ES2561708B2 - Gonadotrophin inhibitor hormone (GnIH) and its use to control puberty, reproduction, intake and growth in fish - Google Patents
Gonadotrophin inhibitor hormone (GnIH) and its use to control puberty, reproduction, intake and growth in fish Download PDFInfo
- Publication number
- ES2561708B2 ES2561708B2 ES201400644A ES201400644A ES2561708B2 ES 2561708 B2 ES2561708 B2 ES 2561708B2 ES 201400644 A ES201400644 A ES 201400644A ES 201400644 A ES201400644 A ES 201400644A ES 2561708 B2 ES2561708 B2 ES 2561708B2
- Authority
- ES
- Spain
- Prior art keywords
- administration
- fish
- sequence
- peptide
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/08—Peptides having 5 to 11 amino acids
- A61K38/09—Luteinising hormone-releasing hormone [LHRH], i.e. Gonadotropin-releasing hormone [GnRH]; Related peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/23—Luteinising hormone-releasing hormone [LHRH]; Related peptides
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Endocrinology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Reproductive Health (AREA)
- Gastroenterology & Hepatology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Peptides Or Proteins (AREA)
Abstract
La hormona inhibidora de gonadotrofinas (GnIH) y su uso para controlar la pubertad, la reproducción, la ingesta y el crecimiento en peces.#La lubina, Dicentrarchus labrax, es una de las especies más cultivadas en la UE. Un problema en su cultivo es el adelanto de la pubertad, que conlleva crecimientos pobres y deterioro en la calidad de la carne. La presente invención se enmarca en el sector de Biotecnología (sector de aplicación de Acuicultura). La invención relata la estrategia de clonación de la hormona inhibidora de las gonadotrofinas (GnIH) de la lubina, que contiene dos nuevos péptidos de la familia RFamida. Estos péptidos han sido sintetizados y utilizados para generar anticuerpos específicos y han demostrado tener efectos inhibidores sobre diferentes factores neuroendocrinos y endocrinos que controlan la reproducción de la lubina. Esta invención puede resultar de interés para controlar la pubertad, la reproducción, la ingesta y el crecimiento de peces.Gonadotrophin inhibitor hormone (GnIH) and its use to control puberty, reproduction, intake and growth in fish. # Sea bass, Dicentrarchus labrax, is one of the most cultivated species in the EU. A problem in its cultivation is the advancement of puberty, which leads to poor growth and deterioration in meat quality. The present invention is part of the Biotechnology sector (Aquaculture application sector). The invention relates to the cloning strategy of gonadotrophin inhibitor hormone (GnIH) from sea bass, which contains two new peptides of the RFamide family. These peptides have been synthesized and used to generate specific antibodies and have been shown to have inhibitory effects on different neuroendocrine and endocrine factors that control the reproduction of sea bass. This invention may be of interest to control puberty, reproduction, intake and growth of fish.
Description
- LA HORMONA INHIBIDORA DE GONADOTROFINAS (GNIH) y SU USO PARA CONTROLAR LA PUBERTAD, LA REPRODUCCIÓN, LA INGESTA y EL CRECIMIENTO EN PECES. THE GONADOTROFIN HORMONE INHIBITOR (GNIH) AND ITS USE TO CONTROL PUBERTY, REPRODUCTION, INGESTION AND GROWTH IN FISH.
- 5 5
- SECTOR DE LA TÉCNICA SECTOR OF THE TECHNIQUE
- Según el área de la técnica esta invención se encuadra en el sector de la Biotecnología. Según el sector de aplicación, la invención tiene un interés para el sector de la Acuicultura, principalmente para la mejora y optimización de los cultivos de lubina y especies próximas (peces percomorfos). According to the area of the technique, this invention falls within the Biotechnology sector. According to the application sector, the invention has an interest for the Aquaculture sector, mainly for the improvement and optimization of sea bass crops and nearby species (percomorphic fish).
- 10 10
- ESTADO DE LA TÉCNICA STATE OF THE TECHNIQUE
- lS lS
- En vertebrados, el área preóptica y el hipotálamo representan las principales áreas neuroendocrinas que controlan la reproducción a través de su conexión con la hipófisis y la modulación de la secreción de gonadotrofinas. Los peces teleósteos, a diferencia de los tetrápodos, carecen de eminencia media y de un sistema que ponga en contacto vascular el hipotálamo con la hipófisis, por lo que las poblaciones celulares implicadas en el control neuroendocrino de la reproducción inervan de forma más o menos directa a las células del lóbulo anterior In vertebrates, the preoptic area and the hypothalamus represent the main neuroendocrine areas that control reproduction through its connection with the pituitary gland and the modulation of gonadotrophin secretion. Teleost fish, unlike tetrapods, lack medium eminence and a system that puts the hypothalamus into vascular contact with the pituitary gland, so that cell populations involved in neuroendocrine control of reproduction innervate more or less directly to the cells of the anterior lobe
- 20 25 20 25
- adenohipofisario. Esta inervación directa de la hipófisis de peces teleósteos ha permitido caracterizar que neurohormonas o factores hipotalámicos pueden estar implicados en el control de la secreción de las hormonas adenohipofisarias. La presencia de fibras nerviosas de las células que producen la hormona liberadora de las gonadotrofinas (GnRH) en el entorno próximo de las células gonadotropas, constituyó una evidencia clara de la acción de estas neurohormonas sobre el ciclo reproductivo de peces (Kah et aL, 1987; 1989; 1992). Estas neurohormonas modulan la actividad de la hipófisis y desencadenan una serie de cascadas endocrinas que conducen a la reproducción (Kah et aL, 1993j Trudeau, 1997, Zohar et aL, 2010). La GnRH constituye el principal factor inductor del proceso reproductivo en todos los vertebrados, a través de la estimulación de la síntesis y adenohypophysary. This direct innervation of the pituitary gland of teleost fish has allowed us to characterize that neurohormones or hypothalamic factors may be involved in the control of adenohypophyseal hormone secretion. The presence of nerve fibers of the cells that produce gonadotropin-releasing hormone (GnRH) in the immediate environment of gonadotropic cells, was clear evidence of the action of these neurohormones on the fish reproductive cycle (Kah et aL, 1987 ; 1989; 1992). These neurohormones modulate the activity of the pituitary gland and trigger a series of endocrine cascades that lead to reproduction (Kah et aL, 1993j Trudeau, 1997, Zohar et aL, 2010). GnRH is the main inducing factor of the reproductive process in all vertebrates, through the stimulation of synthesis and
secreción de gonadotrofinas (GTHs), siendo su antagonista funcional en peces la dopamina, que inhibe la secreción estas hormonas adenohipotisarias que controlan la reproducción (GTHs), como se demostró en el carpín dorado (Peter y Paulencu, 1980; Chang y Peter, 1983; Chang el al., 1983). La existencia de una inhibición dopaminérgica sobre la secreción de gonadotrofinas ha sido demostrada en otras especies de peces teleósteos, taJes como la anguila, el pez gato, la trucha, la liJapia, el salmón coho, la carpa o el mujol (Van Asselt et al., 1988; Levavi-Sivan el aL, 2003; Vidat et aL, 2004; Dufour el al., 2005; Aizen el aL, 2005). Estos conocimientos pennitieron utilizar la GnRH y desarrollar compuestos agonistas y antagonistas de la GnRH y/o la dopa mina (pimozide, domperidona), así como métodos de combinación y administración de los mismos para controlar el proceso reproductivo de peces en la práctica acuícola, como se refleja en las patentes US5288705A, EP0368000B 1, US5643877 A, WO 19960 17619A9, US6210927BI , US7958848B2, entre otras. Sin embargo, la dopamina no parece operar en otros peces teleósteos, en particular en peces marinos como la lubina y otros percifonnes (Copeland and Thomas, 1989; King et al., 1994; Holland et aL, 1998b; Zohar and Mylonas, 2001 ; Prat et al., 2001). Gonadotrophin secretion (GTHs), with its functional antagonist in fish being dopamine, which inhibits the secretion of these adenohypo-thymic hormones that control reproduction (GTHs), as demonstrated in the golden carpine (Peter and Paulencu, 1980; Chang and Peter, 1983 ; Chang al., 1983). The existence of a dopaminergic inhibition on gonadotropin secretion has been demonstrated in other species of teleost fish, such as eel, catfish, trout, liJapia, coho salmon, carp or mujol (Van Asselt et al ., 1988; Levavi-Sivan el aL, 2003; Vidat et aL, 2004; Dufour el al., 2005; Aizen el aL, 2005). This knowledge meant to use GnRH and develop agonist and antagonistic compounds of GnRH and / or the dopa mine (pimozide, domperidone), as well as methods of combination and administration thereof to control the reproductive process of fish in aquaculture practice, such as It is reflected in patents US5288705A, EP0368000B 1, US5643877 A, WO 19960 17619A9, US6210927BI, US7958848B2, among others. However, dopamine does not appear to operate in other teleost fish, particularly marine fish such as sea bass and other percifonnes (Copeland and Thomas, 1989; King et al., 1994; Holland et aL, 1998b; Zohar and Mylonas, 2001; Prat et al., 2001).
La Honnona lnhibidora de las Gonadotrofinas (GnIH) Gonadotropin-inhibiting Honnone (GnIH)
En el año 2000 se identificó en aves un pequefio péptido hipotalámico de 12 aminoácidos que actuaba directamente sobre la hipófisis inhibiendo la síntesis y liberación de gonadotrofinas (Tsutsui et al., 2000; Tsutsui et al., 2007), por lo que fue denominado honnona inhibidora de las gonadotrofinas o GnIH. In 2000, a small hypothalamic peptide of 12 amino acids was identified in birds that acted directly on the pituitary gland by inhibiting the synthesis and release of gonadotrophins (Tsutsui et al., 2000; Tsutsui et al., 2007), so it was called honnone Gonadotropin inhibitor or GnIH.
El precursor de la proteína que codifica el gen GnIH origina 2 o 3 posibles péptidos maduros, dependiendo de la especie, caracterizados por un extremo Cterminal que contiene la secuencia de aminoácidos LPQRFamida, que puede variar en uno o dos aminoácidos dependiendo de la especie estudiada. De los posibles péptidos que se encuentran codificados por el gen GnIH, solo aquellos que tienen un papel de inhibición de la secreción de las gonadotrofinas son denominados como GnlH. The precursor of the protein encoding the GnIH gene originates 2 or 3 possible mature peptides, depending on the species, characterized by a Cterminal end that contains the amino acid sequence LPQRFamide, which can vary by one or two amino acids depending on the species studied. Of the possible peptides that are encoded by the GnIH gene, only those that have a role of inhibiting gonadotrophin secretion are referred to as GnlH.
La familia de la GolH incluye diferentes péptidos, que dependiendo del grupo filogenético, han recibido distintos nombres. Así, en mamíferos están caracterizados los péptidos RFRP-l, RFRP-2 Y RFRP-3; en aves se ha descrito un péptido GnIH, y dos péptidos relacionados con la GnIH denominados GnIHRP-l Y GnIHRP-2; en ranas se ha denominado al péptido GnIH como fGRP, y a los péptidos relacionados codificados por este precursor como fGRP-RP-I, tGRP-RP2; en peces teleósteos, tales como el pez cebra o el carpín dorado, se han descrito tres posibles péptidos GnIH, denominados LPXRFa-l, LPXRFa-2 y LPXRFa-3, pudiendo ser la X=L o Q (Parhar el al., 2012). The GolH family includes different peptides, which, depending on the phylogenetic group, have received different names. Thus, in mammals the RFRP-1, RFRP-2 and RFRP-3 peptides are characterized; in birds, a GnIH peptide has been described, and two GnIH-related peptides called GnIHRP-1 and GnIHRP-2; in frogs the GnIH peptide has been designated as fGRP, and related peptides encoded by this precursor as fGRP-RP-I, tGRP-RP2; In teleost fish, such as zebrafish or goldfish, three possible GnIH peptides, called LPXRFa-l, LPXRFa-2 and LPXRFa-3, may be described as X = L or Q (Parhar el al., 2012 ).
La identificación y localización cerebral de este neuropéptido, mediante técnicas ELISA, técnicas inmunohistoquimicas, técnicas de hibridación in situ (Tsutsui et al., 2000; Tsutsui y Ukena, 2006; Tsutsui et al., 2007), así como la distribución de las fibras en zonas donde se ubican las células liberadoras de gonadotrofinas, sugieren que la GnIH tiene un efecto modulador de la síntesis y liberación de la propia GnRH además de ejercer sus efector inhibidores directos sobre la secreción de gonadotrofinas (hormona luteinizante (LH) y hormona estimulante del foliculo (FSH)) como se ha demostrado en vertebrados tales como aves y mamíferos. Además de lo mencionado anteriormente, la Gnlli también impide el desarrollo gonadal, la síntesis de esteroides y la actividad espennatogénica en aves, lo que sugiere que este neuropéptido puede actuar a distintos niveles del eje reproductivo (Tsutsui et al., 2007; Bentley et al., 2009). The identification and cerebral location of this neuropeptide, through ELISA techniques, immunohistochemical techniques, in situ hybridization techniques (Tsutsui et al., 2000; Tsutsui and Ukena, 2006; Tsutsui et al., 2007), as well as the distribution of the fibers In areas where gonadotrophin-releasing cells are located, they suggest that GnIH has a modulating effect on the synthesis and release of GnRH itself, in addition to exerting its direct inhibitor effector on the secretion of gonadotrophins (luteinizing hormone (LH) and hormone stimulating follicle (FSH)) as demonstrated in vertebrates such as birds and mammals. In addition to the aforementioned, Gnlli also prevents gonadal development, steroid synthesis and spermatogenic activity in birds, suggesting that this neuropeptide can act at different levels of the reproductive axis (Tsutsui et al., 2007; Bentley et al ., 2009).
La presencia de células GnIH en el hipotálamo posterior parece ser una característica conservada a lo largo de la evolución de vertebrados (Tsutsui et al., 2007). Así, recientemente se ha puesto también de manifiesto la presencia de un péptido similar de tipo LPXRF-amida en peces (Sawada et al., 2002; Osugi et al., 2006; Tsutsui et al., 2007). La localización del péptido del tipo LPXRF-amida (homologo a la GnIH de aves y mamíferos) en peces, incluida la lubina europea, ha permitido caracterizar la presencia del mismo en células de áreas cerebrales tales como el bulbo olfativo/nervio terminal, y en el área preóptica, zonas donde se encuentran ubicadas las células de tipo GnRH-I1I y GnRH-I, respectivamente The presence of GnIH cells in the posterior hypothalamus seems to be a conserved characteristic throughout vertebrate evolution (Tsutsui et al., 2007). Thus, the presence of a similar peptide of the LPXRF-amide type in fish has recently been revealed (Sawada et al., 2002; Osugi et al., 2006; Tsutsui et al., 2007). The location of the peptide of the LPXRF-amide type (homologous to the GnIH of birds and mammals) in fish, including European sea bass, has allowed characterizing its presence in cells of brain areas such as the olfactory bulb / terminal nerve, and in the preoptic area, areas where GnRH-I1I and GnRH-I type cells are located, respectively
(González-Martínez el al., 2001, 2002). También se han localizado células GnIH en la región del tegmento mesencefálico, donde se encuentran las células de tipo GnRH-II (González-Martínez el al., 2001, 2002). La presencia de inervación GnIH en áreas neuroendocrinas relacionadas con la reproducción como el área preóptica y el hipotálamo, la inervación GnIH presente en la hipófisis y la expresión de GnIH en las gónadas de la lubina, hace pensar que la GnlH también puede estar ejerciendo efectos inhibidores a distintos niveles del eje reproductivo en peces percifonnes y, mas concretamente, en la lubina europea, donde se ha centrado nuestro estudio. (González-Martínez on al., 2001, 2002). GnIH cells have also been located in the region of the mesencephalic tegment, where GnRH-II type cells are found (González-Martínez el al., 2001, 2002). The presence of GnIH innervation in neuroendocrine areas related to reproduction such as the preoptic area and the hypothalamus, the GnIH innervation present in the pituitary gland and GnIH expression in sea bass gonads, suggests that GnlH may also be exerting inhibitory effects. at different levels of the reproductive axis in percifonnes fish and, more specifically, in European sea bass, where our study has focused.
La relación entre la función reproductiva y el balance energético esta bien establecida y, como regla general, aquellos péptidos que estimulan la ingesta suprimen la función reproductiva y viceversa. Estudios recientes han demostrado que además de sus funciones reproductivas, la GnIH puede también tener un efecto estimulador en la ingesta de alimentos. Este efecto estimulador ha sido obsetvado en diferentes especies de pájaros (Tachaibana et al., 2005, 2008) Y roedores (Johnson et al., 2007; Johnson y Fraley, 2008, Murakami et al., 2008). Sin embargo, el tratamiento con GnIH humana en gallos tiene un efecto inhibidor de la ingesta (eline et aL, 2008), lo que sugiere la importancia especie-especifica de la secuencia de aminoácidos de la GnIH para su efecto fisiológico. El hallazgo dc proycccioncs GnIH en el ccrcbro dc ovcja cn el entorno de las células secretoras de neuropéptido Y (NPY) Y de las propio mela cortinas (POMC), concuerda con el efecto descrito de la GnIH sobre la ingesta de alimento y sugiere que estas interacciones pueden mediar en estos efectos (Qi et al., 2009). Por todo lo dicho anteriormente, la GnIH parece ser un neuropéptido multifuncional, que controla el balance que existe entre reproducción, ingesta y crecimiento. The relationship between reproductive function and energy balance is well established and, as a general rule, those peptides that stimulate intake suppress reproductive function and vice versa. Recent studies have shown that in addition to its reproductive functions, GnIH can also have a stimulating effect on food intake. This stimulating effect has been observed in different bird species (Tachaibana et al., 2005, 2008) and rodents (Johnson et al., 2007; Johnson and Fraley, 2008, Murakami et al., 2008). However, treatment with human GnIH in roosters has an inhibitory effect on intake (eline et aL, 2008), which suggests the species-specific importance of the amino acid sequence of GnIH for its physiological effect. The finding of GnIH projections in the ccrcbro dc ovcja cn the environment of the neuropeptide secreting cells Y (NPY) and the curtain melas themselves (POMC), agrees with the described effect of GnIH on food intake and suggests that these Interactions can mediate these effects (Qi et al., 2009). For all the above, GnIH seems to be a multifunctional neuropeptide, which controls the balance between reproduction, intake and growth.
Problemática planteada. Issue raised.
La producción de mundial de alimentos deberá crecer un 70% entre 2010 y 2050. En relación a los alimentos de origen acuáticos, más de la mitad del total consumido hoy en el mundo procede de granjas de acuicultura. En 2030 se estima World food production should grow 70% between 2010 and 2050. In relation to food of aquatic origin, more than half of the total consumed today in the world comes from aquaculture farms. In 2030 it is estimated
- que esta producción rondara el 65%. Así, la producción de pescado de acuicultura That this production is around 65%. Thus, aquaculture fish production
- en la Unión Europea en 2011 fue 647.156 Toneladas, siendo Espafia el Estado in the European Union in 2011 it was 647,156 Tons, with Spain being the State
- miembro de la VE con mayor volumen de producción en acuicultura con 271.963 member of the VE with the highest production volume in aquaculture with 271,963
- t. en 2011, un 7,8% más que en 2010 (frente al 2,3% de incremento de la pesca) y t. in 2011, 7.8% more than in 2010 (compared to 2.3% increase in fishing) and
- 5 5
- con un valor económico de 457 millones de euros, un 9,7% más que en 2010 with an economic value of 457 million euros, 9.7% more than in 2010
- (Informe APROMAR 2013). (APROMAR 2013 Report).
- La lubina, Dicentrarchus lahrax, es junto a la dorada, una de las especies que The sea bass, Dicentrarchus lahrax, is next to the sea bream, one of the species that
- sostienen la producción de la acuicultura marina en Andalucía, en España y en sustain the production of marine aquaculture in Andalusia, in Spain and in
- Europa. Entre las principales especies acuícolas de la Unión Europea, la lubina se Europe. Among the main aquaculture species of the European Union, sea bass is
- 10 10
- situó en el 60 lugar en cuanto a producción (73.196 Tn), yen So lugar en cuanto a ranked 60th in terms of production (73,196 tons), and so in terms of
- valor económico (casi 400 millones de euros). En la Comunidad de Andalucía la economic value (almost 400 million euros). In the Community of Andalusia the
- lubina acumuló en 2012 el 66% de la producción de peces, con 4.150 Toneladas y sea bass accumulated in 2012 66% of fish production, with 4,150 Tons and
- un valor de 29,4 millones de euros. a value of 29.4 million euros.
- No obstante, aunque el cultivo de lubina está en la actualidad ampliamente However, although the cultivation of sea bass is currently widely
- lS lS
- distribuido, la reproducción controlada de esta especie y su producción son distributed, the controlled reproduction of this species and its production are
- manifiestamente mejorables. En el caso de la lubina, uno de los principales manifestly improvable. In the case of sea bass, one of the main
- problemas que se presentan es el adelanto de la pubertad y de la primera problems that arise is the advancement of puberty and the first
- reproducción en condiciones de cultivo, en particular en machos. Este aspecto reproduction under growing conditions, particularly in males. This aspect
- debe ser tenido muy en cuenta por su implicación práctica en la productividad de It must be taken into account for its practical involvement in the productivity of
- 20 twenty
- las piscifactorfas (Carrillo et aL, 1993; 1995; 2009). Un desarrollo gonadal precoz fish farms (Carrillo et aL, 1993; 1995; 2009). An early gonadal development
- conlleva crecimientos pobres y un deterioro de la calidad de la carne, como se ha it leads to poor growth and deterioration of meat quality, as has been
- puesto de manifiesto en salmónidos, carpas, lubina y bacalao, por lo que en estas revealed in salmonids, carp, sea bass and cod, so in these
- especies es conveni ente suprimir o retrasar la pubertad para permitir un mayor species it is convenient to suppress or delay puberty to allow greater
- crecimiento somático adecuado del animal. adequate somatic growth of the animal.
- 2S 2S
- Además, hay que tener en cuenta que la temperatura representa un factor limitante Also, keep in mind that temperature represents a limiting factor.
- en la reproducción de esta especie. Las ovulaciones y las puestas en hembras sólo in the reproduction of this species. Ovulations and laying in females only
- se producen de forma espontánea cuando el rango de temperatura es 9-17°C, y por they occur spontaneously when the temperature range is 9-17 ° C, and by
- encima de 16-17°C la puesta se bloquea a pesar de que las hembras han alcanzado above 16-17 ° C the setting is blocked even though the females have reached
- la maduración (Carrillo et al., 2009). Ello implica en muchos casos la necesidad maturation (Carrillo et al., 2009). This implies in many cases the need
- 30 30
- de enfriar el agua en las instalaciones acuícolas, con el consiguiente coste of cooling water in aquaculture facilities, with the consequent cost
económico. Sin embargo, los mecanismos mediante los cuales las temperaturas elevadas inhiben el proceso reproductivo están aún sin esclarecer. economic. However, the mechanisms by which elevated temperatures inhibit the reproductive process are still unclear.
Por ello, la presente invención se centra en la clonación y caracterización del precursor de la hormona inhibidora de gonadotrofinas o GnIH. síntesis de los S péptidos maduros sbGnIH-1 y sbGnlH-2, generación de anticuerpos específicos contra los péptidos sbGnIH-l y sbGnIH-2, su uso para identificar las células GnIH y sus proyecciones, así como en la determinación de los efectos de la GnlH en la lubina europea Dicentrarchus Jabrax. Estas herramientas generadas pueden ser de gran utilidad para solventar estos problemas de pubertad precoz en la lubina Therefore, the present invention focuses on the cloning and characterization of the precursor of gonadotrophin inhibitor hormone or GnIH. synthesis of the mature SbGnIH-1 and sbGnlH-2 peptides, generation of specific antibodies against the sbGnIH-l and sbGnIH-2 peptides, their use to identify GnIH cells and their projections, as well as in determining the effects of GnlH in European sea bass Dicentrarchus Jabrax. These generated tools can be very useful to solve these problems of precocious puberty in sea bass
10 y dilucidar los mecanismos mediante los cuales se inhibe la reproducción en la lubina, proporcionando la posibilidad de generar antagonistas funcionales de la GnIH que sean usados para favorecer la reproducción de esta especie. 10 and to elucidate the mechanisms by which reproduction in sea bass is inhibited, providing the possibility of generating functional GnIH antagonists that are used to favor the reproduction of this species.
Referencias bibliográficas empleadas Bibliographic references used
1. Aizen, J., L Meiri, L Tzchori, B. Lcvavi-Sivan, H. Roscnfcld, 2005. Enhancing spawning in the grey mullet (Mugil ccphalus) by removal of dopamincrgic inhibition. Gen Comp Endocrinol 142:212-221. 1. Aizen, J., L Meiri, L Tzchori, B. Lcvavi-Sivan, H. Roscnfcld, 2005. Enhancing spawning in the gray mullet (Mugil ccphalus) by removal of dopamincrgic inhibition. Gene Comp Endocrinol 142: 212-221.
5 2. APROMAR. 2013. La Acuicultura Marina de Peces en España 2013. Fondo 5 2. APPROVE. 2013. Marine Fish Aquaculture in Spain 2013. Fund
Europeo de la Pesca (Unión Europea), Ministerio de Medio Ambiente y Medio Rural y Marino European Fisheries (European Union), Ministry of Environment and Rural and Marine Affairs
3. Bcntlcy GE, Ubuka T, McGuirc NL, Calisi R, Perfito N, Kriegsfeld LJ, 3. Bcntlcy GE, Ubuka T, McGuirc NL, Calisi R, Perfito N, Kriegsfeld LJ,
Wingficld le, Tsutsui K. 2009. Gonadotrophin-inhibitory honnonc: a 10 multifunctional neuropcptidc. J Ncurocndocrinol. 21: 276-281. Wingficld le, Tsutsui K. 2009. Gonadotrophin-inhibitory honnonc: a 10 multifunctional neuropcptidc. J Ncurocndocrinol. 21: 276-281.
4. Carrillo, M., S. Zanuy, F. Prat. R. Serrano, N. R. Bromagc. 1993. 4. Carrillo, M., S. Zanuy, F. Prat. R. Serrano, N. R. Bromagc. 1993
Environrncntal induction of spawning in sea bass, pp. 43-54 in Recent advanccs in Aquaculturc, vol 4, cditcd by R. 1. Robcrts and 1. Muir. Blackwell Scicntific publications, London. Environrncntal induction of spawning in sea bass, pp. 43-54 in Recent advanccs in Aquaculturc, vol 4, cditcd by R. 1. Robcrts and 1. Muir. Blackwell Scicntific publications, London.
15 5. Carrillo, M., S. Zanuy, F. Prat,1. Ccrdá, J. Ramos, E. Mañanós, N. Bromage. 1995. Sea bass, pp. 138-168 in Broodstock management and egg and larval quality. edited by N. R Bromage and R. J. Roberts. Blackwell, Oxford, U.K. 15 5. Carrillo, M., S. Zanuy, F. Prat, 1. Ccrdá, J. Ramos, E. Mañanós, N. Bromage. 1995. Sea bass, pp. 138-168 in Broodstock management and egg and larval quality. edited by N. R Bromage and R. J. Roberts. Blackwell, Oxford, U.K.
6. Carrillo M., Zanuy S., Bayarri M.J. 2009. El control ambiental de la reproduccion de los peces con especial referencia al control del cielo sexual, 20 de la pubertad y de la precocidad. Capítulo 3. En "La Reproducción de los peces: aspectos básicos y sus aplicaciones en acuicultura". Manuel Adrian Carrillo Estévez (Coordinador), Juan Espinosa de los Monteros (Editor científico). Serie: Publicaciones Científicas y Tecnológicas de la Fundación Observatorio Español de Acuicultura. Fundación Observatorio Español de 6. Carrillo M., Zanuy S., Bayarri M.J. 2009. The environmental control of fish reproduction with special reference to the control of the sexual sky, 20 of puberty and precocity. Chapter 3. In "The Reproduction of fish: basic aspects and their applications in aquaculture". Manuel Adrian Carrillo Estévez (Coordinator), Juan Espinosa de los Monteros (Scientific Editor). Series: Scientific and Technological Publications of the Spanish Aquaculture Observatory Foundation. Spanish Observatory Foundation of
2S Acuicultura, Consejo Superior de Investigaciones Científicas y Ministerio de Medio Ambiente y Medio Rural Marino. Madrid. ISBN: 978-6-1. pp: 173-246. 2S Aquaculture, Higher Council for Scientific Research and Ministry of Environment and Marine Rural Environment. Madrid. ISBN: 978-6-1. pp: 173-246.
7. Chang, l E, Peter, RE. 1983. EtTccts ofpimozide and Des GlylO, (D Ala6) luteinizing honnone-releasing honnone ethyalmide on scrum gonadotropin 7. Chang, l E, Peter, RE. 1983. EtTccts ofpimozide and Des GlylO, (D Ala6) luteinizing honnone-releasing honnone ethyalmide on scrum gonadotropin
- concentration, genninal vesicle migration, and ovulation in femate goldfish, Carassius auratus. Gen Comp Endocnnol. 52: 30-37 concentration, genninal vesicle migration, and ovulation in femate goldfish, Carassius auratus. Gen Comp Endocnnol. 52: 30-37
- S S
- 8. Chang, lP, Cook, RE, Peter, RE. 1983. lnfluence of catecholamines on gonadotropin secretion in goldfish, Carassius auratus. Gen Comp Endocrino!. 49: 22-31 8. Chang, lP, Cook, RE, Peter, RE. 1983. lnfluence of catecholamines on gonadotropin secretion in goldfish, Carassius auratus. Endocrine Gene Comp! 49: 22-31
- 9. eliDe, M .A., Bowden, CN., Calchary, W.A., Layne, l .E., 2008. Short-term anorexigenic effects of central neuropeptide VF are associated with hypothalamic changes in chicks. Joumal of Neuroendocrinology 20, 971-977. 9. eliDe, M .A., Bowden, CN., Calchary, W.A., Layne, l .E., 2008. Short-term anorexigenic effects of central neuropeptide VF are associated with hypothalamic changes in chicks. Joumal of Neuroendocrinology 20, 971-977.
- 10 10
- 10. Copeland, P.A., Thomas, P. 1989. Control of gonadotropin release in the Atlantic croaker Micropogonias undulatus: evidence for lack of dopaminergic inhibition. Gen. Comp. Endocrino!. 74,474-483. 10. Copeland, P.A., Thomas, P. 1989. Control of gonadotropin release in the Atlantic croaker Micropogonias undulatus: evidence for lack of dopaminergic inhibition. Gen. Comp. Endocrine!. 74,474-483.
- 15 fifteen
- 11 . Dufour, S., F.-A. Weltzien, M.-E. Sebert, N. Le Belle, B. Vidal, P. Vernier, C. Pasqualini. 2005. Dopaminergic inhibition of reproduction in teteost fi shes: ecophysiological and evolutionary implications. Ann NY Acad Sci 1040:9-22. eleven . Dufour, S., F.-A. Weltzien, M.-E. Sebert, N. Le Belle, B. Vidal, P. Vernier, C. Pasqualini. 2005. Dopaminergic inhibition of reproduction in teteost fi shes: ecophysiological and evolutionary implications. Ann NY Acad Sci 1040: 9-22.
- 20 twenty
- 12. GonzáJez-Martínez, D., Madigou, T., Zmora, N., Anglade, l., Zanuy, S., Zohar, v., Elizur, A., Mufioz-Cueto, l.A. y Kah, O. 2001. Differential expression of three different prepro-GnRH (Gonadotrophin-releasing honnone) messengers in the braio of the European sea bass (Dicentrarchus labrax). J. Comp. Neurol. 429:144-155. 12. GonzáJez-Martínez, D., Madigou, T., Zmora, N., Anglade, l., Zanuy, S., Zohar, v., Elizur, A., Mufioz-Cueto, l.A. and Kah, O. 2001. Differential expression of three different prepro-GnRH (Gonadotrophin-releasing honnone) messengers in the braio of the European sea bass (Dicentrarchus labrax). J. Comp. Neurol 429: 144-155.
- 25 25
- 13. González-Martínez D., Zmora N., Mañanos E., Saligaut D., Zanuy S., Zohar Y., Elizur A , Kah O . and Muñoz-Cueto 1. A. 2002. Immunohistochemical Jocalization of three different prepro-GnRHs (Gonadotrophin-reJeasing honnones) in the braio and pituitary ofthe European sea bass (Dicentrarchus labrax) using antibodies to the corresponding GnRH-associated peptides. J. Comp. Neurol. 446: 95-113. 13. González-Martínez D., Zmora N., Mañanos E., Saligaut D., Zanuy S., Zohar Y., Elizur A, Kah O. and Muñoz-Cueto 1. A. 2002. Immunohistochemical Jocalization of three different prepro-GnRHs (Gonadotrophin-reJeasing honnones) in the braio and pituitary of the European sea bass (Dicentrarchus labrax) using antibodies to the corresponding GnRH-associated peptides. J. Comp. Neurol 446: 95-113.
- 14. Holland, M.CH., y. Gathilf, 1. Meiri, lA. King, K. Okuzawa, A. Elizur, Y. Zohar. 1 998a. Levels of the native farms of GnRH in the pituitary of the 14. Holland, M.CH., and. Gathilf, 1. Meiri, lA. King, K. Okuzawa, A. Elizur, Y. Zohar. 1 998a. Levels of the native farms of GnRH in the pituitary of the
- gilthead seabream, Sparus aurata, al several characteristic stages gonadal cycle. Gen Comp Endocrino! 112: 394-405. Gilthead Seabream, Sparus aurata, at the several characteristic stages gonadal cycle. Endocrine Gene Comp! 112: 394-405.
- of the of the
- S S
- 15. Holland, M.C., S. Hassin, Y. Zohar, 1998b. EfTects oflong-tenn testosterone, gonadotropin-releasing honnone agonist, and pimozide treatments on gonadotropin II levels and ovarian development in juvenile female striped bass (Morone saxatilis). Biol Reprod 59:1153-1162. 15. Holland, M.C., S. Hassin, Y. Zohar, 1998b. EfTects oflong-tenn testosterone, gonadotropin-releasing honnone agonist, and pimozide treatments on gonadotropin II levels and ovarian development in juvenile female striped bass (Morone saxatilis). Biol Reprod 59: 1153-1162.
- 16. lohoson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide3 stimu-lates GH secretion inhibits LH secretion, and has variable effects 00 sex behavior in the adult maJe rat. Honnones and Behavior 5 J, 171-180. 16. lohoson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide3 stimu-lates GH secretion inhibits LH secretion, and has variable effects 00 sex behavior in the adult maJe rat. Honnones and Behavior 5 J, 171-180.
- 10 10
- 17. lohnson, M.A., Fraley, G.S., 2008. Rat RFRP-3 alters hypothalamic GHRH express-ion and growth honnone secretion but does not afTect KiSS-1 gene expression or the onset of puberty in male rats. Neuroendocrinology 88, 305315. 17. lohnson, M.A., Fraley, G.S., 2008. Rat RFRP-3 alters hypothalamic GHRH express-ion and growth honnone secretion but does not afTect KiSS-1 gene expression or the onset of puberty in male rats. Neuroendocrinology 88, 305315.
- lS lS
- 18. Kah, O., J.G. Dulka, P. Dubourg, J. Thibault, R.E. Peter. 1987. Neuroanatomical substrate for the inhibition of gonadotropin secretion in goldfish: existence of a dopaminergic preoptico-hypophyseal pathway. Neuroendocrinology 45:451-458. 18. Kah, O., J.G. Dulka, P. Dubourg, J. Thibault, R.E. Peter 1987. Neuroanatomical substrate for the inhibition of gonadotropin secretion in goldfish: existence of a dopaminergic preoptico-hypophyseal pathway. Neuroendocrinology 45: 451-458.
- 20 twenty
- 19. Kah, O., 1M. Danger, P. Dubourg, G. Pelletier, H. Vaudry, A. Calas. 1989. Characterization, cerebral distribution and gonadotropin-release activity of neuropeptide Y (NPY) in the goldfish. Fish Physiol Biochem 7: 69-76. 19. Kah, O., 1M. Danger, P. Dubourg, G. Pelletier, H. Vaudry, A. Calas. 1989. Characterization, cerebral distribution and gonadotropin-release activity of neuropeptide Y (NPY) in the goldfish. Fish Physiol Biochem 7: 69-76.
- 20. Kah, O., V.L. Trudeau, B.D. Sloley, P. Dubourg, J.P. Chang, K.L. Yu, R.E. Peter. 1992. lnvolvement of GABA in the neuroendocrine regulation of gonadotrophin release in the goldfish.Neuroendocrinology 55: 396-404. 20. Kah, O., V.L. Trudeau, B.D. Sloley, P. Dubourg, J.P. Chang, K.L. Yu, R.E. Peter 1992. lnvolvement of GABA in the neuroendocrine regulation of gonadotrophin release in the goldfish.Neuroendocrinology 55: 396-404.
- 2S 2S
- 21. Kah, O., l. Anglade, E. Leprétre, P. Dubourg, D. de Monbrison. 1993 . The reproductive brain in fish. Fish Physiol Biochem 11 :85-98. 21. Kah, O., l. Anglade, E. Leprétre, P. Dubourg, D. de Monbrison. 1993 The reproductive brain in fish. Fish Physiol Biochem 11: 85-98.
- 22. King, W.V., Thomas, P., Harrell, R.M., Hodson, KG., Sullivan, C.V. 1994. Plasma levels of gonadal steroids during final oocyte maturation of striped bass, Morone saxatilis L. Gen. Comp. Endocrinol. 95,178--191. 22. King, W.V., Thomas, P., Harrell, R.M., Hodson, KG., Sullivan, C.V. 1994. Plasma levels of gonadal steroids during final oocyte maturation of striped bass, Morone saxatilis L. Gen. Comp. Endocrinol 95,178--191.
- 23. 2. 3.
- Levavi-Sivan, B., A. Avitan, T. Kanias, 2003. Characterization of the inhibitory dopamine receptor from the pituitary of lilapia. Fish Physiol Biochem 28:73-75. Levavi-Sivan, B., A. Avitan, T. Kanias, 2003. Characterization of the inhibitory dopamine receptor from the pituitary of lilapia. Fish Physiol Biochem 28: 73-75.
- 24. 24.
- Osugi, T., K. Ukena, S.A. Sower, H. Kawauchi, K. Tsutsui. 2006. Evolutionary origin and divergence of PQRFarnide peptides and LPXRFamide peptides in the RFamide peptide family. Insights from novel lamprey RF.mide peptides. FEBS J. 273: 1731-1743. Osugi, T., K. Ukena, S.A. Sower, H. Kawauchi, K. Tsutsui. 2006. Evolutionary origin and divergence of PQR Farnide peptides and LPXRFamide peptides in the RFamide peptide family. Insights from novel lamprey RF.mide peptides. FEBS J. 273: 1731-1743.
- 25. 25.
- Parhar L, Ogawa S., Kitahashi T. 2012 RFamide peptides as mediators in environmental control of GnRH neuroos. Progress in Neurobiology 98: 176Parhar L, Ogawa S., Kitahashi T. 2012 RFamide peptides as mediators in environmental control of GnRH neuroos. Progress in Neurobiology 98: 176
196. 196
- 26. 26.
- Peter, RE, Paulencu, C. 1980. lnvolvement of the preoptic region in gonadotropin release-inhibition 10 goldfish, Carassius auratus. Neuroendocrinology. 31 : 133-141 Peter, RE, Paulencu, C. 1980. Evolution of the preoptic region in gonadotropin release-inhibition 10 goldfish, Carassius auratus. Neuroendocrinology 31: 133-141
- 27. 27.
- Pral, F., S. Zanuy, M. Carrillo, 2001 Effect of gonadotropin-releasing honnone analogue GnRHa and pimozide on plasma levels of sex. steroids and ovarian development in sea bass Dicentrarchus labrax L. Aquaculture 198: 325-338 Pral, F., S. Zanuy, M. Carrillo, 2001 Effect of gonadotropin-releasing honnone analogue GnRHa and pimozide on plasma levels of sex. steroids and ovarian development in sea bass Dicentrarchus labrax L. Aquaculture 198: 325-338
- 28. 28.
- Qi, Y., Oldfield, B.J., Clarke, U ., 2009. Projections of RFamide-related peptide-3 neurones in the ovine hypothaJamus, with special reference to regions regulating energy balance and reproduction. Joumal of Neuroendocrinology 21, 690-697. Qi, Y., Oldfield, B.J., Clarke, U., 2009. Projections of RFamide-related peptide-3 neurons in the ovine hypothaJamus, with special reference to regions regulating energy balance and reproduction. Joumal of Neuroendocrinology 21, 690-697.
- 29. 29.
- Sawada, K., K. Ukena, H. Satake, E. Iwakoshi, H. Minakata, K.Tsutsui. 2002. Novel fish hypothalamic neuropeptide: Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide. Eur J Riochem 269:6000-6008. Sawada, K., K. Ukena, H. Satake, E. Iwakoshi, H. Minakata, K. Tsutsui. 2002. Novel fish hypothalamic neuropeptide: Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide. Eur J Riochem 269: 6000-6008.
- 30. 30
- Tachibana, T., Sato, M., Takahashi, H., Ukena, K., Tsutsui, K., Furuse, M., 2005. Gonadotropin-inhibiting hormone stimulates feeding behavior in chicks. Brain Research 1050, 94-100. Tachibana, T., Sato, M., Takahashi, H., Ukena, K., Tsutsui, K., Furuse, M., 2005. Gonadotropin-inhibiting hormone stimulates feeding behavior in chicks. Brain Research 1050, 94-100.
- 31. Tachibana, T., Masuda, N., Tsutsui, K., Ukena, K., Ueda, H., 2008. The orexigenic effect of GnIH is mediated by central opioid receptors in chicks. Comparative Bio-chemistry and Physiology Part A: Molecular & Integrative Physiology 150,2 1-25. 31. Tachibana, T., Masuda, N., Tsutsui, K., Ukena, K., Ueda, H., 2008. The orexigenic effect of GnIH is mediated by central opioid receptors in chicks. Comparative Bio-chemistry and Physiology Part A: Molecular & Integrative Physiology 150.2 1-25.
- s s
- 32. Trudeau, V.L. 1997. Neuroendocrine regulation of gonadotrophin JI reIease and gonada! growth in the goldfish, Carassius auratus. Rev Reprod 2: 55-68. 32. Trudeau, V.L. 1997. Neuroendocrine regulation of gonadotrophin JI reIease and gonada! growth in the goldfish, Carassius auratus. Rev Reprod 2: 55-68.
- 33. Tsutsui, K., and K. Ukena. 2006. Review: Hypothalamic LPXRF-amide peptides in vertebrates: identification, localization and hypophysiotropic activity. Peptides 27: 1121-1129. 33. Tsutsui, K., and K. Ukena. 2006. Review: Hypothalamic LPXRF-amide peptides in vertebrates: identification, localization and hypophysiotropic activity. Peptides 27: 1121-1129.
- 10 10
- 34. Tsutsui, K., E. Saigoh, K. Ukena, H Teranishi, Y. Fujisawa, M. Kikuchi, S. lshii, P.J. Sharp. 2000. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochem Biophys Res Commun 275: 661-667. 34. Tsutsui, K., E. Saigoh, K. Ukena, H Teranishi, Y. Fujisawa, M. Kikuchi, S. lshii, P.J. Sharp. 2000. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochem Biophys Res Commun 275: 661-667.
- lS lS
- 35 . Tsutsui, K., O.E. Beotley, T. Ubuka, E. Saigoh, H. Yio, T. Osugi, K. looue, V.S. Chowdhury, K. Ukcna, N.Cicconc, P.l. Sharp, l.e. Wingficld. 2007. The general and comparative biology of gonadotropin-inhibitory honnone (OnlH). Oen Comp Endocrinol 153: 365-370. 35 Tsutsui, K., O.E. Beotley, T. Ubuka, E. Saigoh, H. Yio, T. Osugi, K. looue, V.S. Chowdhury, K. Ukcna, N. Cyconc, P.l. Sharp, l.e. Wingficld. 2007. The general and comparative biology of gonadotropin-inhibitory honnone (OnlH). Oen Comp Endocrinol 153: 365-370.
- 20 twenty
- 36. Van Asselt, L.A., H.J. Goos, W. Smit-van Dijk, P.A.M. Speetjens, P.O. Van Oordl. 1988. Evidence for the involvement of 02 receptors in the dopaminergic inhibition of gonadotropin release in the African catfish, Clarias gariepinus. Aquaculture; 72:369-378. 36. Van Asselt, L.A., H.J. Goos, W. Smit-van Dijk, P.A.M. Speetjens, P.O. Van Oordl 1988. Evidence for the involvement of 02 receptors in the dopaminergic inhibition of gonadotropin release in the African catfish, Clarias gariepinus. Aquaculture; 72: 369-378.
- 37. Vidal, 8., e. Pasqualini, N. Le Belle, M.C.H. Holland, M. Sbaihi, P. Vernier, Y. Zohar, S. Dufour, 2004 Dopamine inhibits luteinizing honnone synthesis and release in the juvenile European eel: a neuroendocrine lock for the onset ofpuberty. Biol Reprod 71: 1491-1 500. 37. Vidal, 8., e. Pasqualini, N. Le Belle, M.C.H. Holland, M. Sbaihi, P. Vernier, Y. Zohar, S. Dufour, 2004 Dopamine inhibits luteinizing honnone synthesis and release in the juvenile European eel: a neuroendocrine lock for the onset of public. Biol Reprod 71: 1491-1 500.
- 2S 2S
- 38. Zohar, Y, c.e. Mylonas. 2001 Endocrine manipulations of spawning in cultured fish: from honnones to genes. Aquaculture 197: 99-136. 38. Zohar, Y, c.e. Mylonas 2001 Endocrine manipulations of spawning in cultured fish: from honnones to genes. Aquaculture 197: 99-136.
- 39. Zohar Y., Muñoz-Cueto l .A., Elizur A., Kah O. 2010. Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocrinol. 165: 438-455. 39. Zohar Y., Muñoz-Cueto L.A., Elizur A., Kah O. 2010. Neuroendocrinology of reproduction in teleost fish. Endocrinol Comp gene. 165: 438-455.
- BREVE DESCRIPCiÓN DE LA INVENCiÓN BRIEF DESCRIPTION OF THE INVENTION
- La presente invención hace referencia al hallazgo y aislamiento del AON copia de The present invention refers to the finding and isolation of the AON copy of
- un nuevo neuropéptido correspondiente al precursor de la hormona inhibidora de a new neuropeptide corresponding to the precursor of the hormone inhibitor of
- gonadotrofinas (GoIH o LPXRFa) en peces perciformes y, mas concretamente, en Gonadotrophins (GoIH or LPXRFa) in perciform fish and, more specifically, in
- S S
- la lubina europea, Dicentrarchus labrax. Además, hemos diseñado y sintetizado a European sea bass, Dicentrarchus labrax. In addition, we have designed and synthesized
- partir de dicho precursor dos péptidos maduros denominados sbGnIH-l o from said precursor two mature peptides called sbGnIH-1 or
- sbLPXRFa-l y sbGnIH-2 o sbLPXRFa-2. Estos péptidos han sido modificados sbLPXRFa-l and sbGnIH-2 or sbLPXRFa-2. These peptides have been modified
- con una amidación e-lenninal y un residuo de cisteína N-terminal para su with an e-lenninal amidation and an N-terminal cysteine residue for
- acoplamiento a KLH, con objeto de favorecer el proceso de inmunización y la coupling to KLH, in order to favor the immunization process and the
- 10 10
- generación de anticuerpos específicos contra la GnIH-l y la GnIH-2 de lubina en generation of specific antibodies against GnIH-l and GnIH-2 from sea bass in
- conejos (anti-sbGnIH-1 y anti-sbGnIH-2) y en cabras (anti-sbGnIH-2). Estos rabbits (anti-sbGnIH-1 and anti-sbGnIH-2) and in goats (anti-sbGnIH-2). These
- anticuerpos han sido utilizados para caracterizar el patrón de localización de las antibodies have been used to characterize the pattern of localization of
- células GnIH-inmunopositivas y sus proyecciones en el cerebro y la hipófisis de la GnIH-immunopositive cells and their projections in the brain and pituitary gland
- lubina. La invención incluye también ensayos de inyección que ponen de Bass. The invention also includes injection tests that put
- 15 fifteen
- manifit!sto un claro efecto inhibidor de la GnIH sobre diferentes factores There is a clear inhibitory effect of GnIH on different factors
- neuroendocrinos y endocrinos que controlan el proceso reproductivo de la lubina. neuroendocrines and endocrines that control the reproductive process of sea bass.
- Esta invención nos ha pennitido profundizar en el conocimiento de los This invention has allowed us to deepen the knowledge of
- mecanismos mediante los cuales se controla y se inhibe la reproducción en la mechanisms by which reproduction is controlled and inhibited in the
- lubina. Esta invención puede ser de gran utilidad para controlar la pubertad de la Bass. This invention can be very useful for controlling the puberty of the
- 20 twenty
- lubina y solventar los problemas de pubertad precoz en los machos de esta sea bass and solve the problems of precocious puberty in the males of this
- especie. Dado que el desarrollo gonadal precoz conlleva crecimientos pobres y un species. Since early gonadal development leads to poor growth and a
- deterioro de la calidad de la carne, suprimir O retrasar la pubertad puede pennitir deterioration of meat quality, suppressing or delaying puberty can penetrate
- un mayor crecimiento somático del animal, con los consiguientes beneficios para greater somatic growth of the animal, with the consequent benefits for
- la producción en la práctica acuÍcola. Asimismo. esta invención abre la production in aquaculture practice. Likewise. this invention opens the
- 25 25
- posibilidad de usar el ADN copia y los anticuerpos específicos generados para possibility of using the copy DNA and the specific antibodies generated to
- bloquear los efectos inhibidores de la GnIH sobre la reproducción, así como block the inhibitory effects of GnIH on reproduction, as well as
- generar antagonistas funcionales de la GnIH que sean usados para promover el generate functional GnIH antagonists that are used to promote
- desarrollo gonadal, la maduración, la puesta y favorecer la reproducción de la gonadal development, maturation, laying and favoring the reproduction of the
- lubina. Por tanto, la aplicación de esta invención pennitirá resolver problemáticas Bass. Therefore, the application of this invention will solve problems
- 30 30
- reales que se presentan en el cultivo acuícola de la lubina y que afectan a la real that occur in the aquaculture of sea bass and that affect the
reproducción y el crecimiento de esta especie. Además, es de esperar que estas herramientas generadas puedan ser de aplicación a especies próximas a la lubina y, en particular, a peces pcrcomorfos como la dorada, la scriola, la corvina o el atún. Reproduction and growth of this species. In addition, it is expected that these generated tools can be applied to species close to sea bass and, in particular, to pcrcomorph fish such as sea bream, scriola, sea bass or tuna.
DESCRIPCIÓN DETALLADA DE LA INVENCIÓN DETAILED DESCRIPTION OF THE INVENTION
l. Clonación y caracterización del ADN copia de la GnIH de lubina l. Cloning and characterization of the DNA copy of the GnIH of sea bass
Para la clonación de la GnIH de lubina hemos partido de una librería de expresión de cerebro y hemos seguido una estrategia basada en el uso de ccbadores degenerados para la amplificación por PCR sobre la misma. La amplificación mediante PCR y la posterior c1cctroforcsis permitieron identificar bandas del tamaño esperado. Estas bandas fueron aisladas, los ácidos nueleicos fueron cluídos y la sccucnciación de estos fragmentos de ADN y su posterior comparación y alineamiento con las secuencias GnIA de otras especies disponibles en las bases de datos nos pennitió determinar que se trataba de una secuencia parcial del precursor de la honnona inhibidora de gonadotrofinas de la lubina (GnIH o precursor LPXRFamida). For the cloning of the GnIH of sea bass we have started from a brain expression library and have followed a strategy based on the use of degenerate ccbators for PCR amplification on it. The amplification by PCR and the subsequent c1cctroforcsis allowed to identify bands of the expected size. These bands were isolated, nueleic acids were cloned and the sccucnciation of these DNA fragments and their subsequent comparison and alignment with the GnIA sequences of other available species in the databases allowed us to determine that it was a partial sequence of the precursor of gonadotrophin inhibitor honnone from sea bass (GnIH or precursor LPXRFamide).
Posterionnente, utilizando oligonueleótidos específicos diseñados a partir de la secuencia parcial clonada de lubina, y mediante la modificación de los extremos 5'y 3' Y la utilización de kits comerciales (SMARTcr RACE cDNA Clontech), obtuvimos la secuencia completa de nueleótidos que codifican para el precursor de la GnlH (o precursor LPXRFamida) de lubina. La secuencia completa clonada de la GnIA de lubina consta de 878 nucleótidos (SEQ ID NO 1), de los cuales 600 nucleótidos (SEQ ID NO 2) codifican el péptido precursor de la GnIA de lubina (ORF) de 200 aminoácidos (SEQ ID NO 3), 49 nueleótidos corresponden al extremo 5 'UTR Y 226 nueleótidos corresponden al extremo 3 'UTR y a la cola poli-A. A diferencia de otros vertebrados, en los que se han descrito tres posibles péptidos GnIA, en estc precursor de lubina hemos identificado solo dos posibles péptidos funcionales, denominados sbGnIH-l o sbLPXRFa-l (PLHLHANMPMRF, SEQ ID NO 4) Y sbGnIH-2 o sbLPXRFa-2 (SPNSTPNMPQRF, SEQ ID NO 5) (Figura l y 2). El análisis filogenético identificó claramente la secuencia clonada en la lubina dentro de la rama en la que se ubican las secuencias GnIHILPXRFa de peces y otros vertebrados (Figura 3). Subsequently, using specific oligonucleotides designed from the partial cloned sequence of sea bass, and by modifying the 5'and 3'-ends and using commercial kits (SMARTcr RACE cDNA Clontech), we obtained the complete sequence of nueleotides that code for the precursor of GnlH (or LPXRFamide precursor) of sea bass. The complete cloned sequence of sea bass GnIA consists of 878 nucleotides (SEQ ID NO 1), of which 600 nucleotides (SEQ ID NO 2) encode the precursor peptide of sea bass GnIA (ORF) of 200 amino acids (SEQ ID NO 3), 49 nueleotides correspond to the 5 'UTR end and 226 nueleotides correspond to the 3' UTR end and the poly-A tail. Unlike other vertebrates, in which three possible GnIA peptides have been described, in this seabass precursor we have identified only two possible functional peptides, called sbGnIH-l or sbLPXRFa-l (PLHLHANMPMRF, SEQ ID NO 4) and sbGnIH-2 or sbLPXRFa-2 (SPNSTPNMPQRF, SEQ ID NO 5) (Figure 1 and 2). The phylogenetic analysis clearly identified the cloned sequence in the sea bass within the branch in which the GnIHILPXRFa sequences of fish and other vertebrates are located (Figure 3).
- 2. 2.
- Expresión de la GnIH de lubina en tejidos centrales y periféricos Expression of sea bass GnIH in central and peripheral tissues
Una vez clonada e identificada la secuencia, se diseñaron cebadores específicos para estudiar, mediante PCR convencional (RT-PCR), la distribución tisular del ARN mensajero en tejidos centrales (bulbo olfativo, telencéfalo, diencéfalo, techo óptico, cerebelo, medula espinal, retina e hipófisis) y periféricos (corazón, hígado, riñón, intestino, músculo, ovario y testículo) de la lubina. En tejidos centrales, la expresión fue muy evidente en te1encéfalo, diencéfalo, techo óptico, cerebelo y retina (Figura 4). En tejidos periféricos, los ARN mensajero de la GnIH fueron evidenciados en el testículo, ovario, riñón e intestino (Figura 4). La expresión de la GnIH en áreas centrales sensoriales como la retina, el techo óptico y el cerebelo, en áreas neuroendocrinas del telencéfal0 y el diencéfalo, así como en el ovario y el testículo refuerzan la implicación de la GnlH en el control de la reproducción de la lubina. Once the sequence was cloned and identified, specific primers were designed to study, by conventional PCR (RT-PCR), the tissue distribution of messenger RNA in central tissues (olfactory bulb, telecephalus, diencephalon, optic ceiling, cerebellum, spinal cord, retina and pituitary gland) and peripherals (heart, liver, kidney, intestine, muscle, ovary and testis) of the sea bass. In central tissues, the expression was very evident in the brain, diencephalon, optic ceiling, cerebellum and retina (Figure 4). In peripheral tissues, GnIH messenger RNAs were evidenced in the testis, ovary, kidney and intestine (Figure 4). The expression of GnIH in central sensory areas such as the retina, the optic roof and the cerebellum, in neuroendocrine areas of the telencephalon0 and the diencephalon, as well as in the ovary and the testis reinforce the involvement of GnlH in the control of the reproduction of the sea bass.
- 3. 3.
- Disei'lo y síntesis de los péptidos sbGnIH-l y sbGnIH-2 Design and synthesis of sbGnIH-l and sbGnIH-2 peptides
Como hemos indicado anterionnente, en la secuencia de la GnlH de lubina deducida identificamos dos posibles péptido maduros, a los cuales hemos denominado sbGnIH-l (sbLPXRFa-l) y sbGnIH-2 (sbLPXRFa-2). El siguiente paso fue sintetizar esos péptidos, que fueron modificados con una amidación en su extremo C-tenninal, característica de los péptidos GnIH funcionales. Ambos péptidos fueron utilizados para los ensayos funcionales que se detallarán más adelante. As we have indicated previously, in the GnlH sequence of deduced sea bass we identify two possible mature peptides, which we have named sbGnIH-l (sbLPXRFa-l) and sbGnIH-2 (sbLPXRFa-2). The next step was to synthesize those peptides, which were modified with an amidation at their C-tenninal end, characteristic of functional GnIH peptides. Both peptides were used for the functional tests that will be detailed later.
Las secuencias de los péptidos sintetizados fue la siguiente: The sequences of the synthesized peptides were as follows:
sbGnlH-I: NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) sbGnIH-2: NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7) sbGnlH-I: NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) sbGnIH-2: NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7)
El péptido sbGnIH-I sintetizado (12 aminoácidos) tenía un peso molecular estimado de 1462,81 Da y un peso molecular experimental de 1461,75 Da, tal como se observó mediante análisis de espectro fotometría de masas (Figura 5). Este péptido fue purificado mediante HPLC. mostrando un pico principal con un tiempo de retención de 13 ,75 minutos, y un nivel de pureza del 95,2% (Figura 5). La secuencia fue verificada mediante espectrometría de masas en tándem (MSIMS). The synthesized sbGnIH-I peptide (12 amino acids) had an estimated molecular weight of 1462.81 Da and an experimental molecular weight of 1461.75 Da, as observed by mass photometry spectrum analysis (Figure 5). This peptide was purified by HPLC. showing a main peak with a retention time of 13, 75 minutes, and a purity level of 95.2% (Figure 5). The sequence was verified by tandem mass spectrometry (MSIMS).
El péptido sbGnIH-2 sintetizado (12 aminoácidos) tenía un peso molecular estimado de 1374,54 Da y un peso molecular experimental de 1373,65 Da, tal como se observó mediante análisis de espectrofotometría de masas (Figura 6). Este péptido fue purificado mediante HPLC. mostrando un pico principal con un tiempo de retención de 13,1 minutos, y un nivel de pureza del 95,1% (Figura 6). La secuencia fue verificada mediante espectrometría de masas en tándem (MSIMS). The synthesized sbGnIH-2 peptide (12 amino acids) had an estimated molecular weight of 1374.54 Da and an experimental molecular weight of 1373.65 Da, as observed by mass spectrophotometry analysis (Figure 6). This peptide was purified by HPLC. showing a main peak with a retention time of 13.1 minutes, and a purity level of 95.1% (Figure 6). The sequence was verified by tandem mass spectrometry (MSIMS).
4. Generación de anticuerpos anti-sbGnIH-l y anti-sbGnIH-2 4. Generation of anti-sbGnIH-l and anti-sbGnIH-2 antibodies
Asimismo. estos péptidos sbGnIH-1 y sbGnIH-2 han sido utilizados para la generación de anticuerpos específicos dirigidos contra los mismos, obtenidos en conejo y cabra. Estos péptidos tenían una amidación e-terminal y un residuo de cisteína N-terminal para su acoplamiento a KLH, con objeto de favorecer el proceso de inmunización. En el caso del péptido sbGnIH-I , los anticuerpos fueron generados en conejo. En el caso del péptido shGnIH-2, se generaron anticuerpos tanto en conejo como en cabra. El protocolo de inmunización fue el siguiente: Likewise. These sbGnIH-1 and sbGnIH-2 peptides have been used for the generation of specific antibodies directed against them, obtained in rabbit and goat. These peptides had an e-terminal amidation and an N-terminal cysteine residue for coupling to KLH, in order to favor the immunization process. In the case of the sbGnIH-I peptide, the antibodies were generated in rabbit. In the case of shGnIH-2 peptide, antibodies were generated in both rabbit and goat. The immunization protocol was as follows:
- Apéndice 1. Producción de anticuerpos en conejo Appendix 1. Production of antibodies in rabbit
- Fecha Date
- Inmunización Sangrado Suero Immunization Bleeding Serum
- Semana O Week O
- Pre-serum 3 mi + lest Pre-serum 3 mi + lest
- Semana I Week I
- I I
- Semana 5 Week 5
- 11 eleven
- Semana 9 Week 9
- 111 111
- Semana 11 Week 11
- f USA + test f USA + test
- Semana 11 Week 11
- 1II+2v '='20 mi 1II + 2v '= '20 mi
- Semana 13 Week 13
- IV IV
- Semana 15 Week 15
- IV+2v+sangrado final 50-70 mi + test IV + 2v + final bleeding 50-70 mi + test
- Apéndice 2. Producción de anticuerpos en cabra Appendix 2. Production of goat antibodies
- Fecha Date
- Inmunización Sangrado Suero Immunization Bleeding Serum
- Semana O Week O
- Prc:-serum 3 mi + lest Prc: -serum 3 mi + lest
- Semana 1 Week 1
- I I
- Semana 5 Week 5
- 11 eleven
- Semana 9 Week 9
- 111 111
- Semana 11 Week 11
- ELlSA + test ELlSA + test
- Semana 11 Week 11
- 1II+2v :::::50 mi + test 1II + 2v ::::: 50 mi + test
- Semana 13 Week 13
- IV IV
- Semana 15 Week 15
- lV+ 2v+sangrado final 50-70 mi + test lV + 2v + final bleeding 50-70 mi + test
Tras el periodo de inmunización (15 semanas) se procedió al sangrado de los animales, a la obtención del suero con los anticuerpos y a la realización de pruebas de ELISA para su titulación. Se utilizaron placas de ELISA NuncIrnmunoTM Plate MaxiSorpTM Surfacc cubiertas con péptido libre (0.004 rng/ml) y proteína (0.002 mg/ml) y un rango de dilución de las muestras de 1: 121After the immunization period (15 weeks) the animals were bled, the serum was obtained with the antibodies and ELISA tests were performed for titration. NuncIrnmunoTM Plate MaxiSorpTM Surfacc Plate coated with free peptide (0.004 rng / ml) and protein (0.002 mg / ml) and a sample dilution range of 1: 121 were used
- 1: one:
- 161051 (suero). Como anticuerpos secundarios se usaron inmunoglobulinas anti-Ig de conejo obtenidas en cabra (Agriscra) a una dilución 1:6667 e inmunoglohulinas anti-Ig de cabra obtenidas en conejo (DAKO) a una dilución 161051 (serum). As secondary antibodies, goat anti-rabbit immunoglobulins obtained in goat (Agriscra) at a dilution of 1: 6667 and goat anti-goat immunoglohulins obtained in rabbit (DAKO) at dilution were used.
- 1: one:
- 10.000. 10,000
Los ensayos de ELISA obtenidos muestran las respuestas de Jos anticuerpos generados frente a los antígenos, en relación al suero prcinmune (Figuras 7, 8 Y 9), en las que se evidencia la curva sigmoidea característica en función de la dilución del suero. Todos los sueros generados mostraron un buen título, con rangos óptimos de dilución entre 1 :7000-1: 11000 para los anticuerpos generados en conejo (anti-sbGnIH-1 y anti-sbGnlH-2). y de 1:2000-1 :6000 para el anticuerpo generado en cabra (anti-sbGnIH-2). The ELISA assays obtained show the responses of the antibodies generated against the antigens, in relation to the prcinmune serum (Figures 7, 8 and 9), in which the characteristic sigmoid curve is evidenced as a function of serum dilution. All sera generated showed a good titer, with optimal dilution ranges between 1: 7000-1: 11000 for rabbit-generated antibodies (anti-sbGnIH-1 and anti-sbGnlH-2). and from 1: 2000-1: 6000 for the goat-generated antibody (anti-sbGnIH-2).
5. Localización inmunohistoouímica de la GnIH en el cerebro y la hipófisis de la lubina 5. Immunohistooumic location of GnIH in the brain and pituitary gland of sea bass
La obtención de anticuerpos específicos contra los péptidos sbGnIH-1 y sbGnIH-2 ha pennitido esclarecer el patrón de distribución espacial de las células GnIH y sus proyecciones por medio de técnicas inmunohitoquímicas. La tineión inmunohistoquímica reveló una alta señal especifica cuando incubamos las secciones con los anticuerpos generados, no mostrando ninguna reacción inespecífica al incubar con el suero pre-inmune o cuando suprimimos los anticuerpos secundarios. Los resultados obtenidos fueron altamente consistentes y no se han encontrado diferencias en el inmunomarcaje entre los anticuerpos contra los péptidos GnIH-l y GnIH-2 en los ejemplares de lubina analizados. Obtaining specific antibodies against the sbGnIH-1 and sbGnIH-2 peptides has been able to clarify the spatial distribution pattern of GnIH cells and their projections by means of immunohitochemical techniques. Immunohistochemical tineion revealed a high specific signal when we incubated the sections with the generated antibodies, showing no nonspecific reaction when incubating with the pre-immune serum or when we suppressed the secondary antibodies. The results obtained were highly consistent and no differences were found in the immunomarking between the antibodies against the GnIH-1 and GnIH-2 peptides in the sea bass specimens analyzed.
Así, los sueros anti-sbGnJH-1 y anti-sbGnIH-2 de lubina nos pennitjeron realizar un análisis completo en secciones seriadas del cerebro, desde las porciones más rostrales (bulbos olfativos) a las más caudales (médula). Tanto para la forma sbGnIH-1 como shGnIH-2, hemos detectado la presencia de cuerpos celulares en el bulbo olfativo, en particular en las células ganglionares del nervio tenninal, en la transición entre la zona mas caudal del bulbo olfativo y la más rostral del telencéfalo, diferenciándose dos poblaciones celulares independientes: una población más rostral y dorsal, en la porción medial de los bulbos y otra población más caudal y ventral en la región del nervio tcnninal. La inmunoreactividad también fue evidente en células de los núcleos central y lateral del telencéfalo ventral, en el núcleo posterior pcrivcntricular del área preóptica. Además, detectamos células inmunorrcactivas de gran tamaño en la zona dorsal-lateral del sinencéfalo rostral. También encontramos células inmunorrcactivas en el núcleo gusta torio secundario, siendo estas células de la zona central del tegrnento mucho mas numerosas y de mcnor tamaño quc las descritas anteriormente. Además fueron detectadas células en la pars distal proximal y en la pars intermedia de la adenohipófisis. Thus, the anti-sbGnJH-1 and anti-sbGnIH-2 sera of sea bass allowed us to perform a complete analysis on serial sections of the brain, from the most rostral portions (olfactory bulbs) to the most caudal (medulla). For both the sbGnIH-1 and shGnIH-2 forms, we have detected the presence of cell bodies in the olfactory bulb, particularly in the ganglion cells of the tenninal nerve, in the transition between the most caudal area of the olfactory bulb and the most rostral of the Telencephalon, differentiating two independent cell populations: a more rostral and dorsal population, in the medial portion of the bulbs and another more caudal and ventral population in the tcnninal nerve region. Immunoreactivity was also evident in cells of the central and lateral nuclei of the ventral telencephalon, in the posterior pcrivcntricular nucleus of the preoptic area. In addition, we detect large immunoreactive cells in the dorsal-lateral area of the rostral syncephalon. We also found immunoreactive cells in the nucleus like secondary thorium, these cells of the central zone of the tegrnento being much more numerous and smaller than those described above. In addition, cells were detected in the proximal distal pars and in the intermediate pars of the adenohypophysis.
En cuanto al patrón de inervación, detectamos fibras sbGnIH-l-y sbGnIH-2inmunorreactivas principalmente en el cerebro anterior y medio. Las fibras fueron mas evidentes en el telencéfalo ventral, área preóptica, tálamo ventral, hipotálamo medio-basal, receso lateral, techo óptico, torus semicircularis, tegmento rostrallateral y en la región caudal del tegmento (núcleo gustatorio secundario). Además hemos localizado fibras en el telencéfalo dorsal, el romboencéfalo ventral, el nervio óptico y en el órgano pineal, así como en la pars distal proximal y pars intermedia de la adenohip6fisis. Regarding the innervation pattern, we detect sbGnIH-l-and sbGnIH-2 immunoreactive fibers mainly in the anterior and middle brain. The fibers were most evident in the ventral telencephalon, preoptic area, ventral thalamus, mid-basal hypothalamus, lateral recess, optic roof, torus semicircularis, rostrallateral tegment and in the caudal region of the tegment (secondary gustatory nucleus). In addition, we have located fibers in the dorsal telencephalon, the ventral rhomboencephalus, the optic nerve and the pineal organ, as well as in the proximal distal and intermediate pars of the adenohypophysis.
Este patrón de distribución de células y fibras GnlH en áreas sensoriales olfativas (bulbo olfativo, nervio tenninal), fotosensitivas (nervio óptico, tceho óptico) y gustativas (núcleo gustatorio secundario), así como en áreas neuroendocrinas relacionadas con la reproducción (telencéfalo ventral, área preóptica, hipotálamo mediobasal) y en la propia adenohip6fisis refuerzan la consideración de la implicación de la GnIH de lubina en el control de procesos como la reproducción, la ¡ngesta y el metabolismo. This pattern of distribution of GnlH cells and fibers in olfactory sensory areas (olfactory bulb, tenninal nerve), photosensitive areas (optic nerve, optic tceho) and gustatory areas (secondary gustatory nucleus), as well as in neuroendocrine areas related to reproduction (ventral telencephalon, preoptic area, midbasal hypothalamus) and in the adenohipfysis itself reinforce the consideration of the involvement of seabass GnIH in the control of processes such as reproduction, intake and metabolism.
6. Dctenninación de los efectos de la GnlH en la lubina 6. Dctennination of the effects of GnlH on sea bass
Una vez caracterizados los posibles péptidos GnlH maduros, se diseñó un experimento para comprobar cual es el efecto in vivo de la GnIH sobre la lubina europea. Los ensayos se realizaron con la fonna sbGnIH-2. Los resultados obtenidos nos mostraron un marcado efecto inhibidor de la GnIH sobre diversos genes cerebrales e hipofisarios que se encuentran implicados en la cstimulación de la reproducción. Así, pudimos observar una disminución de la expresión del ARN mensajero en la honnoDa liberadora de las gonadotrofinas de tipo JI (GnRH-2) a las 6 horas post-inyección (hpi) a todas las dosis analizadas O, 2 Y 4 ¡.tg) Y una inhibición en la expresión de GnRH-I a las 12 hpi a la dosis más alta (4 ¡.tg)(Figura 10). No se observaron efectos de la sbGnlH-2 sobre los niveles de ARN mensajero de la fonna GnRH-3 de lubina, a ninguna de las do sis y tiempos de post-inyección analizados. Las kisspeptinas también fueron inhibidas tras el tratamiento con sbGnIH-2 a las 6 hpi (Figura 10). La inhibición de las kisspcptinas de tipo I (Kissl) fue evidente COn la dosis intennedia (2 ¡.tg), mientras que en el caso de la Kiss2 esta inhibición tuvo lugar a la dosis más alta de 4 "g (Figura 10). Once the possible mature GnlH peptides were characterized, an experiment was designed to verify what the in vivo effect of GnIH is on European sea bass. The tests were performed with the sbGnIH-2 fonna. The results obtained showed a marked inhibitory effect of GnIH on various brain and pituitary genes that are involved in the reproduction stimulation. Thus, we were able to observe a decrease in the expression of messenger RNA in the releasing honon of gonadotrophins of type JI (GnRH-2) at 6 hours post-injection (hpi) at all the doses analyzed O, 2 and 4 ¡.tg ) And an inhibition in the expression of GnRH-I at 12 hpi at the highest dose (4¡tg) (Figure 10). No effects of sbGnlH-2 on messenger RNA levels of sea bass GnRH-3 were observed, at any of the doses and post-injection times analyzed. Kisspeptins were also inhibited after treatment with sbGnIH-2 at 6 hpi (Figure 10). Inhibition of type I kisspcptins (Kissl) was evident with the intentional dose (2 .tg), while in the case of Kiss2 this inhibition took place at the highest dose of 4 "g (Figure 10).
A nivel hipofisario también se observó un efecto inhibidor de la GnIH sobre la expresión de la honnona estimulante del foJiculo (FSH), que está implicada en la maduración inicial de los ovocitos y en la vitelogénesis, y sobre la hormona luteinizante (LH), encargada de la maduración final y puesta, siendo más marcados los efectos sobre esta última (Figura 11). Este efecto inhibidor fue evidente tanto a las 6 hpi (a todas las dosis para la LH y a dosis de 2 y 4 ¡.tg para FSH) como a las 12 hpi (a la dosis de 2"g lanto para FSH como para LH)( Figura 11). Esta inhibición de los ARN mensajeros de estos factores neuroendocrinos y endocrinos estimuladores de la reproducción muestran la inactivación del eje At the pituitary level, an inhibitory effect of GnIH was also observed on the expression of foJiculo-stimulating honnone (FSH), which is involved in the initial maturation of oocytes and in vitellogenesis, and on luteinizing hormone (LH), responsible of the final ripening and setting, the effects on the latter being more marked (Figure 11). This inhibitory effect was evident both at 6 hpi (at all doses for LH and at doses of 2 and 4¡tg for FSH) and at 12 hpi (at the dose of 2 "grams for FSH and for LH) (Figure 11) This inhibition of messenger RNAs from these neuroendocrine and endocrine factors that stimulate reproduction show axis inactivation
reproductivo que provoca la GnIH a distintos niveles del eje cerebro-bipófisisgónada de la lubina. Reproductive system that causes GnIH at different levels of the brain-biprophobic axis of sea bass.
Por lo tanto, esta invención aborda aspectos novedosos sobre el control neuroendocrino del proceso reproductivo en peces, en general, y en la lubina 5 europea en particular. Como novedades podemos destacar la generación de herramientas para identificar la presencia y los niveles de la hormona inhibidora de las gonadotrofinas en la lubina en distintos estadios (estadios larvarios, juveniles y adultos) y el desarrollo de procedimientos para caracterizar los efectos de este nuevo factor neuroendocrino en peces. Además proponemos una 10 aplicación de esta herramienta, ya que esta invención proporciona una metodología a seguir para inhibir la pubertad precoz de esta especie mediante el uso de inyecciones o implantes de GnIH. Asimismo, esta invención puede pennitir la generación de agonistas y/o antagonistas de la GnIH, a través de la modificación de distintos aminoácidos de las secuencias descritas, que pueden ser Therefore, this invention addresses novel aspects of neuroendocrine control of the reproductive process in fish, in general, and in European sea bass 5 in particular. As novelties we can highlight the generation of tools to identify the presence and levels of gonadotrophin inhibitor hormone in sea bass at different stages (larval, juvenile and adult stages) and the development of procedures to characterize the effects of this new neuroendocrine factor in fish We also propose an application of this tool, since this invention provides a methodology to be followed to inhibit the early puberty of this species through the use of GnIH injections or implants. Also, this invention can penetrate the generation of agonists and / or antagonists of GnIH, through the modification of different amino acids of the described sequences, which can be
15 utilizados para inhibir o estimular la reproducción en animales adultos, respectivamente, con el consiguiente beneficio para el control y la mejora de la productividad de esta especie en acuicultura. 15 used to inhibit or stimulate reproduction in adult animals, respectively, with the consequent benefit to control and improve the productivity of this species in aquaculture.
- DESCRIPCIÓN DEL CONTENIDO DE LAS FIGURAS DESCRIPTION OF THE CONTENT OF THE FIGURES
- Figura 1. Secuencia de 878 nuclc6tidos del precursor de GnIH de la lubina Figure 1. Sequence of 878 nucleotides of GnIH precursor of sea bass
- europea, Dicentrarchus labrax (SEQ ID NO 1). La secuencia presenta extremos European, Dicentrarchus labrax (SEQ ID NO 1). The sequence has extremes
- 5'UTR y 3'UTR, de 49 nucleótidos y 226 nucleótidos, respectivamente. La 5'UTR and 3'UTR, of 49 nucleotides and 226 nucleotides, respectively. The
- S S
- secuencia de 600 nuc1eótidos comprendida entre el atg (primer codoo, metionina) 600 nuc1eotide sequence between the atg (first codoo, methionine)
- y el tga (codón stop) marcados en gris se corresponde con la región codificante u and the tga (stop codon) marked in gray corresponds to the coding region u
- ORF (SEQ ID NO 2). La secuencia de 200 aminoácidos codificada se muestra en ORF (SEQ ID NO 2). The 200 amino acid sequence encoded is shown in
- mayúsculas con letra cursiva. En negrita y subrayadas se muestran dos posibles Capital letters with italics. In bold and underlined two possible ones are shown
- señales de poliadenilación (aataaa) presentes en el extremo 3'UTR. polyadenylation signals (aataaa) present at the 3'UTR end.
- 10 10
- Figura 2. Secuencia completa de 200 aminoácidos del precursor de La GnlH de la Figure 2. Complete 200 amino acid sequence of the GnlH precursor of the
- lubina europea (SEQ ID NO 3). El fragmento que se muestra corresponde a la European sea bass (SEQ ID NO 3). The fragment shown corresponds to the
- zona codificante de la secuencia de nucleótidos aislada. Los péptidos maduros coding zone of the isolated nucleotide sequence. Mature peptides
- sbGnlH-I o sbLPXRFa-1 (PLHLHANMPMRF, posición 94-105, SEQ ID NO 4) sbGnlH-I or sbLPXRFa-1 (PLHLHANMPMRF, position 94-105, SEQ ID NO 4)
- Y sbGnlH-2 o sbLPXRFa-2 (SPNSTPNMPQRF, posición 116-127, SEQ ID NO AND sbGnlH-2 or sbLPXRFa-2 (SPNSTPNMPQRF, position 116-127, SEQ ID NO
- 15 fifteen
- 5) aparecen marcados en negrita y sombreados en color gris. Nótese los 5) They are marked in bold and shaded in gray. Notice the
- aminoácidos de procesamiento de estos péptidos, que son K o R en el extremo 5' , Processing amino acids of these peptides, which are K or R at the 5 'end,
- Y GR en el extremo 3'. El codón stop se encuentra indicado por un asterisco. And GR at the 3 'end. The stop codon is indicated by an asterisk.
- Figura 3. Árbol filogenético del precursor identificado del péptido LPXRFamida Figure 3. Phylogenetic tree of the identified precursor of the LPXRFamide peptide
- y los posibles péptidos RFamidas de otros vertebrados. El método usado para and the possible RFamide peptides of other vertebrates. The method used to
- 20 twenty
- construir el árbol filogenético fue el "Neightbour-joining method". Los datos building the phylogenetic tree was the "Neightbour-joining method". The data
- fueron obtenidos mediante 1000 repeticiones, para detenninar los índices de were obtained by 1000 repetitions, to determine the rates of
- confianza dentro del árbol filogenético. Los ortólogos de GnIH comparten el trust within the phylogenetic tree. GnIH orthologs share the
- extremo C-tenninal común LPXRFamida (X = L o Q o M en el caso de peces) el Common C-tenninal end LPXRFamide (X = L or Q or M in the case of fish) the
- cual ha sido identificado en otros vertebrados desde humanos a peces. Los which has been identified in other vertebrates from humans to fish. The
- 25 25
- péptidos de lubina también sustituyen el aminoácido Lisina (L) por el aminoácido sea bass peptides also substitute the amino acid Lysine (L) for the amino acid
- metionina (M). methionine (M).
Figura 4. Expresión del péptido precursor de la GnIH en tejidos centrales y periféricos de lubina mediante RT-PCR. Figure 4. Expression of the GnIH precursor peptide in central and peripheral tissues of sea bass by RT-PCR.
Figura 5. Síntesis del péptido sbGnIH-1 de lubina, modificado con una amidación en su extremo e-tenninal (NH2-PLHLHANMPMRF-CONH2, SEQ ID NO 6). Se presenta el análisis mediante espectrofotometría de masas, que muestra un pico de peso molecular 1461,75 Da y el análisis de HPLC, que evidencia el pico correspondiente a la sbGnIH-l con un tiempo de retenci6n de 13,75 minutos y una pureza del 95,2%. La secuencia fue verificada mediante espectrometria de masas en tándem (MSIMS). Figure 5. Synthesis of sea bass sbGnIH-1 peptide, modified with an amidation at its e-tenninal end (NH2-PLHLHANMPMRF-CONH2, SEQ ID NO 6). The analysis is presented by mass spectrophotometry, which shows a peak of 1461.75 Da molecular weight and HPLC analysis, which shows the peak corresponding to sbGnIH-l with a retention time of 13.75 minutes and a purity of 95.2% The sequence was verified by tandem mass spectrometry (MSIMS).
Figura 6. Síntesis del péptido sbGnIH-2 de lubina, modificado con una amidación en su extremo C-tenninal (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7). Se presenta el análisis mediante espectrofotometria de masas, que muestra un pico de peso molecular 1373,65 Da y el análisis de HPLC, que evidencia el pico correspondiente a la sbGnIH-2 con un tiempo de retención de 13,1 minutos y una pureza del 95,1%. La secuencia fue verificada mediante espectrometría de masas en tándem (MSIMS). Figure 6. Synthesis of sea bass sbGnIH-2 peptide, modified with an amidation at its C-tenninal end (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7). The analysis is presented by mass spectrophotometry, which shows a peak of 1373.65 Da molecular weight and HPLC analysis, which shows the peak corresponding to sbGnIH-2 with a retention time of 13.1 minutes and a purity of 95.1% The sequence was verified by tandem mass spectrometry (MSIMS).
Figura 7. Test de ELISA del suero anti-sbGnIH-1 obtenido en conejo. Se muestra la respuesta obtenida en un ensayo del suero anti-sbGnIH-I generado frente al suero preinmune del mismo conejo. Se utilizaron placas de ELlSA cubiertas con el péptido sbGnIH-I libre (0.004 mg/ml) y proteína (0.002 mg/ml) y un rango de dilución de los sueros de 1: 121-1 : 161 OSI. El ensayo muestra un título óptimo a diluciones entre 1 :9000 y 1: 11500 (parte lineal de la curva entre 1 y 2 de absorbancia a 650 nm). Figure 7. ELISA test of the anti-sbGnIH-1 serum obtained in rabbit. The response obtained in an assay of the anti-sbGnIH-I serum generated against the preimmune serum of the same rabbit is shown. ELlSA plates coated with the free sbGnIH-I peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a serum dilution range of 1: 121-1: 161 OSI were used. The test shows an optimal titre at dilutions between 1: 9000 and 1: 11500 (linear part of the curve between 1 and 2 absorbance at 650 nm).
Figura 8. Test de ELISA del suero anti-sbGnIH-2 obtenido en conejo. Se muestra la respuesta obtenida en un ensayo del suero anti-sbGnIH-2 generado frente al suero preinmune del mismo conejo. Se utilizaron placas de ELlSA cubiertas con el péptido sbGnIH-2 libre (0.004 mg/ml) y proteína (0.002 mg/ml) y un rango de dilución de los sueros de 1: 121-1 : 1 6 1 051. El ensayo muestra un título óptimo a diluciones entre 1 :7000 y 1:11000 (parte lineal de la curva entre 1 y 2 de absorbancia a 650 nm). Figure 8. ELISA test of the anti-sbGnIH-2 serum obtained in rabbit. The response obtained in an assay of the anti-sbGnIH-2 serum generated against the preimmune serum of the same rabbit is shown. ELlSA plates coated with the free sbGnIH-2 peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a serum dilution range of 1: 121-1: 1 6 1 051 were used. The assay shows an optimal titre at dilutions between 1: 7000 and 1: 11000 (linear part of the curve between 1 and 2 absorbance at 650 nm).
Figura 9. Test de ELlSA del suero anti-sbGnIH-2 obtenido en cabra. Se muestra la respuesta obtenida en un ensayo del suero anti-sbGnfH-2 generado frente al suero preinmune de la misma cabra. Se utilizaron placas de ELlSA cubiertas con el péptido sbGnlH-2 libre (0.004 rnglrnl) y proteína (0.002 rnglrnl) y un rango de dilución de los sueros de 1: 121-1 : 161 OS l. El ensayo muestra un título óptimo a diluciones entre 1 :2000 y 1 :6000 (parte lineal de la curva entre 1 y 2 de absorbancia a 650 om). Figure 9. ELlSA test of anti-sbGnIH-2 serum obtained in goat. The response obtained in an assay of the anti-sbGnfH-2 serum generated against the preimmune serum of the same goat is shown. ELlSA plates coated with the free sbGnlH-2 peptide (0.004 rnglrnl) and protein (0.002 rnglrnl) and a serum dilution range of 1: 121-1: 161 OS l were used. The test shows an optimal titre at dilutions between 1: 2000 and 1: 6000 (linear part of the curve between 1 and 2 absorbance at 650 om).
Figura 10. Efecto del tratamiento intracerebroventricular (leV) con el péptido sbGnIH-2 sobre la expresión de GnRH-I, GnRH-2, Kiss-l y Kiss-2 en el cerebro de ejemplares machos de lubina europea. Las dosis empleadas fueron J~g, 211g Y 4"g totales de sbGnlH-2 disuelto en PBS. Los controles fueron tratados solo con vehículo (PBS). Los ejemplares fueron muestreados a las 6 y 12 horas postinyección (6 hpi Y 12 hpi, respectivamente). La expresión relativa para los genes objeto de estudio fue detenninada mediante PCR cuantitativa, usando el gen 18s Figure 10. Effect of intracerebroventricular (leV) treatment with the sbGnIH-2 peptide on the expression of GnRH-I, GnRH-2, Kiss-l and Kiss-2 in the brain of male European sea bass specimens. The doses used were J ~ g, 211g and 4 "g total sbGnlH-2 dissolved in PBS. The controls were treated only with vehicle (PBS). The specimens were sampled at 6 and 12 hours post injection (6 hpi and 12 hpi , respectively) The relative expression for the genes under study was determined by quantitative PCR, using the 18s gene
como normalizador. Cada valor representa la media ± error estándar de 5 individuos diferentes (n=5). Las diferentes letras indican diferencias estadísticas significativas entre grupos, tras aplicar ANOV A de una vía (p ~ 0.05) seguido del test de Tukey. as normalizer Each value represents the mean ± standard error of 5 different individuals (n = 5). The different letters indicate significant statistical differences between groups, after applying one-way ANOV A (p ~ 0.05) followed by the Tukey test.
Figura 11. Efecto del tratamiento intracerebroventricular (leV) con el péptido sbGnlH-2 sobre la expresión FSH y LH en la hipófisis de ejemplares machos de lubina europea. Las dosis empleadas fueron l ....g, 2....g Y 4 ....g totales de sbGnlH-2 disuelto en PBS. Los controles fueron tratados solo con vehículo (PBS). Los ejemplares fueron muestreados a las 6 y 12 horas post-inyección (6 hpi y 12 hpi. respectivamente). La expresión relativa para los genes objeto de estudio fue detenninada mediante PCR cuantitativa. usando el gen 18s como nonnaJizador. Cada valor representa la media ± error estándar de 5 individuos diferentes (0=5). Las diferentes letras indican diferencias estadísticas significativas entre grupos. tras aplicar ANOVA de una vía (p ~0.05) seguido del test de Tukey. Figure 11. Effect of intracerebroventricular (leV) treatment with the sbGnlH-2 peptide on FSH and LH expression in the pituitary gland of male European sea bass. The doses used were l .... g, 2 .... g and 4 .... g total sbGnlH-2 dissolved in PBS. Controls were treated with vehicle only (PBS). The specimens were sampled at 6 and 12 hours post-injection (6 hpi and 12 hpi. Respectively). Relative expression for the genes under study was determined by quantitative PCR. using the 18s gene as a nonnaJizador. Each value represents the mean ± standard error of 5 different individuals (0 = 5). Different letters indicate significant statistical differences between groups. after applying one-way ANOVA (p ~ 0.05) followed by the Tukey test.
MODO DE REALIZACIÓN DE LA INVENCIÓN EMBODIMENT OF THE INVENTION
La estrategia de clonación descrita anteriormente nos permitió obtener la secuencia completa de nucleótidos, que codifican para el precursor de la los hormona inhibidora de gonadotrofinas (GnIH) de la lubina Dicentrarchus labrax. El análisis de la secuencia de aminoácidos de la misma nos ha permitido postular la secuencia de dos péptidos maduros potencialmente funcionales de la familia RF-amida, denominados sbGnIH-l o sbLPXRFa-l (secuencia NH2PLHLHANMPMRF-CONH2) y sbGnIH-2 o sbLPXRFa-2 (secuencia NH2SPNSTPNMPQRF-CONH2). Estos péptidos fueron sintetizados, su peso molecular determinado por espectrofotometria de masas, purificados mediante HPLC y su secuencia verificada mediante espectrometria de masas en tándem (MSIMS). La actividad de estos péptidos en lubina fue detenninada mediante ensayos in vivo, tal como se describe a continuación. The cloning strategy described above allowed us to obtain the complete sequence of nucleotides, which code for the precursor of gonadotrophin inhibitor hormone (GnIH) from sea bass Dicentrarchus labrax. The analysis of the amino acid sequence thereof has allowed us to postulate the sequence of two potentially functional mature peptides of the RF-amide family, called sbGnIH-l or sbLPXRFa-l (sequence NH2PLHLHANMPMRF-CONH2) and sbGnIH-2 or sbLPXRFa- 2 (NH2SPNSTPNMPQRF-CONH2 sequence). These peptides were synthesized, their molecular weight determined by mass spectrophotometry, purified by HPLC and their sequence verified by tandem mass spectrometry (MSIMS). The activity of these peptides in sea bass was determined by in vivo assays, as described below.
Animales y recogidas de muestras Animals and sample collection
Un total de 40 lubinas (Dicentrarchus labrax), con un peso comprendido 839,03g ± 10, 12g se obtuvieron en el "Laboratorio de Cultivos Marinos" de la Universidad de Cádiz (Puerto Real, España), donde se mantuvieron en condiciones de fotoperiodo natural, temperatura de 19"C ± 1°C y salinidad constante de 39 ppt. Los peces fueron distribuidos en 8 tanques (5 ejemplares en cada tanque) con una capacidad total 1,3 m3 totales, un radio de 61 cm y 90 cm de altura. La cantidad de agua efectiva, teniendo en cuenta la densidad de carga, fue de 1 m3. A total of 40 sea bass (Dicentrarchus labrax), weighing 839.03g ± 10, 12g were obtained at the "Laboratory of Marine Cultures" of the University of Cádiz (Puerto Real, Spain), where they were kept in photoperiod conditions natural, temperature of 19 "C ± 1 ° C and constant salinity of 39 ppt. The fish were distributed in 8 tanks (5 specimens in each tank) with a total capacity of 1.3 m3 total, a radius of 61 cm and 90 cm The effective water quantity, taking into account the density of load, was 1 m3.
Para detenninar la funcionalidad de la GnlH sobre el eje reproductivo de la lubina se analizaron sus efectos sobre los niveles de ARN mensajero de diversos genes implicados en la estimulación de la reproducción (GnRH-l, GnRH-2, GnRH-3, Kisspeptina-l, Kisspeptina-2, FSH y LH) mediante PCR cuantitativa. Para ello, los peces fueron anestesiados con MS-222 (Sigma St Louis, MO), medidos, y pesados. Se les realizó una pequeña incisión en el cráneo con un microtaladro a modo de vía, y se inyectaron intracerebroventriculannente (leV) con la ayuda de To determine the functionality of GnlH on the reproductive axis of sea bass, its effects on the levels of messenger RNA of various genes involved in the stimulation of reproduction were analyzed (GnRH-l, GnRH-2, GnRH-3, Kisspeptin-l , Kisspeptin-2, FSH and LH) by quantitative PCR. For this, the fish were anesthetized with MS-222 (Sigma St Louis, MO), measured, and weighed. A small incision was made in the skull with a microtaladro as a way, and they were injected intracerebroventriculannente (leV) with the help of
- un micromanipulador I~lg, 2~lg o 4~lg del péptido sbGnlH-l (NH2a micromanipulator I ~ lg, 2 ~ lg or 4 ~ lg of the sbGnlH-l peptide (NH2
- SPNSTPNMPQRF-CONH2), utilizando como vehículo PBS. Los individuos SPNSTPNMPQRF-CONH2), using as a PBS vehicle. Individuals
- controles fueron inyectados exclusivamente con PBS. Los individuos tratados y Controls were injected exclusively with PBS. The treated individuals and
- sus controles fueron sacrificados a las 6 horas y 9 horas después de la inyección. their controls were sacrificed at 6 hours and 9 hours after the injection.
- S S
- Los cerebros y las hipófisis de los ejemplares se extrajeron mediante disección, y The brains and pituitary glands of the specimens were removed by dissection, and
- las muestras se congelaron inmediatamente en nitrógeno líquido y se almacenaron the samples were immediately frozen in liquid nitrogen and stored
- seguidamente a -800C hasta su posterior análisis. El ARN total de las muestras then at -800C until further analysis. The total RNA of the samples
- fue extraído usando TRIsure (Bioline, Londres, Reino Unido) siguiendo las was extracted using TRIsure (Bioline, London, United Kingdom) following the
- recomendaciones del fabricante, fue cuantificado mediante espectro fotometría en manufacturer's recommendations, was quantified by photometry spectrum in
- 10 10
- un equipo NANODROP (Eppendorf) y su pureza fue evaluada por la relación de a NANODROP team (Eppendorf) and its purity was evaluated by the ratio of
- absorbancias Abs260 nmlAbs280 nm. El ARN total (1 ~g) fue retrotranscrito a Absorbances Abs260 nmlAbs280 nm. Total RNA (1 ~ g) was retrotranscribed to
- ADN copia (ADNc) y el ADN genómico fue eliminado usando el QuantiTect® Copy DNA (cDNA) and genomic DNA was removed using QuantiTect®
- Reverse Transcription Kit (Qiagen, Hilden, Alemania). El análisis de la expresión Reverse Transcription Kit (Qiagen, Hilden, Germany). The expression analysis
- génica se llevó a cabo en un equipo de PCR cuantitativa un equipo CFX96 gene was carried out in a quantitative PCR team a CFX96 team
- lS lS
- Manager System (Bio-Rad, Alcobendas. España) y el kit SensiF AST SYBR No Manager System (Bio-Rad, Alcobendas. Spain) and the SensiF AST SYBR No kit
- ROX (Bioline, Londres, Reino Unido). Las reacciones de qPCR se llevaron a ROX (Bioline, London, United Kingdom). QPCR reactions were led to
- cabo por duplicado en un volumen total de 20 ~I, a partir de 5 ng de ADNc, con conducted in duplicate in a total volume of 20 ~ I, from 5 ng cDNA, with
- cebadores específicos obtenidos a partir de las secuencias GnRH-J, GnRH-2, specific primers obtained from the sequences GnRH-J, GnRH-2,
- GnRH-3, Kisspeptina-l , Kisspeptina-2, FSH y LH de lubina disponibles en las GnRH-3, Kisspeptina-l, Kisspeptina-2, FSH and sea bass LH available in
- 20 twenty
- bases de datos, usando el gen l8S de lubina como gen nonnalizador (Ver Tabla). databases, using the sea bass l8S gene as a nonnalizing gene (See Table).
- El protocolo seguido en la PCR cuantitativa fue el siguiente: a) Activación de la The protocol followed in the quantitative PCR was the following: a) Activation of the
- enzima: 950C durante 2 minutos; b) 40 ciclos: Desnaturalización a 95DC durante enzyme: 950C for 2 minutes; b) 40 cycles: Denaturation at 95DC during
- lO s; Anillamiento y extensión a 60"C (GnRH-I, GnRH-3, FSH, LH, 18S); 610C the; Banding and extension at 60 "C (GnRH-I, GnRH-3, FSH, LH, 18S); 610C
- (Kiss-l , Kiss-2) y 63°C (GnRH-2), durante 25 segundos; c). Curva de melting de (Kiss-l, Kiss-2) and 63 ° C (GnRH-2), for 25 seconds; C). Melting curve
- 2S 2S
- 70°C a 95°C cada 0.5°C durante 5 segundos. Se generaron curvas de melting de 70 ° C to 95 ° C every 0.5 ° C for 5 seconds. Melting curves of
- cada muestra, para corroborar que presentaban un único pico y solo se amplificaba each sample, to confirm that they had a single peak and only amplified
- el gen objeto de estudio. Para descartar la posible contaminación del agua se The gene under study. To rule out possible water contamination,
- realizaron controles negativos sustituyendo el ADNc por agua DEPe. La They performed negative controls by replacing the cDNA with DEPe water. The
- expresión de los genes estudiados se calculó mediante el método .6..6.Ct. Las Expression of the genes studied was calculated using the method .6..6.Ct. The
- 30 30
- posibles diferencias significativas en la expresión de los genes objeto de estudio possible significant differences in the expression of the genes under study
- entre los animales inyectados con las distintas dosis de sbGnlH-2 (1 ~lg, 2~lg o among animals injected with the different doses of sbGnlH-2 (1 ~ lg, 2 ~ lg or
4~g) Y los controles (PBS) en los distintos tiempos post-inyección (6 y 12 horas post-inyección), se analizaron mediante el estadístico ANOV A de una vía, seguido del test de Tukcy. Cuando los requerimientos de nonnalidad y homogeneidad de varianza no fueron satisfechos, se realizaron las 4 ~ g) And the controls (PBS) at the different post-injection times (6 and 12 hours post-injection), were analyzed using the one-way ANOV A statistic, followed by the Tukcy test. When the requirements for nonnality and homogeneity of variance were not satisfied, the
5 transfonnacioncs necesarias (transfonnación logarítmica o raíz) para cumplir con estos requisitos. Las diferencias se consideraron significativas con P<O.05 . 5 necessary transfonnacioncs (logarithmic or root transfonnación) to meet these requirements. The differences were considered significant with P <O.05.
Los resultados obtenidos demostraron el cfccto inhibidor de la sbGnIH-2 sobre la GnRH-l , GnRH-2, Kisspcptina-l , Kisspcptina-2, FSH y LH de lubina, mostrando su efectividad para provocar un bloqueo del eje reproductivo en esta especie. Esta 10 evidencia demuestra la utilidad de la GnIH de lubina para reducir la incidencia de la pubertad precoz o frenar el proceso reproductivo en la lubina. Estos efectos inhibidores de la reproducción pueden incidir de forma positiva en el crecimiento y la productividad de esta especie en la práctica aeuíeola ya que está claramente demostrado que la energía destinada a la reproducción representa un límite para The results obtained demonstrated the cfccto inhibitor of sbGnIH-2 on GnRH-l, GnRH-2, Kisspcptina-l, Kisspcptina-2, FSH and LH of sea bass, showing its effectiveness in causing a blockage of the reproductive axis in this species. This evidence demonstrates the usefulness of sea bass GnIH to reduce the incidence of precocious puberty or slow down the reproductive process in sea bass. These inhibitory effects of reproduction can have a positive impact on the growth and productivity of this species in aeuíola practice since it is clearly demonstrated that the energy destined to reproduction represents a limit for
15 los recursos energéticos destinados al crecimiento. 15 energy resources for growth.
- Tabla: Cebadores usados en PCR cuantitativa Table: Primers used in quantitative PCR
- Nombre del cebador Primer Name
- Secuencia (S -3') Sequence (S -3 ')
- GnRH1(1') GnRH1 (1 ')
- GGTCFT~TGGACT.EAT,,~GG GGTCFT ~ TGGACT.EAT ,, ~ GG
- GnRH1{R) GnRH1 {R)
- TGATICCTCTGCACAACCTAA TGATICCTCTGCACAACCTAA
- GnRH2(1') .~ GnRH2{R) GnRH2 (1 '). ~ GnRH2 {R)
- TGGGCT(¡ctréiWtGTGT, ~j<. " -...,.""".;....~-""-.. CCAGCTCCCTCTTGCCTC TGGGCT (¡ctréiWtGTGT, ~ j <. "-...,." "".; .... ~ - "" - .. CCAGCTCCCTCTTGCCTC
- GnRH3(F) GnRH3 (F)
- TGT®GÁGAGt;tAGAt~t 'f", TGT®GÁGAGt; tAGAt ~ t 'f ",
- GnRH3{R) GnRH3 {R)
- GTITGGGCACTCGCCTCTI GTITGGGCACTCGCCTCTI
- Kfssl(F) Kfssl (F)
- GéÁTCAATACTGGCATCAGCAAAGA GéÁTCAATACTGGCATCAGCAAAGA
- Kiss l{R) Kiss l {R)
- TCAÁCCATTCTGACCTGGGAAAcrT TCAACCCATTCTGACCTGGGAAAcrT
- Ki",(F) Ki ", (F)
- 9GGAGGATIC~GCCCGTGTTTCT 9GGAGGATIC ~ GCCCGTGTTTCT
- Kiss2{R) Kiss2 {R)
- GAGGCCGAACGGGTIGAAGTIGAA GAGGCCGAACGGGTIGAAGTIGAA
- LH~lff' LH ~ lff '
- rtGAGCTTCCT~CTGttCA rtGAGCTTCCT ~ CTGttCA
- LH~ (Rl LH ~ (Rl
- GCAGGCTCTCGAAGGTACAG GCAGGCTCTCGAAGGTACAG
- FSH~ (Fl FSH ~ (Fl
- ACCAACATCAGCATt~G1G ACCAACATCAGCATt ~ G1G
- 18S (F) 18S (F)
- TCAGACCCAAAACCCATGCG TCAGACCCAAAACCCATGCG
- 18S (Rl 18S (Rl
- ACCctGATICCCCGTIACCC ACCctGATICCCCGTIACCC
Claims (69)
- 1. one.
- Un polinucleótido aislado cuya secuenCIa de nucleótidos presenta una identidad de secuencia de al menos un 80% con (a) la SEQ ID NO 1, o (b) la secuencia complementaria de dicha secuencia de nucleótidos, o (e) ambos (a) y (b). An isolated polynucleotide whose nucleotide sequence has a sequence identity of at least 80% with (a) SEQ ID NO 1, or (b) the complementary sequence of said nucleotide sequence, or (e) both (a) and (b).
- 2. 2.
- Un polinucleótido aislado cuya secuencia de nucleótidos presenta una identidad de secuencia de al menos un 80% con (a) la SEQ ID NO 2, o (h) la secuencia complementaria de dicha secuencia de nucleótidos, o (e) ambos (a) y (b). An isolated polynucleotide whose nucleotide sequence has a sequence identity of at least 80% with (a) SEQ ID NO 2, or (h) the complementary sequence of said nucleotide sequence, or (e) both (a) and (b).
- 3. 3.
- Un polinucleótido aislado cuya secuencia de nudeótidos presenta una identidad de secuencia de al menos un 80% con (a) la secuencia que codifica un polipéptido que tiene la secuencia de aminoácidos presentada en la SEQ ID NO 3 desde el residuo aminoacídico número 1 al 93, o (b) la secuencia complementaria de dicha secuencia de nucleótidos, o (c) ambos An isolated polynucleotide whose nudeotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a polypeptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 1 to 93, or (b) the complementary sequence of said nucleotide sequence, or (c) both
- 4. Four.
- Un polinucleótido aislado cuya secuencia de nucleótidos presenta una identidad de secuencia de al menos un 80% con (a) la secuencia que codifica un péptido que tiene la secuencia de aminoácidos presentada en la SEQ ID NO 3 desde el residuo aminoacídico número 94 al 105, o (b) la secuencia complementaria de dicha secuencia de nucleótidos, o (c) ambos An isolated polynucleotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 94 to 105, or (b) the complementary sequence of said nucleotide sequence, or (c) both
- 5. 5.
- Un polinucleótido aislado cuya secuencia de nucleótidos presenta una identidad de secuencia de al menos un 80% con (a) la secuencia que codifica un péptido que tiene la secuencia dc aminoácidos presentada en la SEQ ID NO 3 desde el residuo aminoacídico número 106 al 115, o (b) la An isolated polynucleotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 106 to 115, or (b) the
- 8. 8.
- Los polinucleótidos aislados en las reivindicaciones ] a 7 en forma de ADN The isolated polynucleotides in claims] to 7 in the form of DNA
- 9. 9.
- Los polinucIeótidos aislados en las reivindicaciones 1 a 7 en forma de ARN The polynucIeotides isolated in claims 1 to 7 in the form of RNA
- 10. 10.
- Un polipéptido precursor sbGnIH de 200 aminoácidos que tiene una identidad de secuencia de al menos un 80% con la secuencia descrita en la figura 2 (SEQ ID NO 3) o una sal no tóxica del mismo. A 200 amino acid sbGnIH precursor polypeptide having a sequence identity of at least 80% with the sequence described in Figure 2 (SEQ ID NO 3) or a non-toxic salt thereof.
- 11. eleven.
- Un péptido sbGnlH-l de 12 aminoácidos que tiene una identidad de secuencia de al menos un 80% con la secuencia NH2-PLHLHANMPMRFCOOH (SEQ ID NO 4) o una sal no tóxica del mismo. A 12 amino acid sbGnlH-1 peptide having a sequence identity of at least 80% with the NH2-PLHLHANMPMRFCOOH sequence (SEQ ID NO 4) or a non-toxic salt thereof.
- 12. 12.
- Un péptido como el descrito en la SEQ ID NO 4, modificado con una amidación en su extremo C-tcnninal, que tiene una identidad de secuencia de al menos un 80% con la secuencia NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) o una sal no tóxica del mismo. A peptide such as that described in SEQ ID NO 4, modified with an amidation at its C-tcnninal end, which has a sequence identity of at least 80% with the sequence NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) or a non-toxic salt thereof.
- 13. 13.
- Un péptido como los descritos en las reivindicaciones 11 y 12, en los cuales se han eliminado I o más aminoácidos. A peptide as described in claims 11 and 12, in which I or more amino acids have been removed.
- 14. 14.
- Un péptido como los descritos en las reivindicaciones 1I y 12, en los cuales se han añadido 1 o más aminoácidos. A peptide as described in claims 1I and 12, in which 1 or more amino acids have been added.
- 15. fifteen.
- Un péptido como los descritos en las reivindicaciones 11 , 12, 13 Y 14 en los cuales se han modificado 1 o más aminoácidos. A peptide as described in claims 11, 12, 13 and 14 in which 1 or more amino acids have been modified.
- 16. 16.
- Un péptido sbGnlH-2 de 12 aminoácidos que tiene una identidad de secuencia de al menos un 80% con la secuencia NHrSPNSTPNMPQRFCOOH (SEQ JD NO 5) o una sal no tóxica del mismo. A 12 amino acid sbGnlH-2 peptide having a sequence identity of at least 80% with the NHrSPNSTPNMPQRFCOOH sequence (SEQ JD NO 5) or a non-toxic salt thereof.
- 17. 17.
- Un péptido como el descrito en la SEQ ID NO 5, modificado con una amidación en su extremo C-tenninal, que tiene una identidad de secuencia de al menos un 80% con la secuencia NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7) o una sal no tóxica del mismo. A peptide as described in SEQ ID NO 5, modified with an amidation at its C-tenninal end, which has a sequence identity of at least 80% with the sequence NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7) or a non-toxic salt thereof.
- 18. 18.
- Un péptido como los descritos en las reivindicaciones 16 y 17. en los cuales se han eliminado 1 o más aminoácidos. A peptide as described in claims 16 and 17. in which 1 or more amino acids have been removed.
- 19. 19.
- Un péptido como los descritos en las reivindicaciones 16 y 17, en los cuales se han anadido I o más aminoácidos. A peptide as described in claims 16 and 17, in which I or more amino acids have been added.
- 20. twenty.
- Un péptido como los descritos en las reivindicaciones 16, 17, 18 Y 19, en los cuales se han modificado 1 o más aminoácidos. A peptide as described in claims 16, 17, 18 and 19, in which 1 or more amino acids have been modified.
- 21. twenty-one.
- Un anticuerpo capaz de unirse específicamente a péptidos que tienen una identidad de secuencia de al menos un 80% con los péptidos descritos en las reivindicaciones 11 y 12. An antibody capable of specifically binding to peptides having a sequence identity of at least 80% with the peptides described in claims 11 and 12.
- 22. 22
- El uso del anticuerpo descrito en la reivindicación 21 en técnicas inmunocitoquímicas e inmunohistoquímicas, de Wcstcrn-blot, de DotBlol, de ELISA y de EIA. The use of the antibody described in claim 21 in immunocytochemical and immunohistochemical, Wcstcrn-blot, DotBlol, ELISA and EIA techniques.
- 23. 2. 3.
- Un anticuerpo capaz de unirse específicamente a péptidos que tienen una identidad de secuencia de al menos un 80% con los péptidos descritos en las reivindicaciones 16 y 17. An antibody capable of specifically binding to peptides having a sequence identity of at least 80% with the peptides described in claims 16 and 17.
- 24. 24.
- El uso del anticuerpo descrito en la reivindicación 23 en técnicas inmunocitoquímicas e inmunohistoquímicas, de Westem-blot, de OotBlOl, de ELISA y de EIA. The use of the antibody described in claim 23 in immunocytochemical and immunohistochemical, Westem-blot, OotBlOl, ELISA and EIA techniques.
- 25. 25.
- Un método de inhibir o estimular la reproducción de los peces mediantc la administración a dicho pez de una cantidad eficaz de un péptido que tiene A method of inhibiting or stimulating the reproduction of fish through the administration to said fish of an effective amount of a peptide having
- una identidad de secuencia de al menos un 80% con el péptido descrito en la reivindicación 12 (NH,-PLHLHANMPMRF-CONH" SEQ ID NO 6) o una sal no tóxica del mismo. a sequence identity of at least 80% with the peptide described in claim 12 (NH, -PLHLHANMPMRF-CONH "SEQ ID NO 6) or a non-toxic salt thereof.
- s s
- 26. Un método según la reivindicación 25, en el que dicha administración es mediante inyección. 26. A method according to claim 25, wherein said administration is by injection.
- 10 10
- 27. Un método según la reivindicación 25, en el que dicha administración es la implantación. 28. Un método según la reivindicación 25, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. 27. A method according to claim 25, wherein said administration is implantation. 28. A method according to claim 25, wherein said administration is by dissolving in water in which the fish are swimming.
- 15 fifteen
- 29. Un método según la reivindicación 25, en el que dicha administración es por vía oral a través de la alimentación. 29. A method according to claim 25, wherein said administration is orally through feeding.
- 20 twenty
- 30. Un método según la reivindicación 25, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que pennita sobreexpresar o dejar de expresar a voluntad dicho péptido. 30. A method according to claim 25, wherein said administration is by transgenesis through a vector that includes a promoter that pennites overexpress or stop expressing said peptide at will.
- 25 25
- 31 . Un método de inhibir la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con el péptido descrito en la reivindicación 17 (NH,-SPNSTPNMPQRF-CONH" SEQ ID NO 7) o una sal no tóxica del mismo. 31. A method of inhibiting fish reproduction by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptide described in claim 17 (NH, -SPNSTPNMPQRF-CONH " SEQ ID NO 7) or a non-toxic salt thereof.
- 32. 32
- Un método según la reivindicación 31, en el que dicha administración es mediante inyección. A method according to claim 31, wherein said administration is by injection.
- 33. 33.
- Un método según la reivindicación 31, en el que dicha administración es la implantación. A method according to claim 31, wherein said administration is implantation.
- 34. 3. 4.
- Un método según la reivindicación 31, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 31, wherein said administration is by dissolving in water in which the fish are swimming.
- 35. 35
- Un método según la reivindicación 31, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 31, wherein said administration is orally through feeding.
- 36. 36.
- Un método según la reivindicación 31, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobrcexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 31, wherein said administration is by transgenesis through a vector that includes a promoter that allows to over-express or stop expressing said peptide at will.
- 37. 37.
- Un método de inhibir o estimular la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con los péptidos descritos cn la reivindicaciones 10, 11, 13, 14,15,16,18, 19 Y 20 A method of inhibiting or stimulating the reproduction of fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10, 11, 13, 14 , 15,16,18, 19 and 20
- 38. 38.
- Un método según la reivindicación 37, en el que dicha administración es mediante inyección. A method according to claim 37, wherein said administration is by injection.
- 39. 39.
- Un método según la reivindicación 37, en el que dicha administración es la implantación. A method according to claim 37, wherein said administration is implantation.
- 40. 40
- Un método segUn la reivindicación 37, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 37, wherein said administration is by dissolving in water in which the fish are swimming.
- 41. 41.
- Un método según la reivindicación 37, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 37, wherein said administration is orally through feeding.
- 42. 42
- Un método según la reivindicación 37, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que pennita sobreexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 37, wherein said administration is by transgenesis through a vector that includes a promoter that pennites overexpress or stop expressing said peptide at will.
- 43. 43
- Un método de inhibir o estimular el crecimiento de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con los péptidos descritos en la reivindicaciones 10, 11, 12, 13, 14, 15, 16,17, 18, 19y20. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10, 11, 12, 13 , 14, 15, 16.17, 18, 19 and 20.
- 44. 44.
- Un método según la reivindicación 43, en el que dicha administración es mediante inyección. A method according to claim 43, wherein said administration is by injection.
- 45. Four. Five.
- Un método según la reivindicación 43, en el que dicha administración es la implantación. A method according to claim 43, wherein said administration is implantation.
- 46. 46.
- Un método segun la reivindicación 43, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 43, wherein said administration is by dissolving in water in which the fish are swimming.
- 47. 47
- Un método según la reivindicación 43, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 43, wherein said administration is orally through feeding.
- 48. 48.
- Un método según la reivindicación 43, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 43, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.
- 49. 49.
- Un método de inhibir o estimular la ¡ngesta de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con los péptidos descritos cnlarcivindicaciones IO,Il, 12, 13,14,15, 16. 17, 18, 19y20. A method of inhibiting or stimulating the intake of fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims IO, Il, 12, 13, 14,15, 16. 17, 18, 19 and 20.
- 50. fifty.
- Un método según la reivindicación 49, en el que dicha administración es mediante inyección. A method according to claim 49, wherein said administration is by injection.
- 51. 51.
- Un método según la reivindicación 49, en el que dicha administración es la implantación. A method according to claim 49, wherein said administration is implantation.
- 52. 52
- Un método según la reivindicación 49, en el que dicha administración es mediante la disolución cn agua en la que los peces están nadando. A method according to claim 49, wherein said administration is by dissolving water in which the fish are swimming.
- 53. 53.
- Un método según la reivindicación 49, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 49, wherein said administration is orally through feeding.
- 55. 55.
- Un método de inhibir o estimular la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de polinucle6tidos que tienen una identidad de secuencia de al menos un 80% con los polinucleótidos descritos en las reivindicaciones 8 y 9. A method of inhibiting or stimulating fish reproduction by administering to said fish an effective amount of polynucleotides having a sequence identity of at least 80% with the polynucleotides described in claims 8 and 9.
- 56. 56.
- Un método según la reivindicación 55, en el que dicha administración es mediante inyección. A method according to claim 55, wherein said administration is by injection.
- 57. 57.
- Un método según la reivindicación 55, en el que dicha administración es la implantación. A method according to claim 55, wherein said administration is implantation.
- 58. 58.
- Un método según la reivindicación 55, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 55, wherein said administration is by dissolving in water in which the fish are swimming.
- 59. 59.
- Un método según la reivindicación 55, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 55, wherein said administration is orally through feeding.
- 60. 60
- Un método según la reivindicación 55, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar O dejar de expresar a voluntad dicho polinucleótido. A method according to claim 55, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said polynucleotide at will.
- 61. 61.
- Un método de inhibir O estimular el crecimiento de los peces mediante la administración a dicho pez de una cantidad eficaz de polinucleótidos que tienen una identidad de secuencia de al menos un 80% con los polinucleótidos descritos en las reivindicaciones 8 y 9. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of polynucleotides having a sequence identity of at least 80% with the polynucleotides described in claims 8 and 9.
- 62. Un método según la reivindicación 61, en el que dicha administración es mediante inyección. 62. A method according to claim 61, wherein said administration is by injection.
- s s
- 63. Un método según la reivindicación 61, en el que dicha administración es la implantación. 63. A method according to claim 61, wherein said administration is implantation.
- 10 10
- 64. Un método según la reivindicación 61, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. 65. Un método según la reivindicación 61, en el que dicha administración es por vía oral a través de la alimentación. 64. A method according to claim 61, wherein said administration is by dissolving in water in which the fish are swimming. 65. A method according to claim 61, wherein said administration is orally through feeding.
- 15 fifteen
- 66. Un método según la reivindicación 61, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho polinucleótido. 66. A method according to claim 61, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said polynucleotide at will.
- 20 twenty
- 67. Un método de inhibir o estimular la ¡ngesta de Jos peces mediante la administración a dicho pez de una cantidad eficaz de polinucleótidos que tienen una identidad de secuencia de al menos un 80% con los poJinucleótidos descritos en las reivindicaciones 8 y 9. 67. A method of inhibiting or stimulating the intake of fish by administering to said fish an effective amount of polynucleotides having a sequence identity of at least 80% with the poJinucleotides described in claims 8 and 9.
- 25 25
- 68. Un método según la reivindicación 67, en el que dicha administración es mediante inyección. 68. A method according to claim 67, wherein said administration is by injection.
- 70. Un método según la reivindicación 67, en el que dicha administración es mediante la di solución en agua en la que los peces están nadando. 70. A method according to claim 67, wherein said administration is by means of the solution in water in which the fish are swimming.
- s s
- 71. Un método según la reivindicación 67, en el que dicha administración es por vía oral a través de la alimentación. 71. A method according to claim 67, wherein said administration is orally through feeding.
- 10 10
- 72. Un método según la reivindicación 67, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho polinucleótido. 72. A method according to claim 67, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said polynucleotide at will.
- 15 fifteen
- 73. Un método de inhibir o estimular la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de los anticuerpos descritos en las reivindicaciones 21 y 23. 74. Un método según la reivindicación 73, en el que dicha administración es mediante inyección. 73. A method of inhibiting or stimulating fish reproduction by administering to said fish an effective amount of the antibodies described in claims 21 and 23. 74. A method according to claim 73, wherein said administration is by injection.
- 20 twenty
- 75. Un método según la reivindicación 73, en el que dicha administración es la implantación. 75. A method according to claim 73, wherein said administration is implantation.
- 76. Un método según la reivindicación 73, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. 76. A method according to claim 73, wherein said administration is by dissolving in water in which the fish are swimming.
- 77. 77.
- Un método según la reivindicación 73, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 73, wherein said administration is orally through feeding.
- 78. 78.
- Un método de inhibir o estimular el crecimiento de los peces mediante la administración a dicho pez de una cantidad eficaz de los anticuerpos descritos en las reivindicaciones 21 y 23. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.
- 79. 79.
- Un método según la reivindicación 78, en el que dicha administración es mediante inyección. A method according to claim 78, wherein said administration is by injection.
- 80. 80.
- Un método según la reivindicación 78, en el que dicha administración es la implantación. A method according to claim 78, wherein said administration is implantation.
- 81. 81.
- Un método segun la reivindicación 78, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 78, wherein said administration is by dissolving in water in which the fish are swimming.
- 82. 82.
- Un método según la reivindicación 78, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 78, wherein said administration is orally through feeding.
- 83. 83.
- Un método de inhibir o estimular la ¡ngesta de los peces mediante la administración a dicho pez de una cantidad eficaz de los anticuerpos descritos en las reivindicaciones 21 y 23. A method of inhibiting or stimulating the intake of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.
- 84. 84.
- Un método según la reivindicación 83, en el que dicha administración es mediante inyección. A method according to claim 83, wherein said administration is by injection.
- 85. 85.
- Un método segun la reivindicación 83, en el que dicha administración es la implantación. A method according to claim 83, wherein said administration is implantation.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
ES201400644A ES2561708B2 (en) | 2014-07-31 | 2014-07-31 | Gonadotrophin inhibitor hormone (GnIH) and its use to control puberty, reproduction, intake and growth in fish |
PCT/ES2014/000196 WO2016016478A1 (en) | 2014-07-31 | 2014-11-20 | Gonadotropin-inhibitory hormone (gnih) and use thereof to control the puberty, reproduction, ingestion and growth of fish |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
ES201400644A ES2561708B2 (en) | 2014-07-31 | 2014-07-31 | Gonadotrophin inhibitor hormone (GnIH) and its use to control puberty, reproduction, intake and growth in fish |
Publications (2)
Publication Number | Publication Date |
---|---|
ES2561708A1 ES2561708A1 (en) | 2016-02-29 |
ES2561708B2 true ES2561708B2 (en) | 2016-06-30 |
Family
ID=55216798
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
ES201400644A Active ES2561708B2 (en) | 2014-07-31 | 2014-07-31 | Gonadotrophin inhibitor hormone (GnIH) and its use to control puberty, reproduction, intake and growth in fish |
Country Status (2)
Country | Link |
---|---|
ES (1) | ES2561708B2 (en) |
WO (1) | WO2016016478A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107058391A (en) * | 2017-05-05 | 2017-08-18 | 湖南农业大学 | A kind of slow virus carrier of high efficient expression mouse gonadotropin inhibiting hormone (GN-IH) gene and its application |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5643877A (en) * | 1994-12-05 | 1997-07-01 | University Of Maryland Biotechnology Institute | Compounds comprising gonadotropin releasing hormone (GnRH) and methods for controlling reproduction in fish |
US6949365B2 (en) * | 2002-06-12 | 2005-09-27 | University Of New Hampshire | Polynucleotides encoding lamprey GnRH-III |
-
2014
- 2014-07-31 ES ES201400644A patent/ES2561708B2/en active Active
- 2014-11-20 WO PCT/ES2014/000196 patent/WO2016016478A1/en active Application Filing
Also Published As
Publication number | Publication date |
---|---|
ES2561708A1 (en) | 2016-02-29 |
WO2016016478A1 (en) | 2016-02-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sébert et al. | Melatonin activates brain dopaminergic systems in the eel with an inhibitory impact on reproductive function | |
Weltzien et al. | The brain–pituitary–gonad axis in male teleosts, with special emphasis on flatfish (Pleuronectiformes) | |
Mylonas et al. | Promoting oocyte maturation, ovulation and spawning in farmed fish | |
Mazurais et al. | Central melatonin receptors in the rainbow trout: comparative distribution of ligand binding and gene expression | |
Aliaga‐Guerrero et al. | Gonadotropin‐inhibitory hormone in the flatfish, Solea senegalensis: Molecular cloning, brain localization and physiological effects | |
Sower | The endocrinology of reproduction in lampreys and applications for male lamprey sterilization | |
Matsuda et al. | Orexin system in teleost fish | |
Luckenbach et al. | Regulation of pituitary GnRH receptor and gonadotropin subunits by IGF1 and GnRH in prepubertal male coho salmon | |
Wang et al. | Molecular characterization of Kiss2 receptor and in vitro effects of Kiss2 on reproduction-related gene expression in the hypothalamus of half-smooth tongue sole (Cynoglossus semilaevis) | |
Fairgrieve et al. | Molecular characterization of the gonadal kisspeptin system: cloning, tissue distribution, gene expression analysis and localization in sablefish (Anoplopoma fimbria) | |
US7521057B2 (en) | Lamprey GnRH-III polypeptides and methods of making thereof | |
Wang et al. | Molecular characterization of kiss2 and differential regulation of reproduction-related genes by sex steroids in the hypothalamus of half-smooth tongue sole (Cynoglossus semilaevis) | |
US20150072933A1 (en) | Novel sequences for the control of reproduction in fish | |
Fukunaga et al. | Involvement of melatonin in transducing moon-related signals into the reproductive network of the female honeycomb grouper Epinephelus merra | |
Clark et al. | Calcitonin: characterisation and expression in a teleost fish, Fugu rubripes | |
Feng et al. | Alternative splicing of GnRH2 and GnRH2-associated peptide plays roles in gonadal differentiation of the rice field eel, Monopterus albus | |
ES2561708B2 (en) | Gonadotrophin inhibitor hormone (GnIH) and its use to control puberty, reproduction, intake and growth in fish | |
Ohta et al. | Sexually dimorphic expression of pituitary glycoprotein hormones in a sex‐changing fish (Pseudolabrus sieboldi) | |
Wang et al. | LPXRFa and its receptor in yellowtail kingfish (Seriola lalandi): molecular cloning, ontogenetic expression profiles, and stimulatory effects on growth hormone and gonadotropin gene expression | |
Ahmed et al. | Effect of food restriction on reproductive-related genes and reproductive hormones in adult female rats. | |
Degani et al. | cDNA cloning of blue gourami (Trichogaster trichopterus) prolactin and its expression during the gonadal cycles of males and females | |
Zhao et al. | Characterization and differential expression of three GnRH forms during reproductive development in cultured turbot Schophthalmus maximus | |
Zhang et al. | cDNA sequence and spatio-temporal expression of prolactin in the orange-spotted grouper, Epinephelus coioides | |
Degani et al. | cDNA cloning and mRNA expression of growth hormone in Belontiidae (Anabantoidei suborder) | |
Van Gulick et al. | Co-localization of three gonadotropin-releasing hormone transcripts in larval, parasitic, and adult sea lamprey brains |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FG2A | Definitive protection |
Ref document number: 2561708 Country of ref document: ES Kind code of ref document: B2 Effective date: 20160630 |