ES2948122A1 - Compounds for the treatment and/or prevention of an infection or disease caused by Helicobacter or Campylobacter (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

Compounds for the treatment and/or prevention of an infection or disease caused by Helicobacter or Campylobacter. The present invention relates to a compound of formula I, where the groups R 1 to R 5 and Cy have the meaning described in the description, for use in the treatment and/or prevention of an infection or disease caused by the infection of a bacteria of the genus Helicobacter or Campylobacter. (Machine-translation by Google Translate, not legally binding)

Description

DESCRIPTION

Compounds for the treatment and/or prevention of an infection or disease caused by H elicobacter or Cam pylobacter

The present invention relates to a compound of formula I for use in the treatment and/or prevention of an infection or disease caused by infection with a bacteria of the genus Helicobacter or Campylobacter.

A N TEC ED IN TES OF THE INVENTION

H. pylori is considered the most prevalent bacterial pathogen in humans. A recent study suggests that more than half of the world's population is infected (Hooi JKY, et al. Global prevalence of Helicobacter pylori infection: systematic review and metaanalysis. Gastroenterology 2017; 153: 420-429). The microorganism passes through the mucosal layer that protects the stomach and adheres to and colonizes gastric epithelial cells. Unless the infection is adequately treated, the bacteria can persist in the stomach throughout the patient's life, constituting the most common cause of chronic gastritis and contributing to the pathogenesis of more serious clinical manifestations such as peptic ulcer, gastric adenocarcinoma and lymphoma. mucosa-associated lymphoid tissue (MALT lymphoma) (Kusters JG, et al. Pathogenesis of Helicobacter pylori infection. Clin Microbiol R ev 2006; 19: 449-490; and Moss SF The clinical evidence linking Helicobacter pylori to gastric cancer. C e ll Mol Gastroenterol Hepatol 2017; 3: 183- 191). In 1994, H. pylori was classified as a type I carcinogen (definite human carcinogen) for gastric cancer by the International Agency for Research on Cancer. About 60% of intestinal-type gastric adenocarcinomas and 98% of stomach MALT lymphomas are associated with H. pylori infection. Likewise, chronic infection with this microorganism significantly increases the patient's risk of developing other non-gastric lymphomas, such as diffuse large B-cell lymphoma and ocular adnexal lymphoma. The bacteria has also been implicated in several extra-gastrointestinal disorders, such as ischemic heart and cerebrovascular diseases, atherosclerosis, among others.

H. pylori is a microaerophilic Gram-negative bacteria of the Epsilonproteobacteria class, to which other pathogens of clinical relevance belong, such as C. jejuni. Cam pylobacter is one of the four main causes of diarrheal disease and is considered the most common bacterial cause of gastroenteritis in the world (Kaakoush NO, et al. Epidemiology of Cam pylobacter infection. Clin Microbiol R ev 2015; 28: 687-720 ). Cam pylobacter infections are usually mild, but can be fatal in very young children, the elderly, and immunocompromised individuals. The bacteria colonizes the intestinal epithelium causing acute gastroenteritis, watery diarrhea, fever, nausea and vomiting. Occasionally, the infection can trigger serious extraintestinal events such as bacteremia, meningitis and Guillain-Barré syndrome or severe gastrointestinal pathologies such as pseudomembranous colitis, appendicitis and massive gastrointestinal hemorrhage. Within the genus Campylobacter, the species C. jejuni is associated with most of the infections reported in humans (Igwaran A., et al. Human campylobacteriosis: A public health concern of global importance. Heliyon 2019; 5 : e02814).

Given the alarming development and accumulation of antimicrobial resistance mechanisms due to strains of H. pylori and C. jejuni throughout the world, with the consequent decrease in the effectiveness of antimicrobial treatments considered first-line, the WHO classified these two in 2017 pathogens as “high priority” for the search and development of new antibiotics (Tacconelli E., et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect D is 2018; 18: 318-327).

Therefore, it would be desirable to have safe drugs, highly effective as bactericides against pathogenic epsilonproteobacteria such as Helicobacter pylori and Cam pylobacter jejuni species and selective against relevant members of the human microbiota.

DESCRIPTION OF THE INVENTION

In a first aspect, the present invention relates to a compound of formula I for its use in the treatment and/or prevention of an infection caused by a bacteria of the genus Helicobacter or Cam pylobacter or for its use in the treatment and/or prevention of a disease caused by infection with a bacteria of the genus Helicobacter or Campylobacter, and preferably where the bacteria of the genus Helicobacter is of the species Helicobacter pylori and where the bacteria of the genus Cam pylobacter is of the species Cam pylobacter jejuni.

where:

Ri is an H or halogen group;

R2 is an H or halogen group;

R3 is a group H, halogen, C _1-4 alkyl, -COC _1-4 alkyl; -COOH, -COOC _1-4 alkyl, -OH, -NH ₂ , -SH or -NO ₂ , where C1.4 alkyl is optionally substituted by one or more Rg groups;

R4 is an H or C1-4 alkyl group;

Rs is an H, -COOH or -COOC _1-4 alkyl group;

Cy is a group of formula la, Ib, le or Id:

R6 is an H, halogen, C1-4 alkyl, -COOH or -COOC1-4 alkyl group;

R7 is an H, halogen, C1-4 alkyl, -COOH, -COOC1-4 alkyl or -NO2 group, where C1-4 alkyl is optionally substituted by one or more R i0 groups;

R8 is H or halogen;

R9 is a halogen group; and

Rio is a halogen group.

In another embodiment the invention relates to a compound of formula I for the use defined above where Ri is a group H, Cl or Br, preferably where Ri is H or Br, and more preferably where Ri is H.

In another embodiment the invention relates to a compound of formula I for the use defined above where R2 is an H, Cl or Br group, and preferably where R2 is H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where R4 is an H or _CH3 group.

In another embodiment the invention relates to a compound of formula I for the use defined above where R5 is an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above, where Cy is a la group.

In another embodiment the invention relates to a compound of formula I for the use defined above where R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where R ₉ is a Cl or Br group.

In another embodiment the invention relates to a compound of formula I for the use defined above where R10 is a Cl or Br group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H; and

R2 is a group H, Cl or Br, and preferably where R2 is H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is a group H, Cl or Br, preferably where R1 is H or Br, and more preferably where Ri is H; and

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H; and

R4 is an H or CH ₃ group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H; and

Rsis an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H; and

R ⁷ is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H; and

R8 is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br; and

Cy is a group .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

Cy is a group .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R4 is an H or CH ₃ group; and

Cy is a group .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

Rs is an H or -COOH group; and

Cy is a group .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and Cy is a group la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ; and

Cy is a group .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

Rs is a group H, Br or Cl, and preferably H or Br;y

Cy is a group .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br; and

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br; and

R4 is an H or CH ₃ group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br; and

R5 is an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

Cy is a group ; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

R4 is an H or CH ₃ group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

R5 is an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R4 is an H or CH ₃ group; and

R5 is an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R4 is an H or CH ₃ group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R4 is an H or CH ₃ group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R4 is an H or CH ₃ group; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Rs is an H or -COOH group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Rs is an H or -COOH group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Rs is an H or -COOH group; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or - NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and R8 is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -CO CH ₃ or - NO ₂ ; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

R4 is an H or CH ₃ group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

Rsis an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R4 is an H or CH ₃ group; and

Rsis an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R4 is an H or CH ₃ group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R4 is an H or CH ₃ group; and

R ⁷ is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R4 is an H or CH ₃ group; and

R8 is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R5 is an H or -COOH group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

Rs is an H or -COOH group; and

R ⁷ is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

Rs is an H or -COOH group; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

Rsis an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

Rsis an H or -COOH group.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R5 is an H or -COOH group; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC2Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC2Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R ⁷ is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group; and

R8 is a group H, Br or Cl, and preferably H or Br;y

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is a group H, Br or Cl, and preferably H or Br;y

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ;

Rs is a group H, Br or Cl, and preferably H or Br;y

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R5 is an H or -COOH group;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ;

R8 is a group H, Br or Cl, and preferably H or Br;y

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ;

Rs is a group H, Br or Cl, and preferably H or Br;y

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R5 is an H or -COOH group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R5 is an H or -COOH group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -CO CH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -CO CH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R5 is an H or -COOH group; and

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

Rs is a group H, Br or Cl, and preferably H or Br;y

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

Rs is an H or -COOH group; and

Rs is a group H, Br or Cl, and preferably H or Br;y

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ Hs, -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or - NO ₂ .

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, CH ₃ , Cl, Br, -COOH, -COCH ₃ or -NO ₂ ; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and R8 is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH; and Rs is a group H, Br or Cl, and preferably H or Br.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH;

Rs is a group H, Br or Cl, and preferably H or Br; AND

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -CO O CH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, Rs is a group H, Br or Cl, and preferably H or Br; and

Cy is a group of formula la.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

Ri is an H, Cl or Br group, preferably where Ri is H or Br, and more preferably where Ri is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, Rs is a group H, Br or Cl, and preferably H or Br; and

Cy is a group of formula Ib.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, Rs is a group H, Br or Cl, and preferably H or Br; and

Cy is a formula group le.

In another embodiment the invention relates to a compound of formula I for the use defined above where:

R1 is an H, Cl or Br group, preferably where R1 is H or Br, and more preferably where R1 is H;

R2 is a group H, Cl or Br, and preferably where R2 is H or Br;

R3 is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ ;

R4 is an H or CH ₃ group;

R is an H or -COOH group;

R6 is a group H, Cl, Br, CH ₃ or -COOH, and preferably H, Br, CH ₃ or -COOH;

R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ , and preferably H, and

Cy is a group of formula Id.

In another embodiment the invention relates to a compound of formula I for the previously defined use selected from:

Ċ

Ċ

In another embodiment the invention relates to a compound of formula I for the use defined above selected from A1 to A30.

In another embodiment the invention relates to a compound of formula I for the use defined above selected from A 1, A2, A4 to A6, A8 to A10, A 12 to A 17, A 19 to A22, A26 to A28, A 31 and A32.

In another embodiment the invention relates to the compound of formula I according to the use defined above, where the disease caused by an infection is a gastrointestinal pathology, and preferably where the gastrointestinal pathology is selected from acute gastritis, chronic gastritis, duodenitis, functional dyspepsia, gastric ulcer, duodenal ulcer, gastric adenocarcinoma and mucosa-associated lymphoid tissue lymphoma (MALT lymphoma).

The present invention also relates to a pharmaceutical composition comprising at least one compound of the invention (or a pharmaceutically acceptable salt or solvate thereof) and one or more pharmaceutically acceptable excipients. The excipients must be “acceptable” in the sense of being compatible with the other ingredients of the composition and not being harmful to whoever takes said composition.

Thus, another aspect of the present invention refers to a pharmaceutical composition comprising at least one compound of formula I defined above, for use in the treatment and/or prevention of an infection caused by a bacteria of the genus Helicobactero Cam pylobacter or for its use in the treatment and/or prevention of a disease caused by an infection caused by a bacteria of the genus Helicobacter or Campylobacter, and preferably where the bacteria of the genus Helicobacter is of the species Helicobacter pylori and where the bacteria of the genus Cam pylobacter is of the species Cam pylobacter jejuni.

In another embodiment the invention relates to the pharmaceutical composition defined above, where the disease caused by an infection is a gastrointestinal pathology, and preferably where the gastrointestinal pathology is selected from acute gastritis, chronic gastritis, duodenitis, functional dyspepsia, gastric ulcer, ulcer duodenal, gastric adenocarcinoma and mucosa-associated lymphoid tissue lymphoma (MALT lymphoma).

Another aspect of the invention relates to the use of a compound of formula I or a pharmaceutical composition thereof for the manufacture of a medicament for the treatment and/or prevention of a disease caused by infection by a bacteria of the genus Helicobacter or Campylobacter . , and preferably where the bacteria of the genus Helicobacter is of the species Helicobacter pylori and where the bacteria of the genus Cam pylobacter is of the species Cam pylobacter jejuni.

Another aspect of the invention relates to a method of treatment and/or prevention of a disease caused by infection by a bacteria of the genus Helicobacter or Campylobacter, and preferably where the bacteria of the genus Helicobacter is of the species Helicobacter pylori and where the bacteria of the genus Cam pylobacter is of the species Cam pylobacter jejuni, for a subject in need, especially a human being, comprising administering to said subject an effective amount of a compound of formula I as defined above or a pharmaceutical composition of the same.

In the above definitions, the term C _1-4 alkyl, as a group or part of a group, means a straight-chain or branched alkyl group containing 1 to 4 C atoms and includes the groups methyl, ethyl, propyl, isopropyl , butyl, isobutyl, sec-butyl and tert-butyl.

A halogen radical or its abbreviation halo means fluoro, chloro, bromo or iodine.

The term "optionally substituted by one or more" means the possibility of a group being substituted by one or more, preferably by 1, 2, 3 or 4 substituents, more preferably by 1, 2 or 3 substituents and even more preferably by 1 or 2 substituents, as long as said group has enough available positions that can be substituted. If present, said substituents may be the same or different and may be located on any available position.

Throughout this description, the term "treatment" refers to eliminating, eradicating, totally eradicating, reducing or diminishing the cause or effects of a disease. For the purposes of this invention, treatment includes, but is not limited to be limited to them, alleviate, reduce or eliminate one or more symptoms of the disease; reduce the degree of disease, stabilize (that is, not worsen) the state of the disease, delay or slow the progression of the disease, alleviate or improve the state of the disease and remit (whether complete or partial). Examples include, among others, “eradicate the infection,” “total eradication of the microorganism,” and “decrease colonization of the microorganism.”

As used in the present invention, the term "prevention" refers to preventing the occurrence of the disease that occurs in a patient who is predisposed or has risk factors, but who does not yet present symptoms of the disease. Prevention also includes preventing the reappearance of a disease in a subject who has previously suffered from said disease.

The compounds of the present invention contain one or more basic nitrogens and could therefore form salts with acids, both organic and inorganic. Some compounds of the present invention could contain one or more acidic protons and therefore could also form salts with bases.

There is no limitation on the type of salt that can be used, provided that when used for therapeutic purposes they are pharmaceutically acceptable. Pharmaceutically acceptable salts are those salts that, in medical judgment, are suitable for use in contact with the tissues of humans or other mammals without causing undue toxicity, irritation, allergic response or the like. Pharmaceutically acceptable salts are widely known to anyone skilled in the art.

The compounds of formula I and their salts may differ in certain physical properties, but are equivalent for the purposes of the invention. All salts of the compounds of formula I are included within the scope of the invention.

The compounds of the present invention can form complexes with solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as solvates. As used herein, the term solvate refers to a complex of varying stoichiometry formed by a solute (a compound of formula I or a salt thereof) and a solvent. Examples of solvents include pharmaceutically acceptable solvents such as water, ethanol and the like. A complex with water is known as a hydrate. The solvates of the compounds of the invention (or their salts), including hydrates, are included within the scope of the invention.

The compounds of formula I can exist in different physical forms, that is, in amorphous form and crystalline forms. Likewise, the compounds of the present invention may have the ability to crystallize in more than one form, a characteristic known as polymorphism. Polymorphs can be differentiated by several physical properties well known to those skilled in the art, such as their X-ray diffractograms, melting points or solubility. All physical forms of the compounds of formula I, including all their polymorphic forms (“polymorphs”), are included within the scope of the present invention.

Some compounds of the present invention could exist in the form of various diastereoisomers and/or various optical isomers. Diastereoisomers can be separated by conventional techniques such as chromatography or fractional crystallization. Optical isomers can be resolved by using conventional optical resolution techniques to give optically pure isomers. This resolution can be carried out on synthesis intermediates that are chiral or on products of formula I. Optically pure isomers can also be obtained individually using enantiospecific syntheses. The present invention covers both individual isomers and their mixtures (for example racemic mixtures or mixtures of diastereoisomers), whether obtained by synthesis or by physically mixing them.

The compounds of the present invention can be administered in the form of any pharmaceutical formulation, the nature of which, as is well known, will depend on the nature of the active ingredient and its route of administration. In principle, any route of administration can be used, for example oral, parenteral, nasal, ocular, rectal, and topical.

Throughout the description and claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will emerge partly from the description and partly from the practice of the invention. The The following examples and figures are provided by way of illustration, and are not intended to be limiting of the present invention.

DESCRIPTION OF THE FIGURES

F ig .1 Shows the in vitro inhibition of the biological activity of the transcriptional regulator HsrA. (A) Under optimized in vitro conditions, the recombinant HsrA protein specifically recognizes and binds to DNA sequences of its target promoters. The binding of the protein to the target DNA determines the formation of a stable DNA-protein complex, with a molecular size greater than that of free DNA, experiencing a delay in electrophoretic mobility. The specific binding of HsrA to its target promoter PporGDAB and the formation of an HsrA-DNA complex detectable by the EMSA technique is directly proportional to the concentration of the recombinant protein and cannot be inhibited by the presence of a nonspecific competing DNA fragment. . The optimal protein concentration for the inhibition assays of the compound of interest is that minimum concentration of HsrA that manages to completely complex the target promoter, in this case 6 p.M. (B) The compound of interest inhibits the binding of the HsrA protein to its target promoter, preventing the formation of HsrA-DNA complexes. The inhibition capacity of the compound of interest on the in vitro activity of HsrA is directly proportional to the concentration of the inhibitor, managing to completely inhibit the activity of the protein with some of the inhibitor concentrations tested in the assay.

F ig .2 Shows the interaction model between the HsrA protein of Helicobacter pylori and the experimentally tested ligand. (A) The ligand (compound A0) binds to the C-terminal domain of the protein and interacts directly with amino acid residues involved in recognition and binding to DNA that form a helix-turn-helix (HTH) motif. The DNA-binding helix-turn-helix (HTH) motif in the HsrA regulator comprises amino acids 165 to 199 within the C-terminal domain and is formed by two α-helices separated by a small turn with no secondary structure. This motif has been highlighted in dark color in Figures 2A and 2B and further indicated with an arrow. (B) Surface model of the HsrA protein showing the ligand binding site, located in a pocket or small cavity in the C-terminal domain. The surface corresponding to the HTH motif has been highlighted in dark color and indicated with an arrow (C) The binding of the A0 ligand to the protein is It is stabilized by non-covalent interactions with residues Leu126, Ileu135, Leu152, Lys194, Met195, Pro198, Leu199 and Thr203, which are indicated in the figure. The images have been obtained using the PyMol program.

EXAMPLES

Next, the invention will be illustrated through tests carried out by the inventors, which demonstrate the effectiveness of the product of the invention.

General procedures

1. Cloning of the hsrA gene

Genomic DNA of Helicobacter pylori strain 26695 (ATCC 700392) was purified by the phenol-chloroform method. The biomass obtained from 100 mL of Helicobacter pylori 26695 culture in brain heart infusion (BHI) broth supplemented with 4% fetal bovine serum (FBS) for 48 h under microaerobic conditions was resuspended in 400 pL of 10 mM Tris-buffer. CI (pH 8) and 1 mM EDTA. 1% SD S and 10 pL of proteinase K (10 mg/mL) were added to this cell suspension and incubated for 1 h at 550C. After this time, the sample was washed with 1 volume (same volume of the sample) of phenol, then with 1 volume of phenolchloroform (1:1) and finally two washes were carried out with 1 volume of chloroform. The genomic DNA was precipitated overnight at -20 °C with 2 volumes of cold absolute ethanol and 0.1 volume of 3M sodium acetate (pH 5.2), the precipitate was washed with 70% ethanol and finally resuspended in 10 mM Tris-CI buffer (pH 8) and 1 mM EDTA. The complete sequence of the hsrA gene ( hp1043) was amplified by PCR from the purified genomic DNA of Helicobacter pylori strain 26695 (ATCC 700392) using the primers 5 '-GGAA TTC CA TA TG CGCG TTC TA C TG A TT G - 3' (SEQ ID NO: 1) and 5'-CCCAAGCTTTTACTCTTCACA CGCCGG -3' (SEQ ID NO: 2) and the high fidelity Pfu DNA polymerase enzyme (Agilent). The resulting PCR product was digested with the restriction enzymes Nde\ and Hind\\ \ and cloned between the same restriction sites of the expression vector pET-28a (Novagen). The final vector was partially sequenced to check the integrity of the gene.

2. Recombinant expression and purification of the HsrA protein

Competent Escherichia coli BL21 (DE3) cells were transformed with the vector pET-28a containing the hsrA gene from Helicobacter pylori ATCC 700392. This vector allows the recombinant protein to be expressed as a fusion protein to a peptide with 6 histidine residues at its N-terminal end. The transformed Escherichia coli cells were cultured in Luria-Bertani (LB) medium supplemented with 50 μg/mL kanamycin under conditions of vigorous shaking and 37°C until reaching an optical density of 0.8 measured at a wavelength of 600 nm. The expression of the recombinant HsrA protein was induced by adding 1 mM IPTG to the culture medium, after which the cells were allowed to grow under the same temperature and shaking conditions for 6 hours. After this time, the culture was centrifuged at 8,000 rpm for 10 min at 4°C and the cell biomass obtained was washed with cold PBS pH 7.4.

The recombinant HsrA protein is expressed in soluble form in the cytoplasm of Escherichia coli BL21 (DE3). For protein purification, cells were resuspended in 50 mM Tris-CI buffer (pH 8), with 500 mM NaCl, 10 mM imidazole, and 1 mM PMSF. Cell disruption was performed using 10 45-second ultrasonic cycles in an ice bath, with 30-second breaks between each cycle. Cellular debris was removed by centrifugation at 18,000 rpm for 20 min at 4°C. The recombinant protein with histidine tail contained in the supernatant was purified by immobilized metal affinity chromatography (IMAC) using the Chelating Sepharose Fast Flow matrix (GE Healthcare) loaded with Ni2+ ions, previously equilibrated with the buffer used in cell lysis. The matrix-bound recombinant protein was eluted using an imidazole gradient (0.01 to 1 M) and dialyzed against 50 mM Tris-HCl buffer (pH 8), 300 mM NaCl, and 10% glycerol. The protein concentration was determined using the commercial B CA™ Protein Assay kit (Thermo FisherScientific). The poly-histidine tail was removed from the N-terminal end of recombinant HsrA by treatment with thrombin (GE Healthcare), using 10 U of enzyme for each milligram of recombinant protein. After enzymatic restriction, the recombinant HsrA protein was obtained in the dead volume of a second purification step using IMAC-Ni2+. The protein thus purified was stored at -20°C.

3. In vitro biological activity of HsrA v inhibition assays

The HsrA protein is a response regulator with DNA binding activity, which acts as a transcriptional regulator. The biological activity of this protein is determined by the electrophoretic mobility shift assay (EMSA). In this assay, the transcriptional regulator contacts a DNA fragment corresponding to the promoter region of its target genes. If the protein is active, it will bind specifically to its target promoters and form a protein-DNA complex that will experience a delay in electrophoretic mobility with respect to free DNA, given the larger molecular size of the complex. As a target promoter region of HsrA, a 288 bp sequence corresponding to the promoter of the porGDAB operon was amplified by PCR from the genomic DNA of Helicobacter pylori A TC C 700392 using 5'- CCCCACACTTGCCCCATACAG AC -3' (SEQ ID NO: 3) as primers. ) and 5'-G CA TG CCA TCTA A TTTG AAA CA TG G -3' (SEQ ID NO: 4). The synthesized promoter was purified using the commercial illustra™ G FX PCR DNA and Gel Band Purification kit (GE Healthcare) and its concentration was quantified using a NanoVue Plus spectrophotometer (GE Healthcare). For biological activity assays of freshly purified recombinant HsrA protein, increasing concentrations of the protein, from 2 to 7 pM, were mixed with 120 ng of DNA in 10 mM bis-Tris buffer (pH 7.5), 40 mM KCl , 100 μg/mL BSA, 1 mM DTT and 5% (v/v) glycerol, in a final reaction mixture volume of 20 pL. As nonspecific competitor DNA, 120 ng of a 121 bp fragment corresponding to a portion of the coding sequence of the pkn22 gene ( alr2502) of the cyanobacterium Anabaena sp. was added to all mixtures. P CC 7120. The protein and DNA mixture is incubated at 25 °C for 30 minutes and subsequently separated by non-denaturing electrophoresis in a 6% polyacrylamide gel using 25 mM Tris buffer and 190 mM glycine for the electrophoretic chamber. Polyacrylamide gels were stained with SY BR ® Safe DNA Gel Stain (Invitrogen) and processed with Gel Doc 2000 Image Analyzer (Bio-Rad).

For biological activity inhibition assays, 6 pM of the recombinant HsrA protein was mixed with 2; 1; 0.5; 0.1 and 0.05 mM of compound A0 described in the present invention. Since the compound of interest was dissolved in 100% DMSO, the protein in the presence of the same amount of DMSO was included as a negative control, replacing the inhibitor. The protein and inhibitor mixture in 10 mM bis-Tris buffer (pH 7.5), 40 mM KCl, 100 μg/mL BSA, 1 mM DTT, and 5% (v/v) glycerol was incubated for 10 min at 25 °C. After this time, 120 ng of target promoter ( porGDAB) and 120 ng of competitor DNA ( pkn22) were added to each mixture. The rest of the procedure was carried out under the same conditions of the activity assay described above. Each assay was performed in triplicate.

4. Antimicrobial activity against H elicobacter pylori of the HsrA inhibitor The antimicrobial activity of compound A0 was tested against two different strains of Helicobacter pylori, the strain A TC C 700392 and the clarithromycin-resistant strain A TC C 700684. Both strains were cultured on blood agar (base) N0 2 (OXOID) supplemented with 8% defibrinated horse blood (OXOID) in a humid microaerobic atmosphere (85% N ₂ , 10% CO ₂ , 5% O ₂ ) at 37°C. The minimum inhibitory concentration (MIC) of each compound was determined by the microdilution method using 96-well polystyrene plates with flat bottoms. For assays, bacteria were subcultured in brain heart infusion (BHI) broth supplemented with 4% fetal bovine serum (FBS) for 48 h under microaerobic conditions. After this time, the cultures were diluted with 4% FBS BHI broth to an optical density of 0.01 measured at a wavelength of 600 nm. For the microdilution plate assay, 100 pL of the adjusted bacterial cultures were dispensed into each of the wells of the plate, except the first column of the plate, which received 200 pL of bacterial suspension with 5 pL of the inhibitory compound. A0, at a concentration of 10.24 mg/mL in 100% DMSO. Serial double dilutions of the compound were carried out, evaluating the antibacterial activity of a range of concentrations between 256 and 0.125 mg/L. Positive and negative growth controls with 4% FBS BHI broth without the presence of inhibitors, inoculated and not inoculated with bacteria, were incorporated into all plates. Controls with DMSO and clarithromycin were also incorporated. All plates were incubated under microaerobic conditions at 37°C and visually examined after 48 h of incubation. The minimum inhibitory concentration (MIC) was defined as the minimum concentration of the compound that completely inhibited the visible growth of the bacteria after 48 h.

The minimum bactericidal concentration (MBC) of compound A0 was also determined.

Once the MIC assay was completed, 10 pL aliquots were extracted from two dilutions before and two after the MIC value and plated on blood agar (base) NO ₂ (OXOID) supplemented with 8% defibrinated horse blood (OXOID). in humid microaerobic atmosphere (85% N ₂ , 10% CO ₂ , 5% O ₂ ). The agar plates were incubated at 37°C for 48 h. The CMB value was defined as the minimum concentration of the compound that prevented the growth of >99.9% of Helicobacter pylori cells subcultured on this inhibitor-free medium. Each experiment was performed in triplicate, twice, to confirm the results.

5. Antimicrobial activity against Campylobacter jejuni , Escherichia coli and Staphylococcus epiderm idis of the HsrA inhibitor

The antibacterial activity of compound A0 was tested against Cam pylobacter jejuni ATCC 33560. Both Helicobacter pylori and Cam pylobacter jejuni are pathogenic species of the Epsilonproteobacteria family, both microorganisms have very similar nutritional requirements and grow optimally under the same in vitro culture conditions. In this way, to determine the MIC and MBC against Cam pylobacter jejuni, the same protocol, media and culture conditions described previously for Helicobacter pylori strains were used.

The antimicrobial activity of compound A0 was also determined against strains of two species representative of the normal human microbiota: Escherichia coli and Staphylococcus epidermidis. The calculation of the MIC and MBC of both strains was carried out using the broth microdilution technique, following the recommendations of the European Committee on Antimicrobial Susceptibility Testing (EUCAST).

For the calculation of the MIC, the strains Escherichia coli ATCC 25922 and Staphylococcus epidermidis A TC C 12228 were grown on Mueller-Hilton agar medium overnight at 37°C. Starting from this culture, several representative colonies of each strain were resuspended in sterile saline solution until the bacterial suspension was adjusted to a turbidity similar to the 0.5 standard on the McFarland scale ("1.5 x 108 CFU/mL). From this standardized suspension, the inoculum was prepared in Mueller-Hinton broth at 1x 106 CFU/mL. Sterile 96-well flat-bottom microtiter plates were used in the assay. To each plate, 75 pL of Mueller-Hinton liquid medium was added to all wells except for the first column, where 120 pL was dispensed. 30 pL of the different compounds, previously prepared in working solutions at 0.64 mg/mL in DMSO, were added to the corresponding wells of the first column. Two controls were also included in each plate: a viability control in which the antimicrobial was replaced by the same amount of its solvent (30 pL of DMSO) and a sensitivity control in which kanamycin was incorporated, from a stock to 0. .64 mg/mL. Serial double dilutions were then made from column 1 to the end (eliminating the corresponding 75 pL of the last column) and subsequently 75 pL of freshly prepared inoculum was added to each well of the plate, reaching in all cases a final concentration of 5x105 CFU/mL. The assay allowed the evaluation of the antimicrobial activity of the compounds of interest in a concentration range of 64 μg/mL to 0.5 μg/mL. The plates were incubated at 37°C overnight and the MIC value was read visually due to the absence of turbidity. Each determination was performed at least twice, in duplicate.

For the determination of the MIC, aliquots of 10 pL from each of the wells corresponding to at least one or two dilutions on either side of the MIC value of each compound were seeded in duplicate on Mueller-Hilton agar. The plates were incubated at 37°C overnight. The CMB value was considered the lowest concentration of the compound that prevented the growth of 99.9% of the initial bacterial population after subculture in antimicrobial-free medium.

6. Study of cytotoxicity in HeLa cells

The cytotoxic capacity of compound A0 on human cells was studied using the resazurin reduction assay in HeLa cells. For this assay, the compound PrestoBlue™ from ThermoFisher was used. The cells were seeded in sterile 96-well plates, at a rate of 10,000 cells/well, using Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1% GlutaMAX™ (ThermoFisher) and 1% penicillinstreptomycin antibiotic solution. (Sigma-Aldrich). The plates thus seeded were incubated for 24 h at 37°C under a humidity-saturated atmosphere with 5% CO ₂ . After this time, the cells were exposed in triplicate to serial double dilutions of the compound of interest, in order to evaluate its cytotoxic capacity in a concentration range of 0.125 to 128 mg/L. The amount of total DMSO (vehicle) incorporated in all cases was 1.2% v/v, including DMSO cytotoxicity controls in all assays. After 24 h of exposure to each treatment, 10% v/v PrestoBlue was added and incubated for 2 h at 37°C. The fluorescence emitted by resofurin in viable HeLa cells was recorded with a Synergy HT reader (Biotek).

The active ingredient in PrestoBlue is resazurin, a blue, non-fluorescent and non-toxic compound for cells. Resazurin crosses the membrane of living cells and inside them it is irreversibly reduced to resorufin, a pink compound that emits fluorescence. The amount of resorufin produced in each well of the plate will be proportional to the number of viable cells and may be quantified using an absorbance reader (absorption wavelength: 570 nm) or fluorescence (excited at 530 nm and emitted at 590 nm). Once the fluorescence emission of the HeLa cells has been collected after exposure to each concentration of the compound of interest, a curve of percentage of cell viability versus concentration of the compound is constructed, taking the fluorescence emitted by the wells as 100% viability. of untreated cells. From this curve, the average cytotoxic concentration value (CC ₅₀ ) is determined, that is, the concentration of the compound that causes the death of 50% of the cells in the culture.

7. Calculation of the therapeutic index (TI)

Taking into account the CC ₅₀ of the compound of interest calculated in the cytotoxicity studies in HeLa cells and the minimum inhibitory concentration (MIC) obtained from previous studies of antimicrobial activity, the therapeutic index (TI) of the compound of interest can be calculated. against each microorganism, as a dimensionless numerical value resulting from the CCso/MIC ratio. This value provides an idea about the efficacy and safety of a given drug as it constitutes the ratio between the concentration at which it causes the therapeutic effect versus that which causes toxicity and adverse effects in the patient. The higher the IT value, the greater the safety of the drug. An IT value > 10 implies a high safety window for the compound or drug.

8. Acute toxicity in mice

Acute toxicity by oral ingestion in mice was evaluated following the class method according to the Organization for Economic Cooperation and Development (OECD), with slight modifications. The assay was developed in the Nanotoxicology and Immunotoxicology Unit (UNATI) of the IIS Aragón with the prior approval of the Ethics Advisory Commission for Animal Experimentation of the University of Zaragoza (Ref. PI58/20). Female SW ISS mice weighing 25-30 g, specific pathogen free (SPF), were supplied by Janvier Labs (France). Animals were marked to allow individual identification and kept in their cages for 7 days before dosing to allow acclimatization to laboratory conditions. The test substance was administered in a single dose by intragastric tube. The concentration of each dose was adjusted so as not to administer more than 1 mL/100 g of animal weight. Two groups of 3 animals were fasted for 4 hours (water ad libitum), weighed individually and received a dose of compound A0 . dissolved at the moment in corn oil. One group of animals received a dose of 50 mg/kg body weight and another a dose of 300 mg/kg body weight. After the treatments, the animals were observed individually for the first 30 min and then every 1 h for the first 4 h. Two observations were then made daily for the first 5 days, and daily thereafter, for a total of 14 days. Animals were weighed daily and individual recordings were systematically made for each animal regarding the appearance of skin, coat, mucous membranes, respiratory rate, activity pattern, and somatomotor behavior. At the end of the trial, all animals were humanely euthanized and underwent macroscopic necropsy. Samples from all animals were extracted from the spleen, liver, kidneys, heart and brain, which were fixed in formalin for subsequent pathological analysis by staining with hematoxylin-eosin. The histopathological studies were carried out in the Pathological Anatomy Laboratory of the Lozano Blesa University Clinical Hospital by specialized personnel.

9. Analysis of the protein-liqand interaction by molecular docking (Dockinq)

The binding affinity to the target protein of different low molecular weight ligands with a similar chemical structure was estimated by molecular docking. The three-dimensional structure of the Helicobacter pylori HsrA protein (2HQR, model 1, chain A) was extracted from the Protein Data Bank database. The 3D structures of all ligands were built using the Corina Classic program and minimized using AMMOS (https://mobyle.rpbs.univ-paris-diderot.fr/). The protein and ligands were prepared using AutoDockTools 1.5.6 (https://autodock.scripps.edu/). The molecular structure of the protein was considered rigid, free twisting of the rotatable bonds in the ligand molecules was allowed. Molecular docking analysis was performed using AutoDock Vina 1.2 software. For each of the ligands, the interaction free energies (AG) of the 20 most thermodynamically favored protein-ligand conformations were analyzed after blind docking. The conformation with the lowest binding energy between the ligand and the C-terminal domain (DNA binding domain) of the target protein was considered as the interaction model. The molecular interaction between both molecules was visualized using the PyMol 2.5.2 program (https://pymol.org).

Results

1. Inhibition of the activity of the essential response regulator HsrA

Compound A0 inhibits the biological function of the essential protein HsrA of Helicobacter pylori. The HsrA protein is a response regulator with DNA binding activity. This protein acts in the cell as a transcriptional regulator, it specifically binds to the promoter region of target genes and regulates the transcription of these genes. Previous studies have shown that HsrA constitutes an effective therapeutic target against Helicobacter pylori, given that the inhibition of its biological activity leads to the death of the microorganism. Through gel retardation assays, it is demonstrated that the compound of interest in the present invention inhibits the binding of HsrA to its target promoters, as seen in Figure 1.

2. Antimicrobial activity against H elicobacter pylori

Compound A0 shows potent bactericidal activity against Helicobacter pylori strains. The range of minimum inhibitory concentration observed (MIC = 0.031 - 0.063 mg/L, Table 1) shows an antimicrobial activity of 16 to 32 times greater than metronidazole (MIC = 1 mg/L) against the Helicobacter pylori strains used in the study.

3. Antimicrobial activity against Cam pylobacter jejuni

Compound A0 also demonstrates strong bactericidal activity against another epsilonproteobacteria of clinical interest, Cam pylobacter jejuni, with an MIC value for the control strain A TC C 33560 of 0.25 mg/L (Table 1). This antimicrobial activity against Cam pylobacter is similar to that shown by ciprofloxacin (MIC = 0.5 mg/L) and higher than that obtained with doxycycline (MIC = 1 mg/L), erythromycin (MIC = 2 mg/L) and gentamicin (MIC = 1 mg/L), using the same study strain.

Table 1. Antimicrobial activity of compound A0 against strains of Helicobacter pylori, Campylobacter jejuni and representatives of the normal human microbiota.

MIC: Minimum inhibitory concentration, MBC: Minimum bactericidal concentration, both

expressed in mg/L.

4. Antimicrobial activity representatives of the normal human microbiota The antimicrobial activity of compound A0 against bacterial species representative of the normal human microbiota such as Escheríchia coli and Staphylococcus epidermidis is very low, with MIC values > 64 mg/L (Table 1). This result suggests a selective antimicrobial activity of the compound of interest against epsilonproteobacteria and a low rate of adverse side effects on the normal microbiota, if administered in humans as a new antimicrobial agent.

5. Toxicity and therapeutic index

Compound A0 shows low toxicity both in vitro and in vivo and a high therapeutic index against Helicobacter pylori and C. jejuni (Table 2). Thus, the average dose of the compound required to cause cytotoxicity in a human cell line (HeLa) is >2000 times higher than the average dose required to inhibit the in vitro growth of Helicobacter pylori and >500 times higher than the required dose. to inhibit the in vitro growth of Cam pylobacter je ju ni , which guarantees a wide therapeutic margin in the treatment of infections caused by both microorganisms.

Acute toxicity in mice after oral ingestion is low, with an LD ⁵⁰ value > 300 mg/kg (Table 2). This value represents a lower toxicity than widely prescribed medications such as aspirin (LD50 = 250 mg/kg), voltaren (LD50 = 95 mg/kg) or diazepam (LD50 = 48 mg/kg) and antibiotics such as isoniazid (LD50 = 133 mg/kg). kg). All animals exposed to doses of 50 mg/kg and 300 mg/kg body weight survived. No macroscopic signs of toxicity such as weight loss, alteration of the skin, coat, mucous membranes, respiratory rate, activity pattern and somatomotor behavior were observed during the 14 days of the study. No specific histological alterations of toxicity were observed in any of the organs studied (spleen, liver, kidneys, heart and brain). In two of the three mice exposed to the 300 mg/kg dose, mild inflammatory infiltrates with the presence of eosinophils were observed in lobular and sinusoid areas of the liver. Although these nonspecific histological findings could indicate a hypersensitivity reaction to the compound of interest, they were not accompanied by other typical alterations (eosinophils in portal spaces, cholestasis centrilobular, apoptosis) that could confirm a definitive diagnosis of liver toxicity.

Table 2. Cytotoxicity in HeLa cells, mean lethal dose in mice and therapeutic indices of compound A0 against Helicobacter pylori and Campylogacter jejuni .

CC ₅₀ : Average cytotoxic concentration, LD ₅₀ : Average lethal dose.

The therapeutic index (TI) is the relationship between CC ₅₀ and MIC. An IT value > 10 implies a high safety profile of the compound or drug.

6. Analysis of the protein-liqand interaction by molecular docking. Study of the binding affinity to the target protein of different low molecular weight liqands with similar chemical structure

A bioinformatic prediction of the best interaction model between several ligands of similar chemical structure and the target protein HsrA was performed. The ligand whose antimicrobial activity was experimentally demonstrated (A0) was initially used to define the most probable binding site with the protein through blind docking. Through this procedure, all possible conformations of protein-ligand interaction are analyzed and finally they are organized or classified according to the value of the interaction free energy (FA), which is a measure of the affinity of the complex. The lower the interaction free energy, the greater the binding affinity between both molecules. Given the functional independence of the two domains of HsrA, only the ligands that interacted with the C-terminal DNA binding domain were considered as possible inhibitors of the biological activity of the target protein, with the conformation with lower binding energy for each ligand. The results of the analysis are shown in Figure 2 and Table 3.

As seen in Figure 2C, in the binding site with the protein, within the C-terminal domain, the ligand establishes the following non-covalent interactions with the closest amino acids: (1) the phenyl group of the ligand establishes interactions hydrophobic with aliphatic side chain of residue Leu126, (2) Cl establishes hydrogen bond with the OH group of the side chain of Thr203, (3) the thiophene ring establishes hydrophobic interactions with the aliphatic side chain of amino acids Lys194 and Leu152, (4) the NO ₂ group establishes electrostatic interactions with the NH ₃ + group of Lys 194, while (5) the carbonyl group of the ligand establishes hydrogen bonding with the OH group of the side chain of Thr203. Residues Lys194, Met195, Pro198, Leu199, and Thr203 are part of the HTH motif. According to this interaction model, the inhibition of the biological activity of HsrA as a transcriptional regulator after ligand binding occurs by steric hindrance and blocking of the conformational mobility of the HTH motif, which prevents the recognition of specific DNA sequences and the binding to the promoter regions of their target genes. Ligand binding can also cause a destabilization of the C-terminal domain structure.

Once the most probable interaction site of the experimentally evaluated ligand (A0) was defined, small rational modifications to the chemical structure of this ligand were designed in silico , mainly through changes or additions of new radicals, both polar and apolar, to its phenyl rings. and thiophene, and modifications in the position and chemical nature of the thiophene aromatic ring (Table 3). Next, the free energy of interaction between each of the designed chemical structures and the most probable binding site of the experimental ligand in the HsrA protein, previously defined and visualized in Figure 2, was analyzed by molecular docking.

As can be seen in Table 3, small modifications incorporated in silico to the chemical structure of the experimental ligand (A0) allowed obtaining a series of low molecular weight analogues, which maintained the same interaction model of the experimental ligand in the molecular docking assays. . Notably, some of the chemical modifications performed in the bioinformatics simulation increased the affinity of the ligand for the protein, which is reflected in a lower interaction energy (AG, kcal/mol). However, other modifications appeared to slightly decrease the binding affinity with respect to the experimental ligand.

Table 3. Free energy of interaction between the transcriptional regulator HsrA of Helicobacter pylori and different low molecular weight ligands that share a similar chemical structure, according to molecular docking analysis (Docking).

Molecular docking and calculation of interaction energies were performed using AutoDock Vina software.

The groups Cy and R1 to R8 correspond to the groups of formula I of the compounds of the invention.

Claims (17)

1. A compound of formula I for use in the treatment and/or prevention of an infection caused by a bacterium of the genus Helicobacter Cam pylobactero for use in the treatment and/or prevention of a disease caused by infection by a bacterium of the genus Helicobacter Campylobacter.

Yo where: R ₁ is an H or halogen group; R ₂ is an H or halogen group; R ₃ is a group H, halogen, C _1-4 alkyl, -COC _1-4 alkyl; -COOH, -COOC _1-4 alkyl, -OH, -NH2, -SH or -NO ₂ , where C _1-4 alkyl is optionally substituted by one or more R ₉ groups; R ₄ is an H or C _1-4 alkyl group; R ₅ is an H, -COOH or -COOC _1-4 alkyl group; Cy is a group of formula la, Ib, le or Id:

C _1-4 alkyl is optionally substituted by one or more R i0 groups; R ⁸ is H or halogen; R ⁹ is a halogen group; and Rio is a halogen group. 2. The compound of formula I according to the use of claim 1, where Ri is an H, Cl or Br group. 3. The compound of formula I according to the use of any of claims 1 or 2, where R ₂ is an H, Cl or Br group. 4. The compound of formula I according to the use of any of claims 1 to 3, where R ³ is a group H, Br, Cl, methyl, ethyl, -COC ₂ H ₅ , -COCH ₃ ; -COOH, -COOCH ₃ , -OH, -NH ₂ , -SH or -NO ₂ . 5. The compound of formula I according to the use of any of claims 1 to 4, where R ₄ is an H or CH ₃ group. 6. The compound of formula I according to the use of any of claims 1 to 5, where R5 is an H or -COOH group. 7. The compound of formula I according to the use of any of claims 1 to 6, where Cy is a la group. ⁸ . The compound of formula I according to the use of any of claims 1 to 7, where R ⁶ is a group H, Cl, Br, CH ³ or -COOH. 9. The compound of formula I according to the use of any of claims 1 to 8, where R7 is a group H, CH ₃ , Cl, Br, -COOH, -COC ₂ H ₅ , -COCH ₃ or -NO ₂ . 10. The compound of formula I according to the use of any of claims 1 to 9, where R ₈ is a group H, Br or Cl, and preferably H or Br. 11. The compound of formula I according to the use of any of claims 1 to 10, where R ₈ is a Cl or Br group. 12. The compound of formula I according to the use of claim 1, selected from:



Ċ

13. The compound of formula I according to the use of claim 12, selected from A 1 to A30. 14. The compound of formula I according to the use of any of claims 1 to 13, wherein the bacteria of the genus Helicobacter is of the species Helicobacter pylori and where the bacteria of the genus Cam pylobacter is of the species Cam pylobacter jejuni. 15. A pharmaceutical composition comprising at least one compound of formula I according to any of claims 1 to 14, for use in the treatment and/or prevention of an infection caused by a bacteria of the genus Helicobacter or Cam pylobacter or for use in the treatment and/or prevention of a disease caused by an infection caused by a bacteria of the genus Helicobacter or Campylobacter. 16. The compound of formula I or a pharmaceutical composition thereof according to the use of any of claims 1 to 14, wherein the disease caused by an infection is a gastrointestinal pathology. 17. The compound of formula I or a pharmaceutical composition thereof according to the use of claim 16, wherein the disease caused by an infection is a gastrointestinal pathology, and preferably where the gastrointestinal pathology is selected from acute gastritis, chronic gastritis, duodenitis, functional dyspepsia, gastric ulcer, duodenal ulcer, gastric adenocarcinoma and mucosa-associated lymphoid tissue lymphoma (MALT lymphoma).