ES2879930T3 - Hepatitis B virus surface antigen inhibitor - Google Patents

Abstract

A compound represented by formula (I) or a pharmaceutically acceptable salt thereof, **(See formula)** wherein, R1 is selected from H, OH, CN, NH2, or is selected from the group consisting of C1 alkyl -C5, C1-C5 heteroalkyl, C2-C5 alkynyl, C3-C6 cycloalkyl and 3-6 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 R; R2 is selected from H, halogen, or selected from the group consisting of C1-C3 alkyl and C1-C3 heteroalkyl, each of which is optionally substituted with 1, 2 or 3 R; m is selected from the group consisting of 0, 1, 2, 3, 4 and 5; A is selected from the group consisting of phenyl and 5-6 membered heteroaryl, each of which is optionally substituted with 1, 2 or 3 R; R is selected from the group consisting of H, halogen, OH, CN, NH2, =O, CH3, CH3CH2, CH3O, CF3, CHF2, and CH2F; the "hetero" in C1-C5 heteroalkyl, 3-6 membered heterocycloalkyl, C1-C3 heteroalkyl, and 5-6 membered heteroaryl, is independently selected from the group consisting of N, -O-, =O, -S- , -NH-, -(C=O)-, -(S=O)- and -(S=O)2-; in any one of the above cases, the number of the heteroatom or group of heteroatoms is independently selected from 1, 2 or 3.

Description

DESCRIPTION

hepatitis B virus surface antigen inhibitor

Cross reference to related request

The present application claims the priority of Chinese Patent Application No., CN201710138275.5 filed on March 9, 2017.

Field of invention

The present disclosure relates to a new 10-oxo-6,10-dihydrobenzo [ejpirido [1,2-c] [1,3] oxazine-9-carboxylic acid derivative that acts as an inhibitor of the virus surface antigen. hepatitis B, specifically refers to a compound represented by formula (i) or a pharmaceutically acceptable salt thereof, and a use of the compound represented by formula (i) or the pharmaceutically acceptable salt thereof and a pharmaceutical composition of the same in the treatment of viral hepatitis B.

Previous techniques

Viral hepatitis B, abbreviated as hepatitis B, is a disease caused by infection with the hepatitis B virus (HBV) in the body. Hepatitis B virus is a hepadnaviridae that exists primarily in hepatocytes and damages hepatocytes, causing inflammation, necrosis, and fibrosis of hepatocytes. Viral hepatitis B is divided into two types, acute hepatitis B and chronic hepatitis B. Most adults with acute hepatitis B can heal themselves through their inherent immune function. However, chronic hepatitis B (CHF) has become a major challenge for global healthcare and a leading cause of chronic liver disease, cirrhosis, and hepatocellular carcinoma (HBC) (Edward JG, et al., The oral toll-like receptor 7 agonist GS-9620 in patients with chronic hepatitis B virus infection. Journal of Hepatology (2015); 63: 320-328). An estimated 2 billion people worldwide are infected with the chronic hepatitis B virus, and more than 350 million people have progressed to hepatitis B. Nearly 600,000 people die each year from complications of chronic hepatitis B ( The oral toll-like receptor 7 agonist GS-9620 in patients with chronic hepatitis B virus infection. Journal of Hepatology (2015)). China is an area of high prevalence of hepatitis B and accumulated many hepatitis B patients, which is a serious danger. According to the data, there are about 93 million people infected with the hepatitis B virus in China, and about 20 million of them are diagnosed with chronic hepatitis B, among them, 10% to 20% can progress to cirrhosis and from 1% to 5% can progress to HCC. (Zhang Chunhong, Aplication of interferon in the treatment of hepatitis B. Chinese Medicine Guide (2013); 11: 475-476).

The key to the functional cure of hepatitis B is to remove the HBsAg (surface antigen of the hepatitis B virus) and produce surface antibodies. Quantification of HBsAg is a very important biological indicator. In chronically infected patients, a decrease in HBsAg and seroconversion is rarely seen, which is the end goal of current treatment.

The surface antigenic protein of the hepatitis B virus (HBV) plays a very important role in the process of invasion of HBV into liver cells and is of great importance for the prevention and treatment of HBV infection. Surface antigenic proteins include large (L), medium (M), and small (S) antigenic surface proteins that share a common C-terminal S region. They are expressed in an open reading frame, the different lengths of which are determined by the three AUG start codons of the reading frame. These three antigenic surface proteins include pre-S1 / pre-S2 / S, pre-S2 / S, and S domains. The HBV surface antigenic protein integrates into the endoplasmic reticulum (ER) membrane and begins with the signal sequence N-terminal (Eble et al., 1987, 1990; Schmitt et al., 2004). They not only constitute the basic structure of virions, but also form globular and filamentous subviral particles (SVP, HBsAg), aggregated in the ER, the host ER and the pre-Golgi apparatus (Huovila et al., 1992), the SVP contains mainly surface antigenic protein S (Chisari et al., 1986). The L protein (Bruss, 1997, 2004) is essential in aspects of virus morphogenesis and nucleocapsid interaction, but is not necessary for the formation of SVPs. (Lunsdorf et al., 2011). Due to their lack of nucleocapsids, SVPs are not infectious. SVPs are highly involved in the progression of the disease, especially in the immune response to hepatitis B virus, in the blood of infected people, the content of SVP is at least 10,000 times the number of viruses (Bruns et al. , 1998; Ganem and Prince, 2004), and traps the immune system and weakens the body's immune response to hepatitis B virus. E1HBsAg also inhibits human innate immunity, inhibits polysaccharide-induced cytokine production (LPS) and iL -2 (Vanlandschoot et al., 2002), inhibits DC function of dendritic cells and inhibits LPS-induced activity against kinase 1/2 interference in ERK-1/2 and N-terminal c-Jun in monocytes ( Op den Brouw et al., 2009). It is worth noting that disease progression from cirrhosis and hepatocellular carcinoma is also strongly associated with persistent HBsAg secretion (Chisari et al., 1989; Wang et al., 2004; Yang et al., 2009 ; Wu et al., 2014). This research suggests that HBsAg plays an important role in the progression of chronic hepatitis.

Currently approved anti-HBV drugs are mainly immunomodulators (pegylated interferon-a and interferon-a-2a) and antiviral therapeutic drugs (Lamivudine, Adefovir Dipivoxil, Entecavir, Telbivudine, Tenofovir, Clevudine, etc.). Among them, antiviral therapeutic drugs belong to nucleotides and their mechanism of action is to inhibit HBV DNA synthesis, rather than directly reducing HBsAg levels. As Than long-term treatment, nucleotide drugs have shown a clearance rate of HBsAg that is similar to natural observations (Janssen et al., Lancet (2005), 365, 123-129; Marcellin et al., N. Engl. J Med. (2004), 351, 1206-1217; Buster et al., Hepatology (2007), 46, 388-394).

Clinically available therapies exhibit poor efficacy in reducing HBsAg, therefore, development of oral small molecule inhibitors that can effectively reduce HBsAg is currently required for clinical use.

Even though W02016128335A1 has disclosed a series of 2-oxo-6,7-dihydrobenzo [a] quinazine-3-carboxylic acid derivatives for the treatment or prevention of hepatitis B virus infection (the general structure shown below), this series of fused ring compounds still has the problems of strong molecular rigidity, insufficient solubility, and easy aromatization. Therefore, for clinical applications, there is still a demand for drugs with better pharmacibility.

Content of the present invention

The present disclosure provides a compound represented by formula (I) or a pharmaceutically acceptable salt thereof,

where,

R ¹ is selected from H, OH, CN, NH ² , or is selected from the group consisting of C1-C5 alkyl, C1-C5 heteroalkyl, C2-C5 alkynyl, C3-C6 alkyl, and 3-6 membered heterocycloalkyl, each one of which is optionally substituted with 1,2 or 3 R;

R ² is selected from H, halogen, or is selected from the group consisting of C1-C3 alkyl and C1-C3 heteroalkyl, each of which is optionally substituted with 1,2 or 3 R;

m is selected from the group consisting of 0, 1,2, 3, 4, and 5;

A is selected from the group consisting of 5-6 membered phenyl and heteroaryl, each of which is optionally substituted with 1,2 or 3 R;

R is selected from the group consisting of H, halogen, OH, CN, NH2, = 0, CH ³ , CH ³ CH ² , CH ³ O, CF ³ , CHF ² and CH ² F; the "hetero" in C1-C5 heteroalkyl, 3-6 membered heterocycloalkyl, C1-C3 heteroalkyl, 5-6 membered heteroaryl is independently selected from the group consisting of N, -O-, = 0, -S-, -NH-, - (C = 0) -, - (S = 0) - and - (S = 0) 2-; In any one of the above cases, the number of the heteroatom or group of heteroatoms is independently selected from 1, 2 or 3.

In some embodiments of the present disclosure, R is selected from the group consisting of H, F, Cl, Br, OH, CH ³ , CH ³ O, CF ³ , CHF ^2, and CH ² F.

In some embodiments of the present disclosure, R ¹ is selected from H, OH, CN, NH2, or is selected from the group consisting of CH ³ , CH ³ CH ² , CH ³ CH ² CH ² , CH ³ CH ² CH ² CH ² , CH ³ O, CH ³ CH ² O, CH ³ S, CH3S (= 0), CH3S (= 0) 2, CH ³ SCH ² , CH ³ CH ² S, CH ³ NH,

pirrolidinilo, piperidilo, tetrahidropiranilo, morfolinilo, 2-pirrolidonilo y 3-pirrolidonilo, cada uno de Ios cuales está opclonalmente sustituido con 1,2 o 3 R.

pyrrolidinyl, piperidyl, tetrahydropyranyl, morpholinyl, 2-pyrrolidonyl, and 3-pyrrolidonyl, each of which is optionally substituted with 1,2 or 3 R.

In some embodiments of the present disclosure, Ri is selected from H, OH, CN, NH2, or is selected from the group consisting of CH ³ , CH ³ CH ² , CH ³ CH ² CH ² , CH ³ CH ² CH ² CH ² , CH ³ O, CH ³ CH ² O, CH ³ S, CH3S (= 0), CH3S (= 0) 2, CH ³ SCH ² , CH ³ CH ² S, CH ³ NH,

cada uno de los cuales está opcionalmente sustituido con 1,2 o 3 R.

each of which is optionally substituted with 1,2 or 3 R.

In some embodiments of the present disclosure, R1 is selected from the group consisting of H, OH, CH3, CHF2,

In some embodiments of the present disclosure, R ² is selected from H, F, Cl, Br, or is selected from the group consisting of CH ³ , CH ³ CH ² , CH ³ O, CH ³ CH ² O, and

each of which is optionally substituted with 1,2 or 3 R.

In some embodiments of the present disclosure, R ² is selected from the group consisting of Cl and CH ³ O.

In some embodiments of the present disclosure, A is selected from the group consisting of phenyl, thienyl, thiazolyl, isothiazolyl, oxazolyl, and isoxazolyl, each of which is optionally substituted with 1,2 or 3 R.

In some embodiments of the present disclosure, A is selected from the group consisting of

each of which is optionally substituted with 1,2 or 3 R.

In some embodiments of the present disclosure, A is selected from the group consisting of

In some embodiments of the present disclosure, A is selected from the group consisting of

In some embodiments of the present disclosure, m is 3.

In some embodiments of the present disclosure, R ² is selected from the group consisting of Cl and CH ³ O.

In some embodiments of the present disclosure, Ri is CH ³ O.

In some embodiments of the present disclosure, m is 1.

In some embodiments of the present disclosure, R ² is Cl.

In some embodiments of the present disclosure, R ¹ is " A.

In some embodiments of the present disclosure, A is selected from the group consisting of

each of which is optionally substituted with 1,2 or 3 R.

In some embodiments of the present disclosure, the compound, or the pharmaceutically acceptable salt thereof, is selected from the group consisting of

where,

Ri, R ² , R and m are defined as before.

In some embodiments of the present disclosure, the compound, or the pharmaceutically acceptable salt thereof, is selected from the group consisting of

The present disclosure also provides the compound or the pharmaceutically acceptable salt thereof, which is selected from the group consisting of

In some embodiments of the present disclosure, the compound, or the pharmaceutically acceptable salt thereof, is selected from the group consisting of

The present disclosure also provides a pharmaceutical composition comprising a therapeutically effective amount of the compound or the pharmaceutically acceptable salt thereof according to the claims, and a pharmaceutically acceptable carrier.

The present disclosure also provides the compound or the pharmaceutically acceptable salt thereof, or the pharmaceutical composition for use in treating hepatitis B.

Some of the other embodiments of the present disclosure are arbitrarily combined from the above variants.

Technical effects

The present disclosure creatively designed and synthesized a new series of compounds having a six-membered nitroxide acetal as the backbone. The compound of the present disclosure overcomes the shortcoming that the six-membered annular nitroxide acetal core structure can be unstable and easily hydrolyzed in the acidic environment of the body by ingenious design. It has been confirmed by relevant experiments that the compound of the present disclosure has good stability in a certain temperature range and acid range. Furthermore, after creatively replacing a carbon atom with an oxygen atom, the activity of the series of compounds of the present disclosure can be well maintained compared to the prior art. This was verified in an in vitro hepatitis B surface antigen activity inhibition experiment. At the same time, the design of the oxygen atom replacing the carbon atom prevents the parent nucleus from being dehydrogenated and aromatized by the presence of the carbon atom, and the aqueous solubility of the compound of the present disclosure is improved, so that they can obtain more outstanding pharmacibility properties.

Definitions and descriptions

Unless otherwise indicated, the following terms and phrases used herein are intended to have the following meanings. A specific term or phrase should not be considered undefined or unclear in the absence of a particular definition, but should be understood in the conventional sense. When a trade name appears herein, it is intended to refer to its corresponding basic product or active ingredient thereof. The term "pharmaceutically acceptable" is used herein in terms of those compounds, materials, compositions and / or dosage forms, which are suitable for use in contact with human and animal tissues within the scope of reliable medical judgment, without excessive toxicity, irritation, allergic reaction or other problems or complications, consistent with a reasonable benefit / risk ratio.

The term "pharmaceutically acceptable salt" refers to a salt of the compound of the present disclosure that is prepared by reacting the compound having a specific substituent of the present disclosure with a relatively non-toxic acid or base. When the compound of the present disclosure contains a relatively acidic functional group, a base addition salt can be obtained by contacting the neutral form of the compound with a sufficient amount of base in a neat solution or a suitable inert solvent. The pharmaceutically acceptable base addition salt includes a sodium, potassium, calcium, ammonium, organic amine or magnesium salt or similar salts. When the compound of the present disclosure contains a relatively alkaline functional group, an acid addition salt can be obtained by contacting the neutral form of the compound with a sufficient amount of acid in a neat solution or a suitable inert solvent. Examples of a pharmaceutically acceptable acid addition salt include an inorganic acid salt, where the inorganic acid includes, for example, hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, bicarbonate, phosphoric acid, monohydrogen phosphate, dihydrogen phosphate, sulfuric acid. , hydrogen sulfate, hydroiodic acid, phosphorous acid, and the like; and an organic acid salt, wherein the organic acid includes, for example, acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-toluenesulfonic acid, citric acid, tartaric acid and methanesulfonic acid and the like; and an amino acid salt (such as arginine and the like), and a salt of an organic acid such as glucuronic acid and the like (see Berge et al., "Pharmaceutical Salts", Journal of Pharmaceutical Science 66: 1-19 (1977)) . Certain specific compounds of the present disclosure contain both alkaline and acidic functional groups and can be converted to any acid or base addition salt.

Preferably, by contacting the salt with a base or an acid in a conventional manner, and then removing the parent compound, the neutral form of the compound can thereby be regenerated. The difference between the parent form of the compound and its various salt forms lies in specific physical properties, such as different solubility in a polar solvent.

The "pharmaceutically acceptable salt" used herein belongs to a derivative of the compound of the present disclosure, wherein the parent compound is modified to form a salt with an acid or a base. Examples of the pharmaceutically acceptable salt include, but are not limited to, an inorganic acid or an organic acid salt of an alkali radical such as an amine, an alkali metal salt, or an organic salt of an acid radical such as carboxylic acid. and the like. The pharmaceutically acceptable salt includes a conventional non-toxic salt or a quaternary ammonium salt of the parent compound, such as a non-toxic inorganic acid or organic acid salt. The conventional non-toxic salt includes, but is not limited to, the salt derived from an inorganic acid and an organic acid, wherein the inorganic acid or organic acid is selected from the group consisting of 2-acetoxybenzoic acid, 2-hydroxyethanesulfonic acid, acetic acid, ascorbic acid, benzenesulfonic acid, benzoic acid, bicarbonate, carbonic acid, citric acid, edetic acid, ethanedisulfonic acid, ethanesulfonic acid, fumaric acid, glucoheptose, gluconic acid, glutamic acid, glycolic acid, hydrobromic acid, hydrochloric acid, hydrochloric acid, hydrochloric acid, hydrochloric acid, hydrochloric acid , hydroxyl, hydroxynaphthalene, isethionic acid, lactic acid, lactose, dodecylsulfonic acid, maleic acid, malic acid, mandelic acid, methanesulfonic acid, nitric acid, oxalic acid, pamoic acid, pantothenic acid, phenylacetic acid, phosphoric acid, polygalactanalic acid, acid Propionic, Salicylic Acid, Stearic Acid, Subacetic Acid, Succinic Acid, Sulfamic Acid, Sulfanilic Acid, Sulfuric Acid co, tannin, tartaric acid and p-toluenesulfonic acid.

The pharmaceutically acceptable salt of the present disclosure can be prepared from the parent compound containing an acid or alkali radical by conventional chemical methods. Generally, such a salt can be prepared by reacting the free acid or base form of the compound with a stoichiometric amount of an appropriate base or acid in water or an organic solvent or a mixture thereof. Generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.

In addition to the salt form, the compound provided by the present disclosure also exists as a prodrug. The prodrug of the compound described herein is the compound that readily undergoes a chemical change under physiological conditions to become the compound of the present disclosure. Furthermore, the prodrug can be converted to the compound of the present disclosure by a chemical or biochemical method in an in vivo environment.

Certain compounds of the present disclosure may exist in unsolvated or solvated form, including a hydrated form. Generally, the solvated form is equivalent to the unsolvated form, and both are included within the scope of the present disclosure.

Certain compounds of the present disclosure may have an asymmetric carbon atom (optical center) or a double bond. The racemate, diastereomer, geometric isomer, and individual isomer are all included within the scope of the present disclosure.

Unless otherwise specified, a wedge-shaped bond and a discontinuous bond •) are used to indicate the absolute configuration of a stereogenic center, ^ and are used to indicate the relative configuration of a stereogenic center. When the compound described herein contains an olefinic double bond or other geometric asymmetric centers, the geometric E and Z isomers are included unless otherwise specified. Also, all tautomeric forms are included within the scope of this disclosure.

The compound of the present disclosure may be in a specific geometric or stereoisomeric form. The present disclosure contemplates all of these compounds, including cis and trans isomers, (-) and (+) enantiomers, (R) and (S) enantiomers, diastereoisomers, (D) isomers, (L) isomers and racemic mixtures and other mixtures. , for example, a mixture enriched in enantiomers or diastereoisomers, all of which are included within the scope of the present disclosure. The substituent such as alkyl can have an additional asymmetric carbon atom. All of these isomers and mixtures thereof are included within the scope of the present disclosure.

The (R) and (S) isomers, or the optically active D and L isomers can be prepared using chiral synthesis or chiral reagents or other conventional techniques. If one type of enantiomer of a certain compound of the present disclosure is to be obtained, the desired pure enantiomer can be obtained by asymmetric synthesis or derivative action of the chiral auxiliary followed by separation of the resulting diastereomeric mixture and cleavage of the auxiliary group. Alternatively, when the molecule contains an alkaline functional group (such as amino) or an acid functional group (such as carboxyl), the compound reacts with an appropriate optically active acid or base to form a salt of the diastereomeric isomer which is then subjected to at diastereomeric resolution by the method conventional in the art to provide the pure enantiomer. Furthermore, the enantiomer and diastereoisomer are generally isolated by chromatography using a chiral stationary phase and optionally combined with a chemical derivative method (eg, carbamate generated from amine).

The compound of the present disclosure may contain an unnatural proportion of atomic isotope in one or more of one or more atoms that constitute the compound. For example, the compound can be radioactively labeled with a radioactive isotope, such as tritium (3H), iodine-125 (125l), or C-14 (14C). All isotopic variations of the compound of the present disclosure, whether radioactive or not, are included within the scope of the present disclosure.

"Optional" or "optionally" means that the subsequent event or condition may occur but is not a requirement, this that is, the term includes the case in which the event or condition occurs and the case in which the event or condition does not occur.

The term "substituted" means that one or more hydrogen atoms on a specific atom are substituted with a substituent, including deuterium and hydrogen variants, as long as the valence of the specific atom is normal and the substituted compound is stable, When the substituent is a keto group (i.e. = 0), means that two hydrogen atoms are substituted, Positions on an aromatic ring cannot be substituted with a keto group, The term "optionally substituted" means that one atom can be substituted with one substituent or not, unless otherwise specified, the species and number of the substituent can be arbitrary as long as they are chemically achievable,

When any variable (such as R) appears in the constitution or structure of the compound more than once, the definition of the variable in each case is independent, Thus, for example, if a group is substituted with 0-2 R, the group It can be optionally substituted with up to two Rs, where the definition of R in each case is independent, On the other hand, a combination of the substituent and / or the variant thereof is allowed only when the combination results in a stable compound,

When the number of a connecting group is 0, such as - (CRR) ⁰ -, this means that the connecting group is a single bond,

When one of the variables is a single bond, this means that the two groups connected by the single bond are directly connected, For example, when L in A-L-Z represents a single bond, the structure of A-L-Z is actually A-Z,

When a substituent is vacant, it means that the substituent does not exist, For example, when X is vacant in AX, the structure of AX is actually A, When a bond of a substituent can cross-link two atoms of a ring, such a substituent can be attached to any ring atom, When an enumerative substituent does not indicate by which atom it is attached to a compound included in the general chemical formula but not specifically mentioned, such substituent may be attached by any of its atoms, A combination of substituents is allowed and / or variants thereof only when such combination can result in a compound

stable. For example, the structural unit \ = / \ - / or \ = / \ - / means that it can be substituted in any position of cyclohexyl or cyclohexadiene,

Unless otherwise specified, the term "hetero" represents a heteroatom or a group of heteroatoms (eg, an atomic group containing a heteroatom), including the atom except carbon (C) and hydrogen (H ) and the atomic group containing the above heteroatom, for example, including oxygen (0), nitrogen (N), sulfur (S), silicon (Si), germanium (Ge), aluminum (Al), boron (B), -0-, -S-, = 0, = S, -C (= O) 0-, -C (= O) -, -C (= S) -, -S (= 0), -S (= 0) 2-, and the group consisting of -C (= O) N (H) -, -N (H) -, -C (= NH) -, -S (= 0) 2N (H) - and -S (= O) N (h) -, each of which is optionally substituted,

Unless otherwise specified, the term "ring" refers to a substituted or unsubstituted cycloalkyl, heterocycloalkyl, cycloalkenyl, heterocycloalkenyl, cycloalkynyl, heterocycloalkynyl, aryl or heteroaryl, The so-called ring includes a single ring, a set of rings, a spiro ring, a fused ring or a bridged ring, The number of the atom in the ring is generally defined as the number of members of the ring, for example a "5-7 membered ring" means that 5 to 7 atoms are arranged in a ring, Unless otherwise specified, the ring optionally contains 1 to 3 heteroatoms. Thus, a "5-7 membered ring" includes, for example, phenyl, pyridinyl, and piperidinyl; on the other hand, the term "5-7 membered heterocycloalkyl ring" includes pyridyl and piperidinyl, but excluding phenyl, The term "ring" also includes a ring system containing at least one ring, where each ring independently satisfies the definition previous,

Unless otherwise specified, the terms "heterocycle" or "heterocyclyl" refer to a stable monocyclic, bicyclic, or tricyclic ring containing a heteroatom or group of heteroatoms, which can be saturated, partially unsaturated, or unsaturated (aromatic) and may contain carbon atoms and 1, 2, 3, or 4 ring heteroatoms independently selected from N, 0, and S, wherein any of the above heterocycles can fuse with a benzene ring to form a bicyclic ring, Nitrogen heteroatoms and Sulfur can be optionally oxidized (i.e., N0 and S (O) p, p is 1 or 2), The nitrogen atom can be substituted or unsubstituted (i.e., N or NR, where R is H or other substituents already defined herein), The heterocycle can be attached to the pendant group of any heteroatom or carbon atom to form a stable structure, If the resulting compound is stable, the heterocycle described herein The document may have a shift in a carbon or nitrogen position, The nitrogen atom of the heterocycle is optionally quaternized, In a preferred embodiment, when the total number of S and O atoms of the heterocycle is more than 1, the heteroatoms are not adjacent with each other, In another preferred embodiment, the total number of S and 0 atoms of the heterocycle is not more than 1,

As used herein, the terms "aromatic heterocyclic group" or "heteroaryl" refer to a stable 5-, 6-, or 7-membered monocyclic or bicyclic aromatic ring or stable 7, 8, 9, or 10-membered bicyclic heterocyclic ring containing carbon atoms and 1, 2, 3, or 4 ring heteroatoms independently selected from N, O, and S, The nitrogen atom may be substituted or unsubstituted (i.e., N or NR, where R is H or other substituents already defined herein). Nitrogen and sulfur heteroatoms can optionally be oxidized (ie NO and S (O) p, p is 1 or 2). It is worth noting that the total number of S and O atoms in an aromatic heterocycle is not more than one. The bridged ring is also included in the definition of the heterocycle. A bridged ring is formed when one or more than one atom (ie, C, O, N, or S) connects two non-adjacent carbon or nitrogen atoms. A preferred bridged ring includes, but is not limited to, one carbon atom, two carbon atoms, one nitrogen atom, two nitrogen atoms, and one carbon-nitrogen group. It is worth noting that a bridge always converts a monocyclic ring to a tricyclic ring. In a bridged ring, the substituent on the ring may also be present on the bridged ring.

Examples of the heterocyclic compound include, but are not limited to: acridinyl, azocinyl, benzimidazolyl, benzofuranyl, benzomercaptofuranyl, benzomercaptophenyl, benzoxazolyl, benzoxazolinyl, benzothiazolyl, benzotriazolyl, benzotetrazolyl, benzimidazolyl, benzofuranyl, benzomercaptofuranyl, benzomercaptophenyl, benzoxazolyl, benzoxazolinyl, benzothiazolyl, benzotriazolyl, benzotetrazolyl, benzimidazolyl, benzofuranyl, benzimidazololinyl, benzin-carbazololinyl, benzimidazololinyl, benzimidazololinyl, benzimidazolyl-carbazolyl-4 , chromene, cynolinyl, decahydroquinolinyl, 2H, 6H-1,5,2-dithiazinyl, dihydrofuro [2,3-bjtetrahydrofuranyl, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, 1 H-indazolyl, indolenyl, indolinyl, indolizinyl, 3H-indolyl, isobenzofuranyl, isoindolyl, isoindolinyl, isoquinolinyl, isothiazolyl, isoxazolyl, methylenedioxyphenyl, morpholinyl, naphthyridinyl, octahydroisoquinolinyl, oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazoyl, 1,2,5-, 1,2,4-oxadiazoyl, 1,2,5- oxadiazoyl 3,4-oxadiazolyl, oxazolidinyl, oxazolyl, hydroxyindolyl, pyrimidinyl, phenanthridinyl, phenanthrolinyl, phenazine, phenothiazine, benzoxanthinyl, pheno loxazinyl, phthalazinyl, piperazinyl, piperidinyl, piperidonyl, 4-piperidonyl, piperonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyrido-oxazolyl, pyrido-imidazolyl, pyrido-imidazolyl, pyrido-imidazolyl 2H-pyrrolyl, pyrrolyl, quinazolinyl, quinolinyl, 4H-quinolizinyl, quinoxalinyl, quinuclidinyl, tetrahydrofuranyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, tetrazolyl, 6H-1,2.5-thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4,-thiadiazolyl 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, thianthrenyl, thiazolyl, isothiazolylthienyl, thienyl, thieno-oxazolyl, thieno-thiazolyl, thieno-imidazolyl, thienyl, triazinyl, 1,2,3-triazolyl, 1, 2,4-triazolyl, 1,2.5-triazolyl, 1,3,4-triazolyl and xanthenyl. Also included are fused ring compounds and spiro compounds.

Unless otherwise specified, the term "hydrocarbyl" or its hyponyms (eg, alkyl, alkenyl, alkynyl, and aryl, etc.), by itself or as part of another substituent, refer to a hydrocarbon radical. linear, branched chain or cyclic or any combination thereof. They can be fully saturated (eg, alkyl), mono or polyunsaturated (eg, alkenyl, alkynyl and aryl), they can be mono-, di- or poly-substituted, they can be monovalent (eg, methyl), divalent (eg, methylene), or multivalent (eg, methenyl), may also include a divalent or multivalent group, have a specific number of carbon atoms (eg, C ¹ -C ¹² indicates of 1 to 12 carbon atoms, C ¹ -C ¹² is selected from C ¹ , C ² , C ³ , C ⁴ , C ⁵ , C6, C ⁷ , Cs, Cg, C ¹⁰ , C ¹¹ and C ¹² ; C ³ -C ¹² is selected from C ³ , C ⁴ , C ⁵ , C6, C ⁷ , Cs, Cg, C ¹⁰ , C ¹¹ and C ¹² ). The term "hydrocarbyl" includes, but is not limited to, aliphatic hydrocarbyl and aromatic hydrocarbyl. Aliphatic hydrocarbyl includes linear and cyclic hydrocarbyl, specifically includes but is not limited to alkyl, alkenyl, and alkynyl. Aromatic hydrocarbyl includes, but is not limited to, 6-12 membered aromatic hydrocarbyl such as phenyl, naphthyl, and the like. In some embodiments, the term "hydrocarbyl" refers to a straight or branched group or a combination thereof that can be fully saturated, monounsaturated, or polyunsaturated and can include a divalent or multivalent group. Examples of the saturated hydrocarbyl group include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl) methyl, cyclopropylmethyl, and the homolog o isomer of n-amyl, n-hexyl, n-heptyl, n-octyl and other groups of atoms. Unsaturated hydrocarbyl has one or more than one double or triple bond. Examples of unsaturated alkyl include, but are not limited to, vinyl, 2-propenyl, butenyl, crotyl, 2-isopentenyl, 2- (butadienyl), 2,4-pentadienyl, 3- (1,4-pentadienyl), ethynyl , 1- and 3-propynyl, 3-butynyl and more homologues and higher isomers.

Unless otherwise specified, the term "heterohydrocarbyl" or its hyponyms (such as heteroalkyl, heteroalkenyl, heteroalkynyl, and heteroaryl, etc.), by themselves or as part of another substituent, refer to a straight, branched hydrocarbon group. or stable cyclic or any combination thereof, having a specified number of carbon atoms and at least one heteroatom. In some embodiments, the term "heteroalkyl" by itself or in combination with another term refers to a stable straight chain, a branched hydrocarbon radical, or a combination thereof having a specified number of carbon atoms and at least one heteroatom. In a specific embodiment, a hetero atom is selected from B, O, N, and S, where the nitrogen and sulfur atoms are optionally oxidized and the nitrogen atom is optionally quaternized. The heteroatom or group of heteroatoms can be located at any position inside a heterohydrocarbyl, including the position where the hydrocarbyl is anchored to the remaining part of the molecule. But the terms "alkoxy", "alkylamino" and "alkylthio" (or thioalkyl) are used with the conventional meaning and refer to an alkyl group connected to the remaining part of the molecule through an oxygen atom, an amino or a sulfur atom, respectively. Examples include, but are not limited to, -CH ² -CH ² -O-CH ³ , -CH ² -CH ² -NH-CH ³ , -CH2-CH2-N (CH3) -CH3, -CH ² - S-CH ² -CH ³ , -CH ² -CH ² , -S (O) -CHs, -CH2-CH2-S (O) 2-CH3, -CH = CH-O-CH3, -CH2-CH = N-OCH3 and -CH = CH-N (CH3) -CH3. Up to two consecutive heteroatoms may be present, such as, -CH ² -NH-OCH ³ .

Unless otherwise specified, the terms "cyclohydrocarbyl", "heterocyclohydrocarbyl" or their hyponyms (such as aryl, heteroaryl, cycloalkyl, heterocycloalkyl, cycloalkenyl, heterocycloalkenyl, cycloalkynyl, heterocycloalkynyl, etc.) by themselves or in combination with another term refer to cyclized "hydrocarbyl" or "heterohydrocarbyl". In addition, for heterohydrocarbyl or heterocyclohydrocarbyl (eg, heteroalkyl and heterocycloalkyl), a heteroatom can occupy the position where the heterocycle is anchored to the remaining position of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3oiolohexenyl, oioloheptyl, and the like. Non-limiting examples of heterocycloalkyl include 1- (1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3 -yl, tetrahydro-thiophen-2-yl, tetrahydro-thiophen-3-yl, 1-piperazinyl, and 2-piperazinyl.

Unless otherwise specified, the term "alkyl" refers to a straight or branched chain saturated hydrocarbon group, it may be monosubstituted (eg, -CH ² F) or polysubstituted (eg, -CF ³ ), it can be monovalent (eg, methyl), divalent (eg, methylene), or multivalent (eg, methenyl). Examples of alkyl include methyl (Me), ethyl (Et), propyl (such as n-propyl and isopropyl), butyl (such as n-butyl, isobutyl, s-butyl, f-butyl), pentyl (such as n -pentyl, isopentyl, neopentyl) and the like.

Unless otherwise specified, the term "alkynyl" refers to an alkyl group that has one or more than one carbon-carbon triple bond at any position in the chain, can be monosubstituted or polysubstituted, and can be monovalent, divalent, or multivalent. Examples of alkynyl include ethynyl, propynyl, butynyl, pentynyl, and the like.

Unless otherwise specified, cycloalkyl includes any stable cyclic or polycyclic hydrocarbyl, and any carbon atom is saturated, can be monosubstituted or polysubstituted, and can be monovalent, divalent, or multivalent. Examples of cycloalkyl include, but are not limited to, cyclopropyl, norbornanyl, [2,2,2] bicyclooctane, [4,4,0] bicyclodecanyl, and the like.

Unless otherwise specified, the terms "halo" or "halogen" by itself or as part of another substituent refer to a fluorine, chlorine, bromine or iodine atom. Furthermore, the term "haloalkyl" is intended to include monohaloalkyl and polyhaloalkyl. For example, the term "C ¹ -C ⁴ haloalkyl" is intended to include, but is not limited to, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like. Unless otherwise specified, examples of haloalkyl include, but are not limited to, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachlorethyl.

The term "alkoxy" represents any alkyl defined above having a specified number of carbon atoms linked by an oxygen bridge. Unless otherwise specified, C ¹ -C ⁶ alkoxy includes C ¹ , C ² , C ³ , C ⁴ , C ^5, and C6 alkoxy. Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentyloxy, and S-pentoxy.

Unless otherwise specified, the term "aryl" refers to a polyunsaturated aromatic substituent, it can be mono-, di- or poly-substituted, it can be monovalent, divalent or multivalent, it can be a single ring or a multiple ring (eg, one to three rings; where at least one ring is aromatic), that are fused to each other or covalently connected. The term "heteroaryl" refers to an aryl (or ring) containing one to four heteroatoms. In an illustrative example, the heteroatom is selected from B, O, N, and S, where the nitrogen and sulfur atoms are optionally oxidized and the nitrogen atom is optionally quaternized. A heteroaryl can be attached to the remaining part of a molecule through a heteroatom. Non-limiting examples of aryl or heteroaryl include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2 -oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl , 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl , 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl and 6-quinolyl. The substituent on any of the above aryl and heteroaryl ring systems is selected from the acceptable substituents described below.

Unless otherwise specified, when combined with other terms (such as aryloxy, arylthio, arylalkyl), aryl includes aryl and heteroaryl ring as defined above. Therefore, the term "aralkyl" is intended to include the group (eg, benzyl, phenethyl, pyridylmethyl, etc.) where an aryl is attached to an alkyl, including an alkyl where the carbon atom (eg. g., methylene) has been replaced by an atom such as oxygen, eg, phenoxymethyl, 2-pyridyloxy, 3- (1-naphthyloxy) propyl, and the like.

The term "removable group" refers to a functional group or atom that can be replaced by another functional group or atom by a displacement reaction (such as an affinity displacement reaction). For example, representative leaving groups include: chlorine, bromine; sulfonate group, such as mesylate and tosylate.

The term "protecting group" includes, but is not limited to, "amino protecting group", "hydroxy protecting group".

The term "hydroxy protecting group" refers to a protecting group suitable for blocking the side reaction on hydroxy. Representative hydroxy protecting groups include, but are not limited to: alkyl such as methyl; acyl such as benzyl (Bn), and the like.

The compound of the present disclosure can be prepared by a variety of synthetic methods well known to those of skill in the art, including the following enumerative embodiment, the embodiment consisting of the following enumerative embodiment combined with other chemical synthesis methods, and either equivalent replacement. known to those of skill in the art. The preferred embodiment includes, but is not limited to, the embodiment of the present disclosure.

All solvents used in the present disclosure are commercially available. The present disclosure uses the following abbreviations: HATU stands for hexafluorophosphate of O- (7-azabenzotriazol-1-yl) -N, N, N ', N'tetramethyluronium.

Compounds are named by hand or by ChemDraw® software, commercially available compounds use the names from their supplier directory.

Detailed description of the preferred embodiment

The following examples further illustrate the present disclosure, but the present disclosure is not limited thereto. The present disclosure has been described in detail herein, specific embodiments thereof are also described herein, it is obvious to those skilled in the art that various modifications and improvements can be made to the embodiments of the present disclosure. without departing from the spirit and scope of the disclosure.

Embodiment 1

Step A: 1-1 (50.00 g, 274.47 mmol) was dissolved in dichloromethane (250 ml), then sulfonyl chloride (44.45 g, 329.36 mmol) was added while stirring, the temperature was controlled between 25-30 ° C. The system was stirred at 25-30 ° C for 48 hours. After completion of the reaction, the system was poured into 300 mL of saturated sodium bicarbonate solution, then extracted with EtOAc (150 mL * 3), the organic phases were combined and washed with saturated brine (40 mL * 3), dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure. The residue was purified through a silica gel column (eluent: PE / EtOAc = 10 / 1-2 / 1), yielding 1-2.

Step B: 1-2 (20.00 g, 92.33 mmol) was dissolved in W, W-dimethylformamide (60 mL), then benzyl bromide (14.26 mL, 120.03 mmol) and Potassium carbonate (33.18 g, 240.06 mmol) while stirring, the temperature was controlled between 25-30 ° C. The system was stirred at 25-30 ° C for 48 hours. After completion of the reaction, EtOAc (200 mL) and water (500 mL) were added to it and then separated to provide an organic phase. The organic phase was washed with water (50 mL * 2) and brine (60 mL * 2), dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure to provide 1-3.

Step C: 1-3 (36 g, 117.36 mmol) was dissolved in tetrahydrofuran (40 mL) and water (40 mL), then lithium hydroxide monohydrate (29.55 g, 704.18 mmol) was added ). The system was stirred at 30 ° C for 48 hours. After completion of the reaction, water (200 mL) was added to this and then extracted with EtOAc (50 mL * 3). The aqueous phase was adjusted to pH = 1-2 and extracted with EtOAc (50 mL * 3), the organic phases were combined, dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure, affording 1-4.

Step D: 1-4 (15 g, 51.25 mmol) was dissolved in dichloromethane (150 mL), oxalyl chloride (9.76 g, 76.88 mmol) and W, W-dimethylformamide (394.26) were added pl, 5.13 mmol) under nitrogen atmosphere. The system was stirred at 250C for 2 hours, concentrated under reduced pressure to remove the solvent, yielding 1-5.

Step E: Lithium hexamethyldisilazide (1 mol / L, 101.06 mL) was added dropwise to 1-5 (15.72 g, 50.53 mmol) and ethyl 2-acetyl-3-dimethylamino acrylate (7, 8 g, 42.11 mmol) in tetrahydrofuran solution (93 mL) at -70 ° C. The acetone bath was removed on dry ice and acetic acid (84.22 mL, 1.47 mol) and ammonium acetate (4.22 g, 54.74 mmol) were added to the system, the tetrahydrofuran was removed by concentration at reduced pressure, then stirred at 60-65 ° C for 1.5 hours. After concentrating under reduced pressure and evaporating to dryness, the residue was washed with methyl tert-butyl ether (150 mL) and PE (200 mL), then filtered, the filter cake was dried under reduced pressure, yielding 1 -6.

Step F: 1-6 (5 g, 12.08 mmol) was dissolved in tetrahydrofuran (1.25 L), palladium on carbon (10%, 500 mg) was added under nitrogen atmosphere, after the system was charged with hydrogen several times, the system was stirred at 25 ° C for 15 minutes under an atmosphere of hydrogen at 1.03 bar (15 Psi). Then, after filtration, the residue was dissolved in the mixture of dichloromethane / methanol = 10/1 (1500 mL), then filtered to remove palladium on carbon, the filtrate was concentrated under reduced pressure to provide 1-7.

1H NMR (400MHz, DMSO-d6) 58.54 (s, 1H), 7.72 (s, 1H), 6.78 (s, 1H), 6.51 (s, 1H), 4, 23 (q, J = 7.1 Hz, 2H), 3.83 (s, 3H), 1.30 (t, J = 7.1 Hz, 3H).

Step G: 1-7 (3 g, 9.27 mmol) was dissolved in W, W-dimethylformamide (60 mL), then potassium carbonate (10.25 g, 74.16 mmol) and dibromotoluene ( 6.59 g, 27.81 mmol), the system was stirred at 100 ° C for 32 hours. The reaction mixture was quenched with water (300 mL), then extracted with EtOAc (300 mL * 2). The organic phases were combined and washed with water (300 mL * 2), dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure, and purified using a silica gel column (eluent: PE / EtOAc = 10: 1-1: 0), giving 1-8.

1H NMR (400MHz, CDCI ³ ) 57.96 (s, 1H), 7.63 (s, 1H), 7.51-7.44 (m, 3H), 7.34 (dd, J = 1, 9, 7.5 Hz, 2H), 6.83 (s, 1H), 6.63 (s, 1H), 6.59 (s, 1H), 4.31 (q, J = 7.1 Hz , 2H), 3.92 (s, 3H), 1.33 (t, J = 7.1Hz, 3H).

Step H: 1-8 (100.00 mg, 242.81 pmol) was dissolved in methanol (2 mL) and water (1 mL), then sodium hydroxide (19.42 mg, 485.62 pmol) was added ) and stirred at 25 ° C for 16 hours. The reaction mixture was adjusted with 1 mol / L hydrochloric acid to pH = 3 and extracted with dichloromethane (15 mL * 2). The organic phases were combined and washed with brine, dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure. The residue was washed with PE / EtOAc = 5/1, filtered to provide the filter cake which was dried under reduced pressure, yielding Run 1.

1H NMR (400MHz, DMSO-d6) 16.12 (s, 1H), 8.72 (s, 1H), 8.26 (s, 1H), 7.54 (s, 1H), 7 , 51 (s, 1H), 7.47-7.43 (m, 3H), 7.27 (dd, J = 2.6, 6.4Hz, 2H), 7.11 (s, 1 H), 3.92 (s, 3H).

Embodiment 2

Step A: 1-8 (1.60 g, 3.89 mmol) was dissolved in dichloromethane (160 mL), boron tribromide (2.25 mL, 23.34 mmol) was added dropwise at 700 ° C and stirred at 25 ° C for 16 hours. The reaction mixture was quenched with methanol (60 mL) at 0 ° C, after concentrating under reduced pressure and evaporating to dryness, water (50 mL) and dichloromethane (30 mL) were added, then filtered to provide a solid, which was then dried under reduced pressure to provide 2-2.

1H NMR (400MHz, DMSO-d6) 511.53 (s, 1H), 8.73 (s, 1H), 8.18 (s, 1H), 7.51 (s, 1H), 7, 46-7.41 (m, 5H), 7.21 (dt, J = 2.4, 3.5 Hz, 2H), 6.75 (s, 1H).

Step B: 2-2 (1.20 g, 3.25 mmol) was dissolved in methanol (30 mL), thionyl chloride (2.36 mL, 32.50 mmol) was added at 0 ° C, the mixture of The reaction was stirred at 50 ° C for 16 hours. The system was concentrated under reduced pressure and evaporated to dryness, the solid was washed with PE / EtOAc = 3/1 (12 mL) and filtered to provide the filter cake, which was dried under reduced pressure, yielding 2-3 .

Step C: 2-3 (100.00 mg, 260.57 pmol), 3-bromo-2,2-dimethyl-1-propanol (65.29 mg, 390.86 pmol), sodium iodide (7 , 81 mg, 52.11 pmol), potassium carbonate in W, W-dimethylformamide (2 mL) and stirred at 120 ° C for 16 hours. The reaction mixture was adjusted with 1 mol / L hydrochloric acid to pH = 3-4, then extracted with dichloromethane (15 mL * 2), the organic phases were combined and washed with water (20 mL * 2 ), dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure. The solid obtained was purified by HPLC (column: Boston Green ODS 150 * 30 5 pm; mobile phase: [water (0.225% formic acid) - acetonitrile]; elution gradient: 35% -65%, 12 min), yielding Run 2 (20.90 mg, 44.24 mmol, 16.98%).

1H NMR (400 MHz, DMSO-d6) 58.74 (s broad, 1H), 8.35 (s, 1H), 8.21 (d broad, J = 0.7 Hz, 1H), 7, 55 (s, 1H), 7.45-7.41 (m, 3H), 7.21 (s, 2H), 7.05 (s, 1H), 3.83 (s, 2H), 3 , 28 (s, 2H), 0.93 (s, 6H).

Embodiments 3 to 9 were obtained according to the same method as Embodiment 2.

Embodiment 3

1H NMR (400MHz, CDCh) 58.24 (s, 1H), 7.72 (s, 1H), 7.60-7.45 (m, 3H), 7.33 (dd, J = 1.3, 7.9 Hz, 2H), 7.02 (s, 1H), 6.72 (s, 1H), 6.64 (s, 1H), 4.22 (d, J = 4 , 6Hz, 2H), 3.91-373 (m, 2H), 3.49 (s, 3H).

Embodiment 4

1H NMR (400MHz, CDCh) 58.25 (s, 1H), 7.76 (s, 1H), 7.57-7.51 (m, 3H), 7.33 (broad d, J = 6 , 5 Hz, 2H), 7.05 (s, 1H), 6.70 (s, 1H), 6.65 (s, 1H), 6.32 (s, 0.25H), 6 , 19 (s, 0.45H), 6.05 (s, 0.3H), 4.29 (dt, J = 3.8, 12.6 Hz, 2H).

Embodiment 5

1H NMR (400MHz, DMSO-d6) 58.35 (s, 1H), 7.54 (s, 2H), 7.46-7.43 (m, 4H), 7.24 (s, 1H) , 7.14 (s, 1H), 7.13-7.13 (m, 1H), 4.25 (broad t, J = 5.3 Hz, 3H), 3.61-3.53 (m, 6H), 2.73 (t, J = 5.6 Hz, 3H).

Embodiment 6

1H NMR (400 MHz, CD ³ OD) 58.51 ^(s, 1H), 8.35 ^(s, 1H), 7.99 ^(s, 1H), 7.49 (br ^s, 3H), 7 , 37 ( ^s broad, 2H), 7.19 (s broad, 2H), 6.96 (s, 1H), 4.23 (t broad, J = 6.0 Hz, 2H), 3.79 (t , J = 6.1 Hz, 2H), 2.05 (broad t, J = 6.1 Hz, 3H).

Embodiment 7

1H NMR (400 MHz, CD ³ OD) 58.55 to 8.41 ^(m, 2H), 7.98 ^(s, 1H), 7.48 (br ^s, 3H), 7.37 ^(s, 2H) , 7.19 ^(s, 2H)), 6.97 (br s, 1H), 4.20 (br s, 2H), 3.94 (br s, 2H).

Embodiment 8

1H NMR (400 MHz, CD ³ OD) 58.50 ^(s, 1H), 7.99 ^(s, 1H), 7.54 to 7.32 ^(m, 6H), 7.22 (br ^s, 1H), 6.93 ^(s, 1H), 5.13 to 5.06 (m, 1H), 4.19 to 4.07 (m, 1H), 4.13 (br s, 1H), 3.60 (t broad, J = 58 Hz, 2H), 1.88 (s broad, 2H), 1.61 (s broad, 5H).

Embodiment 9

1H NMR (400MHz, CDCh) 58.22 ( ^s , 1H), 7.75 ( ^s , 1H), 7.61-7.48 ( ^m , 3H), 7.37 (d, J = 6.5 H ^z, 2H), 7.04 ^(s, 1H), 6.88 (s, 1H), 6.63 (s, 1H), 4.85 (t, J = 2.4 Hz, 2H), 2.63 (t, J = 2.4 Hz, 1H).

Embodiment 10

Step A: 2-3 (50.00 mg, 130.28 pmol) were dissolved in DMF (2 mL) and potassium carbonate (36.01 mg, 260.56 mmol), acid (2,2-difluoro -3-Hydroxypropyl) -4-p-toluenesulfonic (34.69 mg, 130.28 pmol), the system was stirred at 1000 ° C for 12 hours. The reaction mixture was adjusted with 1 mol / L hydrochloric acid to pH = 3-4 and extracted with dichloromethane (15 mL * 2), the organic phases were combined and washed with water (20 mL * 2), dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure. The residue was then purified by means of a silica gel plate (silicon dioxide, dichloromethane: methanol = 15: 1), yielding 10-2.

Step B: 10-2 (40.00 mg, 26.79 pmol) was dissolved in tetrahydrofuran (1 mL), methanol (1 mL) and water (1 mL), lithium hydroxide monohydrate (1.12 mg) was added , 26.79 pmol), the system was stirred at 25 ° C for 1 hour. The reaction mixture was adjusted to pH = 3-4, then purified by HPLC (column: Boston Green ODS 150 * 305 pm; mobile phase: [water (0.225% formic acid) - acetonitrile]; gradient elution : 30% -54%, 10 min), providing realization 10.

1H NMR (400MHz, CD3OD) 58.51 (s, 1H), 8.08 (s, 1H), 7.50 (broad d, J = 3.3Hz, 3H), 7.38 (d broad, J = 4.4 Hz, 2H), 7.24 (d broad, J = 18.3 Hz, 2H), 7.07 (s, 1H), 4.45 (t broad, J = 11, 4Hz, 2H), 3.91 (t, J = 13.1Hz, 2H).

Embodiments 11-12 were obtained according to the same method as Embodiment 10.

Embodiment 11

1H NMR (400MHz, DMSO-d6) 58.73 (s, 1H), 8.27 (s, 1H), 7.54 (s, 1H), 7.52 (s, 1H), 7, 47-7.43 (m, 3H), 7.26 (dd, J = 2.6, 6.5 Hz, 2H), 7.13 (s, 1H), 4.26 (t, J = 6, 1Hz, 2H), 3.28-3.24 (m, 2H), 3.03 (s, 3H), 2.23-2.13 (m, 2H).

Embodiment 12

1H NMR (400MHz, CD3OD) 58.35 (s broad, 1H), 7.91 (s, 1H), 7.38 (s broad, 3H), 7.27 (s broad, 2H), 7.09 (s broad, J = 17.0 Hz, 2H), 6.86-6.81 (m, 1H), 4.04 (s broad, 2H), 3.45-3.37 (m, 5H), 2.29-2.21 (m, 2H), 2.02-1.97 (m, 2H), 1.96-1.92 (m, 2H).

Embodiment 13 (13_A and 13_B)

Step A: 13-1 (10.00 g, 59.5 mol) was dissolved at 0 ° C in dioloromethane (500 mL), then sulfonyl chloride (10.77 g, 79.77 mmol, 7.98 mL). The mixture was stirred at 35 ° C for 38 hours. The solution was then added to 300 mL of saturated sodium bicarbonate solution and stirred. The aqueous phase was extracted with EtOAc (150 mL * 3), the combined organic phase was then washed, with saturated brine (40 mL * 3) and dried over anhydrous sodium sulfate, distilled under reduced pressure to provide the residue White color. The white residue was then purified by silica gel chromatography (eluent: PE / EtOAc = 30 / 1-20 / 1) to provide the white solid compound 13-2.

1H NMR (400MHz, CD3OD) 5 10.75 (s, 1H), 7.74 (s, 1H), 6.54 (s, 1H), 5.98 (s, 1H), 3 , 85 (s, 3H).

Step B: 13-2 (8.00 g, 39.49 mmol), 1-bromo-3-methoxypropane (7.25 g, 47.39 mmol) were dissolved in DMF (100.00 mL), cooled to 0 ° C, then potassium carbonate (10.92 g, 78.98 mmol) was added. The mixture was heated to 25 ° C and stirred for 10 hours. EtOAc (300 mL) and water (50 mL) were then added to the solution and stirred at 25 ° C for 10 minutes. The organic phase was separated and washed with saturated brine (40 mL * 3) and dried over anhydrous sodium sulfate, then concentrated under reduced pressure to provide a yellow liquid. The yellow liquid was purified by silica gel chromatography (eluent: PE / EtOAc = 30/1 -20/1) to provide the white solid compound 13-3.

1 H NMR (400 MHz, CDCh) 5 10.90 (s, 1H), 7.82 (s, 1H), 6.52 (s, 1H), 4.16 (t, J = 6.0 Hz, 2 H), 3.94 (s, 3H), 3.60 (t, J = 6.0 Hz, 2H), 3.38 (s, 3H), 2.13 (t, J = 6.0 Hz , 2H).

Step C: Potassium carbonate (4.76 g, 34.45 mmol) was added to 13-3 (3.64 g, 13.25 mmol), benzyl chloride (2.18 g, 17.23 mmol, 1 , 98 mL) in DMF (10.00 mL). The mixture was stirred at 25 ° C for 20 hours. EtOAc (150 mL) and water (30 mL) were added to the solution, the solution was stirred at 20 ° C for 10 minutes. The organic phase was separated and washed with water (30 mL * 2) and saturated brine (30 mL * 2), then dried over anhydrous sodium sulfate and concentrated under reduced pressure to provide the yellow liquid compound 13-4.

Step D: 13-4 (2.00 g, 5.48 mmol) and lithium hydroxide monohydrate (1.38 g, 32.89 mmol) in tetrahydrofuran (20 mL) and water (10 mL) were stirred at 10 -200C for 10 hours. The solution was then washed with EtOAc / PE 1/1 (5 mL * 3). The aqueous phase was adjusted to pH = 1-2. The mixture was then extracted with dichloromethane (50 mL * 3), the organic phase was combined and dried over anhydrous sodium sulfate, then concentrated under reduced pressure to provide the white solid compound 2-benzyloxy-5-chloro-4- (3-methoxypropane) benzoic acid (1.30 g, 3.71 mmol, 67.63%). Thionyl chloride (508.60 mg, 4.28 mmol, 310.12 gl) was added to 2-benzyloxy-5-chloro-4- (3-methoxypropane) benzoic acid (1.00 g, 2.85 mmol) in dichloromethane (10.00 mL). The mixture was stirred at 25 ° C for 1 hour. The mixture was then concentrated under reduced pressure to provide a residue. The residue was then dissolved in toluene and then further concentrated under reduced pressure to provide a residue. Residue 13-5 was kept under a nitrogen atmosphere.

1H NMR (400MHz, DMSO-da) 12.87-12.22 (m, 1H), 7.74 (s, 1H), 7.53 (broad d, J = 7.2 Hz, 2H), 7.40 (t, J = 7.6Hz, 2H), 7.36-7.30 (m, 1H), 6.94 (s, 1H), 5.27 (s, 2H), 4.20 (s, 2H), 3.50 (s, 2H), 3.26 (s, 3H), 1.98 (t, J = 6.4 Hz, 2H).

Step E: 13-5 (2.94 g, 7.96 mmol) and ethyl 2- (dimethylaminomethylene) -3-oxobutanoate (1.62 g, 8.6 mmol, 1.10 eq) were added dropwise in tetrahydrofuran (20 mL) in 5 minutes in lithium hexamethyldisilazide (1 mol / L, 23.88 mL) in tetrahydrofuran (20 mL) at -70 ° C. The cooling bath was then removed and the mixture was continuously stirred for 5 minutes. Then, ammonium acetate (3.23 g, 41.95 mmol) and acetic acid (67.85 g, 1.13 mmol) were added to the mixture and most of the tetrahydrofuran was removed by rotary evaporator at 60 ° C. The residue was then heated at 60-65 ° C for 1.5 hours. The reaction mixture was cooled and water (40 mL) and dichloromethane (200 mL) were added. The mixture was stirred for 10 min and then separated, the organic phase was washed with water (10 mL * 3) and sodium dicarbonate solution, dried and then concentrated to provide the yellow residue. The residue was then purified by silica gel chromatography (eluent: PE / EtOAc = 10/1) to provide compound 13-6.

Step F: Activated wet palladium on charcoal (500mg) was added to 13-6 (3.00g, 6.36mmol) in tetrahydrofuran (20mL). The mixture was stirred at 25 ° C under an atmosphere of hydrogen at 1.03 bar (15 psi) for 2 hours. The brown suspension was then filtered to provide a yellow liquid, then concentrated under reduced pressure to provide a yellow residue. The yellow residue was triturated twice in PE / EtOAc (4/1) and then filtered to provide pale yellow solid 13-7.

Step G: 13-7 (800.00 mg, 2.10 mmol), potassium carbonate (580.48 mg, 4.20 mmol) and dibromotoluene (551.10 mg, 2.21 mmol) were stirred in solution of DMF (20.00 mL) at 100 ° C for 10 hours. Then EtOAc (60 mL) and water (10 mL) were added to the reaction mixture, then the organic phase was separated, the aqueous phase was extracted with EtOAc (20 mL * 3), all the organic phase was combined and washed with water (10 mL * 3) and saturated brine (10 mL * 3), then concentrated under reduced pressure to provide a yellow liquid. The yellow liquid was purified by silica gel chromatography (eluent: PE / EtOAc = 10 / 1-5 / 1) to provide a white solid. The solid was then separated using a chiral chromatography column (column: AD (250mm * 30mm, 10 gm); mobile phase: [ ^{0.1% NH 3} H ² O -MeOH]; elution gradient: 50% -50%, 5.9 min, 800 min), providing run 13-7A (t = 3.831 min) and run 13-7B (t = 4.552 min).

Step H: Lithium hydroxide monohydrate (107.15 mg, 2.55 mmol) was added to 13-7A (240.00 mg, 510.74 mmol) in methanol (9 mL) and water (3 mL). The mixture was then stirred at 25 ° C for 19 hours. The mixture was then washed with EtOAc / PE (1/4) (5 mL) and adjusted with a dilute hydrochloric acid solution (1 mol / L) to pH = 2-3. The mixture was then extracted with dichloromethane (40 mL * 3). The organic phases were combined and concentrated under reduced pressure to provide a yellow liquid. The yellow liquid was purified by HPLC (column: Agela ASB 150 * 25 mm * 5 gm; mobile phase: [water (0.1% TFA) - ACN]; elution gradient: 42% -72%, 10 min) to provide embodiment 13_A.

1H NMR (400MHz, CDCI3) 15.46 (s, 1H), 8.15 (s, 1H), 7.62 (s, 1H), 7.49-7.37 (m, 3H), 7.24 (d broad, J = 7.0 Hz, 2H), 6.93 (s, 1H), 6.61 (s, 1H), 6.55 (s, 1H), 4.67 (s broad , 3H), 4.08 (t, J = 6.2 Hz, 2H), 3.51 (t, J = 5.9 Hz, 2H), 3.28 (s, 3H), 2.08 - 1.93 (m, 2H).

Step I: Lithium hydroxide monohydrate (129.48 mg, 3.09 mmol) was added to 13-7B (290.00 mg, 617.14 mmol) in methanol (9 mL) and water (3 mL). The solution was then stirred at 25 ° C for 19 hours. Then, the mixture was washed with EtOAc / PE (1/4) (5 mL) and adjusted with a hydrochloric acid solution (1 mol / L) to pH = 2-3. The mixture was then extracted with dichloromethane (40 mL * 3). The organic phases were combined and concentrated under reduced pressure to provide a liquid. The yellow liquid was purified by HPLC (column: Agela ASB 150 * 25 mm * 5 gm; mobile phase: [water (0.1% TFA) - ACN]; elution gradient: 42% -72%, CO ^2, 11 min) to provide 13_B embodiment.

1H NMR (400MHz, CDCI3) 58.14 (s, 1H), 7.62 (s, 1H), 7.50-7.36 (m, 3H), 7.24 (broad d, J = 7, 0 Hz, 1H), 7.26-7.22 (m, 1H), 6.93 (s, 1H), 6.61 (s, 1H), 6.54 (s, 1H) , 4.08 (t, J = 6.2 Hz, 2H), 3.51 (t, J = 5.9 Hz, 2H), 3.28 (s, 3H), 2.04 (t, J = 6.1 Hz, 2H).

Embodiment 14

Step A: Benzoyl peroxide (122.21 mg, 504.50 mmol) was added to 14-1 (1.00 g, 10.09 mmol) and bromosuccinimide (3.77 g, 21.19 mmol) in tetrachloromethane ( 10.00 mL), the obtained mixture was illuminated at 800C and stirred for 16 hours. After completion of the reaction, the solvent was removed from the mixture, then the mixture was dissolved in 60 mL of water and extracted with EtOAc (50 mL * 3), the organic phases were combined and washed with 60 mL of saturated brine and dried over anhydrous sodium sulfate, then filtered and concentrated to provide the residue. The residue was purified by silica gel chromatography (eluent: PE / EtOAc = 1 / 0-10 / 1) to provide compound 14-2.

1H NMR (400MHz, CDCI3) 57.82 (d, J = 8.0Hz 1H), 7.50 (d, J = 7.6Hz 1H), 6.66 (s, 1H).

Embodiment 14 was obtained according to the method of step B, C in embodiment 13.

Embodiment 14: 1 H NMR (400 MHz, CDCh) 515.44 (broad s, 1H), 8.60 (broad s, 1H), 7.76 (broad d, J = 2.7 Hz, 1H), 7, 64 (s, 1H), 7.47 (broad d, J = 2.4 Hz, 1H), 7.11 (broad s, 1H), 6.97 (s, 1H), 6.76 (s, 1H ), 4.19 (broad t, J = 6.0 Hz, 2H), 3.60 (t broad, J = 5.2 Hz, 2H), 3.37 (s, 3H), 2.17 - 2.10 (m, 2H).

Embodiments 15-24 can be obtained according to the method of Embodiment 14.

Embodiment 15

1H NMR (400MHz, CDCh) 515.47 (s, 1H), 8.00 (s, 1H), 7.78 (s, 1H), 7.63-7.52 (m, 2H), 7, 50-7.39 (m, 2H), 7.02 (s, 1H), 6.84 (s, 1H), 6.70 (s, 1H), 4.16 (t, J = 6.2 Hz, 2H), 3.59 (t, J = 5.9Hz, 2H), 3.39-3.31 (m, 3H), 2.12 (quin, J = 6.1 Hz, 2H ).

Embodiment 16

1H NMR (400MHz, CDCI ³ ) 515.46 ( ^s , 1H), 8.28 ( ^s , 1H), 7.69 ( ^s , 1H), 7.52-7.46 ( ^m , 1H), 7.44 - 7.37 (m, 1H), 7.32 (s, 1H), 7.12 (broad d, J = 7.2 Hz, 1H), 7.01 (s, 1H) , 6.73 - 6.62 (m, 2H), 4.16 (t, J = 6.0 Hz, 2H), 3.59 (t, J = 6.0 Hz, 2H), 3.36 ( s, 3H), 2.13 (t, J = 6.4 Hz, 2H).

Embodiment 17

1H NMR (400 MHz, CDCh) 515.49 ( ^s broad, 1H), 8.26 ( ^s , 1H), 7.68 ( ^s , 1H), 7.46 (d broad, J = 8.0H ^z , 2H), 7.23 (d broad, J = 8.0 Hz, 2H), 7.00 (s, 1H), 6.75-6.58 (m, 2H), 4.15 (t , J = 6.0 Hz, 2H), 3.59 (t, J = 6.0 Hz, 2H), 3.36 (s, 3H), 2.12 (broad t, J = 6.0 Hz, 2H).

Embodiment 18

1H NMR (400MHz, CDCh) 58.21 ( ^s , 1H), 7.70 ( ^s , 1H), 7.37-7.29 (m, 2H), 7.23-7.15 (m, 2H), 7.00 ( ^s , 1H), 6.68 ( ^s , 1H), 6.62 (s, 1H), 4.16 (broad t, J = 6.0 Hz, 2H), 3.59 (t, J = 6.0 Hz, 2H), 3.36 (s, 3H), 2.17-2.09 (m, 2H).

Embodiment 19

1H NMR (400MHz, CDCh) 515.46 ( ^s broad, 1H), 8.14 ( ^s , 1H), 7.76 ( ^s , 1H), 7.63-7.56 (m, 1H), 7 , 32-7.29 (m, 2H), 7.28 (s, 1H), 7.02 (s, 1H), 6.81 (s, 1H), 6.69 (s, 1H), 4 , 15 (t, J = 6.0 Hz, 2H), 3.58 (t, J = 6.0 Hz, 2H), 3.35 (s, 3H), 2.12 (t, J = 6.0 Hz, 2H).

Embodiment 20

1H NMR (400MHz, CDCh) 515.46 ( ^s broad, 1H), 8.29 ( ^s , 1H), 7.68 ( ^s , 1H), 7.49-7.42 (m, 1H), 7 , 24-7.18 (m, 1H), 7.05 (broad d, J = 9.2 Hz, 1H), 7.03-6.99 (m, 2H), 6.71-6.64 (m, 2H), 4.16 (t, J = 6.0 Hz, 2H), 3.59 (t, J = 6.0 Hz, 2H), 3.36 (s, 3H), 2.13 (quin, J = 6.0 Hz, 2H).

Embodiment 21

1H NMR (400 MHz, CDCI ³ ) 15.55 ( ^s , 1H), 8.05 ( ^s , 1H), 7.76 ( ^s , 1H), 7.47 (t, J = 7.0H ^z , 1H), 7.37 (d, J = 7.5 Hz, 1H), 7.33 (t, J = 7.6 Hz, 1H), 7.21 (d, J = 7, 7Hz, 1H), 7.02 (s, 1H), 6.68-6.61 (m, 2H), 4.15 (t, J = 6.2Hz, 2H), 3.58 (t, J = 5.9 Hz, 2H), 3.35 (s, 3H), 2.44 (s, 3H), 2.12 (t, J = 6.0 Hz, 2H).

Embodiment 22

1H NMR (400MHz, CDCl3) 515.58 ( ^s , 1H), 8.19 ( ^s , 1H), 7.71 ( ^s , 1H), 7.43 - 7.30 (m, 2H), 7 , 16 - 7.10 (m, 2H), 7.00 (s, 1H), 6.69 (s, 1H), 6.54 (s, 1H), 4.15 (t, J = 6.0 Hz , 2H), 3.59 (t, J = 6.0 Hz, 2H), 3.36 (s, 3H), 2.40 (s, 3H), 2.12 (t, J = 6 , 0 Hz, 2H).

Embodiment 23

1H NMR (400MHz, CDCh) 515.59 ( ^s broad, 1H), 8.19 ( ^s , 1H), 7.70 ( ^s , 1H), 7.33-7.28 (m, 2H), 7 , 25-7.19 (m, 2H), 6.99 (s, 1H), 6.68 (s, 1H), 6.55 (s, 1H), 4.15 (t broad, J = 6.1 Hz, 2H), 3.58 (t, J = 5.8 Hz, 2H), 3.35 (s, 3H), 2.41 (s, 3H), 2.14-2 , 09 (m, 2H).

Embodiment 24

1H NMR (400MHz, CDCh) 515.49 ( ^s , 1H), 8.29 ( ^s , 1H), 7.70 ( ^s , 1H), 7.01 ( ^s , 1H), 6.77 - 6.67 (m, 2H), 6.65-6.56 (m, 3H), 4.18 (t, J = 6.2 Hz, 2H), 3.82 (s, 3H), 3, 60 (t, J = 5.9Hz, 2H), 3.38 (s, 3H), 2.14 (quin, J = 6.1Hz, 2H). Embodiments 25-34 can be obtained according to the method of Embodiment 35.

Embodiment 25

1H NMR (400MHz, CDCh) 15.59 ( ^s , 1H), 8.01 ( ^s , 1H), 7.79 ( ^s , 1H), 7.34-7.29 (m, 1H), 7.27 ( ^s , 1H), 7.07 (dd, J = 4.0, 9.0 Hz, 1H), 7.00 (s, 1H), 6.75 (s, 1H), 6.70 (s, 1H), 4.19 (t , J = 6.2 Hz, 2H), 3.90 (s, 3H), 3.61 (t, J = 5.9 Hz, 2H), 3.38 (s, 3H), 2.15 (quin, J = 6.1 Hz, 2H).

Embodiment 26

1H NMR (400MHz, CDCI ³ ) 515.59 ( ^s broad, 1H), 8.01 ( ^s , 1H), 7.79 ( ^s , 1H), 7.34-7.29 (m, 1H ), 7.27 ( ^s , 1H), 7.07 (dd, J = 4.0, 9.0 Hz, 1H), 7.00 (s, 1H), 6.75 (s, 1H), 6 , 70 (s, 1H), 4.19 (t, J = 6.2 Hz, 2H), 3.90 (s, 3H), 3.61 (t, J = 5.9 Hz, 2H), 3 , 38 (s, 3H), 2.15 (quin, J = 6.1 Hz, 2H).

Embodiment 27

1H NMR (400 MHz, CDCH) 57.99 ^(s, 1H), 7.70 ^(s, 1H), 7.54 (dt, J = 5.9, 8.3 H ^z, 1H), 7, 38 (d, J = 8.2 H ^z, 1H), 7.19 -7.13 (m, 1H), 6.95 (s, 1H), 6.87 (s, 1H), 6.63 (s, 1H), 4.14-4.04 (m, 2H), 3.51 (t, J = 5.8Hz, 2H), 3.28 (s, 3H), 2.05 (quin, J = 6.0 Hz, 2H).

Embodiment 28

1H NMR (400MHz, CDCl3) 5 = 15.51 ( ^s broad, 1H), 8.53 ( ^s , 1H), 7.68 ( ^s , 1H), 6.98-6.89 (m, 2H), 6.75 ( ^s , 1H)), 4.24-4.15 (m, 2H), 3.66-3.57 (m, 2H), 3.39 (s, 3H), 2, 33 (s, 3H), 2.25 (s, 3H), 2.15 (quin, J = 6.1 Hz, 2H).

Embodiment 29

1H NMR (400MHz, CDCl3) 58.18 ( ^s , 1H), 7.79 ( ^s , 1H), 7.71-7.63 (m, 1H), 7.16 (t, J = 8, ^6Hz , 2H), 7.03 ( ^s , 1H), 6.83 (s, 1H), 6.71 (s, 1H), 4.22-4.12 (m, 2H), 3, 63-3.62 (m, 1H), 3.60 (t, J = 5.9 Hz, 1H), 3.37 (s, 3H), 2.14 (quin, J = 6.1 Hz , 2H).

Embodiment 30

1H NMR (400MHz, CDCis) 15.38 ( ^s , 1H), 8.35 ( ^s , 1H), 7.69 ( ^s , 1H), 7.02 ( ^s , 1H), 6.95 ( t broad, J = 8.3H ^z , 1H), 6.79 (d broad, J = 5.0Hz, 2H), 6.71 (s, 2H), 4.19 (t, J = 6 , 0Hz, 2H), 3.61 (t, J = 6.0Hz, 2H), 3.38 (s, 3H), 2.15 (t, J = 6.0Hz, 2H).

1H NMR (400 MHz, CDCis) 15.37 ( ^s , 1H), 8.19 ( ^s , 1H), 7.74 ( ^s , 1H), 7.45-7.35 (m, 1H), 7.25 - 7.19 (m, 1H), 7.03 (s, 1H), 6.94 (broad t, J = 6.9 Hz, 1H), 6.87 (s, 1H), 6.68 (s, 1H), 4.16 (t, J = 6.2Hz, 2H), 3.58 (t, J = 5.9Hz, 2H), 3.35 (s, 3H) , 2.12 (t, J = 6.1 Hz, 2H).

Reaiization 32

1H NMR (400MHz, CDCb) 15.38 ( ^s broad, 1H), 8.14 ( ^s , 1H), 7.76 ( ^s , 1H), 7.29 ( ^s broad, 1H), 7.09 - 6.93 (m, 3H), 6.78 (s, 1H), 6.70 (s, 1H), 4.17 (t, J = 6.0 Hz, 2H), 3.59 (t, J = 6.0 Hz, 2H), 3.36 (s, 3H), 2.13 (t, J = 6.0 Hz, 2H).

Reaiization 33

1H NMR (400MHz, CDa ³ ) 515.41 ( ^s broad, 1H), 8.13 ( ^s , 1H), 7.75 ( ^s , 1H), 7.30 (d broad, J = 6.1H ^z , 1H), 7.07-7.00 (m, 3H), 6.77 (s, 1H), 6.69 (s, 1H), 4.16 (t, J = 6.2 Hz, 2H ), 3.59 (t, J = 5.9Hz, 2H), 3.35 (s, 3H), 2.13 (quin, J = 6.1Hz, 2H).

Reaiization 34

1H NMR (400MHz, CDCb) 15.51 ( ^s , 1H), 8.13 ( ^s , 1H), 7.78 ( ^s , 1H), 7.25-7.19 (m, 1H), 7.10 (td, J = 3.8, 8.8 Hz, 1H), 7.02 (s, 1H), 6.84 (dd, J = 3.1.5.3 Hz, 1H), 6 , 75-6.71 (m, 1H), 6.73 (d, J = 2.5Hz, 1H), 4.18 (t, J = 6.2Hz, 2H), 3.82 (s, 3H), 3.60 (t, J = 5.9Hz, 2H), 3.37 (s, 3H), 2.14 (quin, J = 6.1Hz, 2H).

Embodiment 35

ea zac n

Step A: The mixture of 35-1 (20.00 g, 139.7 mmol) and HATU (79.68 g, 209.55 mmol) was dissolved in dichloromethane (250.00 mL), then triethylamine was added (49.48 g, 488.95 mmol, 67.78 mL). The mixture was stirred at 25 ° C for 10 minutes, then W-methoxymethylamine hydrochloride (27.25 g, 279.40 mmol) was added. After the addition, the reaction system was charged with nitrogen 3 times, then stirred at 25 ° C for 3 hours under a nitrogen atmosphere. The reaction mixture was extracted with dichloromethane (150 mL * 3). The organic phase was then washed with water (250 mL * 3) and saturated brine (200 mL * 2), dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure. The crude product was purified by silica gel chromatography (eluent: PE / EtOAc = 1 / 0-1 / 1) to provide compound 35-2.

1H NMR (400MHz, CDCI3) 58.88 (s, 1H), 3.47 (s, 3H), 3.30 (s, 3H), 2.55 (s, 3H).

Step B: 35-2 (1.70 g, 9.13 mmol) was dissolved in dichloromethane (20.00 mL) and cooled to -78 ° C. DIBAL-H (1 mol, 27.39 mL) was added dropwise at -78 ° C. The mixture was stirred for 2 hours. The mixture was then quenched by dropwise adding methanol (2.2 mL) at -78 ° C, then stirred for 10 minutes and the acetone bath was removed on dry ice. Water (1.2 mL), sodium hydroxide (4 mol, 1.2 mL) and water (3 mL) were added to the mixture. After the addition, the mixture was stirred at 25 ° C for 15 min, dried over MgSO4, then filtered and concentrated under reduced pressure to provide compound 35-3.

1H NMR (400MHz, CDCh) 10.05 (s, 1H), 9.18-9.28 (m, 1H), 2.67 (s, 3H).

Step C: A solution of triphenylphosphite (2.93 g, 9.44 mmol, 2.48 mL) was dissolved in dichloromethane (20.00 mL), liquid bromine (1.51 g) and triethylamine (1.00 g, 9.91 mmol, 1.37 mL) to the -60 ° C system. Then 35-3 (600.00 mg, 4.72 mol) was added at -60 ° C. The mixture was stirred at 25 ° C for 3 hours. The reaction mixture was quenched with 5 mL of saturated sodium hyposulfite solution at 25 ° C and then extracted with 60 mL of EtOAc (20 mL * 3). The organic phases were combined and washed with 90 mL of saturated sodium chloride solution (30 mL * 3) and dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel chromatography (eluent: PE / EtOAc = 1/0) to provide compound 35-4.

1H NMR (400MHz, CDCh) 58.86 (s, 1H), 6.73 (s, 1H), 2.58-2.68 (m, 3H).

Embodiment 35 was obtained according to the method of step D, E in embodiment 13.

Embodiment 35: 1H NMR (400MHz, CDCh) 15.45 (s broad, 1H), 8.20-8.54 (m, 2H), 7.74 (s, 1H), 7.05 (s , 1H), 6.91 (s broad, 1H), 6.63 (s, 1H), 4.16 (t, J = 6.15 Hz, 2H), 3.59 (t, J = 5.90 Hz, 2H), 3.37 (s, 3H), 2.67 (s broad, 3H), 2.13 (quin, J = 5.99 Hz, 2H).

Embodiments 36 to 40 were obtained according to the method of Embodiment 35.

Embodiment 36

1H NMR (400MHz, CDCI ³ ) 58.60 ( ^s , 1H), 8.20 ( ^s , 1H), 8.02 ( ^s , 1H), 6.68 ( ^s , 1H), 6.53 ( ^s , 1H), 4.03-4.11 ( ^m , 2H), 3.44-3.57 (m, 2H), 3.24 (s, 3H), 2.32-2, 35 (m, 3H), 2.11 (s, 3H), 1.94 (t, J = 6, 24Hz, 2H).

Embodiment 37

1 H NMR (400 MHz, CDCh) 15.36 ( ^s broad, 1H), 8.60-8.41 ( ^m , 3H), 7.70 ( ^s , 1H), 7.02 ( ^s , 1H) , 6.70 ( ^s , 1H), 4.18 (t broad, J = 6.1 Hz, 2H), 3.60 (t broad, J = 5.6 Hz, 2H), 3.51 (s, 3H), 2.17-2.13 (m, 2H).

Embodiment 38

1H NMR (400MHz, CDCl3) 515.34 ( ^s broad, 1H), 8.89 ( ^s broad, 1H), 8.50 ( ^s broad, 1H), 7.81 ( ^s broad, 1H), 7, 70 ( ^s , 1H), 7.14 (s broad, 1H), 7.00 (s, 1 hr), 6.67 (broad s, 1H), 4.16 (broad t, J = 5. 77 Hz , 2H), 3.58 (broad t, J = 5.83 Hz, 2H), 3.35 (s, 3H), 2.09-2.14 (m, 2H)

Embodiment 39 (39_A and 39_B)

The prehydrolysis compound from run 39 was separated by a chiral HPLC column (column: AD (250mm * 30mm, 10 pm); Mobile phase: [ ^{0.1% NH 3} H ² O in EtOH]; gradient elution rate: 60% -60%, 4.12 Min; 220 Min) to provide the isomers with two configurations, which were hydrolyzed to provide the 39_A run (t = 1594 Min), ee value (enantiomeric excess): 100% and realization 39_B (t = 2,593 Min), ee value (enantiomeric excess): 98%. SFC method (supercritical fluid chromatography): AD-3S_4_40_3ML. Column: Chiralpak AD-3 100 x 4.6 mm ID, 3 pm. Mobile Phase: 40% isopropanol (0.05% DEA) in CO ² . Flow rate: 3 ML / Min. Wavelength: 220 nm. Embodiment 39_A 1NMR H (400 MHz, CDCh) 515.48 ( ^s , 1H), 8.82 (d, J = 1.88H ^z , 1H), 8.48 ( ^s , 1H), 7.66 ( ^s , 1H), 7.39 (d, J = 1.63 Hz, 1H), 6.95 (s, 1H), 6.92 (s, 1H), 6.73 (s, 1H), 4.17 (t, J = 6.21 Hz, 2H), 3.59 (dt, J = 2.20, 5.87 Hz, 2H), 3.36 (s, 3H), 2.13 (quin, J = 6.05 Hz, 2H).

Embodiment 39_B 1H NMR (400MHz, CDCh) 515.50 ( ^s broad, 1H), 8.81 (d, J = 1.51H ^z , 1H), 8.49 ( ^s , 1H), 7.66 ( ^s , 1H), 7.39 (s, 1H), 6.88-7.00 (m, 2H), 6.73 (s, 1H), 4.17 (t broad, J = 6.21 Hz, 2H), 3.53-3.66 (m, 2H), 3.36 (s, 3H), 2.13 (quin, J = 5.99 Hz, 2H).

Embodiment 40 (40_A and 40_B)

Run 40 was separated by HPLC (column: AD (250mm x 30mm, 10 pm); mobile phase: [ ^{0.1% NH 3} H ² O in IPA]: 45% -45% in CO ² , 2 minutes; 1000 min) to provide the isomers with two configurations, run 40_A (t = 1.540 min), ee value (enantiomeric excess): 96.4% and run 40_B (t = 2.067 min), ee value (enantiomeric excess): 93.5%.

Embodiment 40_A: 1 H NMR (400 MHz, CD ³ CD) 5 9.02 (s, 1H), 8.65 (s, 1H), 8.41 (s, 1H), 8.08 (br s, 1H ), 7.67 (s, 1H), 7.17 (s broad, 1H), 6.95 (s, 1H), 4.58 (s broad, 3H), 4.21 (s broad, J = 5 , 9Hz, 2H), 3.61 (t, J = 6.1Hz, 2H), 2.12-2.07 (m, 2H).

Embodiment 40_B: 1 H NMR (400 MHz, CD ³ CD) 5 9.02 (s, 1H), 8.66 (s, 1H), 8.42 (s, 1H), 8.09 (s, 1H) , 7.67 (s, 1H), 7.20 (s broad, 1H), 6.97-6.93 (m, 1H), 6.95 (s, 1H), 4.58 (s broad, 3H ), 4.21 (t broad, J = 6.2 Hz, 2H), 3.61 (t, J = 6.0 Hz, 2H), 2.10 (t broad, J = 6.1 Hz, 2H ).

Embodiment 41

Step A: 41 -1 (2.00 g, 11.23 mmol) was dissolved in tetrahydrofuran (120 mL), then cooled to -60 ° C. N-Butyllithium (2.5 mol / L, 4.72 mL) was added slowly dropwise at -60 ° C, and then N, N-dimethylformamide (1.30 mL, 16.85 mmol) was added, The reaction was stirred at -60 ° C for 1 hour and then warmed to 25 ° C and stirred for 3 hours. The reaction was quenched with water and then extracted with dichloromethane (50 mL x 3), the organic phase was washed with saturated brine (35 mL x 2), dried over anhydrous sodium sulfate, then filtered, and concentrated in vacuo to provide compound 41-2.

1H NMR (400 MHz, CDCI ^3): 59.78 (s, 1H), 7.68 (s, 1H), 2.49 (d, J = 1.0 H ^z, 3 H).

Step B: Triphenylphosphite (52.22 g, 168.3 mmol) was dissolved in dichloromethane (300 mL) and then cooled to -60 ° C. Bromine (8.67 mL, 168.3 mmol) was added slowly dropwise at 0 ° C, then triethylamine (18.73 g, 185.13 mmol, 25.66 mL) and 41-2 ( 10.7 g, 84.15 mmol) to the reaction sequentially, the reaction mixture was stirred at -60 ° C for 1 hour, and then the cooling bath was removed, the reaction was stirred at 25 ° C for 3 hours plus. The reaction was quenched with water and extracted with dichloromethane (500 mL x 3), the organic phase was washed with saturated brine (350 mL x 2), dried over anhydrous sodium sulfate, then filtered and concentrated to empty. The product was purified by chromatography (silicon dioxide, PE: EtOAc = 100: 0) to provide compound 41-3.

1H NMR (400MHz, CDCI ³ ) 57.25 (s, 1H), 6.85 (s, 1H), 2.49 (s, 3H).

Step C: 41-3 (3.52 g, 9.23 mmol) and 41-3 (5.00 g, 18.45 mmol) were dissolved in N, N-dimethylformamide (15 mL), then added potassium carbonate (7.01 g, 50.74 mmol). The mixture was stirred at 100 ° C for 16 hours. The reaction was quenched with water and then extracted with dichloromethane (50.00 mL x 3), the organic phase was washed with brine (35.00 mL x ² ), dried over anhydrous sodium sulfate, then, filtered and concentrated in vacuo. The product was purified by chromatography (silicon dioxide, PE: EtOAc = 0: 100) to provide compound 41-4.

Step D: 41 -4 (300.00 mg, 611.05 pmol) was dissolved in methanol (6.00 mL), then sodium hydroxide solution (4.00 mol / L, 611.05 pL), the mixture was stirred at 25 ° C for 0.5 hours. The reaction mixture was concentrated in vacuo, then N, N-dimethylformamide (2.00 mL) was added and adjusted by formic acid to pH = 3-4, the resulting mixture was purified by preparative HPLC to provide the realization. 41.

1H NMR (400MHz, CDCI ³ ) 15.45 (s, 1H), 8.55 (s, 1H), 7.67 (s, 1H), 7.39 (s, 1H), 6, 98 (s, 2H), 6.75 (s, 1H), 4.25-4.16 (m, 2H), 3.66-3.57 (m, 2H), 3.39 (s, 3H ), 2.47 (s, 3H), 2.16 (quin, J = 6.1 Hz, 2H).

Embodiments 42 and 43 can be obtained according to the method of Embodiment 41.

Embodiment 42

1H NMR (400MHz, CDCh) 15.46 (s, 1H), 8.55 (s, 1H), 7.68 (s, 1H), 7.01-6.96 (m, 3H), 6.71 (s, 1H), 3.97 (d, J = 6.8Hz, 2H), 2.38 (s, 3H), 1.41-1.30 (m, 1H), 0, 77-0.71 (m, 2H), 0.47-0.42 (m, 2H).

Embodiment 43

1H NMR (400 MHz, CDCh): 515.62 (broad s, 1H), 8.83 (broad s, 1H), 8.45 (broad s, 1H), 7.40 (broad s, 1H), 7 .01 (broad s, 1H), 6.95 (broad s, 1H), 6.87 (broad s, 1H), 6.70 (broad s, 1H), 4.16 (broad s, 2H), 3 , 88 (broad s, 3H), 3.56 (broad s, 2H), 3.35 (broad s, 3H), 2.13 (broad s, 2H).

Embodiment 44

Step A: 44-1 (25.00 g, 220.97 mmol) was dissolved in toluene (250.00 mL), then p-toluenesulfonic acid monohydrate (12.61 g, 66.29 mmol) was added and glycol (41.15 g, 662.91 mmol). The mixture was stirred at 1300C for 16 hours using a water trap. Next, 50 mL of saturated sodium bicarbonate solution and 450 mL (150 mL of methyl tert-butyl ether) were used. The organic phase was washed with 300 mL of saturated brine (100 mL x 3), dried over sodium sulfate, then filtered and concentrated under reduced pressure to provide 44-2.

1H NMR (400 MHz, CDCI ³ ) 57.76 (d, J = 3.2 Hz, 1H), 7.31 (d, J = 3.2 Hz, 1H), 6.10 (s, 1H), 4.11-4.00 (m, 4H).

Step B: 44-2 (24.60 g, 156.50 mmol) was dissolved in tetrahydrofuran (615.00 mL) and cooled to -780 ° C, n-butyllithium (2.5 mol, 75.12 mL) to the solution, then stirred for 30 minutes after the addition, and after tetrachloromethane (75.40 mL) was added, the reaction mixture was stirred at 0 ° C for 1 hour. The reaction was quenched with 100 mL of saturated ammonium chloride and extracted with 100 mL of water and 600 mL of EtOAc (200 mL x 3), dried over sodium sulfate, then filtered, and concentrated under reduced pressure. , the residue was purified by silica gel chromatography (eluent: PE / EtOAc = 1 / 0-10 / 1), yielding 44-3.

1H NMR (400MHz, CDCI ³ ) 5 = 7.62 (s, 1H), 6.03 (s, 1H), 4.16-4.07 (m, 4H).

Step C: 44-3 (13.30 g, 69.40 mmol) was dissolved in tetrahydrofuran (37.00 mL) and hydrochloric acid (1 mole, 36.78 mL) was added thereto. The mixture was stirred for 3 hours at 75 ° C. The reaction mixture was neutralized with saturated sodium dicarbonate and extracted with 50 mL of water and 600 mL of EtOAc (200 mL x 3). The organic phases were combined and dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure, the residue was purified by chromatography on silica gel (eluent: PE / EtOAc = 30 / 1-20 / 1 ), providing 44-4.

Embodiment 44 was obtained according to the method of steps D, E, F in embodiment 13.

Embodiment 44: 1H NMR (400MHz, DMSO-d6) 58.97 (s broad, 1H), 8.32 (s, 1H), 8.30-8.24 (m, 1H), 8.27 (s broad, 1H), 7.94 (s, 1H)), 7.82 (s, 1H), 7.48 (broad s, 1H), 7.12 (s, 1H), 4.04 (broad dd, J = 7.2, 11.6 Hz, 2H), 1.25 (d broad, J = 8.4 Hz, 1H), 0.61 (d broad, J = 7.9 Hz, 2H), 0, 38 (width s, 2h).

Embodiment 45 (45_A and 45_B)

Step A: 45-1 (18.12 mL, 170.53 mmol) was dissolved in dichloromethane (425.00 mL), then pyridine (2.76 mL, 34.11 mmol) was added at -100 ° C, and then phosphorous pentachloride (35.51 g, 170.53 mmol) was added at once. The reaction mixture was stirred at -10 ° C for 1 hour and then sodium dicarbonate (42.98 g, 511.59 mmol) was added. The mixture was stirred at -10 ° C for 0.25 hours. The reaction mixture was filtered, the filtrate was dried over anhydrous magnesium sulfate, filtered, and then the filtrate was concentrated under reduced pressure and evaporated to dryness, yielding 45-2.

1H NMR (400 MHz, CDCI ³ ) 57.02 (d, J = 3.9 Hz, 1H), 6.87 (s, 1H), 6.80 (d, J = 4.0 Hz, 1 H).

Step B: 45-3 (50.00 g, 297.35 mmol), potassium carbonate (41.10 g, 297.35 mmol) were dissolved in N, N-dimethylformamide (250.00 mL), 1 -bromo-3-methoxypropane (45.50 g, 297.35 mmol) in N, N-dimethylformamide (150.00 mL) and added dropwise to the above system at 90 ° C in one hour. The reaction mixture was stirred at 90 ° C for 0.5 hours. Water (500 mL) was added, then it was extracted with EtOAc (500 mL x 2), the organic phases were combined and washed with water (1000 mL x 3) and brine (500 mL), dried over sodium sulfate. anhydrous sodium, then filtered and concentrated under reduced pressure. The residue was purified on a silica gel column (eluent: PE / EtOAc = 1/0), yielding 45-4.

Step C: Liquid bromine (9.44 mL, 183.14 mmol) was dissolved in chloroform (150 mL) and added dropwise to 45-4 (40.00 g, 166.49 mmol) in a chloroform solution (570 mL) at 0 ° C, the system was stirred at 25 ° C for 0.5 hours. After concentrating under reduced pressure and evaporating to dryness, the residue was purified by means of a silica gel column (eluent: PE / EtOAc = 1 / 0-50 / 1), yielding 45-5.

Step D: Sheared sodium metal (10.50 g, 456.84 mmol) was added batchwise under nitrogen atmosphere in anhydrous methanol (250.00 mL), the system was stirred at 50 ° C for 3 hours . The system was added to the system 45-5 (45.00 g, 114.21 mmol) and copper chloride (7.68 g, 57.10 mmol) in N, N-dimethylformamide (225.00 mL) of a Once at 25 ° C, the reaction mixture was stirred at 110 ° C for 16 hours under a nitrogen atmosphere. The reaction mixture was quenched with 6 mol / L hydrochloric acid (180 mL) and extracted with EtOAc (500 mL x 2), the organic phases were combined, washed with water (500 mL x 2) and brine (400 mL), dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure. The residue was purified through a silica gel column (eluent: PE / EtOAc = 50 / 1-10 / 1), yielding 45-6.

Step E: 45-6 (17.00 g, 62.90 mmol) was dissolved in N, N-dimethylformamide (100.00 mL), potassium carbonate (13.04 g, 94.35 mmol) and bromide were added benzyl (11.83 g, 69.19 mmol, 8.22 mL). The system was stirred at 25 ° C for 16 hours. Then water (200 mL * 3) was added and it was extracted with EtOAc (200 mL * 2), the organic phases were combined and washed with water (200 mL * 2) and brine (200 mL), dried over sulfate anhydrous sodium, then filtered and concentrated under reduced pressure to provide 45-7.

Step F: 45-7 (22.79 g, 63.24 mmol) was dissolved in methanol (60.00 mL) and tetrahydrofuran (60.00 mL), a potassium hydroxide solution (6 moles / L, 61.55 mL), then stirred at 45 ° C for 2 hours. The reaction mixture was adjusted with 1 mol / L hydrochloric acid to pH = 3-4, the suspension was filtered to provide the residue. The residue was used PE / EtOAc = 10/1 (50 mL), then filtered, concentrated under reduced pressure and dried, yielding 45-8.

1H NMR (400MHz, CDCI ³ ) 10.85 (s broad, 1H), 7.64 (s, 1H), 7.48-7.39 (m, 5H), 6.71 (s, 1H), 5.27 (s, 2H), 4.17 (t, J = 6.5 Hz, 2H), 3.89 (s, 3H), 3.58 (t, J = 5.9 Hz, 2H), 3.38 (s, 3H), 2.13 (quin, J = 6.2 Hz, 2H).

Step G: 45-8 (20.00 g, 57.74 mmol) was dissolved in dichloromethane (200.00 mL), then oxalyl chloride (7.58 mL, 86.61 mmol) and N were added, N-dimethylformamide (4.44 gl, 57.74 gmoles). The system was stirred at 25 ° C for 2 hours, concentrated under reduced pressure, and evaporated to dryness to provide compound 45-9.

Step H: 45-9 (21.06 g, 57.73 mmol) and ethyl 2-acetyl-3-dimethylaminoacrylate (13.90 g, 75.05 mmol) were dissolved in tetrahydrofuran (200.00 mL) and the The mixture was added dropwise to lithium hexamethyldisilazide (1 mol / L, 150.09 mL) at -70 to -60 ° C. After the addition, acetic acid (115.55 mL, 2.02 mol / L) and ammonium acetate (5.78 g, 75.05 mmol) were added. The system was stirred at 65 ° C for 1 hour. After adding a saturated sodium bicarbonate solution (1000 mL), the mixture was extracted with EtOAc (200 mL), the organic phase was washed with water (200 mL) and brine (100 mL), dried over sodium sulfate anhydrous and filtered, then concentrated under reduced pressure to dryness. The residue was washed with MTBE (50 mL) and filtered to provide compound 45-10.

1H NMR (300MHz, CDCI ³ ) 11.03 ( ^s , 1H), 9.02 ( ^s , 1H), 7.71 ( ^s , 1H), 7.64 ( ^s , 1H), 7.46-7.31 ( ^m , 5H), 6.69 ( ^s , 1H), 5.11 (s, 2H), 4.48 (q, J = 7.2 Hz, 2H), 4, 14 (t, J = 6.6 Hz, 2H), 3.93 (s, 3H), 3.58 (t, J = 5.9 Hz, 2H), 3.38 (s, 3H), 2, 11 (quin, J = 6.3 Hz, 2H), 1.46 (t, J = 7.1 Hz, 3H).

Step I: 45-10 (20.00 g, 42.78 mmol) was dissolved in tetrahydrofuran (250.00 mL) and palladium on carbon (10%, 1 g) was added under nitrogen atmosphere, the system was charged with hydrogen under vacuum 3 times, then stirred at 250C for 16 hours under a hydrogen atmosphere at 1.03 bar (15 Psi). After filtration, the filtrate was concentrated under reduced pressure to provide compound 45-11.

1H NMR (400MHz, CDCI ³ ) 514.24 ( ^s , 1H), 11.27 ( ^s , 1H), 8.86 ( ^s , 1H), 7.23 ( ^s , 1H), 7.16 ( ^s , 1H), 6.56 ( ^s , 1H), 4.49 (q, J = 7.1 Hz, 2H), 4.17 (t, J = 6.5 Hz, 2H), 3.90 (s, 3H), 3.59 (t, J = 6.1 Hz, 2H), 3.38 (s, 3H), 2.15 (quin, J = 6.3 Hz, 2H), 1, 47 (t, J = 7.2 Hz, 3H).

Step J: 45-11 (5.00 g, 13.25 mmol) was dissolved in dimethylsulfoxide (50.00 mL), then cesium carbonate (17.27 g, 53.00 mmol) and 2- chloro-5- (dichloromethyl) thiophene (13.35 g, 66.25 mmol). The system was stirred at 100 ° C for 16 hours. The reaction mixture was diluted with water (100 mL), then extracted with dichloromethane (100 mL), the organic phase was washed with water (100 mL x 2) and saturated brine (100 mL), dried over sulfate of anhydrous sodium and then filtered and evaporated under reduced pressure to dryness. The residue was purified by a silica gel column (eluent: PE / EtOAc = 10 / 1-1 / 1 to dichloromethane / ethanol = 100 / 1-30 / 1) to provide compound 45-12.

Step K: 45-12 (200.00 mg, 395.28 pmol) was purified by chiral HPLC (column: OJ (250mm x 30mm, 10 pm); mobile phase: [0.1 ^{NH 3} H ^{2 O} % in MeOH], elution gradient: 30% -30%, 2.3 min, 90 min) to give run 45-12A (t = 2.194 min) and 45-12B (t = 2.544 min).

Step L: Run 45-12A (71.00 mg, 140.32 mmol) was dissolved in tetrahydrofuran (2.00 mL) and methanol (2.00 mL), then sodium hydroxide solution ( 4 moles / L, 1.00 mL), the system was stirred at 25 ° C for 0.5 hours. The reaction mixture was adjusted with 1 mol / L hydrochloric acid to pH = 3, and extracted with dichloromethane (20 mL x 2), the organic phases were combined and dried over anhydrous sodium sulfate, then filtered and concentrated under reduced pressure to provide Embodiment 45_13A.

Step M: Run 45_13A (65.00 mg, 136.01 mmol) was dissolved in tetrahydrofuran (15.00 mL), palladium on carbon (10%, 30 mg) was added under nitrogen atmosphere, the suspension was charged with hydrogen several times, the system was stirred at 25 ° C for 16 hours under an atmosphere of hydrogen at 1.03 bar (15 Psi). The reaction mixture was filtered, the filtrate was concentrated under reduced pressure to dryness, the residue was purified by means of a silica gel plate (silicon dioxide, dichloromethane / methanol = 15: 1), yielding the 45_A (t = 1.941 min), ee value (enantiomeric excess): 100%.

Method for determining the ee value (enantiomeric excess): OD-3S_3_40_3ML Column: Chiralcel OD-3 100 x 4.6 mm ID, 3 pm. Mobile phase: 40% methanol (0.05% DEA) in CO ² . Flow rate: 3 mL / min. Wavelength: 220 nm. Embodiment 45_B (t = 3.040 min), ee value (enantiomeric excess): 100%.

Embodiment 45_A: 1H NMR (400 MHz, CDCI ³⁾ 5 15.66 (br ^s, 1H), 8.41 (br ^s, 1H), 7.48 (d, J = 4.9 H ^z, 1H) , 7.09-7.03 (m, 3H), 7.01 (s, 1H), 6.97-6.93 (m, 1H), 6.67 (s, 1H), 4.16 (t, J = 6.5 Hz, 2H), 3.92 (s, 3H), 3.57 (t, J = 5.9 Hz, 2H), 3.37 (s, 3H), 2.14 (quin, J = 6.2 Hz, 1H), 2.18-2.11 (m, 1H).

Embodiment 45_B: 1H NMR (400 MHz, CDCH) 5 15.63 (br ^s, 1H), 8.37 (br ^s, 1H), 7.49 (br ^s, J = 4.4 H ^z, 1H), 7.06 (s broad, 3H), 7.00 (s, 1H), 6.91 (s broad, 1H), 6.68 (s, 1H), 4.16 (t, J = 6.5 Hz, 2H), 3.93 (s, 3H), 3.57 (t, J = 5.9 Hz, 2H), 3.37 (s, 3H), 2.15 (quin, J = 6.2 Hz, 2H).

Embodiments 46 to 48 can be obtained according to the method of Embodiment 45.

Embodiment 46 (46_A and 46_B)

The prehydrolysis compound from Run 46 was separated by chiral HPLC (column: OJ (250mm x 30mm, 10 pm); mobile phase: [ ^{0.1% NH 3} H ² O -MeOH]; elution gradient: 30% -30%, 3 min; 40 min) to provide isomers with two configurations, t = 2,592 min and t = 2,829 min. After hydrolysis, the 46_A run (t = 2.396 min), ee value (enantiomeric excess): 95.7% and 46_B run (t = 2.887 min), ee value (enantiomeric excess): 100% respectively, were obtained. Methods for the determination of the ee value (enantiomeric excess): OD-3S_3_40_3m L Column: Chiralcel OD-3 100 x 4.6 mm ID, 3 pm. Mobile phase: 40% methanol (0.05% DEA) in CO ² . Flow rate: 3 mL / min. Wavelength: 220 nm.

Embodiment 46_A: 1H NMR (400MHz, CDCI ³ ) 15.42 ( ^s broad, 1H), 8.50-8.44 ( ^m , 1H), 7.62 ( ^s , 1H), 6.91 ( ^s , 2H), 6.74 (d, J = 3.8Hz, 1H), 6.69 (d, J = 3.5Hz, 1H), 6.61 (s, 1H), 4.10 ( t broad, J = 6.0 Hz, 2H), 3.52 (t, J = 5.8 Hz, 2H), 3.29 (s, 3H), 2.06 (quin, J = 6.0 Hz , 2H).

Embodiment 46_B: 1 H NMR (400 MHz, CDCh) 515.44 ( ^s broad, 1H), 8.49 ( ^s , 1H), 7.62 ( ^s , 1H), 6.93 ( ^s , 1H), 6.91 ( ^s , 1H), 6.75-6.72 (m, 1H), 6.70 (d, J = 3.8Hz, 1H), 6.61 (s, 1H), 4.14-4.07 (m, 2H), 3.52 (t, J = 5.9 Hz, 2H), 3.29 (s, 3H), 2.06 (quin, J = 6.1 Hz , 2H).

Embodiment 47 (47_A and 47_B)

The prehydrolysis compound from run 47 was separated by chiral HPLC (column; AS (250 mm x 30 mm, 10 pm); Mobile phase; [ ^{0.1% NH 3} H ² O -MeOH]; gradient elution; 45 % -45%, 2.3 Min; 90 Min) to provide the isOMers with two configurations, (t = 2,110 Min) and (t = 2,574 Min), after hydrolysis, the performance 47_A (t = 2,705 Min) were obtained ), ee value (enantioMeric excess); 99% and completion 47_B (t = 1.818 Min), ee value (enantioMeric excess); 100% respective mind. Method for determining the ee value (enantiomeric excess); OD-3S_3_40_3m L Column; Chiralcel OD-3 100 x 4.6 mm ID, 3 pm. Mobile Phase; 40% methanol (0.05% DEA) in CO ² . Flow rate; 3 ML / Min. Wavelength; 220 nm.

Embodiment 48

1H NMR (400MHz, DMSO-d6) 58.88 ( ^s broad, 1H), 8.29 (d broad, J = ^{7.8H z} , 1H), 7.62-7.44 ( ^m , 2H ), 7.25 ( ^s , 1H), 6.91 (s, 1H), 4.15 (t broad, J = 6.1 Hz, 2H), 3.48 (s broad, 2H), 3, 23 (s, 3H), 1.96 (quin, J = 6.2 Hz, 2H).

Embodiment 49 (49_A and 49_B)

Step A: 49-1 (50.01 g, 297.41 mmol) was dissolved in DMF (300 mL), then cooled to 0 ° C and potassium carbonate (41.10 g, 297.41 mmol) was added . The mixture was heated to 90 ° C, and then bromomethylcyclopropane (40.15 g, 297.41 mmol) was added dropwise in about 1 hour, and then, the mixture was stirred at 90 ° C for 1 hour. The solution was then added to 200 mL of water, followed by extraction with EtOAc (400 mL * 3), the organic phase was collected and washed with water (150 mL) and saturated brine (100 mL * 3), at Then it was concentrated under reduced pressure to provide a white solid. The white solid was purified by silica gel chromatography (eluent: PE / EtOAc = 30/1 -20/1) to provide compound 49-2.

1 H NMR (400 MHz, CDCI ³ ) 10.87 (s, 1H), 7.65 (d, J = 8.8 Hz, 1H), 6.40-6.34 (m, 2H) , 3.83 (s, 3H), 3.74 (d, J = 6.9 Hz, 2H), 1.23-1.15 (m, 1H), 0.62-0.55 (m, 2H), 0.28 (q, J = 5.0 Hz, 2H).

Step B: 49-2 (47.00 g, 211.48 mmol) was dissolved in acetonitrile (200.00 mL) and cooled to 0 ° C, then W-chlorosuccinimide (28.52 g, 213, 59 mmol). The mixture was heated to 90 ° C and stirred for 2 hours. The reaction mixture was concentrated under reduced pressure to provide a yellow residue, and the obtained yellow residue was dissolved in EtOAc (400 mL), then water (300 mL) was added thereto, and the solution was stirred at 25 ° C for 2 min. The organic phase was separated and washed with saturated brine (100 mL x 3), then dried over anhydrous sodium sulfate, concentrated under reduced pressure, triturated with PE / dichloromethane (30/1) to provide compound 49-3.

Step C: Potassium carbonate (62.78 g, 454.26 mmol) was added to 49-3 (53.00 g, 206.48 mmol) and benzyl bromide (38.85 g, 227.13 mmol) in a DMF solution (400.00 mL). Then the mixture was stirred at 25 ° C for 1 hour. EtOAc (800 mL) and water (150 mL) were added to the solution, which was then stirred at 20 ° C for 10 min, the organic phase was separated and washed with water (130 mL * 2) and saturated brine (130 mL * 2), then dried over anhydrous sodium sulfate and dried under reduced pressure to provide compound 49- Four.

Step D: Potassium hydroxide (74.07 g, 1.32 mol) was added to the mixture of 49-4 (60.00 g, 173.01 mmol) in methanol (300.00 mL) and water (100, 00 mL). The mixture was stirred at 50 ° C for 2 hours. The mixture was then concentrated under reduced pressure to 100 mL, then washed with EtOAc / PE (4/1 100 mL). The aqueous phase was separated, then adjusted with 1 mol / L dilute hydrochloric acid to pH = 3-4 to provide a suspension. The suspension was filtered and provided a solid. The solid obtained was triturated with water (100 mL) and filtered, and then recrystallized from the n-heptane / EtOAc mixture to provide compound 49-5.

1H NMR (400 MHz, CDCI ³ ) 58.18-8.16 (m, 1H), 7.48-7.43 (m, 5H), 6.58 (s, 1H), 5.29 (s, 2H), 3.92 (d, J = 6.8 Hz, 2H), 1.29 (s broad, 1H), 0.72-0.68 (m, 2H), 0.44-0 , 39 (m, 2H).

Step E: Oxalyl chloride (19.83 g, 156.26 mmol) was added dropwise to 49-5 (26.00 g, 78.13 mmol) in a solution of dichloromethane (30 mL). After the addition, the mixture was stirred at 28 ° C for 2 hours. The mixture was then concentrated under reduced pressure to provide compound 49-6.

Step F: Compound 49-6 (27.00 g, 76.87 mmol) and (2Z) -2- (dimethylaminomethylene) -3-ethyl oxobutyrate (14.50 g, 78.30 mmol) were added dropwise ) in tetrahydrofuran solution (300 mL) to lithium hexamethyldisilazide (1 mol / L, 195.75 mL) in tetrahydrofuran solution (20 mL) (more than 5 minutes) at -70 ° C. After the addition, the cooling bath was removed and the mixture was stirred for a further 5 minutes. Ammonium acetate (9.05 g, 117.45 mmol) and acetic acid (164.09 g, 2.73 mol) were added to the mixture, and most of the tetrahydrofuran was removed by rotary evaporator and the residue was stirred for 1.5 hours at 60-65 ° C. After the reaction mixture cooled, water (100 mL) and EtOAc (300 mL) were added. The mixture was then stirred for a further 10 minutes and then separated. The organic phase was washed with water (100 mL x 3) and a saturated sodium dicarbonate solution (100 mL), then dried and concentrated to provide a yellow residue. The yellow residue was purified by silica gel chromatography (eluent: PE / EtOAc = 10/1) to provide compound 49-7.

1H NMR (400MHz, CDCI ³ ) 11.06 (s, 1H), 9.00 (s, 1H), 8.06 (s, 1H), 7.62 (s, 1H), 7.41 - 7.32 (m, 5H), 6.58 (s, 1H), 5.19-5.15 (m, 2H), 4.47 (q, J = 7.1 Hz, 2H), 3, 87 (d, J = 6.7Hz, 2H), 1.46 (t, J = 7.2Hz, 3H), 1.32-1.22 (m, 1H), 0.69-0.62 (m, 2H), 0.41-0.35 (m, 2H).

Step G: Palladium on carbon (1.00 g, 10%) was added to 49-7 (26.00 g, 57.28 mmol) in a solution in tetrahydrofuran (500.00 mL) (the reaction system was pre-charged with N ² ). The solution was then stirred at 25 ° C for 2 hours under an atmosphere of hydrogen at 2.07 bar (30 psi). The brown suspension was filtered to provide a yellow liquid. The solution was then concentrated under reduced pressure to provide a yellow residue, then triturated with PE / EtOAc (4/1, 60 mL) twice, filtered to provide compound 49-8.

1H NMR (400MHz, CDCI ³ ) 514.48 (s, 1H), 11.18 (s, 1H), 8.78 (s, 1H), 7.64 (s, 1H), 7.19 (s , 1H), 6.43 (s, 1H), 4.40 (q, J = 7.1Hz, 2H), 3.84 (d, J = 6.7Hz, 2H), 1, 38 (t, J = 7.2 Hz, 3H), 1.35-1.20 (m, 1H), 0.64-0.54 (m, 2H), 0.37-0.31 (m, 2H).

Steps H, I can be obtained according to the method of embodiment 13.

The prehydrolysis compound of embodiment 49 was separated by a chiral HPLC column (column: AS (250mm x 30mm, 10 gm); mobile phase: [ ^{0.1% NH 3} H ² O -MeOH]; gradient elution: 30% -30%, 4.4 min; 600 min) to provide isomers with two configurations (49-9A and 49-9B), then the 49_A run (t = 3,885 min), ee value were obtained (enantiomeric excess): 100% and performance 49_B (t = 4.831 min), ee value (enantiomeric excess): 100% respectively. Method for the determination of the ee value (enantiomeric excess): AD-3 S_3_40_3ML_8 MIN Column: Chiralpak AD-3 100 x 4.6 mm, ID, 3 gm. Mobile phase: 40% methanol (0.05% DEA) in CO ² . Flow rate: 3 mL / min. Wavelength: 220 nm.

Embodiment 49_A: 1 H NMR (400 MHz, CDCh) 16.16 (s, 1H), 9.08 (d, J = 1.96 Hz, 1H), 8.97 (s, 1H), 8.24 ( s, 1H), 7.82 (d, J = 0.86Hz, 1H), 7.79 (s, 1H), 7.47 (s, 1H), 7.07 (s, 1H ), 3.95-4.08 (m, 2H), 1.22-1.31 (m, 1H), 0.58-0.65 (m, 2H), 0.32-0, 40 (m, 2H).

Embodiment 49_B: 1 H NMR (400 MHz, CDCh) 16.14 (s broad, 1H), 9.07 (d, J = 1.83 Hz, 1H), 8.96 (s, 1H), 8.23 (s, 1H), 7.80 (broad d, J = 15.89 Hz, 2H), 7.45 (s, 1H), 7.06 (s, 1H), 3.98-4, 07 (m, 2H), 1.23-1.32 (m, 1H), 0.58-0.68 (m, 2H), 0.32-0.44 (m, 2H).

Embodiment 50 (50_A and 50_B)

The prehydrolysis compound from Run 50 was separated by chiral HPLC (column: OJ (250mm x 30mm, 10 pm); mobile phase: [ ^{0.1% NH 3} H ² O -MeOH]; elution gradient: 40% -40%, 3 min; 700 min) to provide isomers with two configurations, t = 3,277 min and t = 3,598 min, the 50_A performance (t = 4,408 min) were obtained, ee value (enantiomeric excess): 95.5% and 50_B performance (t = 4,145 min), ee value (enantiomeric excess): 84.9% respectively. Method for determining the ee value (enantiomeric excess): OD-3S_3_5_40_3 ML Column: Chiralcel OD-3 100 x 4.6 mm ID, 3 pm Mobile phase: methanol (0.05% DEA) in 5% ^{CO 2 a} 40%. Flow rate: 3 mL / min. Wavelength: 220 nm.

Embodiment 50_A: 1H NMR (400MHz, DMSO-d6) 59.11 (s, 1H), 8.88 (s, 1H), 8.38 (s, 1H), 7.96 (s, 1H), 7.54 (s broad, 1H), 7.01 (s, 1H), 4.06-3.94 (m, 2H), 1.28-1.20 (m, 1H), 0.62-0 , 56 (m, 2H), 0.38-0.32 (m, 2H).

Embodiment 50_B: 1H NMR (400MHz, DMSO-d6) 15.86 (s, 1H), 9.11 (s, 1H), 8.89 (s, 1H), 8.39 (s, 1H) , 7.96 (s, 1H), 7.55 (s, 1H), 7.01 (s, 1H), 4.06-3.94 (m, 2H), 1.24 (t broad, J = 7.0 Hz, 1H), 0.63-0.56 (m, 2H), 0.63-0.56 (m, 1H), 0.38-0.33 (m, 2H).

Embodiment 51 (51_A and 51_B)

Step A: Pyridine (2.82 g, 35.67 mmol) was added to 51-1 (20.00 g, 178.33 mmol) in DCM (150.00 mL) at -100 ° C, then added to this PCI ⁵ (37.14 g, 178.33 mmol). The resulting mixture was stirred for 0.5 hours at -100C. After completion of the reaction, NaHCO3 (44.94 g, 534.99 mmol) was added thereto, the mixture was stirred for a further 0.5 hour and filtered through diatomaceous earth, washed with DCM (20 mL x 3), the filtrate was concentrated to provide residue 51-2.

1H NMR (400 MHz, CDCI ³ ) 57.68 (d, J = 3.91 Hz, 1H), 7.35-7.44 (m, 5H), 7.22 (d, J = 3, 67 Hz, 1H), 6.91 (s, 1H), 5.34 (s, 2H).

Step B: The solution of 51-3 (10.00 g, 26.19 mmol), Cs ² CÜ ³ (38.40 g, 117.86 mmol) and 51-2 (21.88 g, 130.95 mmol) in SOCI ² (100.00 mL) was stirred for 16 h at 100 ° C. After completion of the reaction, the reaction was quenched with water (50 mL), then diluted with water (150 mL) and extracted with DCM (100 mL x 3). The organic phases were combined and washed with saturated brine (100 mL x 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to provide the residue, which was purified by silica gel chromatography (eluent: DCM / EtOH = 100/1 to 8/1) to provide compound 51-4. The solid obtained was then separated by chiral HPLC (column: a S (250 mm * 30 mm, 10 pm); mobile phase: [ ^{0.1% NH 3} H ² O -EtOH]; elution gradient: 40 % -40%, 4.3 min; 120 min) to provide 51-4_A (t = 2,516 min) and 51-4_B (t = 5,098 min).

Step C The hydrolysis was carried out according to the method of embodiment 13.

Compound 51_A was obtained by hydrolysis at 51-4_A. (t = 3.842 min), ee value (enantiomeric excess): 100%; and 51-4_B was obtained by hydrolysis in compound 51_B (t = 2.682 min), ee value (enantiomeric excess): 100%. Method for the determination of the ee value (enantiomeric excess): OD-3S_3_40_3ML Column: Chiralcel OD-3 100 x 4.6 mm ID, 3 pm. Mobile phase: 40% MeOH (0.05% DEA) CO ² . Flow rate: 3 mL / min. Wavelength: 220 nm.

Compound 51_A: 1 H NMR (400 MHz, CDCh) 15.40 (s, 1H), 8.32 (s, 1H), 7.62 (s, 1H), 7.41 (dd, J = 1.28, 4.83 Hz, 1H), 6.93-6.98 (m, 2H), 6.91 (s, 1H)), 6.88 (s, 1H), 6, 62 (s, 1H), 4.09 (t, J = 6.24Hz, 2H), 3.51 (t, J = 5.87Hz, 2H), 3.28 (s, 3H ), 2.05 (quin, J = 6.08 Hz, 2H)

Compound 51_B: 1 H NMR (400 MHz, CDCh) 15.46 (s, 1H), 8.38 (s, 1H), 7.69 (s, 1H), 7.48 (dd, J = 1.47, 4.89 Hz, 1H), 7.00-7.04 (m, 2H), 6.98 (s, 1H)), 6.93 (s, 1H), 6, 69 (s, 1H), 4.16 (t, J = 6.24Hz, 2H), 3.58 (t, J = 5.93Hz, 2H), 3.35 (s, 3H ), 2.12 (quin, J = 6.05 Hz, 2H).

Experiment 1: In vitro HBV assay.

1. Experimental objective:

The HBV DNA content in HepG2.2.15 cell culture supernatant was detected by a quantitative real-time qPCR (real-time qPCR) assay, and the HBV surface antigen content was detected by a linked immunosorbent assay. enzyme (ELISA), the EC ⁵⁰ value of the compound was used as an index to evaluate the inhibitory effect of the compound on HBV.

2. Experiment material:

2.1. Cell line: HepG2.2.15 cells

HepG2.2.15 cell culture medium (DMEM / F12, Invitrogen-11330032; 10% serum, Invitrogen-10099141; 100 units / ml penicillin and 100 pg / ml streptomycin, HycIone-SV30010; 1% non-essential amino acids, Invitrogen-11140050; 2 mM L-GLUTAMINE, Invitrogen-25030081; Geneticin 300 pg / mL, Invitrogen-10131027 2.2. Reagents:

Trypsin (Invitrogen-25300062)

DPBS (Corning-21031CVR)

DMSO (Sigma-D2650-100ML)

High-throughput DNA purification kit (QIAamp 96 DNA Blood Kit, Qiagen-51162)

Quantitative Rapid Start Universal Probe Reagent (FastStart Universal Probe Master, Roche-04914058001) Hepatitis B Surface Antigen Quantitative Detection Kit (Antu Bio, CL 0310)

23. Consumables and appliances:

96-well cell culture plate (Corning-3599)

CO ² Incubator (HERA-CELL-240)

Optical Sealing Film (ABI-4311971)

96-well plate for quantitative PCR (Applied Biosystems-4306737)

Quantitative Fluorescence PCR Machine (Applied Biosystems-7500 Real-Time PCR System)

3. Experimental procedures and methods:

3.1. HepG2.2.15 cells (4 x 104 cells / well) were seeded in a 96-well plate and cultured overnight at 370C, 5% CO ² .

3.2. The next day, the compound was diluted to 8 concentrations, 1: 3 dilution gradients. Compound from different gradients was added to the culture well, the wells were doubled. The final DMSO concentration was 0.5% in the culture solution. 10 pM ETV was used as a 100% inhibition control; 0.5% DMSO was used as a 0% inhibition control.

3.3. On the fifth day, the culture solution was replaced with a fresh culture solution containing the compound.

3.4. On the eighth day, the culture solution was collected in the culture well and the content of S antigen of the hepatitis B virus was measured by ELISA with partial samples; and still partial samples were taken for DNA extraction using a high-throughput DNA purification kit (Qiagen-51162).

3.5. The preparation of the PCR reaction solution is shown in Table 1:

Table 1 Preparation of the PCR reaction solution

Pre-primer sequence: GTGTCTGCGGCGTTTTATCA

Post-primer sequence: GACAAACGGGCAACATACCTT

Probe sequence: 5 'FAM CCTCTKCATCCTGCTGCTATGCCTCATC TAMRA -3'

3.6. 15 pL of reaction mix was added to each well of the 96-well PCR plate, then 10 pL of HBV DNA sample or standard product DNA was added to each well.

3.7. The qPCR plate was sealed with an optical sealing film, centrifuged at 1500 rpm for 2 minutes, and then the HBV copy number of each sample was quantitatively detected by fluorescence quantitative qPCR. The qPCR operating procedure is as follows

3.8. Data analysis:

Calculation of the inhibition percentage

% of Inh. = (1 - value in the sample / value of the control group with DMSO) x 100.

Dose-response curves were adjusted using GraphPad Prism software, and the EC ^{50 value was calculated.} It was a concentration that inhibited 50% of the compound against HBV.

3.9. Determination of the S antigen content of the hepatitis B virus measured by ELISA

Specific steps should refer to the product manual, and a brief description of the steps was as follows: 50 pL of sample and standard sample were taken and added to the reaction plate respectively, then 50 pL of conjugate was added of enzyme to each of the wells, they were shaken by rocking movement to mix well, then, they were kept in a warm bath at 370C for 60 min, and the plate was washed with washing solution 5 times, 50 pL of luminescent substrate to each well, mixed well and reacted at rt for 10 min in the dark, finally the intensity of chemiluminescence was detected with ELISA. The percentage of inhibition of each compound was calculated by the following formula: inhibition rate (%) = (1 - value 1 of the sample / value of the control group with DMSO) x 100%. Dose-response curves were fitted using GraphPad Prism software, and the EC ⁵⁰ value of 50% inhibition concentration of the compound against HBV was calculated.

4. Experimental results: refer to tables 2 and 3.

Table 2 Experimental results of HBV DNA

Conclusion: The representative compound of the present disclosure can effectively reduce the DNA content of HBV, which shows a significant inhibitory effect on HBV.

Table 3 Experimental results of HBsAg

Conclusion: The compound of the present disclosure can effectively reduce the content of HBV surface antigen (HBsAg), which shows a significant inhibitory effect against HBV.

Claims (15)

1. A compound represented by formula (I) or a pharmaceutically acceptable salt thereof,

where, Ri is selected from H, OH, CN, NH ² , or is selected from the group consisting of C1-C5 alkyl, C1-C5 heteroalkyl, C2-C5 alkynyl, C3-C6 cycloalkyl, and 3-6 membered heterocycloalkyl, each of which it is optionally substituted with 1,2 or 3 R; R ² is selected from H, halogen, or is selected from the group consisting of C1-C3 alkyl and C1-C3 heteroalkyl, each of which is optionally substituted with 1,2 or 3 R; m is selected from the group consisting of 0, 1,2, 3, 4, and 5; A is selected from the group consisting of 5-6 membered phenyl and heteroaryl, each of which is optionally substituted with 1,2 or 3 R; R is selected from the group consisting of H, halogen, OH, CN, NH ² , = O, CH ³ , CH ³ CH ² , CH ³ O, CF ³ , CHF ^2, and CH ² F; the "hetero" in C1-C5 heteroalkyl, 3-6 membered heterocycloalkyl, C1-C3 heteroalkyl and 5-6 membered heteroaryl, is independently selected from the group consisting of N, -O-, = O, -S- , -NH-, - (C = O) -, - (S = O) - and - (S = O) 2-; In any one of the above cases, the number of the heteroatom or group of heteroatoms is independently selected from 1,2 or 3. 2. The compound or pharmaceutically acceptable salt thereof as defined in claim 1, wherein R is selected from the group consisting of H, F, Cl, Br, OH, CH ³ , CH ³ O, CF ³ , CHF ² and CH ² F. 3. The compound or the pharmaceutically acceptable salt thereof as defined in claim 1 or 2, wherein R ¹ is selected from H, OH, CN, NH ² , or is selected from the group consisting of CH ³ , CH ³ CH ² , CH ³ CH ² CH ² , CH ³ CH ² CH ² CH ² , CH ³ O, CH ³ CH ² O, CH ³ S, CH3S (= O), CH3S (= O) 2, CH ³ SCH ² , CH ³ CH ² S, CH ³ NH,

pyrrolidinyl, piperidyl, tetrahydropyranyl, morpholinyl, 2-pyrrolidonyl, and 3-pyrrolidonyl, each of which is optionally substituted with 1,2 or 3 R. 4. The compound or pharmaceutically acceptable salt thereof as defined in claim 3, wherein R ¹ is selected from H, OH, CN, NH ² , or is selected from the group consisting of CH ³ , CH ³ CH ² , CH ³ CH ² CH ² , CH ³ CH ² CH ² CH ² , CH ³ O, CH ³ CH ² O, CH ³ S, CH3S (= O), CH3S (= O) 2, CH ³ SCH ² , CH ³ CH ² S, CH ³ NH,

each of which is optionally substituted with 1,2 or 3 R. The compound or the pharmaceutically acceptable salt thereof as defined in claim 4, wherein R ¹ is selected from the group consisting of H, OH, CH ³ , CHF ² , CH ³ O

6. The compound or pharmaceutically acceptable salt thereof as defined in claims 1 or 2, wherein R2 is selected from H, F, Cl, Br, or is selected from the group consisting of CH3, CH3CH2, CH3O, CH3CH2O

And each of which is optionally substituted with 1,2 or 3 R. 7. The compound or pharmaceutically acceptable salt thereof as defined in claim 6, wherein R ² is selected from the group consisting of Cl and CH ³ O. 8. The compound or pharmaceutically acceptable salt thereof as defined in claims 1 or 2, wherein A is selected from the group consisting of phenyl, thienyl, thiazolyl, isothiazolyl, oxazolyl, and isoxazolyl, each of which is optionally substituted with 1,2 or 3 R. 9. The compound or pharmaceutically acceptable salt thereof as defined in claim 8, wherein A is selected from the group consisting of

each of which is optionally substituted with 1,2 or 3 R; optionally, A is selected from the group consisting of

optionally to this, A is selected from the group consisting of

10. The compound or pharmaceutically acceptable salt thereof as defined in claims 1 or 2, wherein m is 3; optionally, R ² is selected from the group consisting of Cl and CH ³ O; optionally thereto, R ¹ is CH ³ O; optionally to this, A is selected from the group consisting of

each of which is optionally substituted with 1,2 or 3 R. The compound or the pharmaceutically acceptable salt thereof as defined in claims 1 or 2, wherein m is 1; optionally, R ² is Cl; optionally to this,

optionally to this, A is selected from the group consisting of

each of which is optionally substituted with 1,2 or 3 R. 12. The compound or pharmaceutically acceptable salt thereof as defined in any one of claims 1-11, which is selected from the group consisting of

where, Ri, R ² , R and m are as defined in claims 1-11. The compound or the pharmaceutically acceptable salt thereof as defined in claim 1, which is selected from the group consisting of

optionally, the compound or the pharmaceutically acceptable salt thereof is selected from the group consisting of

14. A pharmaceutical composition comprising a therapeutically effective amount of the compound or the pharmaceutically acceptable salt thereof as defined in any one of claims 1-13 and a pharmaceutically acceptable carrier. The compound or the pharmaceutically acceptable salt thereof as defined in any one of claims 1-13 or the pharmaceutical composition as defined in claim 14 for use in the treatment of hepatitis B.