are 2'-fluoronucleosides, nucleosides followed by the subscript S are S-cEt nucleosides, with In this case, the specified nucleic base sequence of the modified oligonucleotide contains the nucleic base sequence 5' -CACUUU-3', each cytosine being either unmethylated cytosine or 5-methylcytosine, or a pharmaceutically acceptable salt thereof.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 5'-AGCACUUUG-3', each cytosine being either an unmethylated cytosine or a 5-methylcytosine. In certain embodiments, each cytosine is an unmethylated cytosine. In certain variants

- 11 043761 implementation each bond is independently selected from a phosphodiester bond and a thiophosphate bond. In certain embodiments, all bonds are thiophosphate bonds.

Presented herein are compounds of the structure AsG _s C _M A _F C _F U _F U _M U _s G _s in which the nucleosides followed by the subscript M are 2'-O-methylnucleosides, nucleosides followed by the subscript F, are 2'-fluoronucleosides, nucleosides followed by the index S are S-cEt nucleosides, each cytosine is either unmethylated cytosine or 5-methylcytosine; or a pharmaceutically acceptable salt thereof. In certain embodiments, each cytosine is an unmethylated cytosine. In certain embodiments, each linkage is independently selected from a phosphodiester linkage and a thiophosphate linkage. In certain embodiments, all bonds are thiophosphate bonds.

Presented herein are compounds of the structure A _S G _S C _M A _F C _F U _F U _M U _S G _S , in which the nucleosides followed by the subscript M are 2'-O-methylnucleosides, the nucleosides followed by the subscript F are 2'-fluoronucleosides, nucleosides followed by S are S-cEt nucleosides, each cytosine is an unmethylated cytosine; or a pharmaceutically acceptable salt thereof. In certain embodiments, each linkage is independently selected from a phosphodiester linkage and a thiophosphate linkage. In certain embodiments, all bonds are thiophosphate bonds.

Presented herein are compounds containing a modified oligonucleotide consisting of 9 linked nucleosides, wherein the modified oligonucleotide has the following nucleoside structure in a 5' to 3' orientation:

NsNsNmN _f N _f N _f NmNsNs wherein nucleosides followed by the subscript M represent 2'-O-methylnucleosides, nucleosides followed by the subscript F represent 2'-fluoronucleosides, nucleosides followed by the subscript S represent are S-cEt nucleosides and all linkages are thiophosphate linkages, and wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence 5'-CACUUU-3', each cytosine being either an unmethylated cytosine or 5-methylcytosine, or a pharmaceutical thereof acceptable salt.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 5'-AGCACUUUG-3', each cytosine being either an unmethylated cytosine or a 5-methylcytosine. In certain embodiments, each cytosine is an unmethylated cytosine.

This document presents compounds of the structure AsGsC _M A _F C _F U _F U _M U _s G _s , _Wherein nucleosides followed by the subscript M represent 2'-O-methylnucleosides, nucleosides followed by the subscript F represent are 2'-fluoronucleosides, nucleosides followed by the index S are S-cEt nucleosides, each cytosine is either unmethylated cytosine or 5-methylcytosine, and all bonds are thiophosphate bonds; or a pharmaceutically acceptable salt thereof. In certain embodiments, each cytosine is an unmethylated cytosine.

Presented herein are compounds of the structure A _S G _S C _M A _F C _F U _F U _M U _S G _S , where nucleosides followed by the subscript M are 2'-O-methylnucleosides, nucleosides followed by the subscript F are 2'-fluoronucleosides, nucleosides followed by the subscript S are S-cEt nucleosides, each cytosine is an unmethylated cytosine, and all bonds are thiophosphate bonds; or a pharmaceutically acceptable salt thereof.

- 12 043761

Presented herein is a modified oligonucleotide named RG4326, in which the structure of the modified oligonucleotide is

- 13 043761

Also provided herein are pharmaceutically acceptable salts of the modified oligonucleotide RG4326. Thus, in certain embodiments, the modified oligonucleotide has the structure

or a pharmaceutically acceptable salt thereof.

- 14 043761

A non-limiting exemplary pharmaceutically acceptable salt of RG4326 has the structure

In certain embodiments, the pharmaceutically acceptable salt of the modified oligonucleotide contains fewer cationic counterions (such as Na ⁺ ) than there are thiophosphate and/or phosphodiester bonds present per molecule (i.e., some of the thiophosphate and/or phosphodiester bonds are protonated). In certain embodiments, the pharmaceutically acceptable RG4326 salt contains less than 8 cationic counterions (such as Na ⁺ ) per RG4326 molecule. Those. in certain embodiments, the pharmaceutically acceptable salt of RG4326 may contain an average of 1, 2, 3, 4, 5, 6, or 7 cationic counterions per RG4326 molecule, with the remaining thiophosphate groups being protonated.

Certain uses of the present invention.

Provided herein are methods of inhibiting the activity of one or more members of the miR-17 family in a cell, comprising contacting the cell with a compound provided herein that contains a nucleic acid sequence complementary to the core sequence of miR-17.

Provided herein are methods of inhibiting the activity of one or more miR-17 family members in a subject, comprising administering to the subject a pharmaceutical composition provided herein. In certain embodiments, the subject has a disease associated with one or more members of the miR-17 family.

Provided herein are methods of treating polycystic kidney disease (PKD) comprising administering to a subject in need thereof a compound provided herein that contains a nucleic acid base sequence complementary to the core sequence of miR-17. In certain embodiments, the subject has polycystic kidney disease. In certain embodiments, the polycystic kidney disease is selected from autosomal dominant polycystic kidney disease (ADPKD), autosomal recessive polycystic kidney disease (ARPKD), and nephronophthisis (NP). In certain embodiments, the polycystic kidney disease is selected from autosomal dominant polycystic kidney disease (ADPKD) and autosomal recessive polycystic kidney disease (ARPKD).

In certain embodiments, the subject has a disorder that is characterized by multiple non-renal symptoms as well as polycystic kidney disease. Such disorders include, for example, Joubert syndrome and related disorders (JSRD), Meckel syndrome (MKS) or Bardet-Biedl syndrome (BBS). Accordingly, provided herein are methods of treating polycystic kidney disease (PKD) comprising administering to a subject a compound provided herein that includes a nucleobase sequence complementary to the core sequence of miR-17, and the subject has Joubert syndrome and related disorders ( JSRD), Meckel syndrome (MKS) or Bardet-Biedl syndrome (BBS). Provided herein are methods of treating polycystic kidney disease (PKD) comprising administering a compound provided herein which contains a nucleobase sequence complementary to the core sequence of miR-17, wherein the subject is suspected of having Joubert syndrome and related disorders (JSRD ), Meckel syndrome (MKS) or Bardet-Biedl syndrome (BBS).

In certain embodiments, the polycystic kidney disease is autosomal dominant polycystic kidney disease (ADPKD). ACPKD is caused by mutations in the PKD1 or PKD2 gene. ACPKD is a progressive disease in which cyst formation and kidney enlargement lead to kidney failure and ultimately end-stage renal disease in 50% of patients by age 60. Patients with ACPKD may require lifelong dialysis and/or a kidney transplant. ACPKD is the most common genetic cause of kidney failure. Excessive proliferation of cysts is the hallmark of the pathological feature of ACLD. In the treatment of polycystic kidney disease (PKD), the main goal of treatment is to maintain kidney function and prevent the onset of end-stage renal disease (ESRD), which in turn improves the life expectancy of patients with polycystic kidney disease. Total renal volume usually increases steadily in patients with ACLD, and the increase correlates with worsening renal function. Provided herein are methods of treating ACPKD comprising administering to a subject having or suspected of having ACPKD a compound provided herein that contains a nucleobase sequence complementary to the core sequence of miR-17.

In certain embodiments, the polycystic kidney disease is autosomal recessive polycystic kidney disease (ARPKD). ARPKD is caused by mutations in the PKHD1 gene and is a cause of chronic kidney disease in children. The typical renal phenotype of ARPKD is enlarged kidneys; however, ARPKD has marked effects on other organs, especially the liver. Patients with ARPKD progress to end-stage renal disease and require a kidney transplant by age 15 years. Provided herein are methods of treating ARPKD, comprising administering to a subject having or suspected of having ARPKD a compound provided herein that contains a nucleobase sequence complementary to the core sequence of miR-17.

In certain embodiments, the polycystic kidney disease is nephronophthisis (NP).

Nephronophthisis is an autosomal recessive cystic kidney disease that is a common cause of ESRD in children. NF is characterized by kidneys of normal or reduced size, cysts concentrated at the corticomedullary junction, and tubulointerstitial fibrosis. Mutations in one of several NF genes, such as NPHP1, have been identified in patients with NF. Provided herein are methods of treating NF comprising administering to a subject having or suspected of having NF a compound provided herein that contains a nucleic acid sequence complementary to the core sequence of miR-17.

In certain embodiments, the subject having polycystic kidney disease has Joubert syndrome and related disorders (JSRD). JSRD includes a wide range of distinctive features, including brain, retinal, and skeletal abnormalities. Some subjects with JSRD have polycystic kidney disease, in addition to the characteristic features of JSRD. Accordingly, provided herein are methods of treating polypolycystic kidney disease in a subject suffering from JSRD, comprising administering to the subject suffering from JSRD a compound provided herein that contains a nucleic acid sequence complementary to the core sequence of miR-17. In certain embodiments, the subject is suspected of having JSRD.

In certain embodiments, the subject having polycystic kidney disease has Meckel syndrome (MKS). MKS is a disorder with severe signs and symptoms in many parts of the body, including the central nervous system, skeletal system, liver, kidneys and heart. Common features of MKS are the presence of numerous fluid-filled cysts in the kidneys and enlarged kidneys. Accordingly, provided herein are methods of treating MKS, comprising administering to a subject having MKS a compound provided herein that includes a nucleic acid sequence complementary to the core sequence of miR- 16 043761

17. In certain embodiments, the subject is suspected of having MKS.

In certain embodiments, the subject having polycystic kidney disease has Bardet-Biedl syndrome (BBS). BBS is a disease that affects many parts of the body, including the eyes, heart, kidneys, liver, and digestive system. The hallmark of BBS is the presence of renal cysts. Accordingly, provided herein are methods of treating polypolycystic kidney disease in a subject having BBS, comprising administering to the subject having BBS a compound provided herein that contains a nucleic acid sequence complementary to the core sequence of miR-17. In certain embodiments, the subject is suspected of having BBS.

In certain embodiments, the subject was diagnosed with PPD prior to administration of the compound containing the modified oligonucleotide. Diagnosis of PKD may be achieved by evaluation of parameters including, but not limited to, the subject's family history, clinical features (including, but not limited to, hypertension, albuminuria, hematuria, and impaired GFR), renal imaging studies (including, but not limited to, MRI, ultrasound, and CT scans), and/ or histological analysis.

In certain embodiments, diagnosing PKD involves screening for mutations in one or more PKD1 or PKD2 genes. In certain embodiments, diagnosing ARPKD involves screening for mutations in the PKHP1 gene. In certain embodiments, diagnosing NF includes screening for one or more mutations in one or more NPHP1, NPHP2, NPHP3, NPHP4, NPHP5, NPHP6, NPHP7, NPHP8, or NPHP9 genes. In certain embodiments, diagnosing JSRD involves screening for mutations in the NPHP1, NPHP6, AHI1, MKS3, or RPGRIP1L genes. In certain embodiments, diagnosing MKS involves screening for mutations in the NPHP6, MKS3, RPGRIP1L, NPHP3, CC2D2A, BBS2, BBS4, BBS6, or MKS1 genes. In certain embodiments, diagnosing BBS involves screening for mutations in the BBS2, BBS4, BBS6, MKS1, BBS1, BBS3, BBS5, BBS7, BBS7, BBS8, BBS9, BBS10, BBS11, or BBS12 genes.

In certain embodiments, the subject has increased total kidney volume. In certain embodiments, the total kidney volume is the height-adjusted total kidney volume (TGV). In certain embodiments, the subject has hypertension. In certain embodiments, the subject has impaired renal function. In certain embodiments, the subject is in need of improving kidney function. In certain embodiments, the subject is identified as having impaired renal function.

In certain embodiments, the levels of one or more miR-17 family members are increased in the kidney of a subject having PKD. In certain embodiments, the subject is determined to have elevated levels of one or more miR-17 family members in the kidney before administration. The miR-17 family member can be measured in kidney biopsy specimens. In certain embodiments, prior to administration, the subject is determined to have elevated levels of one or more miR-17 family members in the subject's urine or blood.

In any of the embodiments provided herein, a subject may undergo certain tests to diagnose polypolycystic kidney disease in the subject, for example, to determine the cause of polypolycystic kidney disease, to assess the extent of polypolycystic kidney disease in the subject, and/or to determine the subject's response to treatment. Such tests can evaluate markers of polycystic kidney disease. Some of these tests, such as glomerular filtration rate and blood urea nitrogen levels, are also measures of kidney function. Markers of polycystic disease include, but are not limited to, measurement of the subject's total kidney volume;

measuring the subject's hypertension;

assessing the subject's kidney pain;

measuring fibrosis in a subject;

measuring the subject's blood urea nitrogen level;

measuring the subject's serum creatinine level;

measuring the subject's creatinine clearance;

measuring the subject's albuminuria;

measuring the subject's albumin:creatinine ratio;

measuring the subject's glomerular filtration rate;

measuring the subject's hematuria;

measuring NGAL protein in the subject's urine; and/or measuring KIM-1 protein in the subject's urine.

Unless otherwise noted, blood urea nitrogen level, serum creatinine level, creatinine clearance, albuminuria, creatinine-to-albumin ratio, glomerular filtration rate, and hematuria refer to measurements in the blood (such as whole blood or serum) of the subject.

Markers of polycystic kidney disease are determined by laboratory tests. Reference ranges for individual markers may vary from laboratory to laboratory. Izme

- 17 043761 discrepancies may be due, for example, to differences in the specific assays used. Thus, the upper and lower limits of the normal distribution of a marker in a population, also known as the upper limit of normal (ULN) and lower limit of normal (LON), respectively, may vary from laboratory to laboratory. For any given marker, a healthcare professional can determine which levels outside the normal distribution are clinically significant and/or indicative of disease. For example, a health care provider may determine the glomerular filtration rate, which may indicate a decrease in the rate of kidney function in a subject with polycystic kidney disease.

In certain embodiments, said administration of a compound provided herein results in one or more clinically beneficial results. In certain embodiments, said administration improves renal function in a subject. In certain embodiments, said administration slows the rate of decline in renal function in a subject. In certain embodiments, said administration reduces the total kidney volume of the subject. In certain embodiments, said administration slows the rate of increase in total kidney volume in a subject. In certain embodiments, said administration reduces total height-adjusted kidney volume (GARV). In certain embodiments, said administration slows the rate of increase in TPR.

In certain embodiments, said administration inhibits the growth of cysts in a subject. In certain embodiments, said administration slows the rate of increase in cyst growth in a subject. In certain embodiments, the cyst is present in the subject's kidney. In certain embodiments, the cyst is present in an organ other than the kidney, such as the liver.

In certain embodiments, said administration relieves kidney pain in a subject. In certain embodiments, said administration slows the increase in kidney pain in the subject. In certain embodiments, said administration delays the onset of kidney pain in the subject.

In certain embodiments, said administration reduces hypertension in the subject. In certain embodiments, said administration slows the worsening of hypertension in a subject. In certain embodiments, said administration delays the onset of hypertension in the subject.

In certain embodiments, said administration reduces fibrosis in the subject's kidney. In certain embodiments, said administration slows the worsening of fibrosis in the subject's kidney.

In certain embodiments, said administration delays the onset of end-stage renal disease in the subject. In certain embodiments, said administration delays the time of dialysis for the subject. In certain embodiments, said administration delays the time of kidney transplantation for the subject. In certain embodiments, administration improves the life expectancy of the subject.

In certain embodiments, said administration reduces albuminuria in a subject. In certain embodiments, said administration slows the worsening of albuminuria in a subject. In certain embodiments, said administration delays the onset of albuminuria in the subject. In certain embodiments, said administration reduces hematuria in a subject. In certain embodiments, said administration slows the worsening of hematuria in the subject. In certain embodiments, said administration delays the onset of hematuria in the subject. In certain embodiments, said administration reduces the blood urea nitrogen level of the subject. In certain embodiments, said administration reduces the serum creatinine level in the subject. In certain embodiments, said administration improves creatinine clearance in a subject. In certain embodiments, said administration reduces the albumin:creatinine ratio in the subject.

In certain embodiments, said administration improves the glomerular filtration rate in a subject. In certain embodiments, said administration slows the rate of decline in the subject's glomerular filtration rate. In certain embodiments, the glomerular filtration rate is the estimated glomerular filtration rate (eGFR). In certain embodiments, the glomerular filtration rate is the measured glomerular filtration rate (eGFR).

In certain embodiments, said administration reduces the level of neutrophil gelatinase-associated lipocalin (NGAL) protein in the subject's urine. In certain embodiments, said administration reduces the level of kidney injury molecule 1 (KIM-1) in the subject's urine.

In any of the embodiments provided herein, a subject may be subjected to certain tests to assess the extent of disease development in the subject. Such tests include, but are not limited to, measuring the subject's total kidney volume;

- 18 043761 measurement of arterial hypertension in the subject;

measuring the subject's kidney pain;

measuring fibrosis in the subject's kidney;

measuring the subject's blood urea nitrogen level;

measuring the subject's serum creatinine level;

measuring creatinine clearance in the subject's blood;

measuring the subject's albuminuria;

measuring the subject's albumin:creatinine ratio;

measuring the glomerular filtration rate of a subject, wherein the glomerular adaptation rate is estimated or measured;

measuring neutrophil gelatinase-associated lipocalin (NGAL) protein in the subject's urine; and/or measuring kidney injury molecule-1 (KIM-1) protein in the subject's urine.

In certain embodiments, a subject having polycystic kidney disease experiences a decrease in quality of life. For example, a subject having polycystic kidney disease may experience kidney pain, which may reduce the subject's quality of life. In certain embodiments, said administration improves the subject's quality of life.

In any of the embodiments presented herein, the subject is a human. In certain embodiments, the human subject is an adult. In certain embodiments, the adult is at least 21 years of age. In certain embodiments, the human subject is a pediatric subject, i.e. the subject is under 21 years of age. Pediatric populations may be defined by regulatory authorities. In certain embodiments, the human subject is an adolescent. In certain embodiments, the adolescent is at least 12 years of age and less than 21 years of age. In certain embodiments, the human subject is a child. In certain embodiments, the child is at least 2 years old and less than 12 years old. In certain embodiments, the human subject is an infant. In certain embodiments, the infant is at least 1 month old and less than 2 years old. In certain embodiments, the subject is a newborn. In certain embodiments, the newborn is less than one month old.

Any of the compounds described herein can be used in therapy. Any of the compounds presented herein can be used for the treatment of polycystic kidney disease. In certain embodiments, polycystic kidney disease is an autosomal dominant polycystic kidney disease. In certain embodiments, polycystic kidney disease is an autosomal recessive polycystic kidney disease. In a certain embodiment, the polycystic kidney disease is nephronophthisis. In certain embodiments, the subject has Joubert syndrome and related disorders (JSRD), Meckel syndrome (MKS), or Bardet-Biedl syndrome (BBS).

Any of the modified oligonucleotides described herein can be used for therapy. Any of the modified oligonucleotides presented herein can be used for the treatment of polycystic kidney disease.

Any of the compounds presented herein can be used for the preparation of a medicinal product. Any of the compounds presented herein can be used for the preparation of a medicament for the treatment of polycystic kidney disease.

Any of the modified oligonucleotides presented herein can be used for drug preparation. Any of the modified oligonucleotides presented herein can be used for the preparation of a drug for the treatment of polycystic kidney disease.

Any pharmaceutical composition provided herein can be used for the treatment of polycystic kidney disease.

Some additional therapies.

Treatments for polycystic kidney disease or any of the conditions listed herein may include more than one therapy. Thus, certain embodiments provided herein provide methods of treating a subject having or suspected of having polycystic kidney disease, comprising administering at least one therapeutic agent in addition to administering a compound provided herein comprising the sequence nucleotide bases complementary to the central sequence of miR-17.

In certain embodiments, the at least one additional therapy includes a pharmaceutical agent.

In certain embodiments, the pharmaceutical agent is an antihypertensive agent.

- 19 043761

Antihypertensive agents are used to control a subject's blood pressure.

In certain embodiments, the pharmaceutical agent is a vasopressin receptor 2 antagonist. In certain embodiments, the vasopressin receptor 2 antagonist is tolvaptan.

In certain embodiments, the pharmaceutical agents include angiotensin II receptor blockers (ARBs). In certain embodiments, the angiotensin II receptor blocker is candesartan, irbesartan, olmesartan, losartan, valsartan, telmisartan, or eprosartan.

In certain embodiments, the pharmaceutical agents include angiotensin II-converting enzyme (ACE) inhibitors. In certain embodiments, the ACE inhibitor is captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, or ramipril.

In certain embodiments, the pharmaceutical agent is a diuretic. In certain embodiments, the pharmaceutical agent is a calcium channel blocker.

In certain embodiments, the pharmaceutical agent is a kinase inhibitor. In certain embodiments, the kinase inhibitor is bosutinib or KD019.

In certain embodiments, the pharmaceutical agent is an adrenergic receptor antagonist.

In certain embodiments, the pharmaceutical agent is an aldosterone receptor antagonist. In certain embodiments, the aldosterone receptor antagonist is spironolactone. In certain embodiments, spironolactone is administered at a dose of 10 to 35 mg per day. In certain embodiments, spironolactone is administered at a dose of 25 mg per day.

In certain embodiments, the pharmaceutical agent is a mammalian target of rapamycin (mTOR) inhibitor. In certain embodiments, the mTOR inhibitor is everolimus, rapamycin, or sirolimus.

In certain embodiments, the pharmaceutical agent is a hormone analogue. In certain embodiments, the hormone analogue is somatostatin or adrenocorticotrophic hormone.

In certain embodiments, the pharmaceutical agent is an antifibrotic agent. In certain embodiments, the antifibrotic agent is a modified oligonucleotide complementary to miR-21.

In certain embodiments, the additional therapy is dialysis. In certain embodiments, additional therapy is a kidney transplant.

In certain embodiments, the pharmaceutical agents include anti-inflammatory agents. In certain embodiments, the anti-inflammatory agent is a steroidal anti-inflammatory agent. In certain embodiments, the steroidal anti-inflammatory agent is a corticosteroid. In certain embodiments, the corticosteroid is prednisone. In certain embodiments, the anti-inflammatory agent is a non-steroidal anti-inflammatory drug. In certain embodiments, the nonsteroidal anti-inflammatory agent is ibuprofen, a COX-1 inhibitor, or a COX-2 inhibitor.

In certain embodiments, the pharmaceutical agent is a pharmaceutical agent that blocks one or more responses to fibrogenic signals.

In certain embodiments, the adjunctive therapy may be a pharmaceutical agent that enhances the body's immune system, including low doses of cyclophosphamide, thymostulin, vitamins and nutritional supplements (e.g., antioxidants including vitamins A, C, E, beta-carotene, zinc, selenium, glutathione, coenzyme Q-10 and echinacea) and vaccines, such as the immunostimulating complex (ISCOM), which contains a vaccine composition that combines multimeric antigen presentation and an adjuvant.

In certain embodiments, adjunctive therapy is selected to treat or reduce the side effects of one or more pharmaceutical compositions of this invention. Such side effects include, but are not limited to, injection site reactions, liver dysfunction, renal dysfunction, hepatotoxicity, renal toxicity, central nervous system disorders and myopathies. For example, elevated serum aminotransferase levels may indicate hepatotoxicity or liver dysfunction. For example, elevated bilirubin may indicate hepatotoxicity or liver dysfunction.

Specific sequences of microRNA nucleic bases

The miR-17 family includes miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR-106b. Each member of the miR-17 family has a nucleobase sequence comprising the nucleobase sequence 5'-AAAGUG-3' or the miR-17 core sequence, which is the nucleobase sequence at positions 2 to 7 of SEQ ID NO: 1 .

- 20 043761

In addition, each miR-17 family member shares some nucleobase sequence identity outside the central region. Accordingly, a modified oligonucleotide containing a nucleobase sequence complementary to the core sequence of miR-17 can target other microRNAs of the miR-17 family in addition to miR-17. In certain embodiments, the modified oligonucleotide targets two or more microRNAs of the miR-17 family. In certain embodiments, the modified oligonucleotide targets three or more microRNAs of the miR-17 family. In certain embodiments, the modified oligonucleotide targets four or more microRNAs of the miR-17 family. In certain embodiments, the modified oligonucleotide targets five or more microRNAs of the miR-17 family. In certain embodiments, the modified oligonucleotide targets six microRNAs of the miR-17 family. For example, a modified oligonucleotide that has the nucleobase sequence 5' -AGCACUUUG-3' targets all members of the miR-17 family.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 5'-CACUUU-3'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 5' -GCACUUUG-3'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 5'-AGCACUUU-3'.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide is $'"AGCACUUUG-3'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 5'-CACTTT-3'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 5'-CACUTT-3'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 3'-CACUUT-3'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence s'-cactut-s'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 5'-CACUTT-3'.

In certain embodiments, the modified oligonucleotide comprises the nucleobase sequence 5' -CACTTU-3'.

In certain embodiments, each cytosine is independently selected from unmethylated cytosine and 5-methylcytosine. In certain embodiments, the at least one cytosine is an unmethylated cytosine. In certain embodiments, each cytosine is an unmethylated cytosine. In certain embodiments, the at least one cytosine is 5-methylcytosine. In certain embodiments, each cytosine is 5-methylcytosine.

In certain embodiments, the number of bound nucleosides of the modified oligonucleotide is less than the length of its target microRNA. A modified oligonucleotide is considered to be a modified oligonucleotide having a sequence of nucleotide bases that is completely complementary (also called 100% complementary) to the sequence region of the target miRNA if it has a number of linked nucleosides whose length is less than the length of the target miRNA, with each nucleotide base of the modified oligonucleotide is complementary to the nucleic base at the corresponding position of the target microRNA. For example, a modified oligonucleotide consisting of 9 linked nucleosides, in which each nucleobase is complementary to the corresponding position of miR-17, is completely complementary to miR-17.

In certain embodiments, the modified oligonucleotide has a nucleobase sequence having one mismatch with respect to the nucleobase sequence of the target microRNA. In certain embodiments, the modified oligonucleotide has a nucleobase sequence having two mismatches with respect to the nucleobase sequence of the target microRNA. In some such embodiments, the modified oligonucleotide has a nucleobase sequence having no more than two mismatches with respect to the nucleobase sequence of the target microRNA. In some such embodiments, the mispaired nucleic acid bases are contiguous. In some such embodiments, the mispaired nucleic acid bases are not contiguous.

Although the sequence listing accompanying this submission identifies each nucleobase sequence as RNA or DNA as required, in practice these sequences may be modified by a combination of chemical modifications specified herein.

- 21 043761 document. One skilled in the art will readily appreciate that in sequence listings, the designation RNA or DNA to describe modified oligonucleotides is somewhat arbitrary. For example, a modified oligonucleotide provided herein containing a nucleoside containing a 2'-O-methoxyethylsaccharide group and a thymine base may be described as a DNA residue in a sequence listing, even if the nucleoside is modified and is not a natural DNA nucleoside.

Accordingly, the nucleic acid sequences presented in the sequence listing are intended to cover nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to, such nucleic acids having modified nucleic bases. By further example and without limitation, a modified oligonucleotide having the nucleobase sequence ATCGATCG in the sequence listing includes any oligonucleotide having such nucleic acid sequence, modified or unmodified, including, but not limited to, such compounds containing RNA bases such as oligonucleotides having the sequence AUCGAUCG and those having some DNA bases and some RNA bases such as AUCGATCG and oligonucleotides having other modified bases such as AT^CGAUCG, ^me C being 5-methylcytosine.

Certain modifications.

In certain embodiments, the oligonucleotides provided herein may contain one or more modifications of the nucleotide base, sugar and/or internucleoside linkage and, as such, are modified oligonucleotides. The modified nucleotide base, sugar and/or internucleoside linkage may be selected in unmodified form for desirable properties such as, for example, increased cellular uptake, increased affinity for other oligonucleotides or nucleic acid targets, and increased stability in the presence of nucleases.

In certain embodiments, the modified oligonucleotide contains one or more modified nucleosides.

In certain embodiments, the modified nucleoside is a sugar-modified nucleoside. In some such embodiments, sugar-modified nucleosides may further contain a natural or modified heterocyclic backbone and/or may be linked to another nucleoside through a natural or modified internucleoside linkage and/or may include additional modifications independent of the sugar modification. In certain embodiments, the sugar-modified nucleoside is a 2'-modified nucleoside, wherein the sugar ring is modified at the 2' carbon of native ribose or 2'-deoxyribose.

In certain embodiments, the 2'-modified nucleoside has a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moiety is D-caxap in the alpha configuration. In some such embodiments, the bicyclic sugar moiety is D-caxap in the beta configuration. In some such embodiments, the bicyclic sugar moiety is L-caxap in the alpha configuration. In some such embodiments, the bicyclic sugar moiety is L-caxap in the beta configuration.

Nucleosides containing such bicyclic sugar moieties are called bicyclic nucleosides or BNA. In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4'-CH ₂ -O-2') BNA;

(B) eD-methyleneoxy (4'-CH ₂ -O-2') BNA;

(C) ethyleneoxy (4'-(CH ₂ ) ₂ -O-2') BNA;

(D) aminooxy (4'-CH ₂ -ON(R)-2') BNA;

(E) oxyamino (4'-CH ₂ -N(R)-O-2') BNA;

(F) methyl (methyleneoxy) (4'-CH(CH ₃ )-O-2') BNA (also called ethyl or cEt);

(G) methylene-thio (4'-CH ₂ -S-2') BNA;

(H) methylene-amino (4'-CH2-N(R)-2') BNA;

(I) methylcarbocyclic (4'-CH2-CH(CH ₃ )-2') BNA;

(J) c-MOE (4'-CH(CH2-0Me)-0-2') BNA; and (K) propylenecarbocyclic (4'-(CH ₂ ) ₃ -2') BNA, as shown below.

- 22 043761

where Bx represents a nucleic base group; And

R independently represents H, a protecting group or C1-C12 alkyl.

In certain embodiments, the 2'-modified nucleoside contains a 2'-substituent group selected from F, OCF ₃ , O-CH ₃ (also referred to as 2'-OMe), OCH ₂ CH ₂ OCH ₃ (also referred to as 2'-O -methoxyethyl or 2'-MOE), 2'-O(CH ₂ ) ₂ SCH ₃ , O-(CH ₂ ) ₂ -O-H(CH ₃ ) ₂ , -O(CH2)2O(CH2)2N(CH3 )2 and O-CH2-C(=OZHN)CH3.

In certain embodiments, the 2'-modified nucleoside contains a 2'-substituent group selected from F, O-CH ₃ and OCH ₂ CH _{2 OCH} 3 .

In certain embodiments, the sugar-modified nucleoside is a 4'-thio-modified nucleoside. In certain embodiments, the sugar-modified nucleoside is a 4'-thio-2'-modified nucleoside. A 4'-thio-modified nucleoside has a β-D-ribonucleoside, with the 4'-O replaced by 4'-S. A 4'-Thio-2'-modified nucleoside is a 4'-thio-modified nucleoside having a 2'-OH substituted with a 2' substituent group. Suitable 2'-substituting groups include 2'-OSH ₃ , 2'-OSH ₂ CH ₂ OCH ₃ and 2'-F.

In certain embodiments, the modified oligonucleotide contains one or more internucleoside modifications. In some such embodiments, each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage contains a phosphorus atom.

In certain embodiments, the modified oligonucleotide contains at least one thiophosphate internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide is a thiophosphate internucleoside linkage.

In certain embodiments, the modified oligonucleotide contains one or more modified nucleic acid bases. In certain embodiments, the modified nucleotide base is selected from 5-hydroxymethylcytosine, 7-deazaguanine, and 7-deazaadenine. In certain embodiments, the modified nucleotide base is selected from 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. In certain embodiments, the modified nucleotide base is selected from 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.

In certain embodiments, the modified nucleotide base comprises a polycyclic heterocycle. In certain embodiments, the modified nucleotide base comprises a tricyclic heterocycle. In certain embodiments, the modified nucleotide base comprises a phenoxazine derivative. In certain embodiments, phenoxazine can be further modified to form a nucleic acid base, known in the art as a G-clamp.

In certain embodiments, the modified oligonucleotide is conjugated to one or more moieties that enhance activity, cellular distribution, or

- 23 043761 uptake of the resulting antisense oligonucleotides by the cell. In some such embodiments, the fragment is a cholesterol fragment. In certain embodiments, the moiety is a lipid moiety, and additional moieties for conjugation include carbohydrates, peptides, antibodies or antibody fragments, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In certain embodiments, the carbohydrate moiety is N-acetyl-O-galactosamine (GalNac). In certain embodiments, the conjugate group is attached directly to the oligonucleotide. In certain embodiments, the conjugate moiety is attached to the modified oligonucleotide through a linking moiety selected from amino, azido, hydroxyl, carboxylic acid, thiol, unsaturated groups (e.g., double or triple bonds), 8-amino-3,6-dioxaoctanoic acid (ADO ), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1carboxylate (SMCC), 6-aminohexanoic acid (AHEX or AHA), substituted CpCi alkyl, substituted or unsubstituted C2-C1o alkenyl and substituted or unsubstituted C2-C1o alkynyl. In some such embodiments, the substituent group is selected from hydroxyl, amino, alkoxy, azido, carboxy, benzyl, phenyl, nitrile, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

In some such embodiments, the compound comprises a modified oligonucleotide having one or more stabilizing groups that are attached to one or both ends of the modified oligonucleotide to improve properties such as nuclease stability. The stabilizing groups include cap structures. These terminal modifications protect the modified oligonucleotide from degradation by exonucleases and may aid in delivery and/or localization within the cell. Said cap may be present at the 5' end (5' cap) or at the 3' end (3' cap) or may be present at both ends. Cap structures include, for example, inverted deoxyabase caps.

Some pharmaceutical compositions.

Provided herein are pharmaceutical compositions containing a compound or modified oligonucleotide provided herein and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is an aqueous solution. In certain embodiments, the aqueous solution is saline. Pharmaceutically acceptable diluents used herein are understood to be sterile diluents. Suitable routes of administration include, but are not limited to, intravenous and subcutaneous administration.

In certain embodiments, the pharmaceutical composition is administered in dosage unit form. For example, in certain embodiments, the dosage unit is in the form of a tablet, capsule, or bolus injection.

In certain embodiments, the pharmaceutical agent is a modified oligonucleotide that has been prepared in a suitable diluent, adjusted to pH 7.0-9.0 with an acid or alkali during preparation, and then lyophilized under sterile conditions. The lyophilized modified oligonucleotide is then reconstituted with a suitable diluent, for example an aqueous solution such as water, or physiologically compatible buffers such as saline, Hank's solution or Ringer's solution. The reconstituted product is administered by subcutaneous injection or intravenous infusion. The lyophilized drug product may be packaged in a 2 ml clear Type I (ammonium sulfate treated) glass vial, sealed with a bromobutyl rubber stopper and sealed with an aluminum surface sealant.

In certain embodiments, the pharmaceutical compositions provided herein may further contain other additional components commonly found in pharmaceutical compositions at their level of use in the prior art of their respective fields. Thus, for example, these compositions may contain additional compatible pharmaceutically active materials, such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents.

In certain embodiments, the pharmaceutical compositions provided herein may contain additional materials useful for the physical formulation of the various dosage forms of the compositions of this invention, such as colors, flavors, preservatives, antioxidants, deactivators, thickeners and stabilizers; such additional materials also include, but are not limited to, excipients such as alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In various embodiments, such materials, when added, should not unduly interfere with the biological activity of the components of the compositions of this invention. The compositions may be sterilized and, if desired, mixed with auxiliary agents, for example, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, osmotic salts, buffers, dyes, flavors and/or aromatics, and the like. , which do not interact harmfully with the oligonucleotide(s) of the composition (drug). Certain pharmaceutical compositions for injection

- 24 043761 are suspensions, solutions or emulsions in oily or aqueous vehicles and may contain formulation agents such as suspending, stabilizing and/or dispersing agents. Some solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or dextran.

Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents, allowing highly concentrated solutions to be obtained.

Lipid moieties have been used in nucleic acid therapy in a variety of ways. In one method, the nucleic acid is introduced into preformed liposomes or lipoplexes made from mixtures of cationic lipids and neutral lipids. In another method, DNA complexes with mono- or polycationic lipids are formed without the presence of a neutral lipid. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent in a particular cell or tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent in adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the pharmaceutical agent in muscle tissue.

In certain embodiments, the pharmaceutical composition provided herein comprises a polyamine compound or lipid moiety complexed with a nucleic acid. In certain embodiments, such preparations include one or more compounds, each of which individually has the structure defined by formula (Z), or a pharmaceutically acceptable salt thereof,

I X ^a zx ^b h ^V N nr ₂

L RJn where each X ^a and X ^b for each case independently represents C _1-6 alkylene;

n is 0, 1, 2, 3, 4 or 5;

each R is independently H, wherein at least n+2 R moieties in at least about 80% of the molecules of the compound of formula (Z) in the preparation are not H;

m is 1, 2, 3 or 4;

Y is O, NR ² or S;

R ¹ represents alkyl, alkenyl or alkynyl, each of which is optionally substituted with one or more substituents; And

R ² is H, alkyl, alkenyl or alkynyl, each of which is optionally substituted with one or more substituents, provided that if n=0, then at least n+3 R moieties are not H.

Such preparations are described in PCT publication WO/2008/042973, which is incorporated herein by reference in its entirety for the disclosure of lipid preparations. Some additional drugs are described in Akinc et al., Nature Biotechnology, 26, 561-569 (01 May 2008), which is incorporated herein by reference in its entirety for the disclosure of lipid drugs.

In certain embodiments, the pharmaceutical composition provided herein is formulated using known techniques, including, but not limited to, mixing, dissolving, granulating, dragee-making, levitating, emulsifying, encapsulating, entrapping, or tableting processes.

In certain embodiments, the pharmaceutical composition provided herein is a solid (eg, powder, tablet, and/or capsule). In some such embodiments, a solid pharmaceutical composition containing one or more oligonucleotides is prepared using ingredients known in the art, including, but not limited to, starches, sugars, diluents, granulating agents, lubricants, binders and disintegrants.

In certain embodiments, the pharmaceutical composition provided herein is formulated as a depot formulation. Some such depot medications tend to last longer than non-depot medications. In certain embodiments, such drugs are administered by implantation (eg, subcutaneously or intramuscularly) or intramuscular injection. In certain embodiments, depot formulations are prepared using suitable polymeric or hydrophobic materials (eg, an emulsion in a suitable oil) or ion exchange resins, or as sparingly soluble derivatives, eg, as a sparingly soluble salt.

In certain embodiments, the pharmaceutical composition provided herein includes a delivery system. Examples of delivery systems include, but are not limited to

- 25 043761 them, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents are used, such as dimethyl sulfoxide.

In certain embodiments, the pharmaceutical composition provided herein contains one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of this invention to specific tissues or cell types. For example, in certain embodiments, the pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

In certain embodiments, the pharmaceutical composition provided herein comprises a sustained release system. A non-limiting example of such a sustained release system is a semi-permeable matrix of solid hydrophobic polymers. In certain embodiments, sustained release systems may, depending on their chemical nature, release pharmaceutical agents over a period of hours, days, weeks, or months.

Some injectable pharmaceutical compositions are presented in unit dosage form, such as ampoules or multi-dose containers.

In certain embodiments, the pharmaceutical composition provided herein comprises a modified oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate, or ameliorate the symptoms of a disease or to prolong the survival of the subject being treated.

In certain embodiments, one or more modified oligonucleotides provided herein are formulated as a prodrug. In certain embodiments, when administered in vivo, the prodrug is chemically converted to a biologically, pharmaceutically, or therapeutically more active form of the oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in some cases, a prodrug may be more bioavailable (eg, when administered orally) than the corresponding active form. In some cases, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, the prodrugs are less soluble in water than the corresponding active form. In some cases, such prodrugs have better ability to pass through cell membranes, where water solubility negatively affects mobility. In certain embodiments, the prodrug is an ester. In some such embodiments, the ester is metabolically hydrolyzed to a carboxylic acid upon administration. In some cases, the carboxylic acid-containing compound is the corresponding active form. In certain embodiments, the prodrug contains a short peptide (polyamino acid) linked to an acidic group. In some such embodiments, the peptide is cleaved upon administration to form the corresponding active form.

In certain embodiments, a prodrug is prepared by modifying a pharmaceutically active compound such that the active compound will be regenerated when administered in vivo. A prodrug may be designed to alter the metabolic stability or transport characteristics of a drug, to mask side effects or toxicity, to improve the taste of the drug, or to alter other characteristics or properties of the drug.

Thanks to knowledge of pharmacodynamic processes and in vivo drug metabolism, those skilled in the art, when a pharmaceutically active compound is known, can create prodrugs of the compound (see, for example, Nogrady (1985), Medicinal Chemistry A Biochemical Approach, Oxford University Press, New York, p. 388-392).

Additional routes of administration include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, inhalation, intrathecal, intracardiac, intraventricular, intraperitoneal, intranasal, intraocular, intratumoral, intramuscular, and intramedullary. In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic effects. For example, pharmaceutical compositions can be administered directly to the site of the desired effect (eg, the kidney).

Certain sets.

The present invention also provides kits. In certain embodiments, the kits include one or more compounds containing a modified oligonucleotide disclosed herein. In certain embodiments, these kits may be used to administer a compound to a subject.

In certain embodiments, the kit includes a pharmaceutical composition ready for administration. In certain embodiments, the pharmaceutical composition is present in a vial. A plurality of vials, for example 10, may be present, for example, in dosage packs. In certain embodiments, the vial is designed to be accessible to a syringe. The kit may also contain instructions for using the compounds.

In certain embodiments, the kit contains the pharmaceutical composition present in a prefilled syringe (such as single-dose syringes, e.g., with a 27-gauge, ¹ / _2- inch (1.27 cm) needle with a needle guard) rather than in a vial. A plurality of pre-filled syringes, for example 10, may be present, for example, in dosage packs. The kit may also contain instructions for administering compounds containing the modified oligonucleotide described herein.

In certain embodiments, the kit contains a modified oligonucleotide provided herein as a lyophilized drug product and a pharmaceutically acceptable diluent. In preparation for administration to a subject, the lyophilized drug product is reconstituted in a pharmaceutically acceptable diluent.

In certain embodiments, in addition to compounds containing the modified oligonucleotide disclosed herein, the kit may further include one or more of the following: a syringe, an alcohol swab, a cotton swab, and/or a gauze pad.

Certain experimental models.

In certain embodiments, the present invention provides methods for using and/or testing modified oligonucleotides of the present invention in an experimental model. Those skilled in the art may select and modify protocols for such experimental models to evaluate the pharmaceutical agent of the invention.

Typically, modified oligonucleotides are first tested in cultured cells. Suitable cell types include those of the cell type to which delivery of the modified oligonucleotide in vivo is desired. For example, suitable cell types for studying the methods described herein include primary or cultured cells.

In certain embodiments, the extent to which the modified oligonucleotide interferes with the activity of one or more miR-17 family members is assessed in cultured cells. In certain embodiments, inhibition of miRNA activity can be assessed by measuring the level of one or more predicted or confirmed miRNA-regulated transcripts. Inhibition of miRNA activity may result in an increase in the level of a miR-17 family member-regulated transcript and/or a protein encoded by a miR-17 family member-regulated transcript (ie, the miR-17 family member-regulated transcript is derepressed). Additionally, in certain embodiments, certain phenotypic outcomes may be measured.

Several animal models are available to those skilled in the art to study one or more members of the miR-17 family in human disease models. Models of polycystic kidney disease include, but are not limited to, models with mutations and/or deletions in Pkd1 and/or Pkd2; and models containing mutations in other genes.

Non-limiting exemplary PKD models containing mutations and/or deletions in Pkd1 and/or Pkd2 include hypomorphic models, such as models containing missense mutations in Pkd1, and models with reduced or unstable expression of Pkd2;

inducible conditional knockout models; and conditional knockout models.

Non-limiting exemplary models of PKD containing mutations in genes other than Pkd1 and Pkd2 include models with mutations in Pkhd1, Nek8, Kif3a and/or Nphp3. Models of PBP are discussed, for example, in Shibazaki et al., Human Mol. Genet., 2008, 17(11):1505-1516; Happe and Peters, Nat. Rev. Nephrol., 2014, 10(10):587-601; and Patel et al., PNAS, 2013, 1, 10(26):10765-10770.

Certain quantitative analyses.

In certain embodiments, miRNA levels are quantified in cells or tissues in vitro or in vivo. In certain embodiments, changes in miRNA levels are accomplished using microarray analysis. In certain embodiments, changes in miRNA levels are performed using one of several commercially available PCR assays, such as the TaqMan® miRNA assay (Applied Biosystems).

Modulation of miRNA activity by an anti-miR mimic or miRNA can be assessed using mRNA microarray profiling. mRNA sequences that are modulated (increased or decreased in amount) by an anti-miR mimic or microRNA are examined for the presence of a central miRNA sequence to compare the modulation of mRNAs that are targets of that miRNA with the modulation of mRNAs that are not targets of that miRNA. In this way, the interaction of anti-miR with its target microRNA can be assessed

- 27 043761 or microRNA mimic with its targets. In the case of anti-miR, mRNAs whose expression levels are elevated are screened for mRNA sequences that contain a sequence complementary to the central microRNA sequence to which the anti-miR is complementary.

Modulation of miRNA activity by an anti-miR compound can be assessed by measuring the level of the miRNA target messenger RNA, or by measuring the level of the messenger RNA itself or the protein transcribed from it. Antisense inhibition of miRNAs usually results in an increase in the messenger RNA and/or protein levels of the miRNA's target messenger RNA, i.e. anti-miR treatment results in derepression of one or more target messenger RNAs.

Examples

The following examples are presented to more fully illustrate certain embodiments of the invention. However, they should in no way be construed as limiting the broad scope of the invention. Those skilled in the art will readily accept the fundamental principles of this discovery to develop various compounds without departing from the spirit of the present invention.

Example 1. The role of miR-17 in PBP.

Members of the miR-17-92 microRNA cluster of the miR-17 family are upregulated in a mouse model of PPD. Genetic deletion of the miR-17-92 cluster in a mouse model of PKD reduces the growth of renal cysts, improves kidney function and prolongs survival (Patel et al., PNAS, 2013, 1, 10 (26):10765-10770). The miR-17-92 cluster contains 6 different microRNAs, each with a different sequence: miR-17, miR-18a, miR-19a, miR-19-b-1 and miR-92a-1.

The miR-17-92 cluster includes two microRNAs, miR-17 and miR-20a, which are members of the miR-17 family of microRNAs. Each member of this family shares a core sequence identity and varying degrees of sequence identity outside the core sequence region. Other members of the miR-17 family are miR-20b, miR-93, miR-106a and miR-106b, miR-20b and miR-106a, which are located in the miR-106a-363 cluster on the human X chromosome, and miR-93 and miR-106b are located in the miR-106b-25 cluster on human chromosome 7. The sequences of miR-17 family members are shown in Table. 1.

Table 1

MicroRNAs of the miR-17 family

microRNA SEQUENCE (5' to 3') central sequence region in bold SEQ ID NO miR-17 CAAAGUGCUUACAGUGCAGGUAG 1 miR-20a UAAAGUGCUUAUAGUGCAGGUAG 2 miR-2 0b CAAAGUGCUCAUAGUGCAGGUAG 3 miR-93 CAAAGUGCUGUUCGUGCAGGUAG 4 miR-106a AAAAGUGCUUACAGUGCAGGUAG 5 miR-106b UAAAGUGCUGACAGUGCAGAU 6

Previous studies using the anti-miR-17 research compound identified a role for miR-17 in PKD in two different models of PKD, the Pkd2-KO model (also known as Pkhd1/cre; Pkd2 ^F/F model) and the Pcy model. An instrumental research modified oligonucleotide complementary to miR-17 was tested in a mouse model of PPD. The anti-miR-17 compound was an all-thiophosphate oligonucleotide of 19-linked nucleosides in length (5′-CTGCACTGTAAGCACTTTG-3′; SEQ ID NO: 7) with DNA, 2′-MOE and S-cEt sugar moieties. Although the compound mispairs with other miR-17 family members, testing in in vitro assays has shown that it hybridizes and inhibits all miR-17 family members.

Pkd2-KO mice spontaneously develop polycystic kidney disease. Mice were treated with 20 mg/kg anti-miR-17 instrumental compound or control oligonucleotide or PBS. Results showed that anti-miR-l7 treatment of Pkd2-KO mice reduced the primary treatment parameter measured, kidney weight to body weight ratio, by 17% compared to control treatment (p=0.017). Anti-miR-17 treatment also significantly reduced BUN and mRNA expression of kidney injury biomarkers, Kim1 and Nga1, in Pkd2-KO mice. Finally, anti-miR-17 treatment resulted in a trend of decreased serum creatinine levels and decreased cystic index in Pkd2-KO mice. These results were not observed when anti-miR control was used, indicating that they are specifically related to miR-17 inhibition.

Pcy mice carrying a mutation in Nphp3 spontaneously develop polycystic kidney disease with slower disease progression than Pkd2-KO mice. Mice were treated with 50 mg/kg

- 28 043761 instrumental compound aHTu-miR-17 or FSB once a week for 26 weeks. The mean kidney-to-body weight ratio in Pcy mice treated with anti-miR-17 was 19% lower than the mean kidney-to-body weight ratio in Pcy mice treated with PBS alone (p=0.0003).

Pcy mice treated with anti-miR-17 showed an average 28% reduction in cystic index compared to Pcy mice treated with PBS alone (p=0.008).

These data demonstrated that in two different experimental models of PBP, miR-17 is a validated target for the treatment of PBP.

Example 2: Connection Design and Screening.

While the instrumental investigational compound showed efficacy in models of PPD, the compound was found to be mildly proinflammatory in an in vivo study. In addition, the investigational instrumental compound has not been sufficiently effective in development as a pharmaceutical treatment for PPD.

Accordingly, a screen was conducted to identify inhibitors of one or more members of the miR-17 family that are sufficiently effective, convenient to administer, and safe to administer to subjects with PLD. An additional criterion was a sufficiently high ratio of kidney to liver delivery to increase the proportion of the anti-miR-17 compound that is delivered to the target organ.

Approximately 200 modified oligonucleotides were designed containing a sequence of nucleic bases complementary to the central sequence of miR-17 with varying lengths and chemical compositions. The lengths of the compounds ranged from 9 to 20 linked nucleosides, and the compounds varied in the number, type, and placement of chemical modifications. Because efficacy and safety cannot be predicted based on the chemical structure of the nucleobase compound, the compounds were evaluated both in vitro and in vivo for potency, efficacy, pharmacokinetic behavior, viscosity, safety, and metabolic stability in a series of assays. designed to eliminate compounds with unfavorable properties. In some assays, the anti-miR-17 instrumental compound was used as a reference against which library compounds were compared. As described below, each of the nearly 200 compounds was first tested in multiple in vitro assays (e.g., activity, toxicology, metabolic stability) to identify a smaller set of compounds suitable for further testing in more complex in vivo assays (e.g., pharmacokinetic profile , effectiveness, toxicology). The screening process was designed to identify a potential pharmaceutical agent based on aggregated data from all assays, focusing on efficacy, pharmacokinetic profile (eg, renal delivery), and safety characteristics.

Potency and effectiveness in vitro and in vivo.

In vitro efficacy was assessed using a luciferase reporter assay. A luciferase reporter plasmid for miR-17 with two fully complementary miR-17 binding sites in tandem in the 3'-UTR of the luciferase gene. Longer compounds were selected if their maximum inhibition was greater than that of the anti-miR-17 instrumental compound. Because shorter compounds, such as 9-mers, are generally not maximally active under the same assay conditions used for longer compounds, shorter compounds were selected based on maximum inhibition relative to their respective control compounds. Thus, compounds that differ in length and chemical composition were included in further testing.

In vivo activity was assessed using the microRNA polysome shift assay (miPSA-microRNA polysome shift assay). This assay was used to determine the extent to which compounds directly interact with the miR-17 target in the kidneys of normal and PKD mice. MiPSA is based on the principle that active miRNAs bind to their target mRNAs in translationally active high molecular weight polysomes (HMW), while inhibited miRNAs reside in low MW polysomes (LMW). Anti-miR treatment results in the displacement of miRNAs from BMM polysomes to HMM polysomes. Thus, miPSA provides a direct measurement of target miRNA interactions using complementary anti-miR (Androsavich et al., Nucleic Acids Research., 2015, 44:e13).

Selected compounds that passed multiple screening criteria were evaluated for efficacy in experimental models of PPD, such as the Pkd2-KO mouse model and the Pcy mouse model. Mice were treated with an anti-miR-17 compound and clinically relevant measurable parameters were assessed, including kidney weight-to-body weight ratio, blood urea nitrogen levels, serum creatinine levels, and kidney cystic index.

Pharmacokinetic properties.

Metabolic stability was assessed by incubating each anti-miR-17 compound in mouse liver lysate. After 24 h, the percentage of remaining intact compound was calculated. Compounds that are not stable after 24 hours of incubation are potentially not stable in vivo.

The pharmacokinetic properties and tissue distribution of selected compounds were assessed in wild-type C57BL6 mice and JCK mice (an experimental model of PPD). The compound was administered to wild-type mice at 0.3, 3, or 30 mg/kg or to JCK mice at 3, 30, or 100 mg/kg. After seven days, the mice were sacrificed. Kidney and liver tissues were collected. The concentration of anti-miR-17 compound was measured in the liver and kidneys. Preference was given to compounds that accumulate in greater quantities in the kidneys compared to the liver (i.e., have a higher ratio of accumulation in the kidneys to accumulation in the liver).

A complete pharmacokinetic profile for selected compounds that passed multiple screening criteria was obtained in C57BL6 mice. In one study, mice were given a single subcutaneous injection of an anti-miR-17 compound at a dose of 30 mg/kg. In another study, mice were given three subcutaneous injections of an anti-miR-17 compound at a dose of 39 mg/kg over a two-month period. In each study, liver and kidney samples were collected at 1, 4, 8 hours, 1, 4, 7, 14, 28, and 56 days after injection.

Toxicological data.

In in vitro assays, toxicity potential was assessed using a biochemical fluorescent binding assay (FBA-biochemical fluorescent binding assay) and analysis of liver or kidney sections. FBA is performed by incubating a fluorescent dye with each compound and immediately measuring the fluorescence. Highly fluorescent compounds have the potential to cause toxicity in vivo. Analysis of liver or kidney sections is performed by incubating a tissue section from a liver core sample isolated from a rat. After 24-hour incubation, RNA was isolated from the tissue section and the expression levels of 18 pro-inflammatory genes were measured. Induction of proinflammatory gene expression indicates the potential for proinflammatory effects in vivo.

Additional in vivo toxicological evaluations were performed by administering a single subcutaneous injection of 300 mg/kg anti-miR-17 compound to normal mice (Sv129 mice). After four days, mice were sacrificed, blood was collected for serum chemistry, livers and spleens were weighed, and RNA was isolated from kidney and liver tissues. The level of expression of the pro-inflammatory gene, interferon-induced protein with tetratricopeptide repeats (IFIT) was measured. Since induction of IFIT expression potentially indicates toxicity, compounds that do not induce IFIT expression are preferred.

Throughout the screening process, some anti-miR-17 compounds performed well in several assays. Although no single compound was the best in every assay, after several rounds of screening, some compounds exhibited particularly favorable characteristics, such as high activity and a relatively high ratio of renal to hepatic accumulation. Of the nearly 200 compounds that were tested in in vitro assays, approximately 20 met criteria for further in vivo testing. These 20 compounds were eventually narrowed down to five compounds, and finally to one compound, RG4326, which had the best overall profile and was selected as a potential pharmaceutical agent. Following the identification of this compound, additional studies were conducted to evaluate potency, pharmacokinetic profile, and efficacy.

RG4326 has the following sequence and chemical modification scheme AsGsCmA _f C _f U _f UmUsGs, in which nucleosides followed by the suffix M are 2'-O-methyl-nucleosides, nucleosides followed by the suffix F are 2'- fluoronucleosides, nucleosides followed by the subscript S are S-cEt nucleosides, each cytosine is an unmethylated cytosine, and all bonds are thiophosphate bonds. As illustrated in the following examples, this compound demonstrated a strong on-target interaction with miR-17 in vivo, efficacy in a mouse model of PKD, and a pharmacokinetic profile that favored renal distribution.

In addition, the viscosity of RG4326 was found to be 6 cP at a concentration of approximately 150 mg/ml (in water at 20°C), making RG4326 in solution suitable for subcutaneous injection.

Example 3: Additional short anti-miR-17 compounds.

An additional nine-nucleotide compound (RG4047), in which each nucleoside is an S-cEt nucleoside, was tested in separate assays to compare the activity, safety, and pharmacokinetic profile with RG4326.

One of the assays used was the luciferase assay. As noted above, short (e.g., 9-nucleotide) anti-miR-17 compounds, although they may be advantageous in in vivo studies, do not necessarily perform well in in vitro transfection assays. Accordingly, transfection conditions in the luciferase assay were optimized for short anti-miR-17 compounds so that the inhibitory activity of the compounds could be measured.

RG5124 was used as a control compound. RG5124 is 9 linked nucleosides long and has the same sugar modification pattern as RG4326 but has the sequence

- 30 043761 nucleic bases, which is not complementary to miR-17.

The miR-17 luciferase reporter plasmid contained a fully complementary miR-17 binding site in the 3′-UTR of the luciferase gene. HeLa cells were transfected with the miRNA mimic and its cognate luciferase reporter, followed by transfection with anti-miR-17 at doses of 0.001, 3, 10, 30, 100, and 300 nM. At the end of the 24-hour transfection period, luciferase activity was measured. As shown in table. 2-1, RG4047, although not as potent as RG4326, inhibited miR-17 activity in a dose-dependent manner. SD indicates standard deviation.

Table 2-1

Luciferase reporter assay

Fold of luciferase derepression at each concentration of anti-T1I-17 (nM) 300 nM 100 nM 30 nM 10 nM 3 nM 0.001 nM RG4326 AsGsCmAfCfUfUmU sGs Average 11.7 13.9 14.1 10.4 5.3 1 CO 3.6 6, 5 6, 9 4.9 1.8 0.2 RG5124 AsС s AmAfUfGfCmAsСs Average 1 0.7 1 2.6 1.2 1 CO 0.3 0.4 0.4 2.8 0.4 0.2 RG4047 AsGsCsAsCsUsUsUsGs Average 7.5 8.2 3.5 2.2 1.6 1 CO 3 3 3 3 3 60

RG4047 was evaluated for in vivo activity, safety, and renal and hepatic distribution. As with large library screens, in vitro activity did not predict in vivo behavior. RG4047 induced a weak proinflammatory signal in both the kidney and liver, was a less potent miR-17 inhibitor than RG4326 in vivo in both wild-type and PLD mice, and had a much lower ratio of renal to renal accumulation. accumulation in the liver (see Table 2-2). These studies showed that the activity and properties of RG4047 were not improved compared to RG4326.

To further examine the effect of placement, type, and number of chemical modifications on activity and the ratio of renal to hepatic accumulation for the 9-mer compounds, additional anti-miR-17 compounds were evaluated in wild-type and JCK mice. The JCK model is a mouse model of slowly progressive polycystic kidney disease associated with the same gene that causes nephronophthisis type 9 in humans. Renal cysts in this mouse develop in several regions of the nephron.

MiPSA was used to evaluate the activity of each compound, as measured by displacement scale, in wild-type and JCK mice. Tissue accumulation of the anti-miR-17 compound was measured by extracting the compound using liquid-liquid extraction (LLE-liquid-liquid extraction) and/or solid-phase extraction (SPE-solid-phase extraction), followed by analysis of compound identity and concentration using high-performance liquid ion-pairing-reversed-phase chromatography coupled with time-of-flight mass spectrometry (IP-RP-HPLC-TOF).

The results for these additional compounds, as well as for RG4326 and RG4047, are shown in Table 1. 2-2.

Wild-type mice were administered a single dose of 3 mg/kg for the miPSA assay and a single dose of 30 mg/kg for the tissue accumulation assay. JCK mice were administered a single dose of 30 mg/kg for both miPSA and tissue accumulation assays. Kidney tissue was collected seven days after administration of the anti-miR-17 compound. As shown in table. 2-2, changes in the type and location of modified nucleosides demonstrated a significant effect on the inhibitory activity of miR-17 and/or the ratio of renal to hepatic accumulation of anti-miR-17 compounds. For example, while RG4324 exhibited activity as measured by miPSA, the kidney:liver ratio was lower than other compounds. A higher ratio of renal to hepatic accumulation is generally favored for a disease in which the primary site of action is the kidney. In contrast, RG4327 exhibited a high kidney:liver ratio but low activity in PLD mice. As noted above, RG4326 exhibited the most suitable potency and pharmacokinetic profile for the treatment of PPD.

- 31 043761

Table 2-2

Comparison of activity and tissue accumulation of aHTu-miR-17 compound

Compound Sequence (5' to 3') and chemical modifications Ratio of kidney to liver accumulation in wild-type mice Ratio of accumulation in the kidneys to accumulation in the liver in PBP mice miPSA indicator in wild-type mice miPSA indicator in mice with PBP 4047 AsGsCsAsCsUsUsUsGs 4.4 2.1 1.76 1, 80 4324 AsGsCmAsCmU sUmU sGs 5.0 3.9 2.81 2.53 4325 AsGsCmAmCmUmUmU sGs 12.4 5.7 1.82 2.00 4326 AsGsCmAfCfUfUmU sGs HL 6.0 2.63 2, 65 4327 AsGmCfAfCfUfUfUmGS 24.9 9.4 2.85 1.53

Example 4: Activity of RG4326 in Additional In Vitro Assays.

Additional in vitro studies were conducted to further investigate the activity of RG4326. A luciferase reporter assay was used to test the ability of RG4326 to inhibit miR-17 family members: miR-17, miR-20a, miR-93, and miR-106b. A luciferase reporter plasmid was constructed for each of miR-20a, miR-93, and miR-106b with a fully complementary miRNA binding site in the 3′-UTR of the luciferase gene. HeLa cells were transfected with a miRNA mimic and its cognate luciferase reporter, followed by transfection with 100 nM anti-miR-17. As shown in table. 3, miR-17, miR-20a, miR-93 and miR-106b were each inhibited by RG4326, demonstrating that the anti-miR-17 compound inhibits multiple miR-17 family members. Since RG4326 is 100% complementary to other untested miR-17 family members, miR-20b and miR-106b, it is expected to also inhibit these miRNAs. Data in table. 3 are also shown in FIG. 1A.

Table 3

Inhibition of the miR-17 family in vitro

Mean value (times) of luciferase derepression CO miR-17 13.1 1.6 miR-20 21.7 2.8 miR-93 10.9 0.9 miR-10 6 17.7 5.5

To test the ability of RG4326 to inhibit miR-17 regulation of endogenous targets, miR-17 target gene derepression was assessed in vitro in several renal cell types from kidneys of normal and PKD mice. Mouse renal collecting duct (IMCD3) cells were treated with 0.3, 1.2, 4.7, 18.8, 75, and 300 nM RG4326 or control oligonucleotide RG5124. Additional control groups included untreated cells and mock-transfected cells (cells treated with transfection reagent only). After a 24-hour transfection period, cells were harvested and RNA was extracted. The mRNA levels of 18 miR-17 target genes were measured and averaged to provide a pharmacodynamic signature value (PD signature value), reported as Log2 fold change (Log2FC) relative to mock transfection. As shown in table. 4, RG4326, but not control treatment, derepressed miR-17 targets in a dose-dependent manner. The data is also shown in FIG. 2B.

Table 4

PD value of a characteristic set of miR-17 parameters in IMCD3 cells

Concentration of anti-t1K-17 compound (nM) 0.3 1.2 4.7 18.8 75 300 RG4326 Average Log2FC -0.075 -0.067 0.027 0.272 0.369 0.373 CO 0.020 0.017 0.014 0.037 0.006 0.002 RG5124 Average Log2FC -0.083 -0.103 -0.097 -0.108 -0.124 -0.065 CO 0.033 0.013 0.026 0.041 0.039 0.037

The ability of RG4326 to derepress miR-17 targets was also assessed in additional kidney cell types derived from both normal and PKD mouse kidneys. Cells were treated with 30 nM RG4326 or control oligonucleotide RG5124. After a 24-hour cell transfection period

- 32 043761 RNA was collected and extracted. The mRNA levels of 18 miR-17 target genes were measured and averaged to provide a pharmacodynamic signature value (PD signature value), reported as Log2 fold change (Log2FC) relative to mock transfection. As shown in table. 5, RG4326, but not the control oligonucleotide, derepressed miR-17 targets in several different cell types derived from healthy and diseased kidneys. P<0.05 indicates a p value less than 0.05 calculated using one-way ANOVA (analysis of variance). NC indicates a change that is not statistically significant.

Table 5

Derepression of miR-17 targets in kidney cells

Mouse kidney cell type Cell line nomenclature Mouse Origin of the kidneys RG4326 FD characteristic set value RG5124 FD characteristic set value parameters (Log2FC@30 nM) parameters (Log2FC@30 nM) Collecting ducts DBA-DT Normal 0.40 ±0.09; p<0.05 0.10 ±0.05; NZ Collecting ducts DBA-PBP PBP 0.52 ±0.06; p<0.05 -0.07 ±0.02; NZ Collecting ducts IMCD3 Normal 0.57 ±0.06; p<0.05 -0.03 ±0.05; NZ Collecting ducts Ml Normal 0.18 ±0.18; p<0.05 -0.08 ±0.02; NZ Distal tubules MSCT Normal 0.10±0.01; p<0.05 0.03 ±0.01; NZ Proximal tubules LTL-DT Normal 0.35 ±0.02; p<0.05 -0.04 ±0.02; NZ Proximal tubules LTL-PBP PBP 0.39±0.01; p<0.05 -0.03 ±0.04; NZ

Example 5 Potency of RG4326 in vivo.

MicroRNA polysome shift assay (miPSA) was used to identify compounds that directly bind to miR-17 in the kidneys of normal and PKD mice. MiPSA is based on the principle that active miRNAs bind to their target mRNAs in translationally active high molecular weight polysomes (HMW), while inhibited miRNAs reside in low MW polysomes (LMW). Anti-miR treatment results in the displacement of miRNAs from BMM polysomes to HMM polysomes. Thus, miPSA provides a direct measurement of target miRNA interactions using complementary anti-miR (Androsavich et al., Nucleic Acids Research, 2015, 44:e13).

For this experiment, the model chosen for PKD was the JCK model, a mouse model of slowly progressive polycystic kidney disease associated with the same gene that causes human nephronophthisis type 9. Renal cysts in this mouse develop in several regions of the nephron.

C57BL6 mice were treated with a single subcutaneous dose of 0.3, 3, and 30 mg/kg RG4326 or instrumental anti-miR-17 (described in Example 1). JCK mice were treated with a single subcutaneous dose of 3, 30, and 100 mg/kg RG4326 or instrumental anti-miR-17. PBS treatment was used as an additional control.

Seven days after treatment, mice were sacrificed and kidney tissue was isolated for miPSA. The calculated bias estimates shown in Table. 6 demonstrated strong target interaction of RG4326 in both normal and PKD kidneys. Displacement rates following treatment with RG4326 were higher than displacement rates following treatment with the anti-miR-17 instrumental compound. Data for wild-type and JCK mice are also shown in Fig. 3A and 3B respectively.

- 33 043761

Table 6

Targeted interaction with RG4326 in vivo

miR miR 0.3 mg/ kg 3 mg/kg 30 mg/ kg 3 mg/kg 30 mg/kg 100 mg/ kg RG4326 Average 2.29 2.91 3, 19 Average 1.63 2.58 2.73 CO 0.52 0.97 0.81 CO 0.04 0.32 0.53 Instrumental anti-miR17 Average 1.51 2.05 2.77 Average 0.97 1.67 2.08 CO 0.51 0.79 0.55 CO 0.21 0.27 0.46 PBS Average 0.03 Average 0.00 CO 0.52 CO 0.28

Example 6: In Vivo Efficacy of RG4326 in Experimental Models of PPD.

Two experimental models of PBP were used to evaluate the effectiveness. Pkd2-KO mice spontaneously develop polycystic kidney disease and have been used as a model of ADPKD. See Patel et al., PNAS, 2013, 110(26):10765-10770. Pcy mice carrying a mutation in Nphp3 spontaneously develop polycystic kidney disease with slower disease progression than Pkd2-KO mice. The Pcy model is used as a model for nephronophthisis. See Narre and Peters, Nat. Rev. Nephrol., 2014, 10:587-601.

Model Pkd2-KO.

RG4326 was tested in the Pkd2-KO mouse model of ADPKD.

This model is also referred to as the PKD2-KO model. Wild-type mice were used as control mice. An oligonucleotide complementary to a microRNA not related to miR-17 was used as a specificity treatment control (RG5124).

On each of days 10, 11, 12 and 19 from birth, sex-matched mice of the same litter were given a subcutaneous injection of RG4326 at a dose of 20 mg/kg (n=12), RG5124 at a dose of 20 mg/kg (n=12), instrumental anti -miR-17 at a dose of 20 mg/kg (n=12) or PBS (n=12). Mice were sacrificed at 28 days of age and kidney weight, body weight, cystic index, serum creatinine and blood urea nitrogen (BUN) levels were measured. BUN level is a marker of kidney function. Higher BUN levels correlate with worse kidney function, so lower BUN levels are an indicator of reduced kidney injury and damage and improved function. Statistical significance was calculated by one-way ANOVA with Dunnett's multiple correction.

The cystic index is a histological measurement of the cystic area relative to the total area of the kidneys. For this assay, one kidney was perfused with cold PBS and 4% w/v paraformaldehyde and then collected for analysis. The kidneys were fixed with 4% paraformaldehyde for 2 h and then embedded in paraffin for sectioning. Sagittal sections of kidneys were stained with hematoxylin and eosin (H&E). All image processing steps were automated and performed in freely available open source software: R1 script, which used functions from the Image Bioconductor 2 EB package and the ImageMagick3 image processing toolkit. H&E Aperio SVS images of the kidneys were converted to TIFF images, and the first frame was saved for image analysis. First, the total cross-sectional area of the kidney was calculated using image segmentation. Image segmentation was used in a similar manner to find all internal structures, including the renal cyst. A filter was applied to remove all objects with a radius of less than three pixels. The cystic index is the image area associated with cysts divided by the total area of the kidneys. The cystic index was calculated separately for longitudinal and transverse sections of the kidneys for each individual animal.

The combined cystic index of individual animals was compared for each treatment group.

The results are presented in table. 7. The mean kidney weight to body weight ratio (BW/BW ratio) in Pkd2-KO mice treated with RG4326 was 29% lower than the mean BW/BW ratio of Pkd2-KO mice treated with PBS (p=0. 0099). Pkd2-KO mice treated with RG4326 showed an average 12% reduction in cystic index compared with PBS-treated Pkd2-KO mice, although the difference was not statistically significant. Mean BUN levels were reduced by 13% in

- 34 043761 Pkd2-KO mice treated with PBS, although the difference was not statistically significant. Mean serum creatinine levels in RG4326-treated Pkd2-KO mice were 18% lower than those in PBS-treated Pkd2-KO mice, although the result was not statistically significant. These results were not observed with the control oligonucleotide, indicating that they are specifically due to miR-17 inhibition. While a previous study demonstrated a decrease in MP/BW ratio, BUN, and cystic index in Pkd2-KO after anti-miR-17 treatment, no statistically significant changes were observed in this study. Treatment with the control oligonucleotide, RG5124, did not reduce the kidney weight-to-body weight ratio, cystic index, or AUB.

The MP/BW ratio, BUN and cystic index are also shown in Fig. 4A, 4B and 4C respectively.

Table 7

Efficiency of RG4326 in the PBP Pkd2-KO model

MP/MT mg/g Ratio BUN mg/dL Cystic index Serum creatinine mg/dL RG4326 Average 40.98 72.92 50.3 0.26 CO 5,973 15.1 10.21 0.05 RG5124 Average 55.35 86, 67 56, 67 0.31 CO 11.73 20.18 6,679 0.08 FSB Average 57.72 83.58 56.86 0.31 CO 18.47 23.96 7,928 0.14

These results demonstrate that RG4326 treatment results in a positive outcome in Pkd2-KO mice for the biological measure relevant to PKD treatment, kidney volume relative to body weight. Regarding this particular parameter measured, RG4326 was more effective than the anti-miR-17 instrumental compound. Treatment with RG4326 resulted in a trend toward decreased BUN and decreased cystic index in Pkd2-KO mice.

RSU model.

RG4326 was tested in a mouse model of Rcy. Wild-type mice were used as the control group. From four weeks of age, Pcy mice were treated once weekly with subcutaneous injection of RG4326 at 25 mg/kg, instrumental anti-miR-17 at 25 mg/kg, control oligonucleotide RG5124 at 25 mg/kg, or PBS. Each treatment group contained 15 male mice. Three treatments were given at 55, 56 and 57 days of age and then weekly at 6, 7, 8, 9, 10, 11, 12, 13 and 14 weeks of age. Also tested was tolvaptan, a vasopressin V2 receptor antagonist (VRA) that is prescribed to some patients with polycystic kidney disease. Mice were sacrificed at 15 weeks of age. Body weight was recorded. One of the kidneys was extracted and weighed, and the others were processed for histological analysis to calculate the cystic index as described for the study in Pkhd1/cre; Pkd2 ^F/F . Blood urea nitrogen (BUN) and serum creatinine levels were measured. Statistical significance was calculated by one-way ANOVA with Dunnett's multiple correction.

The results are presented in table. 8. Relative to the mean MP/BW ratio in PBS-treated mice, the mean MP/BW ratio in Pcy-treated mice was 19% lower in the 25 mg/kg RG4326 group (p=0.0055). In addition, cystic index was reduced by 34% in Pcy mice treated with RG4326 compared to Pcy mice treated with PBS (p=0.016). Treatment with RG4326 reduced BUN in Pcy mice by 16% compared to BUN in PBS-treated Pcy mice (p=0.0070). Treatment with control oligonucleotide or anti-miR-17 instrumental compound did not result in a statistically significant reduction in MP/BW ratio, BUN, or cystic index. Tolvaptan was not effective in this study. Data in table. 8 are also shown in FIG. 5.

- 35 043761

Table 8

Efficiency of RG4326 in the Rsu model_______________________

MP/MT Ratio AMK Cystic Index RG4326 Average 18.1 19.7 0.16 CO 2.0 2.8 0.06 RG5124 Average 21.4 21.2 0.23 CO 3.4 2.3 0.08 Tolvaptan Average 20.1 24.4 026 CO 4.5 3.4 0.09 FSB Average 22.5 23.4 0.24 CO 3.9 3.8 0.07

These data demonstrate in an additional model of PKD that treatment with RG4326 results in reductions in kidney weight, BUN, and cystic index.

Example 7: Pharmacokinetic evaluation of RG4326.

Because of their reduced ability to bind serum proteins, which is a property that determines the distribution of oligonucleotides in the body, short oligonucleotides are not strongly expected to have pharmacokinetic properties that make them suitable for use as drugs. RG4326 was incubated in mouse, monkey, or human liver homogenate. The identity and concentration of RG4326 and metabolites were determined after 24-hour incubation. RG4326 and metabolites were extracted using liquid-liquid extraction (LLE) and/or solid-phase extraction (SPE), which were then analyzed for identity and concentration using ion-pairing-reversed-phase high performance liquid chromatography. coupled with time-of-flight mass spectrometry (IP-RP-HPLC-TOF). As shown in table. 9, despite its short length, RG4326 was found to have a particularly favorable pharmacokinetic profile, with more than 95% of the parent compound RG4326 remaining intact after 24 hours of incubation.

Table 9

Metabolic stability in vitro in mouse, monkey and human liver lysate

Ex Vivo liver lysate (% analyte) Compound Subsequence Mouse Monkey Human RG4326 5'- AsGsCmAfCfUfUmUsGs -3' 99.1 95, 9 98.7 Metabolite 1 5'-A _s G _s CmAfCf-3' 0.3 1.8 0.6 Metabolite 2 5'-A _s GsCmAf-3' 0.6 2.3 0.7

Pharmacokinetic behavior was assessed by administering a single subcutaneous dose of 30 mg/kg RG4326 or the anti-miR-17 instrumental compound to wild-type mice. At 1, 4, 8 hours, 1, 7, 14, 28 and 56 days after a single injection, mice were sacrificed and the mean concentration of anti-miR compound in kidney and liver tissue was measured (μg/g) as described above. The area under the curve (AUC) was calculated for kidney and liver tissue using the formula μg-h/g, where μg is the amount of oligonucleotide in the tissue, h is the time of tissue collection in hours, and g is the weight of the tissue. The ratio of kidney AUC to liver AUC was determined. Kidney tissue was also processed for miPSA to determine the target interaction for each compound in this study. PSA AUC was calculated using the formula Log2FCxh, where Log2FC is the replacement value, h is the moment of tissue collection in hours. Kidney potential on day 7 was calculated using the formula Log2FC+r/MKr, with Log2FC being the replacement value determined by miPSA, g being the mass of kidney tissue, and μg being the amount of anti-miR in kidney tissue on day seven.

As shown in table. 10, the ratio of kidney AUC to liver AUC for RG4326 is higher than that for the instrumental anti-miR-17. Strikingly, although the kidney AUC is lower for RG4326 than for the αanti-miR-17 compound, the activity as determined by miPSA is significantly higher. Thus, RG4326 exhibits greater activity at lower concentrations in the kidney, the primary target tissue for PBP.

- 36 043761

Table 10

Pharmacokinetic profile of RG4326

In vivo profile after a single dose at 30 mg/kg Instrumental Anti-miR-17 RG4326 Pharmacokinetics Kidney AUC (µg * h/g; one hour to 56 days) 20711 5347 Liver AUC (µg * h/g; one hour to 56 days) 20275 1206 Kauc/Lauc ratio 1.0 4.4 Inhibition of miR- 17 Kidney miPSA AUC(Log2FC * h; 8 hours to 7 days) 296 463 Potency Kidney D7 (Log2FC * g/mcg) 0.047 0.351

The pharmacokinetic behavior of RG4326 was further characterized in wild-type (C57B16) and JCK mice. Groups of 5 mice received three subcutaneous injections of 10 mg/kg on each of three consecutive days. At 1.4, 7, 14, and 21 days after the third and final injection, mice were sacrificed and plasma, kidney, and liver samples were collected. To measure RG4326, RG4326 was extracted using liquid-liquid extraction (LLE) and/or solid-phase extraction (SPE), and then analyzed for identity and concentration using ion-pairing-reversed-phase high-performance liquid chromatography in combined with time-of-flight mass spectrometry (IP-RP-HPLC-TOF).

The data is summarized in table. 11. RG4326 was observed to be stable in both plasma and tissues, with more than 90% of the parent compound remaining after 21 days. Anti-miR is distributed rapidly to tissues, within several hours after injection, and primarily to the kidney. The half-life is approximately eight days in the liver and kidneys of wild-type mice, approximately six days in the liver of JCK mice, and approximately 8 days in the kidneys of JCK mice. In wild-type mice, the kidney AUC to liver AUC ratio was 17. In PLD mice, the kidney AUC to liver AUC ratio was 13. These data demonstrate that the pharmacokinetic profile of RG4326 is comparable in normal and PLD mice.

Table 11 __________Pharmacokinetic profile of RG4326 in normal and PBP mice__________

Mouse model Normal PBP Line of mice C57BL6 JCK Tissue matrix Liver Bud Liver Bud %Parents >90% >90% >90% >90% From ₂ 4h 1.6 µg/g 61.4 µg/g 5.9 µg/g 66.5 µg/g t 1/2 ~ 8 days ~ 8 days ~ 6 days ~ 8 days AUG 0-21days 17 mcg * day/g 282 mcg * day/g 37 mcg * day/g 497 mcg * day/g Po/Pe ratio (AUC) 17 13 Po/Pe ratio (C ₂ 4h) 38 eleven

Example 8: Safety Assessment of RG4326.

The potential for renal and liver toxicity was assessed in in vitro, ex vivo and in vivo assays.

Toxicity potential was assessed using a biochemical fluorescent binding assay (FBA biochemical fluorescent binding assay). FBA is performed by incubating a fluorescent dye with each compound and immediately measuring the fluorescence. Results are expressed as fold change (linear FC) relative to control samples.

Highly fluorescent compounds have the potential to cause toxicity in vivo.

Ex vivo assays were performed using liver or kidney tissue sections. Liver or kidney section analysis is performed by incubating a tissue section from a liver or kidney core sample isolated from a rat.

-

Claims (15)

After a 24-hour incubation, RNA was extracted from the tissue section and the expression levels of 18 pro-inflammatory genes, including IFIT, were measured. Log2 fold change (Log2-FC) transformation was performed relative to PBS treatment. Induction of proinflammatory gene expression indicates the potential for proinflammatory effects in vivo. In vivo analysis was performed on normal Sv129 mice. A single subcutaneous dose of RG4326 300 mg/kg was administered. PBS and two non-miR-17 anti-miRs, one known to be pro-inflammatory (positive control) and the other known to be non-pro-inflammatory (negative control), were included as controls. Four days later, the mice were sacrificed. Kidney and liver tissue were isolated for RNA isolation. The expression level of the IFIT gene, known to be induced during the inflammatory response, was measured and normalized to mouse GAPDH. Log2 fold change (Log2-FC) transformation was performed relative to PBS treatment. Table 12 Security profile RG4326 Positive control Negative control RG4326 Biochemical Fluorescence Binding Assay Relative Fluorescence Unit (Linear FC) 136.4 ±14.9 46.3 ± 14.7 24.9 ± 3.1 Ex Vivo analysis of kidney sections Characteristic distribution of pro-inflammatory parameter (Log2-FC) 1.35 ±0.35 0.39 ±0.07 -0.30 ± 0.22 Ex Vivo Liver Section Analysis IFIT3 Expression (Log2-FC) 7.57 ±0.62 0.54 ±0.60 1.11 ±0.32 In vivo acute phase analysis IFIT expression in kidney (Log2-FC) Expression of IFIT in the liver (Log2-FC) 1.29 ±0.58 2.24 ±0.84 0.28 ±0.31 0.62 ±0.54 0.34 (n=1) 0.21 ± 0.08 These data demonstrated that RG4326 exhibited a favorable safety profile and minimal risk of inflammatory propensity based on multiple analyses. CLAIM 1. A modified oligonucleotide consisting of 9 linked nucleosides, in which the specified modified oligonucleotide has the following distribution of nucleosides in orientation from 5' to 3': wherein nucleosides followed by a subscript M are 2'-O-methylnucleosides, nucleosides followed by a subscript F are 2'-fluoronucleosides, nucleosides followed by a subscript S are an S-cEt nucleoside, and all bonds are thiophosphate bonds, and the nucleobase sequence of said modified oligonucleotide is 5'-AGCACUUUG-3', each cytosine independently selected from unmethylated cytosine and 5-methylcytosine, or a pharmaceutically acceptable salt thereof. 2. The modified oligonucleotide according to claim 1, which is a pharmaceutically acceptable salt of the specified structure. 3. The modified oligonucleotide according to claim 2, wherein said pharmaceutically acceptable salt is a sodium salt. - 38 043761 4. Modified oligonucleotide having the structure or a pharmaceutically acceptable salt thereof. 5. A modified oligonucleotide according to claim 4, characterized in that it is a pharmaceutically acceptable salt of the specified structure. 6. Modified oligonucleotide according to claim 4, characterized in that it is a sodium salt of the specified structure. - 39 043761 7. Modified oligonucleotide having the structure 8. A pharmaceutical composition containing a modified oligonucleotide according to any one of claims 1 to 7 and a pharmaceutically acceptable diluent. 9. The pharmaceutical composition according to claim 8, characterized in that said pharmaceutically acceptable diluent is an aqueous solution. 10. The pharmaceutical composition according to claim 9, characterized in that said aqueous solution is a physiological solution. 11. A pharmaceutical composition containing a modified oligonucleotide according to any one of claims 1 to 7 and a pharmaceutically acceptable diluent, which is a lyophilized composition. 12. Pharmaceutical composition consisting of a modified oligonucleotide according to any one of claims 1-7 in physiological solution. 13. A method of inhibiting the activity of one or more members of the miR-17 family in a cell, comprising contacting the cell with a modified oligonucleotide according to any one of claims 1 to 7. 14. A method of inhibiting the activity of one or more members of the miR-17 family in a subject, comprising administering to the subject a pharmaceutical composition according to any one of claims 8 to 12. 15. The method of claim 14, wherein said subject has a disease associated with miR-17. -