ES2770154T3 - Biomarkers of future cardiac events - Google Patents

Abstract

In vitro use of CCL5 and CCL3 chemokine as a biomarker for the identification of whether or not a test subject is at high risk for a future acute cardiovascular syndrome or event.

Description

DESCRIPTION

Biomarkers of future cardiac events

Field of the Invention

The present invention relates to the identification of CCL3 and CCL5 chemokine biomarkers predictive of future acute coronary syndromes including unstable angina pectoris (API). The scope of protection is defined by the appended claims.

Background to the invention

Acute coronary syndromes, which include unstable angina pectoris (API), are associated with high morbidity and mortality. In general, API results from the erosion or rupture of a vulnerable atherosclerotic plaque superimposed by occlusive thrombus formation and distal ischemia 1. Atherosclerosis is increasingly considered a dyslipidemic disorder with a strong inflammatory character 2 These inflammatory processes are partly orchestrated by chemokines, which participate in the inflammatory process by mediating the recruitment of monocytes to sites of injury, vascular smooth muscle cell proliferation, neovascularization, and platelet activation 3-5 In addition, it appears that chemokines also play a role in cardiac ischemia. In fact, it was reported that ischemia led to induced expression of chemokines in the myocardium or in the circulation, which results in the recruitment of subsets of leukocytes and progenitor cells to the area of injury to contribute to injury repair 6 Given Because of their diverse and profound impact on cardiovascular diseases, chemokines could not only serve as biomarkers for atherosclerosis, plaque rupture or ischemia, but also represent attractive therapeutic targets 7

To date, approximately 50 chemokines have been characterized and several are observed to be involved in atherosclerosis and atherothrombosis. 5 In fact, it has already been shown in various studies that the plasma levels of Regulated by the activation of expressed and secreted normal T lymphocytes (RANTES or CCL5), fractalkine (CX3CL1) and monocyte chemotactic protein 1 (MCP-1 or CCL2) are altered in API or myocardial infarction 8-11. EP 1500709 A1 discloses CCL3 as a prospective biomarker for cardiovascular disease. However, prospective data on plasma chemokine levels and / or chemokine receptor expression by circulating leukocyte subsets in acute coronary syndromes are lacking. Furthermore, the use of such chemokines as markers of future coronary events has not been exploited.

Summary of the invention

The present invention is based on a study to assess the levels of 11 chemokines in resistant unstable angina pectoris. The inventors examined the initial chemokine plasma patterns of a prospective cohort of patients with unstable angina pectoris by a high-performance multiplex assay, which allows simultaneous quantification of multiple chemokines in a single plasma sample 12 For prospective analysis, they analyzed differentially expressed chemokines at baseline in ELISA follow-up samples. In addition, peripheral blood mononuclear cells (CMSP) were examined for chemokine receptor expression.

In a first aspect, the present disclosure provides the use of the chemokine CCL3 and / or CCL18 and optionally CCL5 as a biomarker for identifying whether or not a test subject is at high risk for an acute cardiovascular syndrome or event.

CCL3 is also known as MIP-1a (macrophage inflammatory alpha protein) and LD78a / b; CCL18 is also known as PARC, DC-CK-1, AMAC-1, or MIP-4; and CCL-5 is also known as RANTES regulated by the activation of expressed and secreted normal T and SISd.

The cardiovascular syndrome or event may comprise coronary artery disease, atherosclerosis, acute myocardial infarction, arteriosclerosis, unstable angina pectoris (API), embolism, deep vein thrombosis, stroke, congestive heart failure, or arrhythmia.

Biomarker as used in the present disclosure means that the level of CCL3 and / or CCL18, and optionally CCL5 as determined (eg, detects and / or quantifies) in a tissue sample or a sample of an individual's body fluid, it is a predictive indicator for a future acute cardiovascular disorder as such and / or for monitoring the status and / or progression of a disorder. Detection of such biomarkers can also be used to monitor therapeutic regimens and / or clinical trials in order to detect whether or not a particular treatment may be effective.

The aforementioned cytokines can be identified in a sample of body fluid from a subject, or in cells obtained from a subject, such as, for example, from an atherosclerotic plaque. The sample of an individual's body fluid can be derived from blood, for example isolated mononuclear cells, or from a fraction of blood, for example plasma or serum, especially plasma. For the purposes of the aspects and realizations Above, the subject may be a human animal or any other animal. In particular embodiments, the subject is selected from the group consisting of human, non-human, equine, bovine, sheep, goat, cleft, avian, feline, or canine primate.

CCL18 and / or CCL5, as used herein, include full-length protein, a protein fragment, a mutated protein, derivatives, and secretory (producer) cells, eg, leukocytes and receptors thereof. Fragments, mutants, and derivatives of such chemokines are such that the biomarker characteristic of chemokines is retained.

The use of the aforementioned chemokines as biomarkers according to the present disclosure means that one or more of said chemokines is determined in said sample from an individual, for example, with detection means including those that are conventional in the field of assays, For example immunoassays, chemokines are detected by an immunoassay such as enzyme-associated immunoassays (ELISA); fluorescence-based assays, such as dissociation-enhanced lanthanide fluoroimmunoassay (DELFIA), radiometric assays, multiplex immunoassays, or cytometric bead assays (CBA); sensors. Detection means include, for example, a molecule that specifically recognizes the particular chemokine, for example a molecule that is directly or indirectly detectable. Detection means preferably comprise an antibody, which includes antibody derivatives or fragments thereof, for example an antibody that recognizes said chemokine (s), for example, an antibody that recognizes brand-name chemokine.

The label can be a conventional one, for example biotin or an enzyme such as alkaline phosphatase (AP), horseradish peroxidase (HRP) or peroxidase (POD), or a fluorescent molecule, for example a fluorescent dye, such as, for example , fluorescein isothiocyanate. The molecule bearing the label, for example the antibody bearing the label, can be detected according to conventional procedures, for example by fluorescence measurements or enzyme detection procedures.

CCL3, CCL18 and / or CCL5 secreting cells can be determined in a sample of an individual's body fluid, for example blood, using standard procedures such as, for example, as described below. Cells, eg separated by a density gradient, can be purified from the sample, eg blood, and the purified cells obtained are stained. Anti-CCL 18/3/5 antibodies, for example fluorescently labeled anti-CCL 18/3/5 antibodies, can be added to the stained cell preparation, optionally after stimulation of the cells, for example with interleukin-4 , and determining the level of CCL 18/3/5 secretion by cells or cells secreting CCL 18/3/5, or determining the expression of CCL18 and / or 3 receptor (s) and optionally CCL5.

Optionally, CCL18 and / or CCL3 and optionally CCL5 comprised in the sample or CCL 18/3/5 that recognizes, for example, detectable molecule comprised in the detection means, can be immobilized on a solid phase. An appropriate solid phase includes, for example, a conventional one, for example a plastic plate such as a polystyrene or polyvinyl plate, especially a microtiter plate. Microbeads can also be used as the solid phase, for example coated microbeads. The solid phase can be coated with a coating material the nature of which depends, for example, on the label comprised in the detection means. The coating material must be capable of binding the label, for example the label may be biotin and the coating material includes streptavidin, for example covalently bound to the solid phase.

In another aspect, the present disclosure provides a method of detecting and / or diagnosing in vitro whether or not an individual is at high risk for an acute cardiovascular syndrome or disorder, a method comprising:

a) providing a sample of an individual's body fluid;

b) determining a level of CCL3 and / or CCL18 and optionally CCL5 in the sample;

c) comparing the level of CCL3 and / or CCL18 and optionally CCL5 as determined in step b) with a reference level of a body fluid sample from a healthy control individual; and

d) detecting and / or diagnosing in vitro if the level of said CCL3 and / or CCL18 and optionally CCL5 as determined in step b) is significantly different from said reference level.

As mentioned above, the appropriate chemokine receptor can also be determined, for example by FACS analysis, using an antibody, preferably labeled, that specifically recognizes the receptor.

The determination of CCL3 and / or CCL18 and optionally CCL5 is carried out as described above, for example using a molecule that specifically recognizes the biomarker, for example an antibody, an antibody derivative, an antibody fragment, such as by example an anti-CCL3 or CCL18 antibody, for example a commercially available specific antibody against CCL3 or CCL18, for example by an immunodiagnostic assay procedure.

In order to further enhance the sensitivity and / or selectivity of the diagnostic potential of the aforementioned chemokines as biomarkers, the procedures described herein may be used in conjunction with evaluation of clinical symptoms and / or determination of the level of al less other biomarker in the subject, in which the amount of the at least one other biomarker may also be indicative of cardiovascular disease or a predisposition to it. The additional biomarker (s) can be selected from other chemokines or cytokines and risk factors that have been indicated as biomarkers of disease, such as CXCL 10 (IP-10), C-reactive protein, troponin 1, creatine kinase, creatine kinase MB, CD40L, HDL, ESR, platelet number, sex, a cardiac index, myoglobin and / or interleukin-6 (preferred embodiment), or any other biomarker more or less predictive of cardiovascular disorders.

In another aspect the present disclosure provides a method of monitoring the therapeutic efficacy of treating an individual with a substance that is expected to have an effect on the reduction or cure of an ACS disorder or disease, a method which comprises determining the level of CCL3 and / or CCL18 and optionally CCL5 or receptor (s) thereof in a sample of a body fluid from said individual and comparing it with the level of CCL3 and / or CCL18 and optionally CCL5 prior to administration of said substance. In another aspect the present disclosure provides a method of modulating a chemokine response in a vertebrate suffering from or predisposed to suffering from an acute cardiovascular syndrome (ACS) comprising the step of increasing or decreasing, or otherwise altering, functional activity of CCL3 and / or CCL18. The term "modulating a chemokine" in the context of the present invention also includes within its scope substantially preventing or deliberately inducing chemokine functional activity in a vertebrate.

The term "deliberately prevent or induce the functional activity of chemokines" in the context of the present invention includes within its scope increasing or decreasing the expression and / or intracellular or extracellular distribution and / or activity of at least one chemokine as described in This document.

Increasing expression can occur as a result of increasing mRNA expression, or increasing gene transcription using procedures known to those of skill in the art. Those skilled in the art will appreciate that there are many suitable procedures for increasing or decreasing the expression of a chemokine encoding nucleic acid sequence as described herein.

One of skill in the art will appreciate that the expression or function of one or more chemokines can be increased or decreased by increasing or decreasing chemokine mRNA levels, respectively, by post-transcriptional modulation. For example, interfering RNA can be used as a procedure to reduce chemokine RNA levels.

Increasing or decreasing intracellular distribution can occur as a result of the addition of chemokine binding proteins to the intracellular environment. Alternatively, intracellular distribution can be increased, decreased, or altered by adding or removing signal sequences and / or leader sequences to chemokine. Techniques used in such procedures will be familiar to those skilled in the art.

Increasing or decreasing chemokine activity can be caused by bringing the chemokines into contact with chemokine inhibitors, or activators of chemokines and / or chemokine binding molecules. Examples include antibody, antibody fragment, or nanobody; Genetically / chemically modified chemokine or chemokine portion with agonist or antagonist activity; a synthetic small molecular entity; or any other protein (mammalian, viral, or bacterial) with the ability to modify the activity of CCL3, CCL5, or CCL18. The term "contact" in the context of the present invention means that it does not require physical contact. Functional contact is sufficient, which is where the presence of the chemokine inhibitor or activator or binding protein affects the activity of the chemokine. This can occur when, for example, a third protein mediates the interaction / contact between the chemokine binding molecule and the chemokine. That is, the interaction is indirect. Suitable inhibitors and activators include, but are not limited to, chemokine receptor inhibitors. A person skilled in the art will know suitable inhibitors or activators. In addition, co-factors or chemokine binding molecules can affect its activity. Examples include antibodies and fragments thereof (eg Fab, F (Ab ') ² , Fv, disulfide-linked Fv, scFv, diabody). It will be appreciated that this list is far from exhaustive.

In a further aspect, a screen is provided to identify a modulator of CCL3 and / or CCL18 for possible use in the treatment of ACS, such as API, the screen comprising the steps of:

providing in vitro a cell capable of expressing CCL3 and / or CCL18;

contacting a test modulator molecule with said cell;

subjecting said cell to conditions whereby the cell would normally express CCL3 and / or CCL18 in the absence of the test molecule and;

detect whether or not the test molecule has a modulating effect on the activity of CCL3 and / or CCL18.

The modulatory effect is preferably an inhibitory effect on the activity of CCL3 and / or CCL18 and may, for example, refer to levels of mRNA expression encoding said chemokines, or to observed protein levels. Such levels can be easily determined by the expert recipient, using techniques well known to the expert and as described herein. Normally, a control, the control comprising a cell to which the test molecule has not been added, in order to obtain a reference level of CCL3 and / or CCL18.

Convenient cells for use in such a procedure include leukocytes or neutrophils.

According to the above aspects of the disclosure, the functional activity of CCL3 and / or CCL18 is advantageously modulated using any one or more of the procedures selected from the group consisting of: administering a pharmaceutically effective amount of said chemokine / s to the vertebrate; administering a pharmaceutically effective amount of one or more inhibitor / s of said chemokine (s) to the vertebrate; modulate the transcription of said chemokine (s) in the vertebrate; modulate the translation of chemokine (s) in the vertebrate; modulate the post-translational modification of chemokine (s) in the vertebrate and modulate the intracellular or extracellular distribution of said chemokine (s) in the vertebrate.

In a preferred example, the functional activity of said chemokine (s) is modulated by administering a pharmaceutically effective amount of one or more inhibitor / s of said chemokine (s) to the vertebrate. Advantageously, the one or more chemokine inhibitor (s) are selected from the group consisting of: chemical chemokine inhibitors, anti-chemokine antibodies and dominant negative mutants of those one or more chemokines described herein.

The functional activity of one or both chemokines can be modulated. A person skilled in the art will appreciate that these chemokines can act in isolation or synergistically. Furthermore, there may be functional redundancy in chemokine activity.

Detailed description of the invention

The present invention will now be further described by way of example and with reference to the figures showing:

Figure 1: Plasma levels of CCL5 and CCL18 as determined by multiplex in stabilized and resistant patients with unstable angina pectoris at t = 0 (A). ELISA was used for the temporal distribution at t = 0, t = 2 and t = 180 days. CCL5 levels decreased significantly at t = 2 and were at the same level at t = 180 (B), while CCL18 levels remained elevated at t = 2 and decreased again at t = 180 (C). Soluble CD40L levels peaked at t = 0 and decreased at t = 2 and t = 180 (D). CRP levels peaked at t = 2, and decreased to lower than initial values (t = 0) at t = 180 (E). Values represent mean ± SEM, * P <0.05, ** P <0.001 and NS = not significant.

Figure 2: The plasma levels of the upper quartiles of CCL5 and CCL18 were significantly associated with the appearance of resistant ischemic symptoms in unstable angina pectoris, while the levels of quartiles of sCD40L and CRP did not show any significant correlation (A). The upper quartile levels of CCL5 on day 0 are predictive of the need for future revascularization procedures (B), while the upper quartile levels of CCL5 were predictive of acute coronary syndromes or recurrent symptoms of unstable angina pectoris in the term of the following 18 months (C, D). * P = 0.02, ** P = 0.01, # P <0.01 and N.S. = not significant.

Figure 3: Quantitative PCR analysis showed markedly dysregulated expression by decreased CCL5 and CCL18 in unstimulated CMSP from patients with ischemic symptoms at t = 0 compared to CMSP at t = 180 (A). In contrast to the expression of chemokine receptor surface proteins in CMSP, mRNA expression of c Cl5 and CCL18 receptors CCR1, CCR3, CCR4 and CCR5 was also approximately at least 2-fold deregulated by decrease in baseline (B ). Values represent mean ± SEM, * P <0.05 and ** P <0.001.

Figure 4: Protein expression in CMSP of CCR3 and CCR5 showed a clear up-regulation of both receptors in CD14 + cells (A, B) and CD3 + cells (C, D) at the initial level. Triple modulation for CD14, CD3 and CCR3 / 5 revealed the same trend, although CD14 + cells exhibited more prominent upregulation of CCR3 and CCR5 expression than CD3 + cells (E, F). Analysis of total surface expression of CCR3 and CCR5 in all CMSP also showed dramatic upregulation of CCR3 and CCR5 expression, indicating that the increased expression of CCR3 and CCR5 is only partially produced by CD3 + cells and CD14 + positive (G, H, I). * P <0.05, ** P <0.01 and #P <0.001.

Figure 5: Stimulation of CMSP for 6 hours with rCCL5 and sCCL18 showed no significant differences in mRNA expression of CCR1 (A), CCR4 (C) and CCR5 (D). CCR3 expression was markedly downregulated after stimulation with sCCL18, but not with rCCL5 (B). Values represent mean ± SEM, * P <0.01, NS = not significant, rCCL5 = ^c C ^l 5 recombinant, sCCL18 = synthetic CCL18.

Figure 6: Evaluation of the heterophilic interaction between CCL5 and CCL18 on PAGE (18%). Lanes 1 and 2 show the reference mobility of rCCL5 (7,851 kDa) and sCCL18 (7,855 kDa), both chemokines showed a poor tendency to form 15.6 kDa homodimers. Lanes 3 and 4 were loaded with mixtures of rCCL5 and sCCL18 at a ratio of 1: 1 and 1: 5 (w: w), at which the dimers have been crosslinked by incubation for 30 min at RT with 25 mM paraformaldehyde. Note the slightly higher electrophoretic mobility and slightly more yellowish staining of the CCL18 monomer and dimer. The degree of dimer formation was not altered after co-incubation and subsequent crosslinking of CCL5 and CCL18, indicating that CCL5 and CCL18 are not probably employed in no significant heterophilic cross-interaction even at supra-physiological concentrations. Total protein load per lane was constant (2 | jg) (A).

Figure 7: PAGE analysis was corroborated by EM Ma Ld I-TOF analysis: CCL5 and CCL18 (10 pmol / jl) gave mass peaks at approximately 7,860 Da (M +; theoretical mass of CCL5 and CCL18 7,851 and 7,855 Da, respectively), with only peaks less than about 15,730 Da, illustrating the low tendency to form homodimers (M ² +) (A, B). CCL18 MALDI-TOF mass spectrometry that had been pre-incubated with CCL5 at a 1: 1 and 1: 5 p: p ratio (total concentration 10 pmol / jl) in 50 mM HEPES / 0.1 mM EDTA with paraformaldehyde gave an essentially similar pattern and the formation of dimers was equally minimal at both ratios (C, D).

Figure 8: Total levels of CD14 + cells (monocytes and neutrophils) did not differ between t = 0 and t = 180, while CD3 + cells showed a small decrease (11.8%), although significant, in the initial level (A ). At the mRNA level, an increase in HNP-3 + neutrophils was observed, suggesting the enhanced release of post-ischemic neutrophils. However, the expression ratio of CCR2: CX3CR1, a measure of the monocyte subset profile, was not differentially regulated (B). Values represent mean ± SEM, * P = 0.01, ** P <0.001 and NS = not significant.

Figure 9: Demonstrates that transient exposure of mice to elevated levels of CCL18 in the circulation (as effected by repeated administration of recombinant CCL18 protein) will exacerbate the development of atherosclerosis and thereby enhance the risk of cardiovascular disease.

Figure 10: Shows that the development of atherosclerotic plaques in the aortic sinus of hyperlipidemic mice (LDLr - / -) with a deficiency of CCL3 is sharply reduced.

Figure 11: Circulating CCL3 levels in APRAIS were comparable to those observed in patients in the MISSION cohort! (TO). Temporary CCL3 monitoring clearly shows the transient increase in CCL3 during ischemia, as the levels were significantly reduced to t = 180 compared to t = 0 (B). * P = 0.03 and ** P <0.001.

Figure 12: Levels of upper quartiles of CCL3 at baseline are predictive of the appearance of acute coronary syndromes during follow-up (A). Furthermore, the upper quartile levels were also indicative of recurrent ischemic symptoms during or directly after hospitalization (B). * P = 0.01 and ** P <0.01.

Figure 13: Plasma levels of CCL3 (A), CCL5 (B) and CXCL8 (C) were significantly elevated in patients with AMI (•) versus controls (o), while CXCL10 (D) showed the opposite pattern. * P = 0.025, ** P = 0.006, *** P = 0.02 and # P = 0.004.

Figure 14: Evaluation of IL-6, CCL3 and CXCL10 levels in LAD-ligated or sham-operated mice. Cardiac ischemia induced significantly elevated levels of IL-6, and CCL3, (A, B). On the other hand, CXCL10 presented an inverted pattern (C). * P = 0.007, ** P = 0.02, and *** P = 0.03.

Figure 15: Linked mice showed a significant increase in the percentage of circulating T lymphocytes with concomitant enrichment in the CCR5 + and CXCR3 + (AC) subsets. The increase in circulating T lymphocytes was accompanied by a decrease in CCR5 + spleen T lymphocytes, while no effects on total spleen T lymphocytes or CXCR3 + (DF) were evident. * P = 0.04, ** P = 0.02, *** P = 0.04 and P = 0.004.

Figure 16 shows that the temporal distribution of CCL3 expression in collar-induced carotid artery plaques showed elevated CCL production32 weeks after collar placement (A). Rapid and stationary induction was observed for the macrophage marker CD68 (B), while CD36 induction was somewhat delayed (C). ** p <0.01 compared to the initial level (t = 0).

Figure 17 shows that the expression of CCL3 in macrophages is strongly up-regulated after stimulation with LPS (50 ng / ml) (A) but not ox-LDL (10 ug / ml) (B). The LPS-induced CCL3 response in vivo is suppressed in CCL3 - / - chimeras (C, black bars) *** p <0.001.

Figure 18 shows that atherosclerotic lesions were significantly smaller in CCL3 '/ _ chimeras compared to WT controls (A with representative images). The content of macrophages (B), collagen (C) and T lymphocytes (D) was similar between WT and CCL3 '/ _ chimeras. Neutrophil entry (E) and adhesion (F) in CCL3 '/ _ chimeras were significantly attenuated. The black bars represent WT controls and the white bars represent CCL3 '/ _ chimeras. * p <0.05, ** p <0.01.

Figure 19 shows that the total number of white blood cells (A) and monocytes (B) was not different in CCL3 - / - mice, while the numbers of neutrophils (C) were significantly reduced. Black bars represent WT and white bars represent CCL3 '/ _ chimeras. ** p <0.01, *** p <0.001.

Figure 20 shows the kinetics of transient leukopenia induced by cyclophosphamide (A) and neutropenia (B) in control mice (white bars) and CCL3 '/ _ (black bars). Neutrophil removal is accelerated in CCL3 '/ _ chimeras (C), while repopulation is similar (D). The black bars represent WT mice and the white bars represent CCL3 '/ _ mice. * p <0.05. ** p <0.01.

Figure 21 shows that intraperitoneal injection of KC did not affect the numbers of circulating CD11b + CD7T Gr1alto neutrophils in WT and CCL3 '/ _ (A) mice. KC caused the induction of neutrophil entry into the peritoneal cavity to be "2.5-fold lower in CCL3 '/ _ mice compared to WT (B) mice. The black bars represent WT mice and the white bars represent CCL3 '/ _ mice. ** p = 0.003,

Example 1: CCL5 (RANTES) and CCL18 (PARC) are specific markers for resistant unstable angina pectoris and increase transiently during severe ischemic symptoms.

Procedures

Study population

All chemokines and inflammatory parameters were determined in plasma samples from a cohort of patients, derived from the well-defined APRAIS study (Acute Phase Reaction and Ischemic Syndromes) 13. In summary, 54 patients who were admitted to the emergency department of the Leiden University Medical Center between March and September 1995 with unstable Braunwald class IIIB angina pectoris and were followed for up to 18 months were included. Venous blood samples were obtained at admission (t = 0), after 2 (t = 2) and 180 days after admission (t = 180), they were centrifuged and aliquots of plasma were stored at -80 ° C until the subsequent analysis. All patients had received conventional medical therapy, ie, aspirin 300 mg orally, nitroglycerin intravenously, and time-based heparin infusion adjusted for activated partial thromboplastin. A clinical end point of the APRAIS study was the appearance of resistant unstable angina pectoris during hospitalization. Unstable angina was considered resistant if angina at rest, despite medical treatment, continued or reappeared, causing invasive coronary evaluation and subsequent revascularization therapy. Although the study cohort was relatively small, it constituted a clearly defined, well-documented population with a similar starting point. All subjects gave written informed consent and the study protocol was authorized by the Ethical Committee of the Leiden University Medical Center.

Isolation of cells

PMSCs were isolated from patients (t = 0 and t = 180), plus 6 healthy volunteers of the same age from venous blood samples with EDTA by density centrifugation in Histopaque (Sigma, St. Louis, MO). CMSPs were collected from the interface and washed twice with culture medium, consisting of Iscove-modified Dulbecco's medium containing Glutamax (Gibco, Paisly, UK) and supplemented with 10% FCS. CMSP were cryopreserved in culture medium containing 20% FCS and 10% dimethyl sulfoxide until further use.

Chemokines multiplex assay

Circulating levels of chemokines CCL2, CCL3, CCL5, CCL11, CCL17, CCL18, CCL22, CXCL8, CXCL9, CXCL10 chemokine and type factor MIF, OSM cytokines, IFN- ^and OPG and sRANKL and adhesion molecules were determined, sVCAM and sICAM in samples at t = 0 with a custom multiplex bioassay using the Bio-Plex Suspension Array system (Bio-Rad laboratories, Hercules, CA). Plasma samples were filtered and subsequently diluted with 10% normal mouse and rat serum (Rockland, Gilvertsville, PA) to block residual non-specific antibody binding. 1000 microspheres per chemokine (10 µl / well) in a total volume of 60 µl were added, along with standard and blank samples, and the suspension was incubated for 1 hour in a 96-well filter plate at room temperature (RT). Then 10 pl of biotinylated antibody mixture (16.5 pg / ml) was added and incubated for 1 hour at RT. After washing with PBS-1% BSA-0.5% Tween 20, beads were incubated with 50 ng / well of streptavidin R-phycoerythrin (BD Biosciences, San Diego, CA) for 10 minutes. Finally, the beads were washed again with PBS-1% BSA-0.5% Tween 20, and the fluorescence intensity was measured in a final volume of 100 µl of high-performance ELISA buffer (Sanquin, Amsterdam, The Netherlands). Measurements and data analysis were performed with the Bio-Plex Suspension Array system in combination with Bio-Plex Manager version 3.0 software (Bio-Rad laboratories, Hercules, CA) (see also ref #: 14)

ELISA and other tests

For temporal analysis of plasma CCL5 and human CCL18 levels during follow-up, samples at t = 0, t = 2, and t = 180 were tested by a CCL5 Instant ELISA kit (Bender MedSystems, Vienna, Austria) and a CCL18 ELISA (RayBiotech, Norcross, GA), respectively, according to the manufacturer's protocol. Initial level inflammatory parameters such as C-reactive protein, fibrinogen, erythrocytic sedimentation rate (ESR) and plasminogen activator inhibitor 1 (PAI-1) were determined as previously described in detail. 13 Soluble CD40 ligand (sCD40L) were determined and interleukin 6 (IL-6) by a highly sensitive immunoassay (Quantakine HS, R&D Systems, Minneapolis, MN), CRP samples at t = 180 by a turbidimetric test in a fully automatic Modular P800 unit (Roche, Almere, Los Low).

Evaluation of the heterophilic interaction of CCL5 and CCL18

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to assess whether recombinant CCL5 (7.8 kDa) and synthetic CCL18 (7.8 kDa) interacted in heterophilic interactions. Proteins (rCCL5, sCC118, rCCL5 / sCCL18 at 1: 1 weight ratio and 1: 5 (w: w; 2 pg total protein per lane) were incubated for one hour at RT in 50 mM HEPES / EDTA 0 buffer 0.1 mM (pH = 7.4), after 25 mM paraformaldehyde was added to crosslink any homo- or heterodimer formed. After 30 minutes, protein mixtures in loading buffer were denatured and subjected to SDS-PAGE (18%; 2 pg of protein per lane, one hour at 70 mV and 30 minutes at 150 mV), the proteins were visualized by silver staining. Protein mixtures were also analyzed on a MALDI-TOF Voyager-DE Pro mass spectrometer (PerSeptive Biosystems, Framingham, MA).

RT-PCR analysis

To assess the expression of CCL5, CCL18, CCR1, CCR2, CCR3, CCR4, CCR5, CX3CR1 and human neutrophil peptide-3 (HNP-3) in CMSP, mRNA was isolated and analyzed. Guanidium phenol thiocyanate was used to extract total RNA from CMSP, samples were subjected to DNase I treatment (Promega, Madison, WS) after the cDNA was generated using RevertAid M-MuLV reverse transcriptase (Fermentas, Burlington, Canada ) according to manufacturer protocol 2 Semi-quantitative gene expression was performed using the SYBR-Green procedure (Eurogentec, Liege, Belgium) on an ABI PRISM 7700 machine (Applied Biosystems, Foster City, CA) with primers for CCL5, CCL18, CCR1, CCR2, CCR3, CCR4, CCR5, CX3CR1, CD11b and human neutrophil peptide-3 (HNP-3). Cyclophilin and hypoxanthine guanine phosphoribosyl transferase (HPRT) were used as maintenance genes (see Table 1 for primer sequences).

Table 1. Primer sequences used for RT-PCR analysis.

Gene name Direct________________________ Reverse____________________

HPRT GAAATGTCAGTTGCTGCA ^{acaatccgcccaaagggaac}

TTCCT

Cyclophilin AGTCTTGGCAGTGCAGAT GAAGATGAGAACTTC ATCCT AAA

GAA GCATA

CCR1 TCCTGCTGACGATTGACA GTGCCCGCAAGGCAAAC

GGTA

CCR2 TTCGGCCTGAGTAACTGT TGAGTCATCCCAAGAGTCTCTGTC

GAAA CCR3 CT GCT GCAT GAACCCGGT GGAAGAAGTGGCGAGGTACT

CCR4 ACT GTGGGCT CCTCC AAA TCCATGGTGGACTGCGTG

TTT

CCR5 AGACATCCGTTCCCCTAC CAGGGCTCCGATGTATAATAATT

AAGAA GA

CX3CR1 GTCCACGTTGATTTCTCCT CGTGTGGTAAGTAAAATTGCTGC

CATC T HNP-3 CCCAGAAGTGGTTGTTTC TTTCCTTGAGCCTGGATGCT

CCT CCL5 T CT GCGCTCCT GCAT CT G CAGT GGGCGGGCAAT G

CCL18 CCTGGAGGCCACCTCTTC TGCAGCTCAACAATAGAAATCAA

TAA____________________ TT___________________________

Relative gene expression was calculated by subtracting the number of threshold cycles (Ct) of the target gene from the average Ct of cyclophilin and HPRT and raising two to the power of this difference.

Flow cytometry

The surface expression of CCR3 and CCR5 on CMSP CD3 + and CD14 + was evaluated by flow cytometry. Cryopreserved CMSP were thawed, washed three times in RPMI 1640 containing 20% FCS, and then stained using APC-conjugated anti-CD3 and anti-CD14 antibodies (BD Biosciences, San Jose, CA), in addition to anti-CCR3 antibodies. and FITC-conjugated anti-CCR5 (R&D Systems). Rat FITC-conjugated rat IgG2a and FITC-conjugated mouse IgG2b antibodies of non-specific isotypes (eBiosciences, San Diego, CA) were used as negative controls. Samples were analyzed with a fluorescence activated flow cytometer (FACSCalibur) and subsequently analyzed using CELLQuest software (BD Biosciences), 50,000 cells were counted for each sample.

CMSP stimulation assay

Cryopreserved CMSP specimens, obtained from six healthy volunteers, were thawed as described above, plated in a U-shaped round bottom 96-well plate (Greiner Bio-one) and stimulated for 6 hours at 37 ° C. with pure medium (control) or medium supplemented with 50 ng / ml of recombinant CCL5 (Peprotech, Rocky Hill, NJ), 50 ng / ml of the synthetic CCL18 peptide SM-1 (sCCL18), or a combination of rCCL5 and sCCL18 ( 25 ng / ml per peptide) 3 After incubation, total RNA was isolated from the cells, cDNA was prepared and the expression of chemokine receptors was determined.

Statistic analysis

Differences between the study populations of the present inventors and the original cohort were examined by Fisher's exact test and Student's t-test for independent data. Plasma levels of chemokines and inflammatory markers were tested for normal Gaussian distribution and values were logarithmically transformed for skewed distribution when appropriate. Regarding the latter, geometric means are given instead of arithmetic. The means were compared by the bilateral Student t test for independent data or the Mann-Whitney U test when appropriate. In order to assess the predictive value of CCL5 and CCL18 for the appearance of resistant symptoms, independent of possibly confounding factors, a multivariate analysis was performed, which corrected for age, HDL and ESR levels, in addition to other risk factors. established cardiovascular (eg, hypertension, hypercholesterolemia, lipid and blood pressure lowering medication, diabetes mellitus, smoking behavior, BMI and history of cardiovascular disease) and sCD40L and CRP biomarkers. The quartile distribution was evaluated and used for the Spearman correlation coefficient and the Pearson's chi-square test to determine the association of plasma levels of chemokines, in addition to levels of sCD40L and CRP for the appearance of resistant API . Diagnostic performance curves were generated to assess predictive chemokine values for resistant ischemic symptoms. Correlation analyzes between multiplex values and ELISA and between chemokines and inflammatory parameters were performed using the Spearman ordinal correlation test. The results were analyzed by FACS using the t-test for paired data, the stimulation test was analyzed using ANOVA. A bilateral P value <0.05 was considered significant. All analyzes were performed using SPSS version 14.0 software (SPSS, Chicago, IL). Results

Study population

Chemokine plasma analyzes were performed on a subcohort of previously unfrozen plasma samples from 54 consecutive patients, excluding selection bias. This subcohort, consisting of 31 patients with established ischemic symptoms and 23 with resistant ones, corresponded to the original cohort in cardiovascular risk factors, history of myocardial infarction or PTCA / CABG and laboratory parameters (Tables 2A and B).

Table 2A. Initial patient characteristics and laboratory parameters.

Chemokine cohort (N = 54) APRAIS (N = 211) P-value Age, years 65.4 ± 11.0 62.7 ± 10.2 0.08 Resistant (%) 43 36 0.43

Male sex (%) 73.8 71.1 0.75

Current smoker (%) 24.6 30.5 0.45

BMI (kg / m2) 25.2 ± 6.0 25.9 ± 3.36 0.23

Diabetes (%) 16.4 14.6 0.98 Hypertension (%) 23 23.5 0.99

Statin use (%) 8.2 12.2 0.48

History of:

Myocardial infarction (%) 45 43.2 0.88

PTCA (%) 26 29.1 0.75

CABG (%) 23 21.6 0.86

Laboratory parameters:

Total cholesterol, mmol / l 6.00 ± 1.5 6.18 ± 1.2 0.38

HDL, mmol / l 1.14 ± 0.4 1.14 ± 0.3 0.97

CRP, mg / l * 2.36 2.66 0.50

ESR, mm / h * 16,44 14,88 0,30 Fibrinogen, g / l * 3,56 3,42 0,34

Table 2B. Baseline Patient Characteristics of the Chemokine Cohort and Laboratory Parameters

Stabilized (N = 31) Resistant (N = 23) Value of P Age, years 67.3 ± 10.2 64.5 ± 11.4 0.30

Male sex (%) 87 63 0.05 Current smoker (%) 22 25 0.69

BMI (kg / m2) 24.9 26.7 0.78 Diabetes (%) 9 19 0.16 Hypertension (%) 17 38 0.39

History of:

Myocardial infarction (%) 48 47 0.89

PTCA (%) 30 25 0.57

CABG (%) 35 16 0.19

Laboratory parameters: 8.27 ± 2.1 8.51 ± 0.8 0.61 Hemoglobin, mmol / l

Hematocrit (%) 47 41 0.26 Leukocytes, 109 / l 7.49 ± 2.9 7.68 ± 2.2 0.79 Number of platelets, 106 / l 186.5 ± 66 223.9 ± 75 0, 07 Glucose, mmol / l 7.37 ± 2.7 6.49 ± 1.4 0.15 Creatinine, pmol / l 99.2 ± 52.3 108.7 ± 32.1 0.44 Cholesterol, mmol / l 5.92 ± 1.8 6.16 ± 1.0 0.56

HDL, mmol / l 1.23 ± 0.4 0.99 ± 0.2 0.02

ESR, mm / h * 14,15 20,70 0,03 Fibrinogen, g / l * 3,42 3,78 0,26

CRP, mg / l * 2.14 2.77 0.47 sCD40L, pg / ml 23.6 20.3 0.32

As not all 54 patients responded to donate blood after 180 days, the ELISA analysis at this time was performed for 47 patients (29 stabilized versus 18 resistant), but the initial characteristics of this subcohort corresponded to those of the cohort. original (data not shown). Comparison for baseline demographics in the chemokine cohort showed no notable difference between resistant versus stabilized patients, except for a small but significant difference in gender composition (87% vs. 67% male; P = 0, 05); the mean age of all patients was 65 years (41 to 85 years). Regarding clinical and plasma lipid parameters at baseline, there was no difference in total cholesterol levels in stabilized and resistant patients (5.92 vs. 6.16 mmol / l; P = 0.56), while HDL levels were lower (1.23 vs. 0.99 mmol / l; P = 0.02) in the last population. This group also presented a high tendency towards a greater inflammatory state, as illustrated by high levels of ESR (14.15 versus 20.7 mm / h; P = 0.03), despite the fact that the levels of fibrinogen and CRP they were essentially similar. No difference in baseline sCD40L levels was observed between groups.

Multiplex analysis: Regulation by increase of CCL5 and CCL18

All chemokine and cytokine data as determined by multiplex analysis (samples at t = 0) were logarithmically transformed before further statistical analysis due to their biased distribution profiles, except for OPG. The plasma levels of most chemokines and cytokines did not differ between stabilized and resistant patients. The levels of CCL5 (23.1 vs. 32.7 ng / ml; P = 0.018) and CCL18 (53.7 vs. 104.4 ng / ml; P = 0.011), however, appeared to be significantly elevated in patients resistant, while there was a significant borderline increase in those of CCL3 (53.6 vs. 73.7 pg / ml; P = 0.09) (Table 3 and Figure 1A).

Table 3. Plasma chemokine concentrations analyzed using the multiplex technique.

Resilient Stabilized Variable Value of P

CCL5, pg / ml 23158 32704 0.018

CCL18, pg / ml 53678 104399 0.011

CCL2, pg / ml 154 146 0.77

CCL3, pg / ml 53.6 73.7 0.09

CCL11, pg / ml 63.7 65.8 0.88

CCL17, pg / ml 40.3 51.2 0.34

CCL22, pg / ml 527 546 0.79

CXCL8, pg / ml 12.4 13.4 0.84

CXCL9, pg / ml 158 156 0.96

CXCL10, pg / ml 221 157 0.12

MIF, pg / ml 330 439 0.45

OPG, pg / ml * 937 1096 0.25

OSM, pg / ml 456 690 0.25

sRankL, pg / ml 5.0 5.7 0.83

sVCAM, pg / ml 681082 735190 0.45

sICAM, pg / ml 106,340 117,625 0.28

Values are geometric means

* indicates arithmetic mean

Furthermore, the observed differences in CCL5 levels remained significant after multivariate analysis adjusting for cardiovascular risk factors and sCD40L and CRP levels (P = 0.023), while CCL18 levels were significant borderline (P = 0 , 06). However, differences in CCL18 levels reached significance after multivariate analysis for all confounding factors except HDL (P = 0.021). Thus, CCL5, in addition to CCL18, appear to be independent prognostic factors for the emergence of resistant ischemic symptoms, even when adjusted for sCD40L and CRP levels. Furthermore, the levels of CCL5 and CCL18 showed no mutual correlation (R = 0.05; P = 0.7), reflecting that these chemokines are regulated or operate independently. Still, although no significant heterophilic interactions were observed between CCL5 and CCL18, it is conceivable that both chemokines, which share CCR3 as a common target receptor, will interact functionally (Figures 6 and 7). CXCL10 had a tendency to increase in stabilized patients, although it was not significant enough (221.6 vs. 157.5 pg / ml; P = 0.12), which could indicate a protective effect of this specific chemokine. IFN- ^y levels were simply undetectable and therefore not shown.

Next, the present inventors sought to assess whether CCL5 and CCL18 levels had diagnostic potential. Given the size of the cohort, the levels of CCL5 and CCL18 were classified into quartiles and analyzed for correlation with the appearance of future resistant ischemic symptoms (Table 4A).

Table 4A. Quartile levels of CCL5 and CCL18 at baseline as determined by multiplex analysis

CCL5 CCL18 quartiles

1 <15.1 <39.3

2> 15.1 and <25.5> 39.3 and <66.0

3> 25.5 and <40.3> 66.0 and <130.0

4> 40.3> 130.0

All values are in ng / ml

It was observed that the risk of resistant ischemic symptoms increased in the upper quartiles of CCL5 (R = 0.32; P = 0.017; linear-by-linear association chi-square 5.53; P = 0.019), while this trend was even more pronounced for CCL18 (R = 0.392; P = 0.003; linear-by-linear association chi-square 8,105; P = 0.004) (Figure 2A). Elevated CCL18 levels were slightly more predictive than those of CCL5 as indicated by the diagnostic performance curve (area under the curve 0.71 vs. 0.69). The cutoff values of> 40 ng / ml for CCL5 and> 130 ng / ml for CCL18 gave a sensitivity of 73.9% and 65.2%, respectively, in addition to a specificity of 67.7% and 61.3% . Combined analysis of the upper two quartiles of CCL5 and CCL18 for the appearance of resistant ischemic symptoms revealed a very significant relationship (x2 with continuity correction 8.12; P <0.01). Although the sensitivity reached 47.8%, the specificity of the combined analysis was surprisingly high 90.3%. The combined positive predictive value for CCL5 and CCL18 levels was 78.5% with a concomitant negative predictive value of 70.0%. Adding sCD40L or CRP levels to the analysis gave no further increase in sensitivity, specificity, or predictive value (data not shown). Analysis of verification and monitoring of ELISA of CCL5 and CCL18

The medium and individual ELISA and the multiplex CCL5 levels (P <0.001) corresponded excellently. In addition, they were also observed to increase plasma levels of CCL5 in resistant patients compared to stabilized on day 0 when evaluated by ELISA (36.4 vs. 26.5 ng / ml). Interestingly, already after two days, a marked decrease in plasma CCL5 levels was observed in the entire cohort (12.1 vs. 30.3 ng / ml; P <0.001) and CCL5 levels were also observed. reduced to t = 180, showing that CCL5 transiently increases during an unstable angina pectoris event (Figure 1B). The present inventors did not observe any difference between the stabilized and resistant groups 2 and 180 days after inclusion. Plasma levels of CCL18 showed a different time pattern after ischemic symptoms. ELISA analysis confirms differential expression of CCL18 on day 0 between resistant and stabilized patients (56.2 vs. 41.1 ng / ml; P = 0.02). Although absolute values were slightly lower in the ELISA compared to the multiplex assay, statistical analyzes revealed an excellent correlation between the two trials (Spearman's test; P <0.001). Interestingly, CCL18 levels in the total cohort on day 2 did not differ from baseline levels (day 0), suggesting that CCL18 and CCL5 levels could be regulated by separate mechanisms. At 180 days, CCL18 levels were significantly down-deregulated compared to day 2 values (48.4 vs. 34.5 ng / ml; P <0.001), suggesting a role for CCL18 in related procedures with cardiac ischemia-reperfusion (Figure 1C).

Ligand soluble CD40 and CRP

The levels of both sCD40L, in addition to CRP, were significantly elevated at t = 0 compared to t = 180 (sCD40L 2.04 vs. 0.69 ng / ml; P <0.001, CRP 2.36 vs. 0.96 mg / l; P <0.001) (Figure 1D, E). However, sCD40L levels began to decrease as early as t = 2 (1.35 ng / ml; P <0.05), indicating that elevated levels at baseline reflect an acute phase response related to activation platelets. Since soluble CD40L levels at t = 0 and t = 2 were significantly correlated with CCL5 levels at t = 0 and t = 2 ( t = 0 R = 0.40; P <0.01, t = 2 R = 0.35; P = 0.01), elevated CCL5 levels can also be mainly caused by platelet activation. However, sCD40L showed a significant negative correlation with CCL18 levels at t = 0 (R = -0.36; P = 0.01), suggesting that the latter represents a feedback response to platelet activation. CRP levels were even further elevated to t = 2 (6.43 mg / l; P <0.001), which is in agreement with previous reports 1516, and is supposedly indicative of a potentiated post-ischemic systemic inflammatory state in these patients. two days after ischemia and / or coronary intervention. CRP levels did not show correlations with CCL5 or CCL18 levels. The quartile levels of sCD40L, in addition to CRP, had no potential to predict resistant ischemic symptoms (R = 0.043 and R = -0.034; NS) (Figure 2A: for distribution of quartiles, see Table 4B).

Table 2B. Quartile CRP and sCD40L levels at baseline.

Quartiles CRP mg / l sCD40L ng / ml

1 <1.2 <14.2

2> 1.2 and <2.6> 14.2 and <26.4

3> 2.6 and <6.5> 26.4 and <33.7

4> 6.5> 33.7

All values are in ng / ml

Inflammation and clinical follow-up

Correlation analysis for chemokines with systemic inflammatory parameters fibrinogen, IL-6, PAI-1 and ESR did not reveal an association, except for a weak correlation between CXCL10 and IL-6 levels (R = 0.29; P = 0.02, other data not shown). And, most importantly, it was observed that the initial upper quartile levels of CCL5 as determined by multiplex were correlated with the need for revascularization procedures within the next 18 months (R = 0.35; P = 0.01). In addition, initial upper quartile levels of CCL18 were correlated with the re-manifestation of unstable angina pectoris (API) during the hospitalization (R = 0.36; P = 0.007), in addition to the appearance of an acute coronary syndrome (ACS) during the 18-month follow-up period (R = 0.31; P = 0.02) (Figures 2B -D). Initial sCD40L and CRP levels did not correlate with any of the monitoring parameters (data not shown).

Analysis of CMSP chemokine expression and chemokine receptors

Although the interaction of CCL5 with CCR1, CCR3, CCR4 and CCR5 is well described, the current receptor for CCL18 is so far unknown, which makes CCL18 currently an orphan ligand 17 However, CCL18 has been reported to be a competitive inhibitor of binding from CCL11 (eotaxin) to CCR318 Thus, the present inventors examined the mRNA expression of CCR1, CCR3, CCR4 and CCR5 chemokine receptors, in addition to that of CCL5 and CCL18 in CMSP. The present inventors observed surprising highly significant down-regulation of all four chemokine receptors involved at baseline (t = 0) compared to CMSP at t = 180 (Figure 3B). A similar temporal pattern was observed for CCL5 and CCL18, with CCL5 being abundantly expressed in CMSP and CCL18 at only lower levels (Figure 3A). Subsequent FACS analysis to detect CCR3 and CCR5 expression in CD3 + T lymphocytes and CD14 + monocytes revealed, to the surprise of the present inventors, a significant elevated expression of CCR3 and CCR5 proteins in both CD3 + and CD14 + cells at t = 0 in comparison with t = 180 (Figure 4A-D) (see comment p. 28). Triple staining for CD3 or CD14 with CCR3 and CCR5 showed high expression of chemokine receptors in the CD3 + population (3.1% triple cells positive at t = 0 vs. 2.3% at t = 180; P = 0.007 ) and even more prominently in CD14 + cells (32.1% vs. 5.1% at t = 0 and t = 180, respectively; P <0.001). An identical pattern was observed for the percentage of CCR3 + and CCR5 + cells, in addition to the combined CCR3 + / CCR5 + cells in the total CMSP population (Figure 4G-I).

To assess whether the reduced gene expression pattern at baseline was produced by transient shifts in the leukocyte distribution profile, the present inventors have monitored the total percentage of CD14 + (monocyte) and CD3 + (T lymphocyte) cells in CMSP. Monocyte numbers were not different between the two time points, while CD3 + cells decreased slightly at t = 0 (54.2 vs. 66.6%; P = 0.01) (Figure 8A) see p. 28. An additional study revealed no difference in the expression ratio of CCR2: CX3CR1, a measure of the distribution of the subset of monocytes 19, in CMSP as well. The present inventors, however, observed significantly elevated expression levels of HNP-3, a selective neutrophil marker, at t = 0, indicating enhanced neutrophil release during API (Figure 8B) see p. 28. Possibly, the observed changes in chemokine receptor expression at t = 0 can be attributed at least partially to the high numbers of neutrophils. Unlike plasma chemokine levels, no differences in expression level were observed for chemokine receptors between stabilized and resistant patients at t = 0 (data not shown).

CMSP stimulation assay

In part, however, down-regulation of chemokine receptors may reflect a feedback response to the immunomodulatory burst after API. To verify whether the observed regulation of CCR1, CCR3, CCR4 and CCR5 expression in CMSP is related to the elevated levels of CCL5 and CCL18 during ischemic events, the present inventors stimulated CMSP with rCCL5 and / or sCCL18. After 6 hours of stimulation, the present inventors observed no differential effect on CCR1, CCR4 and CCR5 mRNA expression. In contrast, however, sCCL18 caused dramatic down-regulation of CCR3 expression, and this effect was further amplified by co-incubation with rCCL5 (P <0.01, Figure 5A-D). Therefore, the down-regulation of CCR3 mRNA in CMSP observed in vivo could be produced by high levels of CCL18. The down-regulation of CCR1, CCR4 and CCR5 in vivo could be well regulated by ligands other than CCL5 and CCL18.

Discussion

To the knowledge of the present inventors, this is the first study to describe the profiling of a broad panel of chemokines by multiplex assay in plasma of patients with API in a prospective manner. Of all the chemokines tested, only CCL5 and CCL18 levels, independent of other inflammatory markers and sCD40L, were observed to be transiently elevated in resistant versus stabilized patients at baseline and decreased within 6 months after appearance of API symptoms. These phenomena were accompanied by a sharp decrease, probably induced by CCL18, in the expression of mRNA from related chemokine receptors CCR3 and CCR5 in CMSP on day 0 versus day 180. Concomitantly, it was found that the superficial expression of CCR3 and CCR5 increased at baseline, possibly reflecting rapid receptor exposure by CMSP during ischemic symptoms. Both CCL5 and CCL18 also show predictive characteristics regarding the clinical outcome.

The multiplex panel contained various chemokines, which have been previously associated with atherosclerosis or cardiovascular disease, such as CCL2, CCL5, CCL11, CXCL8 and CXCL10. 5 CCL5 and CCL18 were the only chemokines that were differentially regulated at the initial level among resistant patients and stabilized. Resistant patients had sustained severe ischemic complaints despite antianginal medication that warranted coronary angiography with or without percutaneous coronary intervention. Therefore, while the levels of Other chemokines participating in CVD were relatively unchanged, and while resistant patients generally did not differ from stabilized in the degree of general systemic inflammation, CCL5 and CCL18 could be unique chemokine markers for the severity of ischemia in patients with API.

CCL5 and CCL18 were selected for additional temporal analysis for a 180-day follow-up. As previously mentioned, the role of CCL5 as an inflammatory mediator in cardiovascular disease is widely recognized, and indeed, elevated levels of CCL5 were observed in patients with 920 acute coronary syndromes. However, these studies examined levels of CCL5. in hospitalization and, with one exception, they did not include a prospective study design. Only Nomura et al. showed a decrease in CCL5 levels at 30 days in API patients after PCI, to levels comparable to 180-day levels in the study of the present inventors 9 The data of the present inventors extends this observation, as they demonstrate that the decrease in CCL5 levels is not a consequence of PCI, but an intrinsic characteristic of patients with stabilized APIs. Although data on the reference levels of CCL5, CCL52 and 180 days after inclusion are still lacking, they were very comparable to values reported in healthy controls by Parissis et al., Suggesting that CCL5 levels had returned to baseline within the time frame. 2 days after the onset of ischemic symptoms 21.

To learn more about the contribution of activated platelets to peak levels of CCL5, the present inventors conducted a temporal evaluation of sCD40L 22 The present inventors observed significantly elevated levels of sCD40L at baseline, which is in agreement with previous studies and reflects the Enhanced platelet activation state in API2324. However, the observed progressive decrease in sCD40L levels to t = 2 and t = 180 after API has never been documented in patients with API and may illustrate the rapid restoration of sCD40L homeostasis after API. Furthermore, t = 0 and t = 2 levels were correlated with CCL5 levels, suggesting that activated platelets may, directly or indirectly, be an important source of CCL5. Aside from their massive secretion by activated platelets, elevated levels of CCL5 may also arise during API of activated T lymphocytes and as a result of altered homeostasis in ischemic distal tissue to occlusion 2526. As Rothenbacher et al. observed reduced levels of CCL5 in patients with stable coronary heart disease compared to controls, it is unlikely that the acute inflammation itself could be responsible for the transient increase in CCL5 during API 27. This is emphasized by the inventors' findings, as the Present inventors observed a down-regulation of CCL5 mRNA expression in CMSP at baseline compared to 180 days after the onset of ischemia. It remains to be seen whether the elevated response in resistant patients reflects a broader activation of platelets (or T lymphocytes) or an increased ability of platelets and T lymphocytes to make CCL5.

Interestingly, CCL18 has not yet been associated with cardiovascular disorders in patient cohorts. CCL18 is present at high levels in blood and is produced by antigen presenting cells and by eosinophils. It is believed to act on the functioning of the primary immune response as an attractant for T lymphocytes, B lymphocytes, and monocytes 17 As previously mentioned, however, its receptor has not been identified, despite CCL18 being reported to function as an antagonist of neutral CCR3 18 Evidence on a direct role of CCL18 in cardiovascular disease is inconclusive and is limited to two descriptive studies documenting the expression of CCL18 in atherosclerotic plaques and in particular at sites of reduced stability 2829. The present inventors now show that Plasma CCL18 levels are elevated in API patients and even higher in patients with resistant symptoms. The elevation of CCL18 is transient sustained, but the levels are reduced after 180 days. The current source of the persistent CCL18 rise after API is less clear. CCL18 expression was down-regulated in baseline CMSP, disqualifying the abundant production by these cells as the main source of plasma CCL18. Possibly, plasma levels may reflect a release of CCL18 containing vulnerable plaques 28 CCL18 levels were negatively correlated with sCD40L levels, possibly indicating a negative feedback response upon platelet activation. Additional research will have to clarify its role in acute coronary syndromes.

It has been suggested that various chemokines may act in the pathogenesis of non-infarcted ischemic cardiomyopathy, since the generation of predominant reactive oxygen and hypoxia in ischemic tissue will induce a chemokine response 30 Illustratively, it was observed that MCP-1 was upregulated in the myocardium at least 7 days after ischemia in mice and was associated with interstitial fibrosis and left ventricular dysfunction in the absence of myocardial infarction 6 CCL18 levels persisted at a high level for at least two days as well, and given their ability To activate fibroblasts and increase collagen production, it is tempting to propose a similar role for CCL18 in wound healing 31. It can not only modulate the attraction of leukocyte subsets but, as shown by Wimmer et al., CCL18 can also play a facilitating role in bone marrow hematopoietic stem cell function 32 Therefore high levels of CC L18 could contribute in the inflammatory response, but also in the mobilization of progenitor cells towards areas of myocardial ischemia in anticipation of the myocardial repair procedure.

To further emphasize the role of CCL5 and CCL18 in the pathophysiology of myocardial ischemia, the present inventors observed a significant increase in surface exposure of CCR3 and CCR5 by CD3 + T lymphocytes and CD14 + monocytes and a paradoxical downregulation of CCR1 mRNA, CCR3, CCR4 and CCR5 at the initial level. This is an interesting and contradictory observation, even though the present inventors are not the first to observe such a discrepancy between mRNA chemokine protein and receptor expression in CMSP from API patients. In fact, Damas et al. have reported a similar, but opposite, effect for CXCR4, that is, down-regulation of the protein, but up-regulation of the level of mRNA in API compared to healthy control subjects, while levels of its CXCL12 ligand were Reduced in API Patients Compared to Controls 33 The rapid increase in surface protein exposure may result from the acute mobilization of intracellular receptors in response to enhanced plasma levels of related ligands or other actors that are released in unstable angina. The relative down-regulation of chemokine receptor mRNA in CMSP may partially reflect an API-displaced leukocyte profile with rapid mobilization of HNP-3 + neutrophils as judged from expression of HNP-3 enhanced in CMSP mRNA. at t = 0 34, and a minor decrease in CD3 + cells, while total CD14 + levels remained unaffected. Partially, however, it may also be attributable to a negative feedback response to normalize exposed receptor levels as shown by new in vitro CCL18 regulation studies (Figure 5). Transcriptional feedback can be done in direct response to exposure of surface receptors to CCL18, since CCR3 mRNA levels were dramatically reduced after exposure to sCCL18, thus identifying a novel modulating role of CCL18 in cardiac ischemia.

Examination of the distribution of quartiles of CCL5 and CCL18 shows a clear relationship with the appearance of resistant symptoms. Furthermore, upper quartile levels were also correlated with future cardiovascular events and revascularization procedures, while sCD40L and CRP, which have been shown to have strong prognostic power in other studies 35-37, did not do this at this cohort size. . Given the major cellular sources of CCL5 and CCL18, activated platelets, and ischemic tissue, increased levels of resistant API may reflect more pronounced thrombosis and ischemia-related induction in these patients. It remains to be clarified whether or not it is causal in the progression of resistant disease. With respect to the prognostic capabilities of CCL5 and CCL18, the sensitivity and specificity of the upper quartile levels of the chemokines separately did not exceed 80%. The combination of the upper two quartiles of both chemokines gave a viable specificity of 90.3%, which thus quite effectively rules out resistant symptoms for low levels of CCL5 and CCL18. However, although CCL5 and CCL18 may have potential as independent prospective biomarkers for disease, the correlations that the present inventors observed between these chemokines and the clinical severity of symptoms, in addition to various monitoring parameters, despite being highly significant, did not they are currently strong enough on their own. Therefore, determination of plasma CCL5 and CCL18 levels, in combination with other clinical diagnostic parameters, could add prognostic features to the evaluation of patients with API. This question needs to be addressed in future studies on a larger scale.

Some problems and limitations of this study should be noted. First, the setup of the present inventors primarily ruled out studying the control levels of these chemokines prior to API. However, the present inventors believe that since the prospective analyzes were performed on the same patients, the conclusions on the temporal profile of CCL5 and CCL18 are warranted. Since all patients are largely symptom-free at 180 days after API, the present inventors can safely assume that the latest values will approximate the pre-API levels of CAD patients. Second, it has recently been shown that statins can influence serum chemokine levels in addition to chemokine receptor expression in CMSP 838. As the present inventors were in the fortunate circumstance that cohort sampling had taken place when Statin therapy had just started to appear, only 8.2% of the patients in the cohort of the present inventors were on statin therapy. Since the data of the present inventors was corrected for this minority use of statins, the present inventors believe that their results are not biased by statin therapy. Finally, the multiplex panel also comprised chemokines that had previously been associated with atherosclerosis or myocardial ischemia, including CCL2, CCL3, CXCL8, and CXCL10 213940. In the study of the present inventors, patients with resistant unstable angina showed no significant difference for these chemokines. nor for the other immunomodulators that had been tested. Thus, these cytokines have not been selected for further temporal analysis, but the present inventors cannot rule out a priori that these cytokines may affect unstable angina pectoris and myocardial ischemia.

Furthermore, preliminary data in ApoE - / - atherosclerosis-prone mice that had already developed collar-induced carotid artery plaques showed that a 3-week intraperitoneal administration regimen of recombinant CCL18 aggravated the progression of the lesion by a significant 50% (Figure 9), suggesting that CCL18 may not only be a promising marker of cardiovascular disease, but also a valid candidate for therapeutic intervention in cardiovascular disease.

To conclude, the present inventors identified CCL5 and particularly CCL18 as relevant chemokines in API. If they play a causative role in pathogenesis or are more indirectly implicated by other mechanisms, if these markers harbor any additional diagnostic potential and if they are adequate therapeutic targets, they need to be addressed in future studies.

References

1. Bertrand ME, Simoons ML, Fox KA, Wallentin LC, Hamm CW, McFadden E, De Feyter PJ, Specchia G, Ruzyllo W. Management of acute coronary syndromes in patients presenting without persistent ST-segment elevation. Eur Heart J. 2002; 23: 1809-40.

2. Hansson GK. Inflammation, Atherosclerosis, and Coronary Artery Disease. N Engl J Med. 2005; 352: 1685-1695.

3. Charo IF, Taubman MB. Chemokines in the pathogenesis of vascular disease. Circ Res. 2004; 95: 858-66.

4. Weber C. Platelets and chemokines in atherosclerosis: partners in crime. Circ Res. 2005; 96: 612-6.

5. Kraaijeveld AO, by Jager SC, van Berkel TJ, Biessen EA, Jukema JW. Chemokines and Atherosclerotic Plaque Progression: Towards Therapeutic Targeting? Curr Pharm Des. 2007; 13: 1039-1052.

6. Dewald O, Frangogiannis NG, Zoerlein M, Duerr GD, Klemm C, Knuefermann P, Taffet G, Michael LH, Crapo JD, Welz A, Entman ML. Development of murine ischemic cardiomyopathy is associated with a transient inflammatory reaction and depends on reactive oxygen species. Proc Natl Acad Sci USA. 2003; 100: 2700-5.

7. Charo IF, Ransohoff RM. The many roles of chemokines and chemokine receptors in inflammation. N Engl J Med. 2006; 354: 610-21.

8. Damas JK, Boullier A, Waehre T, Smith C, Sandberg WJ, Green S, Aukrust P, Quehenberger O. Expression of fractalkine (CX3CL1) and its receptor, CX3CR1, is elevated in coronary artery disease and is reduced during statin therapy . Arterioscler Thromb Vasc Biol. 2005; 25: 2567-72.

9. Nomura S, Uehata S, Saito S, Osmni K, Ozeki Y, Kimura Y. Enzyme immunoassay detection of plateletderived microparticles and RANTES in acute coronary syndrome. Thromb Haemost. 2003; 89: 506-12.

10. McDermott DH, Yang Q, Kathiresan S, Cupples ^l A, Massaro JM, Keaney JF, Jr., Larson MG, Vasan RS, Hirschhorn JN, O'Donnell CJ, Murphy PM, Benjamin EJ. CCL2 polymorphisms are associated with serum monocyte chemoattractant protein-1 levels and myocardial infarction in the Framingham Heart Study. Circulation.

2005; 112: 1113-20.

11. de Lemos JA, Morrow DA, Sabatine MS, Murphy SA, Gibson CM, Antman EM, McCabe CH, Cannon CP, Braunwald E. Association between plasma levels of monocyte chemoattractant protein-1 and long-term clinical outcomes in patients with acute coronary syndromes. Circulation. 2003; 107: 690-5.

12. de Jager W, te Velthuis H, Prakken BJ, Kuis W, Rijkers GT. Simultaneous detection of 15 human cytokines in a single sample of stimulated peripheral blood mononuclear cells. Clin Diagn Lab Immunol. 2003; 10: 133-9.

13. Verheggen PW, de Maat MP, Cats VM, Haverkate F, Zwinderman AH, Kluft C, Bruschke AV. Inflammatory status as a main determinant of outcome in patients with unstable angina, independent of coagulation activation and endothelial cell function. Eur Heart J. 1999; 20: 567-74.

14. de Jager W, Prakken BJ, Bijlsma JW, Kuis W, Rijkers GT. Improved multiplex immunoassay performance in human plasma and synovial fluid following removal of interfering heterophilic antibodies. J Immunol Methods.

2005.

15. Cusack MR, Marber MS, Lambiase PD, Bucknall CA, Redwood SR. Systemic inflammation in unstable angina is the result of myocardial necrosis. J Am Coll Cardiol. 2002; 39: 1917-23.

16. Kennon S, Price CP, Mills PG, Ranjadayalan K, Cooper J, Clarke H, Timmis AD. The effect of aspirin on C-reactive protein as a marker of risk in unstable angina. J Am Coll Cardiol. 2001; 37: 1266-70.

17. Schutyser E, Richmond A, Van Damme J. Involvement of CC chemokine ligand 18 (CCL18) in normal and pathological processes. J Leukoc Biol. 2005; 78: 14-26.

18. Nibbs RJ, Salcedo TW, Campbell JD, Yao XT, Li Y, Nardelli B, Olsen HS, Morris TS, Proudfoot AE, Patel VP, Graham GJ. C-C chemokine receptor 3 antagonism by the beta-chemokine macrophage inflammatory protein 4, a property strongly enhanced by an amino-terminal alanine-methionine swap. J Immunol. 2000; 164: 1488-97.

19. Tacke F, Alvarez D, Kaplan TJ, Jakubzick C, Spanbroek R, Llodra J, Garin A, Liu J, Mack M, van Rooijen N, Lira SA, Habenicht AJ, Randolph GJ. Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate within atherosclerotic plaques. J Clin Invest. 2007; 117: 185-94.

20. Steppich BA, Moog P, Matissek C, Wisniowski N, Kuhle J, Joghetaei N, Neumann FJ, Schomig A, Ott I. Cytokine profiles and T cell function in acute coronary syndromes. Atherosclerosis. 2007; 190: 443-51.

21. Parissis JT, Adamopoulos S, Venetsanou KF, Mentzikof DG, Karas SM, Kremastinos DT. Serum profiles of C C chemokines in acute myocardial infarction: possible implication in postinfarction left ventricular remodeling. J Interferon Cytokine Res. 2002; 22: 223-9.

22. Andre P, Nannizzi-Alaimo L, Prasad SK, Phillips DR. Platelet-derived CD40L: the switch-hitting player of cardiovascular disease. Circulation. 2002; 106: 896-9.

23. Aukrust P, Muller F, Ueland T, Berget T, Aaser E, Brunsvig A, Solum NO, Forfang K, Froland SS, Gullestad L. Enhanced levels of soluble and membrane-bound CD40 ligand in patients with unstable angina. Possible reflection of T lymphocyte and platelet involvement in the pathogenesis of acute coronary syndromes. Circulation.

1999; 100: 614-20.

24. Garlichs CD, Eskafi S, Raaz D, Schmidt A, Ludwig J, Herrmann M, Klinghammer L, Daniel WG, Schmeisser A. Patients with acute coronary syndromes express enhanced CD40 ligand / CD154 on platelets. Heart.

2001; 86: 649-55.

25. Nelson PJ, Kim HT, Manning WC, Goralski TJ, Krensky AM. Genomic organization and transcriptional regulation of the RANTES chemokine gene. J Immunol. 1993; 151: 2601-12.

26. Weber C, Schober A, Zernecke A. Chemokines: key regulators of mononuclear cell recruitment in atherosclerotic vascular disease. Arterioscler Thromb Vasc Biol. 2004; 24: 1997-2008.

27. Rothenbacher D, Muller-Scholze S, Herder C, Koenig W, Kolb H. Differential expression of chemokines, risk of stable coronary heart disease, and correlation with established cardiovascular risk markers. Arterioscler Thromb Vasc Biol. 2006; 26: 194-9.

28. Reape TJ, Rayner K, Manning CD, Gee AN, Barnette MS, Burnand KG, Groot PH. Expression and cellular localization of the CC chemokines PARC and ELC in human atherosclerotic plaques. Am J Pathol. 1999; 154: 365-74.

29. Papaspyridonos M, Smith A, Burnand KG, Taylor P, Padayachee S, Suckling KE, James CH, Greaves DR, Patel L. Novel candidate genes in unstable areas of human atherosclerotic plaques. Arterioscler Thromb Vasc Biol. 2006; 26: 1837-44.

30. Frangogiannis NG, Entinan ML. Chemokines in myocardial ischemia. Trends Candiovasc Med. 2005; 15: 163-9.

31. Atamas SP, Luzina IG, Choi J, Tsymbalyuk N, Carbonetti NH, Singh IS, Trojanowska M, Jimenez SA, White B. Pulmonary and activation-regulated chemokine stimulates collagen production in lung fibroblasts. Am J Respir Cell Mol Biol. 2003; 29: 743-9.

32. Wimmer A, Khaldoyanidi SK, Judex M, Serobyan N, Discipio RG, Schraufstatter IU. CCL18 / PARC stimulates hematopoiesis in long-term bone marrow cultures indirectly through its effect on monocytes. Blood.

2006; 108: 3722-9.

33. Damas JK, Waehre T, Yndestad A, Ueland T, Muller F, Eiken HG, Holm AM, Halvorsen B, Froland SS, Gullestad L, Aukrust P. Stromal cell-derived factor-1alpha in unstable angina: potential antiinflammatory and matrix -stabilizing effects. Circulation. 2002; 106: 36-42.

34. Hansen PR. Role of neutrophils in myocardial ischemia and reperfusion. Circulation. 1995; 91: 1872-85.

35. Kinlay S, Schwartz GG, Olsson AG, Rifai N, Sasiela WJ, Szarek M, Ganz P, Libby P. Effect of atorvastatin on risk of recurrent cardiovascular events after an acute coronary syndrome associated with high soluble CD40 ligand in the Myocardial Ischemia Reduction with Aggressive Cholesterol Lowering (MIRACL) Study. Circulation.

2004; 110: 386-91.

36. Varo N, de Lemos JA, Libby P, Morrow DA, Murphy SA, Nuzzo R, Gibson CM, Cannon CP, Braunwald E, Schonbeck U. Soluble CD40L: risk prediction after acute coronary syndromes. Circulation. 2003; 108: 1049-52. 37. Lindahl B, Toss H, Siegbahn A, Venge P, Wallentin L. Markers of myocardial damage and inflammation in relation to long-term mortality in unstable coronary artery disease. FRISC Study Group. Fragmin during Instability in Coronary Artery Disease. N Engl J Med. 2000; 343: 1139-47.

38. Veillard NR, Braunersreuther V, Arnaud C, Burger F, Pelli G, Steffens S, Mach F. Simvastatin modulates chemokine and chemokine receptor expression by geranylgeranyl isoprenoid pathway in human endothelial cells and macrophages. Atherosclerosis. 2006; 188: 51-8.

39. Gerszten RE, Garcia-Zepeda EA, Lim YC, Yoshida M, Ding HA, Gimbrone MA, Jr., Luster AD, Luscinskas FW, Rosenzweig A. MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature. 1999; 398: 718-23.

40. Heller EA, Liu E, Tager AM, Yuan Q, Lin AY, Ahluwalia N, Jones K, Koehn SL, Lok VM, Aikawa E, Moore KJ, Luster AD, Gerszten RE. Chemokine CXCL10 promotes atherogenesis by modulating the local balance of effector and regulatory T cells. Circulation. 2006; 113: 2301-12.

Example 2: CCL3 (MIP-1a) levels are elevated during acute coronary syndromes and show strong prognostic power for future ischemic events.

Procedures

Patient cohorts

MISSION

Study populations from the MISSION! Intervention study were assembled 12 The group of patients with AMI consisted of 44 patients (54.5% male; mean age 61.8 ± 11.6 years) diagnosed with AMI based on ECG and clinical chemical parameters (high levels of troponin and creatine kinase). The control group represented 22 non-symptomatic subjects of the same age and sex (54.5% men; mean age 61.7 ± 12.8), who did not suffer from the manifestation of coronary artery disease (Table 5). Initial blood samples were taken from patients with AMI within 2 hours after hospitalization and within 6 hours after the onset of AMI. Patients suffering from autoimmune disease, malignant tumors, chronic inflammatory diseases such as rheumatoid arthritis, or who received immunosuppressant or chemotherapy were excluded from the study. This study was authorized by the local ethical committee and all healthy patients and volunteers gave informed consent before being recruited. The research was adapted to the principles outlined in the Declaration of Helsinki.

APRAIS

Plasma samples from patients with unstable angina, derived from the well-defined APRAIS (Acute Phase Reaction and Ischemic Syndromes) study, were used to determine circulating CCL3 levels. 13 In summary, 54 patients were admitted to the emergency department. from Leiden University Medical Center between March and September 1995 with unstable Braunwald class IIIB angina pectoris and were followed for up to 18 months. Venous blood samples were obtained at admission (t = 0) after 2 (t = 2) and 180 days after admission (t = 180), centrifuged, and aliquots of plasma were stored at -80 ° C until the subsequent analysis. All patients had received conventional medical therapy, ie, aspirin 300 mg orally, nitroglycerin intravenously, and time-based heparin infusion adjusted for activated partial thromboplastin. All subjects gave written informed consent and the study protocol was authorized by the Ethical Committee of the Leiden University Medical Center.

Chemokines multiplex assay

Circulating chemokine levels of CCL2, CCL3, CCL5, CCL11, CCL17, CCL18, CCL22, CXCL8, CXCL9 and CXCL10 were determined, in addition to four reference cytokines in the MISSION cohort, in addition to CCL3 levels in the APRAIS cohort, using a reading based on highly sensitive fluorescent microspheres as described after 1415. Briefly, plasma samples were filtered and then diluted with 10% normal mouse and rat serum (Rockland, Gilvertsville, PA) to block binding of non-specific antibody residual. 1000 microspheres per chemokine (10 µl / well) in a total volume of 60 µl were added, along with standard and blank samples, and the suspension was incubated for 1 hour in a 96-well filter plate at room temperature (RT) . Then, 10 µl of biotinylated antibody mixture (16.5 jg / ml) was added and incubated for 1 hour at RT. After washing with PBS-1% BSA-0.5% Tween 20, beads were incubated with 50 ng / well of streptavidin R-phycoerythrin (BD Biosciences, San Diego, CA) for 10 minutes. Finally, the beads were washed again with PBS-1% BSA-0.5% Tween 20, and the fluorescence intensity was measured in a final volume of 100 jl of high-yield ELISA buffer (Sanquin, Amsterdam, The Netherlands). Measurements and data analysis were performed with the Bio-Plex Suspension Array system in combination with Bio-Plex Manager version 3.0 software (Bio-Rad laboratories, Hercules, CA).

Murine myocardial infarction

Mice were anesthetized and artificially ventilated with a mixture of oxygen and N ² O [1: 2 (vol / vol)] using a rodent respirator (Harvard Apparatus, Holliston, MA) to which 2-2.5% of isoflurane (Abbott Laboratories, Hoofddorp, The Netherlands) for anesthesia. Myocardial infarction was induced by permanent ligation of the proximal left anterior descending coronary artery with a sterile 7/0 silk suture (Ethicon, Johnson & Johnson, Amersfoort, The Netherlands). Three hours after ligation, the mice were sacrificed, CMSP and spleens were isolated for flow cytometric analysis, and plasma was collected for chemokine detection. All animal procedures were authorized by the Leiden University Animal Ethics Committee. ELISA and other tests

Human CCL3, as well as murine (Biosource, Carlsbad, CA), murine CXCL10 (R&D Systems, Minneapolis, MN) and murine IL-6 (eBioscience, San Diego, CA) levels were determined by sandwich ELISA assays as described per the manufacturer's protocol. Initial inflammatory parameters were determined in the APRAIS cohort, such as C-reactive protein, fibrinogen, and erythrocytic sedimentation rate (ESR), as previously described. 13 Soluble CD40 ligand (sCD40L) was determined using a highly sensitive immunoassay (Quantakine HS, R&D Systems, Minneapolis, MN).

Flow cytometry

Whole blood CMSP were isolated by destruction of erythrocytes. Splenocytes were isolated by triturating spleens through a 70 jm cell filter (BD falcon, BD Biosciences, San Jose, CA). After collection, total blood cells and splenocytes were incubated with erythrocyte lysis buffer for 5 minutes on ice. Cells were spun for 5 minutes and resuspended in lysis buffer. Residual erythrocytes were lysed by incubation for 5 minutes on ice. Cells were washed twice with PBS and counted. Accordingly, cells were stained for surface markers CD4, CCR3, CCR5 (BD Biosciences), CD8, F4 / 80 (eBioscience), and CXCR3 (US biological, Swampscott, MA) by adding 0.25 jg of antibody per sample. After 45 minutes incubation on ice, cells were washed with PBS and subsequently analyzed by flow cytometry (FACScalibur, BD biosciences).

Statistical procedures

Statistical analysis was performed using SPSS version 13.0 (SPSS, Chicago, IL). All values are expressed as mean ± standard error of the mean. Differences in the distribution of risk factors between the control and AMI groups were analyzed with a Fisher exact probability test. Chemokine data for normal distribution was tested using a Kolmogorov-Smirnov analysis. Non-Gaussian distributed data was analyzed by a Mann-Whitney U test, while normally distributed variables were analyzed by the Student's t-test. Correlation analysis with inflammatory parameters was performed using Spearman's rank correlation test. Covariate adjustment for risk factors was performed by a univariate linear regression test. The quartile distribution of CCL3 was evaluated and used for the chi-square test to associate elevated levels of CCL3 with future cardiovascular events. A value of P <0.05 was considered significant.

Results

MISSION Patient Statistics

Two sub-cohorts were compiled at a 2: 1 ratio, as a pilot study revealed that the standard deviation in cytokine levels in the AMI population was on average 1.5 times greater than that of the control subjects. AMI and control sub-cohorts were matched for sex, age, and risk factors known to be associated with the inflammatory state (type 2 diabetes mellitus, hypertension, and hyperlipidemia). The AMI cohort comprised a higher fraction of smokers and ex-smokers than the control cohort (56.8% in AMI compared to 22.7% in controls; P = 0.01; Table 5). Therefore, all chemokine values were adjusted for smoking by univariate analysis. All proteins were perfectly within the detectable range of the assay used.

Table 5. Characteristics of MISSION!

Controls Acute myocardial infarction P value

Age (years) 61.7 ± 2.6 61.8 ± 1.8 0.96

Men / women 12/10 24/20 1.00

Diabetes mellitus 3 (13.6%) 6 (13.6%) 1.00 Hypertension 8 (36.3%) 11 (25%) 0.39

Total cholesterol 5.6 ± 0.3 mmol / l 6.0 ± 0.1 mmol / l 0.14 Smoking 5 (22.7%) 25 (56.8%) *; 0.01

4 (18.1%) ex-smokers 4 (9.1%) ex-smokers

Reference panel

As a control for the validity of the multiplex assay, a panel of reference cytokines and cell adhesion markers were included in the analysis. In compliance with previous findings, plasma levels of IL-2 (0.07 ± 0.06 pg / ml in controls vs. 0.65 ± 0.28 in ⁱ A ^m ; P = 0.003), TNF-a (1 0.05 ± 0.32 pg / ml in controls vs. 2.4 ± 0.72 in AMI; P = 0.03), sICAM-1 (476.1 ± 80.7 ng / ml in controls vs. 713, 0 ± 49.9 in AMI; P = 0.04) and IL-6 (9.8 ± 4.1 in controls compared to 23.7 ± 8.0 pg / ml in AMI; P = 0.04) they were significantly elevated in patients with AMI (Table 6). Other markers of general inflammation such as IL-1a, IFN-, and sVCAM-1 remained unchanged (data not shown), thus showing that the cohort of patients with AMI was not enriched in subjects with a general hyperinflammatory state.

Table 6. Quartile levels at t = 0 of APRAIS CCL3 as determined by multiplex

CCL3 quartiles (pg / ml)

1 <41

2> 41 and <53

3> 53 and <83

4> 83

Chemokines

Plasma levels of CC CCL3 chemokine (39.8 pg / ml, 21.3-50.3 IQR in controls compared to 47.8 pg / ml, 39.6-67.2 IQR in AMI; P = 0 , 01: Figure 13A) and CCL5 (13.4 ng / ml, 6.4 -29.2 IQR in controls compared to 33.3 ng / ml, 19.1-45.3 in AMI; P = 0.001: Figure 14B) were significantly regulated by increase in AMI compared to control patients (Table 7). After correction for cardiovascular risk factors, CCL3 and CCL5 remained significantly elevated during AMI (P = 0.025 and P = 0.006, respectively). Of the CXC chemokines only CXCL8 (4.2 ± 0.50 pg / ml in controls compared to 6.8 ± 0.56 in AMI; P = 0.01; Figure 13C) was significantly upregulated, while CXCL10 (255.1 ± 47.2 pg / ml in control vs. 162.6 ± 20.3 in AMI; P = 0.002: Figure 13D) was down-regulated in AMI compared to controls. After covariate adjustment, both CXCL8 and CXCL10 remained significantly changed (P = 0.02 and P = 0.04 respectively). All other measured chemokines were not differentially regulated during AMI (Table 7).

Table 7. Mean Values of Cytokines and Chemokines

IAM control P P *

IL-2 0.07 ± 0.06 pg / ml 0.65 ± 0.28 pg / ml T 0.003 0.047

IL-6 9.8 ± 4.1 pg / ml 23.8 ± 8.0 pg / ml T 0.04 0.07

TNFa 0.6 pg / ml, (0-1.6) 1.4 pg / ml, (0.5-2.4) T 0.03 0.01

sICAM-1 476 ± 80.7 ng / ml 714 ± 50.0 ng / ml T 0.045 <0.001

CCL2 305 ± 81 pg / ml 522 ± 77 pg / ml = 0.08 0.14

CCL3 49.8 pg / ml (21.3-50.6) 47.7 pg / ml, (39.6-67.2) T 0.02 0.025

CCL5 13.4 ng / ml (6.4-29.2) 33.3 ng / ml, (19.8-45.3) T 0.001 0.006

CCL11 15.9 pg / ml, (12.7-22.0) 21.2 pg / ml, (13.6-29.8) = 0.27 0.33

CCL17 16.4 pg / ml, (10.5-21.4) 16.6 pg / ml, (8.6-28.9) = 0.46 0.26

CCL18 555 ± 186 ng / ml 681 ± 160 ng / ml = 0.18 0.85

CCL22 356 pg / ml, (264-409) 371 pg / ml, (296-549) = 0.11 0.08

CXCL8 3.5 pg / ml, (1.9-4.3) 5.1 pg / ml, (3.5-7.4) T 0.004 0.02

CXCL9 163 ± 51 pg / ml 155 ± 25 pg / ml = 0.16 0.87 CXCL10 255 ± 47.4 pg / ml 120 ± 20.3 pg / ml 1 0.001 0.004

Reference panel (IL-2, IL-6, TNF-a and sICAM-1) and chemokines of measured parameters containing P value and corrected P value (P *) after adjustment for smoking. Values are expressed as mean ± SEM or median with IQR when appropriate.

APRAIS

To verify this observation, the present inventors compared the CCL3 levels of the MISSION cohort! with those in the APRAIS cohort as described above, refer to Example 1. Cross-study analysis showed that API patients also had similar elevated plasma levels of CCL3 compared to MISSION! (Figure 11A). Next, the present inventors performed a temporal analysis of circulating CCL3 levels in the APRAIS cohort of patients with unstable angina pectoris. Plasma samples from baseline (t = 0), t = 2, and t = 180, as analyzed by ELISA, revealed a significant decrease in CCL3 levels to t = 180 compared to t = 0, in addition to t = 2 ( t = 0 7.57 pg / ml; t = 26.49 pg / ml; t = 180 4.31 pg / ml, P <0.001) (Figure 11B). Although absolute plasma CCL3 levels detected by ELISA were lower, the comparison of both techniques revealed a highly significant correlation (R = 0.92, P <0.001). Next, the present inventors sought to assess whether the plasma levels of CCL3 had any potential to predict the clinical outcome. Given the size of the cohort, plasma levels at t = 0 of multiplex CCL3 were, therefore, classified into quartiles and analyzed for correlation with the appearance of ischemic symptoms during or immediately after hospitalization and / or acute coronary syndromes. (For distribution of quartiles, see Table 6). The upper quartile levels of CCL3 were highly predictive of the appearance of acute coronary syndromes during follow-up (likelihood ratio 11.52; P <0.01) and recurrent unstable angina pectoris during hospitalization (likelihood ratio 14.63 ; P <0.01) (Figure 12A, B). Cardiac death during follow-up also showed a significant, although less strong association (likelihood ratio 7.92; P <0.05) (data not shown). Finally, CCL3 was not correlated with any of the inflammatory parameters (data not shown). However, sCD40L levels revealed a significant negative correlation with CCL3 levels (R = -0.44; P = 0.001), suggesting a feedback response after platelet activation.

Unlike CCL5 and CCL18, CCL3 levels were not predictive of a resilient nature of API (early stage), but highly significant that more medium-term events occur within 180 days of API.

Murine myocardial infarction

The results obtained in humans suggest an important role for CCL3 in ischemic myocardial injury. To determine if the enhanced chemokines were related to ischemia, the present inventors performed myocardial infarction experiments on mice. As CCL5 and CXCL8 chemokines have been extensively studied with respect to atherothrombosis and AMI, the present inventors directed their interest to CCL3 and CXCL10. To induce acute myocardial infarction, the left anterior descending coronary artery was ligated in C57B16 mice. The levels of CCL3 were, in agreement with the previous findings of MISSION !, significantly elevated after AMI (33.2 ± 1.5 vs. 76.4 ± 37.4 pg / ml in bound animals; P = 0.02 ) (Figure 14B). As a control for the AMI model, levels of the cytokine IL-6 related to ischemia 1617 were measured. IL-6 levels were significantly upregulated after ligation (0.67 ± 0.26 in sham animals versus 1.34 ± 0.46 ng / ml in ligatures; P = 0.007, Figure 14A). Surprisingly, unlike the MISSION! Findings, CXCL10 levels were significantly enhanced after AMI (157.3 ± 64.8 in sham-operated animals compared to 310.6 ± 86.6 pg / ml in ligands; P = 0.03) (Figure 14C). Furthermore, CMSP were collected and analyzed for the expression of chemokine receptors in different cell subsets. As expected, the total circulating T lymphocyte population was potentiated after ligation (14.1 ± 3.8% in controls vs. 32.8 ± 14.4% in ligated mice; P = 0.038), although no effects were observed in splenic T lymphocytes (P = 0.9, Figure 15A and D, respectively). Furthermore, the number of both circulating macrophages, as well as splenic, was not regulated by ischemic injury (data not shown). Further analysis of the T lymphocyte population revealed a specific enrichment of CCR5 + T lymphocytes (8.0 ± 2.0% in controls compared to 11.4 ± 1.4% in linked animals; P = 0.02) ( Figure 15B). Enrichment in circulatory CCR5 + T lymphocytes was accompanied by a reduction in splenic CCR5 + T lymphocytes (19.95 ± 0.5% vs. 14.1 ± 3.1%; P = 0.004) (Figure 15E). CCR3 is the known receptor for CCL3-related chemokine CCL4. Since CCL3 and CCL4 are normally co-regulated, the present inventors also analyzed CMSP and splenocytes for expression of CCR3. Circulating CCR3 + T lymphocyte numbers were very low. Analysis showed a slight, although not significant (P = 0.24) increase in circulating CCR3 + T lymphocytes (data not shown). There were no obvious differences in splenic CCR3 + T lymphocytes (data not shown). Taken together, these data suggest a specific migration of CCL3 from T lymphocytes from secondary lymphoid organs to the site of ischemic injury. In addition, expression of the CXC CXCR3 chemokine receptor in circulating T lymphocytes was also determined. In coincidence with the potentiated CXCL10 levels, the number of circulating CXCR3 + T lymphocytes was significantly elevated after LAD ligation (29.1 ± 1.9% vs. 43.5 ± 5.7%; P = 0.04 ) (Figure 15C). However, no effects were evident on CXCR3 + spleen T lymphocytes (P = 0.78) (Figure 15F).

Preliminary data suggests that CCL3 levels are not predictive of the risk of future cardiovascular events, but may also be causally implicated in the development of the disease as the growth of atherosclerotic plaques in the aortic sinus of mice inactivated in the hyperlipidemic LDL receptor. with a leukocyte deficiency in CCL3 it is significantly lower (-60%) than that in mice with normal CCL3 leukocyte production (Figure 10).

References

1. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 2005; 352: 1685-95. 2. Laing KJ, Secombes CJ. Chemokines. Dev Comp Immunol. 2004; 28: 443-60.

3. Weber C. Novel mechanistic concepts for the control of leukocyte transmigration: specialization of integrins, chemokines, and junctional molecules. J Mol Med. 2003; 81: 4-19.

4. Weber C, Schober A, Zernecke A. Chemokines: key regulators of mononuclear cell recruitment in atherosclerotic vascular disease. Arterioscler Thromb Vasc Biol. 2004; 24: 1997-2008.

5. Olson TS, Ley K. Chemokines and chemokine receptors in leukocyte trafficking. Am J Physiol Regul Integr Comp Physiol. 2002; 283: R7-28.

6. Kraaijeveld AO, by Jager SC, van Berkel TJ, Biessen EA, Jukema JW. Chemokines and atherosclerotic plaque progression: towards therapeutic targeting? Curr Pharm Des. 2007; 13: 1039-52.

7. Mause SF, von Hundelshausen P, Zernecke A, Koenen RR, Weber C. Platelet Microparticles. A Transcellular Delivery System for RANTES-Promoting Monocyte Recruitment on Endothelium. Arterioscler Thromb Vasc Biol.

2005.

8. Simeoni E, Winkelmann BR, Hoffmann MM, Fleury S, Ruiz J, Kappenberger L, Marz W, Vassalli G. Association of RANTES G-403A gene polymorphism with increased risk of coronary arteriosclerosis. Eur Heart J.

2004; 25: 1438-46.

9. Boger CA, Fischereder M, Deinzer M, Aslanidis C, Schmitz G, Stubanus M, Banas B, Kruger B, Riegger GA, Kramer BK. RANTES gene polymorphisms predict all-cause and cardiac mortality in type 2 diabetes mellitus hemodialysis patients. Atherosclerosis. 2005.

10. Frangogiannis NG. The role of the chemokines in myocardial ischemia and reperfusion. Curr Vasc Pharmacol.

2004; 2: 163-74.

11. Tarzami ST, Miao W, Mani K, Lopez L, Factor SM, Berman JW, Kitsis RN. Opposing effects mediated by the chemokine receptor CXCR2 on myocardial ischemia-reperfusion injury: recruitment of potentially damaging neutrophils and direct myocardial protection. Circulation. 2003; 108: 2387-92.

12. Liem SS, van der Hoeven BL, Oemrawsingh PV, Bax JJ, van der Bom JG, Bosch J, Viergever EP, van Rees C, Padmos I, Sedney MI, van Exel HJ, Verwey HF, Atsma DE, van der Velde ET, Jukema JW, van der Wall EE, Schalij MJ. MISSION !: optimization of acute and chronic care for patients with acute myocardial infarction. Am Heart J. 2007; 153: 14 e1-11.

13. Verheggen PW, de Maat MP, Cats VM, Haverkate F, Zwinderman AH, Kluft C, Bruschke AV. Inflammatory status as a main determinant of outcome in patients with unstable angina, independent of coagulation activation and endothelial cell function. Eur Heart J. 1999; 20: 567-74.

14. de Jager W, te Velthuis H, Prakken BJ, Kuis W, Rijkers GT. Simultaneous detection of 15 human cytokines in a single sample of stimulated peripheral blood mononuclear cells. Clin Diagn Lab Immunol. 2003; 10: 133-9.

15. de Jager W, Prakken BJ, Bijlsma JW, Kuis W, Rijkers GT. Improved multiplex immunoassay performance in human plasma and synovial fluid following removal of interfering heterophilic antibodies. J Immunol Methods.

2005; 300: 124-35.

16. LaFramboise WA, Bombach KL, Dhir RJ, Muha N, Cullen RF, Pogozelski AR, Turk D, George JD, Guthrie RD, Magovern JA. Molecular dynamics of the compensatory response to myocardial infarct. J Mol Cell Cardiol.

2005; 38: 103-17.

17. Shu J, Ren N, Du JB, Zhang M, Cong HL, Huang TG. Increased levels of interleukin-6 and matrix metalloproteinase-9 are of cardiac origin in acute coronary syndrome. Scand Cardiovasc J. 2007; 41: 149-54. 18. Miyao Y, Yasue H, Ogawa H, Misumi I, Masuda T, Sakamoto T, Morita E. Elevated plasma interleukin-6 levels in patients with acute myocardial infarction. Am Heart J. 1993; 126: 1299-304.

19. Mizia-Stec K, Gasior Z, Zahorska-Markiewicz B, Janowska J, Szulc A, Jastrzebska-Maj E, Kobielusz-Gembala I. Serum tumor necrosis factor-alpha, interleukin-2 and interleukin-10 activation in stable angina and acute coronary syndromes. Coron Artery Dis. 2003; 14: 431-8.

20. Wang YN, Che SM, Ma AQ. Clinical significance of serum cytokines IL-1beta, sIL-2R, IL-6, TNF-alpha, and IFN-v in acute coronary syndrome. Chin Med Sci J. 2004; 19: 120-4.

21. de Lemos JA, Hennekens CH, Ridker PM. Plasma concentration of soluble vascular cell adhesion molecule-1 and subsequent cardiovascular risk. J Am Coll Cardiol. 2000; 36: 423-6.

22. Zhou RH, Shi Q, Gao HQ, Shen BJ. Changes in serum interleukin-8 and interleukin-12 levels in patients with ischemic heart disease in a Chinese population. J Atheroscler Thromb. 2001; 8: 30-2.

23. Hashmi S, Zeng QT. Role of interleukin-17 and interleukin-17-induced cytokines interleukin-6 and interleukin-8 in unstable coronary artery disease. Coron Artery Dis. 2006; 17: 699-706.

24. Parissis JT, Adamopoulos S, Venetsanou KF, Mentzikof DG, Karas SM, Kremastinos DT. Serum profiles of C C chemokines in acute myocardial infarction: possible implication in postinfarction left ventricular remodeling. J Interferon Cytokine Res. 2002; 22: 223-9.

25. Nomura S, Uehata S, Saito S, Osumi K, Ozeki Y, Kimura Y. Enzyme immunoassay detection of plateletderived microparticles and RANTES in acute coronary syndrome. Thromb Haemost. 2003; 89: 506-12.

26. Mause SF, von Hundelshausen P, Zernecke A, Koenen RR, Weber C. Platelet microparticles: a transcellular delivery system for RANTES promoting monocyte recruitment on endothelium. Arterioscler Thromb Vasc Biol.

2005; 25: 1512-8.

27. Guan E, Wang J, Norcross MA. Identification of human macrophage inflammatory proteins 1alpha and 1beta as a native secreted heterodimer. J Biol Chem. 2001; 276: 12404-9.

28. Vandervelde S, van Luyn MJ, Rozenbaum MH, Petersen AH, Tio RA, Harmsen MC. Stem cell-related cardiac gene expression early after murine myocardial infarction. Cardiovasc Res. 2007; 73: 783-93.

29. Hou Y, Plett PA, Ingram DA, Rajashekhar G, Orschell CM, Yoder MC, March KL, Clauss M. Endothelialmonocyte-activating polypeptide II induces migration of endothelial progenitor cells via the chemokine receptor CXCR3. Exp Hematol. 2006; 34: 1125-32.

30. Waeckel L, Mallat Z, Potteaux S, Combadiere C, Clergue M, Duriez M, Bao L, Gerard C, Rollins BJ, Tedgui A, Levy BI, Silvestre JS. Impairment in postischemic neovascularization in mice lacking the CXC chemokine receptor 3. Circ Res. 2005; 96: 576-82.

Materials and procedures

Animals

LDLr / _ mice were obtained from the local animal husbandry facility. Mice were maintained with sterilized regular feed (RM3; Special Diet Services, Essex, R.U.). Drinking water with antibiotics (83 mg / l ciprofloxacin and 67 mg / l polymyxin B sulfate) and 6.5 g / l sucrose was supplied and provided at will. Animal experiments were conducted in the animal facilities of the Gorlaeus laboratories of the University of Leiden. All experimental protocols were authorized by the Ethical Committee for Animal Experiments at Leiden University.

Temporal expression profile

Male LDLr / _ mice were fed a western-type diet containing 0.25% cholesterol and 15% cocoa butter (Special Diet Services, Sussex, UK) two weeks prior to surgery and throughout the experiment. To determine gene expression levels in mouse plates (n = 20), atherosclerotic carotid artery lesions were induced by perivascular collar placement as previously described 1. Mice were anesthetized by subcutaneous injection of ketamine (60 mg / kg , Eurovet Anima1Health, Bladel, The Netherlands), fentanyl citrate and fluanisone (1.26 mg / kg and 2 mg / kg, respectively, Janssen Anima1Health, Sauderton, UK). From 0 to 8 weeks after collocation, a subset of 4 mice was sacrificed every two weeks. Animals were anesthetized as described above and perfused through the left cardiac ventricle with PBS and bled by transection of the femoral artery. Subsequently, both common carotid arteries were removed and deep-frozen in liquid nitrogen for optimal preservation of the RNA. The specimens were stored at -80 ° C until further use.

RNA isolation

Two or three carotids per sample were pooled and homogenized by grinding in liquid nitrogen with a pistil. Total RNA was extracted from the tissue using Trizol reagent according to the manufacturer's instructions (Invitrogen, Breda, The Netherlands). RNA was reverse transcribed using M-MuLV reverse transcriptase (RevertAid, MBI Fermentas, Leon-Roth) and used for quantitative analysis of gene expression with an ABI PRISM 7700 Taqman apparatus (Applied Biosystems, Foster City, CA) as previously described 2, using murine hypoxanthine phosphoribosyltransferase (HPRT) and cyclophilin A (CypA) as standard maintenance genes (Table 8). Bone marrow transplant

To induce bone marrow aplasia, male LDLr / _ receptor mice were exposed to a single dose of 9 Gy (0.19 Gy / min, 200 kV, 4 mA) of whole body irradiation using an Andrex Smart 225 Rontgen source ( YXLON International) with a 6mm aluminum filter 1 day before transplant. Bone marrow was isolated from male CCL3 '/ _ or littermates by washing the femurs and shins. The irradiated recipients received 0.5x107 bone marrow cells by injection into the tail vein and were allowed to recover for 6 weeks. Animals were placed on a western-type diet containing a 0.25% cholesterol and 15% cocoa butter (SDS) diet for 12 weeks and subsequently sacrificed. Twenty-four hours before slaughter, a subset of animals was injected intraperitoneally with lipopolysaccharide (LPS) ( Salmonella minnesota R595 (Re) (List Biological Laboratories Inc., Campbell, CA)). Plasma levels were determined by sandwich ELISA (Biosource, Carlsbad, CA, according to the manufacturer's protocol) to confirm altered production of leukocyte CCL3.

Histological analysis

Cryostat sections were collected from the aortic root (10 µm) and stained with Oil-red-O. Lesion size was determined in 5 sections of the aortic valve leaflet area. Corresponding sections were immunohistochemically stained on separate slides with an antibody directed against a macrophage-specific antigen (MOMA-2, monoclonal rat IgG2b, 1:50 dilution; Serotec, Oxford, UK). Goat rat anti-IgG-AP (1: 100 dilution; Sigma, St. Louis, MO) was used as the secondary antibody and NBT-BCIP (Dako, Glostrup, Denmark) as enzyme substrates. Masson's trichrome stain (Sigma, St. Louis, MO) was used to visualize collagen (blue stain). Neutrophils were visualized by staining with Naftol AS-D chloroacetate esterase according to the manufacturer's protocol (Sigma).

Macrophage stimulation

Serum-deprived RAW264.7 macrophages were stimulated with 10 jg / ml of ox-LDL or 1 ng / ml of LPS for 24 hours. Total RNA was isolated for real-time PCR to assess CCL3 expression. Serum-deprived RAW 264.7 macrophages were stimulated with recombinant CCL3 (10 or 100 ng / ml) for 24 hours. [3H] -thymidine (1 jCi / well, 24 Ci / mmol specific activity; Amersham Biosciences, The Netherlands) was then added to each well and the cells were allowed to proliferate for another 24 hours. The cells were rinsed twice with cold PBS and subsequently lysed with 0.1M NaOH. The amount of [3H] -thymidine incorporation was measured using a liquid scintillation analyzer (Tri-Carb 2900R).

Cyclophosphamide-induced neutropenia

Mice CCL3 '/ _ female or control WT received an intraperitoneal (ip) injection of cyclophosphamide (6 mg / mouse) to deplete blood neutrophils as previously described 3, 4 Blood samples were taken through the tail vein regularly and blood cell differentiation was determined on a Sysmex cell differentiation apparatus (Goffin Meyvis, Etten-Leur, The Netherlands).

In vivo chemotaxis

CCL3 - / - female or WT control mice received an i.p. 500 ng of recombinant KC (Peprotech, Rocky Hill, NJ) or PBS. Two hours later, blood and peritoneal cells were isolated and analyzed for neutrophil composition by flow cytometry.

Flow cytometry

Peritoneal leukocytes were collected by washing the peritoneal cavity with PBS. Crude peripheral blood mononuclear cells (CMSP) and peritoneal leukocytes were incubated at 4 ° C with erythrocyte lysis buffer (NH ⁴ Cl 155mM in 10mM Tris / HCl, pH 7.2) for 5 minutes. Cells were spun for 5 minutes at 1500 rpm, resuspended in lysis buffer to remove residual erythrocytes. Cells were washed twice with PBS. Cell suspensions were incubated with 1% normal mouse serum in PBS and stained for CD11b, GR1 and CD71 surface markers (eBioscience, San Diego, CA.) at a concentration of 0.25 jg Ab / 200,000 cells. The cells were subsequently subjected to flow cytometric analysis (FACSCalibur, BD Biosciences, San Diego, CA). FACS data were analyzed with CELLQuest software (BD Biosciences).

Statistic analysis

Data are expressed as mean ± SEM. A bilateral Student's t-test was used to compare individual groups, while multiple groups were compared with a unilateral ANOVA and a subsequent Student-Newman-Keuls multiple comparison test. Non-parametric data were analyzed using a Mann-Whitney U test. A level of P <0.05 was considered significant.

Results

Temporal expression analysis of atherosclerotic lesions in LDLr - / - mice showed a clear regulation by transient increase of CCL3 in initial plates (2 weeks after collar placement). In more advanced stages of injury progression, CCL3 is returning to its original level. This expression is initially accompanied by high expression of the CD68 macrophage marker, of which its levels remain high at later points in time. CD36 expression is somewhat delayed compared to CD68 and CCL3 (Figure 16). Expression profiles suggest that CCL3 may be involved in the critical recruitment of inflammatory cells for atherosclerotic injury sites. In vitro exposure of RAW 264.7 macrophages to ox-LDL leads to a moderate induction of CCL3 expression, while the TLR4 LPS ligand strongly induces MIP1a at the mRNA level (Figure 17).

To assess the effects of hematopoietic CCL3 deficiency on leukocyte migration and activation, in addition to atherogenesis, the present inventors reconstituted LDLr - / - mice with CCL3 - / - bone marrow. CCL3 deficiency did not influence body weight or total cholesterol levels during the course of the experiment (data not shown). Plasma MIP1a levels were not significantly different between CCL3 - / - chimeras and littermate controls (2.4 ± 0.8 pg / ml in WT vs. 0.9 ± 0.6 pg / ml in CCL3 chimeras '/ _; p = 0.1, Figure 17C). The CCL3 deficient phenotype was much more pronounced after in vivo LPS treatment. Levels of circulating MIP1a 24 h after LPS treatment were strongly elevated in WT but not in CCL3 - / - chimeras (14.7 ± 0.4 pg / ml in control compared to 2.1 ± 1.0 pg / ml in CCL3 '/ _ chimeras; p = 0.00005, Figure 18A).

The development of lesions in the aortic root of CCL3 '/ _ chimeras was reduced by a significant 31% (135.1 ± 76.5x103 | jm2 in CCL3' / _ compared to 198.4 ± 51.4x103 jm 2 in controls; P = 0.04, Figure 19A). The percentage of intimal MoMa-2 + macrophages was not different between groups (19.3 ± 2.6% in controls vs. 22.9 ± 3.0% in CCL3 '/ _, Figure 18B), suggesting that CCL3 it alone may not be very critical in macrophage accumulation and proliferation in atherosclerotic plaque. The numbers of CD3 T lymphocytes were not influenced by CCL3 deficiency (2.9 ± 1.2 T lymphocytes / mm2 of plaque in controls and 2.6 ± 1.5 T lymphocytes / mm2 of plaque in CCL3 - / -, Figure 18D). In contrast, the number of plaque neutrophils (7.0 ± 0.7 in WT compared to 2.9 ± 0.8 / mm2 of intimal tissue in CCL3 '/ _ plates; p = 0.001, Figure 18E) In addition to neutrophil adhesion, they were significantly reduced in CCL3 '/ _ plates (Figure 18F). As a measure of the stage of lesion progression, intimal collagen deposition was determined. The percentage of collagen in CCL3 '/ _ plates was not influenced by CCL3 deficiency (7.5 ± 1.4 in WT compared to 5.7 ± 1.0% in CCL3' / _ chimeras, Figure 18C ).

CCL3 deficiency did not influence the total number of circulating white blood cells in WT animals and those transplanted with CCL3 '/ _ (4.4 ± 0.7 in WT versus 3.9 ± 0.6x106 cells / ml in CCL3' / _, Figure 19A) and the number of circulating monocytes was not affected by CCL3 deficiency either (7.7 ± 1.1 in WT vs. 8.9 ± 1.0% in CCL3 '/ _ chimeras, Figure 19B) . Interestingly, the percentage of circulating neutrophils was significantly reduced in CCL3 '/ _ chimeras (35.3 ± 3.9 in WT vs. 23.6 ± 2.5% in CCL3' / _ chimeras; p = 0.02 , Figure 19C).

The reduced numbers of neutrophils may result from a reduced half-life or altered differentiation and exit from the neutrophil stroma. To investigate this, animals were treated with a single injection of cyclophosphamide and neutrophil repopulation clearance / kinetics monitored for 10 days. Basal leukocyte number and cell composition were not different between WT controls and CCL3 '/ _ mice. CCL3 deficient cells were slightly more sensitive to cyclophosphamide treatment (Figure 20A, B), since the half life of leukocytes was significantly enhanced in CCL3 '/ _ mice compared to WT (1.09 ± 0.07 days in WT compared to 0.89 ± 0.06 days in CCL3 '/ _; p = 0.04, Figure 20C) and seemed equally distributed in the subset of neutrophils and lymphocytes (Figure 20C). Thus, CCL3-deficient mice show a reduced neutrophil half-life that coincides with the reduced numbers of circulating and plated neutrophils in this strain. Cell repopulation started 5 days after injection and was similar between CCL3 '/ _ and WT controls (Figure 20D)

Next, the present inventors evaluated the chemotactic response of WT and CCL3 '/ _ neutrophils to a gradient of the major chemokine in neutrophil recruitment, KC. Two hours after ip KC injection, WBC and peritoneal leukocytes were isolated and analyzed for neutrophil content. Circulating neutrophil numbers were similar between WT and CCL3 '/ _ animals (6.1 ± 1.0 in WT compared to 5.3 ± 1.0 in CCL3' / _, Figure 21A). Surprisingly, given the reduced numbers of circulating neutrophils, CCL3 '/ _ animals had slightly enhanced neutrophil numbers in the peritoneum under normal conditions (0.6 ± 0.5% in WT compared to 1.4 ± 0.07, p = 0.2, data not shown). KC injections strongly induced migration of neutrophils into the peritoneum of control animals. Peritoneal neutrophil numbers after KC injections in CCL3 '/ _ animals were only marginally lower compared to WT animals (12.3 ± 0.4 in controls compared to 10.2 ± 1.9 in CCL3 animals '/ _, data not shown). However, induction of neutrophil entry was reduced in CCL3 - / - animals (20x induction in WT compared to 7.5x induction in CCL3 - / -, p = 0.003; Figure 21C), which suggests altered neutrophil chemotaxis CCL3 - / - in conditions of inflammation.

Interestingly, plaque formation was attenuated as a result of the specific absence of CCL3 leukocytes, which may be due to reduced accumulation of neutrophils in the plaque. Together, the data of the present inventors indicate that CCL3 deficiency will result in reduced neutrophil half-life and altered CXCR2-dependent accumulation of neutrophils in the plaque, which will subsequently result in attenuated plaque progression.

Discussion

Chemokine-mediated migration of leukocytes into the vessel wall is an essential stage in the formation and progression of atherosclerotic lesions. 5 CC CCL3 chemokine can interact with CCR4, CCR1, and CCR5 chemokine receptors, of which the latter two participate in atherogenesis. Combined with the upregulated aortic expression during atherogenesis 6, and its potent chemotactic effect on T lymphocytes, macrophages, and TNF-a7 neutrophils, a role for this chemokine in atherogenesis is conceivable. Here, the present inventors show that leukocytes are the main source of CCL3 in inflammatory conditions and that CCL3 leukocyte deficiency attenuates plaque development, altering the half-life of neutrophils and reducing neutrophil accumulation.

In vitro experiments clearly established that activated macrophages are a rich source of CCL3, which is in agreement with previous data. 8 Furthermore, it was observed that initial levels of CCL3 in the circulation were only partially of leukocyte origin, but produced almost exclusively by leukocytes. during the inflammatory response produced by LPS 2, 9 The expression profiles of the development of atherosclerotic lesions revealed that CCL3 is mainly up-regulated during the early progression of lesions, suggesting that CCL3 is involved in plaque inflammation 6 Atherogenesis in CCL3-mice / - It was significantly attenuated, but there were no evident effects on the content of macrophages or T lymphocytes. Interestingly, the hematopoietic and systemic deficiency of one of the CCL3 receptors, CCR1, led to accelerated atherosclerosis 10, 11. Plaques deficient in CCR1 contained more macrophages and T lymphocytes and T lymphocytes CCR1 - / - produced They were more IFNy 10 On the other hand, functional deficiency of CCR5, either in the hematopoietic lineage or systemically, was shown to reduce the development of atherosclerotic lesions, and the plaques contained fewer macrophages and T11 lymphocytes. Use of Met-RANTES similarly attenuated the development of atherosclerosis, macrophage content, and T lymphocyte. In addition, treatment with Met-Rantes produced lower expression levels of CCR5, but not of its ligand CCL313. CCL3 was shown to have an affinity Higher binding by CCR5 1415, suggesting that CCR5-mediated effects are primary during chronic low-rate inflammation, whereas acute substantial inflammation may correct these effects by CCR1 signaling. The phenotypic change observed in hematopoietic CCL3 deficiency appears to be more in line with that of impaired CCR5 function, despite the fact that the present inventors observed no discernible effect on plaque macrophage content. This indicates that although CCL3 could influence the migration of inflammatory cells, it is not crucial in the migration of monocytes or T lymphocytes to the plate.

Neutrophils were not implicated, until recently, in the pathogenesis of atherosclerosis. However, more and more data is accumulating that supports an active role of this subset of white blood cells in this disease. Naruka et al. showed that plaque neutrophil infiltrates were associated with acute coronary events. 16 The experimental support came from van Leeuwen et al., showing the abundant presence of neutrophils in advanced mouse plaques 17, and from a collaborative expansion after CXCR418 blockade. Plaque neutrophils are powerful inflammatory cells that act over a narrow period of time. Neutrophils are associated with elevated intimal apoptosis and a pro-inflammatory phenotype 18 Possibly, the accumulation of neutrophils in atherosclerotic lesions can induce destabilization of plaques as a result of potent inflammation, formation of necrotic nuclei as a consequence of oxidative injury and degradation matrix by release of neutrophil elastases. CCL3 has been reported to be capable of enhancing pro-inflammatory cytokine-induced neutrophil chemotaxis INFRa in a CCR5-dependent manner 7 In coincidence with these findings, the present inventors show attenuated neutrophil migration to and diapedis in plaque deficient Hematopoietic CCL3. In addition, in vivo neutrophil migration to KC (murine IL8 analog) in CCL37 'mice was reduced. This indicates that IL-8, similar to TNFa, can induce CCL3-mediated neutrophil migration.

Another interesting option is that CCL3 affects neutrophil homeostasis. During inflammation, circulating neutrophil numbers were significantly lower in CCL37 'mice, which are in good agreement with the notion that neutrophil apoptosis is considered a protective measure to buffer acute inflammatory responses and prevent unwanted tissue damage 19. Thus, terminally matured neutrophils show a sharply reduced half-life. Furthermore, they have impaired migration and degranulation by 2021. The present inventors observed a clear effect of CCL3 - / - on kinetic elimination of neutrophils, since the half-life of CCL3 deficient neutrophils was reduced. However, neutrophil repopulation was not influenced by CCL3 deficiency, which shows that neutrophil maturation and stromal release are not themselves influenced. These data suggest that CCL37 'neutrophils are more sensitive to cyclophosphamide, and perhaps other signals. pro-apoptotic leading to reduced half-life.

Taken together, the data of the present inventors clearly establish a causal role for neutrophils in the development of atherosclerosis. Furthermore, the present inventors assume that under conditions of inflammatory leukocyte-derived CCL3 they can, possibly in concert with TNFa, alter neutrophil homeostasis and enhance neutrophil chemotaxis to the atherosclerotic plaque to accelerate lesion formation.

Table 8: RT-PCR primer sequences and sources.

Forward primer gene (5'-3 ') reverse primer (5'-3')

CCL3 GCCACATCGAGGGACTCTTC GATGGGGGTTGAGGAACGTG

TO

CD36 GTTCTTCCAGCCAATGCCTT ATGTCTAGCACACCATAAGATGTA

T CAGTT

CD68 CCTCCACCCTCGCCTAGTC TTGGGTATAGGATTCGGATTTGA

HPRT TTGCTCGAGATGTCATGAAG AGCAGGTCAGCAAAGAACTTATAG

GA

CypA CCATTTCAAGAAGCAGCGTT ATTTTGTCTTAACTGGTGGGTCTGT

T

References

1. von der Thusen JH, van Berkel TJ, Biessen EA. Induction of rapid atherogenesis by perivascular carotid collar placement in apolipoprotein E-deficient and low-density lipoprotein receptor-deficient mice. Circulation. Feb 27 2001; 103 (8): 1164-1170.

2. Kasama T, Strieter RM, Standiford TJ, et al. Expression and regulation of human neutrophil-derived macrophage inflammatory protein 1 alpha. J Exp Med. Jul 11993; 178 (1): 63-72.

3. Zuluaga AF, Salazar Be, Rodriguez CA, et al. Neutropenia induced in outbred mice by a simplified low-dose cyclophosphamide regimen: characterization and applicability to diverse experimental models of infectious diseases. BMC Infect Dis. 2006; 6:55.

4. Spellberg BJ, Collins M, French SW, et al. A phagocytic cell line markedly improves survival of infected neutropenic mice. J Leukoc Biol. Aug 2005; 78 (2): 338-344.

5. Charo IF, Taubman MB. Chemokines in the pathogenesis of vascular disease. Circ Res. Oct 29 2004; 95 (9): 858-866.

6. Moos MP, John N, Grabner R, et al. The lamina adventitia is the best site of immune cell accumulation in standard chow-fed apolipoprotein E-deficient mice. Arterioscler Thromb Vasc Biol. Nov 2005; 25 (11): 2386-2391.

7. Montecucco F, Steffens S, Burger F, et al. Tumor necrosis factor-alpha (TNF-alpha) induces integrin CD11b / CD18 (Mac-1) up-regulation and migration to the CC chemokine CCL3 (MIP-1alpha) on human neutrophils through defined signaling pathways. Cell Signal. Mar 2008; 20 (3): 557-568.

8. Fahey TJ, 3rd, Tracey KJ, Tekamp-Olson P, et al. Macrophage inflammatory protein 1 modulates macrophage function. J Immunol. May 11992; 148 (9): 2764-2769.

9. Harrison LM, van den Hoogen C, van Haaften WC, et al. Chemokine expression in the monocytic cell line THP-1 in response to purified shiga toxin 1 and / or lipopolysaccharides. Infect Immun. Jan 2005; 73 (1): 403-412. 10. Potteaux S, Combadiere C, Esposito B, et al. Chemokine receptor CCR1 disruption in bone marrow cells enhances atherosclerotic lesion development and inflammation in mice. Mol Med. Jan-Dec 2005; 11 (1-12): 16-20.

11. Potteaux S, Combadiere C, Esposito B, et al. Role of bone marrow-derived CC-chemokine receptor 5 in the development of atherosclerosis of low-density lipoprotein receptor knockout mice. Arterioscler Thromb Vasc Biol. Aug 2006; 26 (8): 1858-1863.

12. Braunersreuther V, Zernecke A, Arnaud C, et al. Ccr5 but not Ccr1 deficiency reduces development of dietinduced atherosclerosis in mice. Arterioscler Thromb Vasc Biol. Feb 2007; 27 (2): 373-379.

13. Veillard NR, Kwak B, Pelli G, et al. Antagonism of RANTES receptors reduces atherosclerotic plaque formation in mice. Circ Res. Feb 62004; 94 (2): 253-261.

14. Neote K, DiGregorio D, Mak JY, et al. Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor. Cell. Feb 121993; 72 (3): 415-425.

15. Samson M, Labbe O, Mollereau C, et al. Molecular cloning and functional expression of a new human CC-chemokine receptor gene. Biochemistry. Mar 191996; 35 (11): 3362-3367.

16. Naruko T, Ueda M, Haze K, et al. Neutrophil infiltration of culprit lesions in acute coronary syndromes. Circulation. Dec 32002; 106 (23): 2894-2900.

Claims (10)

1. In vitro use of CCL5 and CCL3 chemokine as a biomarker to identify whether or not a test subject is at high risk for a future acute cardiovascular syndrome or event. 2. The use according to claim 1, wherein the cardiovascular syndrome or event may comprise coronary artery disease, atherosclerosis, acute myocardial infarction, arteriosclerosis, unstable angina pectoris, embolism, deep vein thrombosis, stroke, heart failure congestive or arrhythmia. 3. The use according to claim 1 or claim 2 to monitor the status and / or progression of said syndrome or event. 4. The use according to claim 1 or claim 2 to monitor therapeutic regimens and / or clinical trials in order to detect whether or not a particular treatment may be effective in reducing an elevated risk of an acute cardiovascular syndrome or event. The use according to any preceding claim, wherein said biomarkers are detected in a cell taken from a subject or a sample of an individual's body fluid that can be derived from blood, for example, isolated mononuclear cells, or from a fraction of blood, eg plasma or serum, especially plasma. 6. The use according to any preceding claim, wherein the subject is selected from the group consisting of human, non-human primate, equine, bovine, ovine, goat, cleft, avian, feline or canine. 7. The use according to any preceding claim, wherein said one or more chemokines are detected by an immunoassay such as enzyme-associated immunoassays (ELISA); fluorescence-based assays, such as dissociation-enhanced lanthanide fluoroimmunoassay (DELFIA), radiometric assays, multiplex immunoassays, or cytometric bead assays (CBA); sensors. The use according to any preceding claim, wherein said one or more chemokines are detected by measuring the level of expression of the chemokine mRNA. 9. An in vitro procedure for predicting whether or not an individual is at high risk for a future acute cardiovascular syndrome or disorder, a procedure comprising: a) providing a sample of a body fluid previously obtained from an individual; b) determine a level of CCL3 and CCL5 in the sample; c) comparing the level of CCL3 and CCL5 as determined in step b) with a reference level of a sample of a body fluid from a healthy control individual; and d) detecting whether the level of said CCL3 and CCL5 determined in step b) is significantly different from said reference level and, therefore, whether or not an individual is at high risk of an acute cardiovascular syndrome or disorder. 10. The use or method according to any preceding claim, further comprising evaluating clinical symptoms and / or determining the level of at least one other biomarker in the selected subject of CXCL 1 (IP-10), C-reactive protein, troponin 1 , creatine kinase, creatine kinase MB, CD40L, HDL, ESR, number of platelets, sex, a cardiac index, myoglobin and / or interleukin-6, in which the amount of the at least one other biomarker is indicative of cardiovascular disease or a predisposition to the same.