ES2561708A1

ES2561708A1 - Gonadotrophin inhibitory hormone (gnih) and its use to control puberty, reproduction, intake and growth in fish (Machine-translation by Google Translate, not legally binding)

Info

Publication number: ES2561708A1
Application number: ES201400644A
Authority: ES
Inventors: José Antonio MUÑOZ CUETO; José Antonio PAULLADA SALMERON
Original assignee: Universidad de Cadiz
Current assignee: Universidad de Cadiz
Priority date: 2014-07-31
Filing date: 2014-07-31
Publication date: 2016-02-29
Anticipated expiration: 2034-07-31
Also published as: ES2561708B2; WO2016016478A1

Abstract

The gonadotropin inhibiting hormone (gnih) and its use to control puberty, reproduction, ingestion and growth in fish. The sea bass, dicentrarchus labrax, is one of the most cultivated species in the eu. A problem in their culture is the advancement of puberty, which leads to poor growth and deterioration in the quality of the meat. The present invention is part of the biotechnology sector (aquaculture application sector). The invention relates the cloning strategy of the gonadotrophin inhibitor hormone (gnih) of sea bass, which contains two new peptides from the rfamide family. These peptides have been synthesized and used to generate specific antibodies and have been shown to have inhibitory effects on different neuroendocrine and endocrine factors that control the reproduction of sea bass. This invention may be of interest to control puberty, reproduction, ingestion and growth of fish. (Machine-translation by Google Translate, not legally binding)

Description

secreción de gonadotrofinas (GTHs), siendo su antagonista funcional en peces la dopamina, que inhibe la secreción estas hormonas adenohipofisarias que controlan la reproducción (GTHs), como se demostró en el carpín dorado (Peter y Paulencu, 1980; Chang y Peter, 1983; Chang et al., 1983). La existencia de una inhibición dopaminérgica sobre la secreción de gonadotrofinas ha sido demostrada en otras especies de peces teleósteos, tales como la anguila, el pez gato, la trucha, la tilapia, el salmón coho, la carpa o el mujol (Van Asselt et al., 1988; Levavi-Sivan et al., 2003; Vidal et al., 2004; Dufour et al., 2005; Aizen et al., 2005). Estos conocimientos permitieron utilizar la GnRH y desarrollar compuestos agonistas y antagonistas de la GnRH y/o la dopamina (pimozide, domperidona), así como métodos de combinación y administración de los mismos para controlar el proceso reproductivo de peces en la práctica acuícola, como se refleja en las patentes US5288705A, EP0368000B 1, US5643877 A, WO 1996017619A9, US6210927Bl, US7958848B2, entre otras. Sin embargo, la dopamina no parece operar en otros peces teleósteos, en particular en peces marinos como la lubina y otros perciformes (Copeland and Thomas, 1989; King et al., 1994; Holland et al., 1998b; Zohar and Mylonas, 2001; Prat et al., 2001). Gonadotrophin secretion (GTHs), being its functional antagonist in fish dopamine, which inhibits the secretion of these adenohypophyseal hormones that control reproduction (GTHs), as demonstrated in the golden carpín (Peter and Paulencu, 1980; Chang and Peter, 1983 ; Chang et al., 1983). The existence of a dopaminergic inhibition of gonadotrophin secretion has been demonstrated in other species of teleost fish, such as eel, catfish, trout, tilapia, coho salmon, carp or mujol (Van Asselt et al ., 1988; Levavi-Sivan et al., 2003; Vidal et al., 2004; Dufour et al., 2005; Aizen et al., 2005). This knowledge allowed the use of GnRH and the development of agonist and antagonistic compounds of GnRH and / or dopamine (pimozide, domperidone), as well as methods of combining and administering them to control the reproductive process of fish in aquaculture practice, as reflected in patents US5288705A, EP0368000B 1, US5643877 A, WO 1996017619A9, US6210927Bl, US7958848B2, among others. However, dopamine does not appear to operate in other teleost fish, particularly marine fish such as sea bass and other perciform fish (Copeland and Thomas, 1989; King et al., 1994; Holland et al., 1998b; Zohar and Mylonas, 2001 ; Prat et al., 2001).

La Hormona Inhibidora de las Gonadotrofinas (GnIH) Gonadotrophin Inhibitory Hormone (GnIH)

En el año 2000 se identificó en aves un pequeño péptido hipotalámico de 12 aminoácidos que actuaba directamente sobre la hipófisis inhibiendo la síntesis y liberación de gonadotrofinas (Tsutsui et al., 2000; Tsutsui et al., 2007), por lo que fue denominado hormona inhibidora de las gonadotrofinas o GnIH. In 2000, a small hypothalamic peptide of 12 amino acids was identified in birds that acted directly on the pituitary gland by inhibiting the synthesis and release of gonadotrophins (Tsutsui et al., 2000; Tsutsui et al., 2007), so it was called the hormone Gonadotropin inhibitor or GnIH.

El precursor de la proteína que codifica el gen GnIH origina 2 o 3 posibles péptidos maduros, dependiendo de la especie, caracterizados por un extremo Cterminal que contiene la secuencia de aminoácidos LPQRFamida, que puede variar en uno o dos aminoácidos dependiendo de la especie estudiada. De los posibles péptidos que se encuentran codificados por el gen GnIH, solo aquellos que tienen un papel de inhibición de la secreción de las gonadotrofinas son denominados como GnIH. The precursor of the protein encoding the GnIH gene originates 2 or 3 possible mature peptides, depending on the species, characterized by a Cterminal end that contains the amino acid sequence LPQRFamide, which can vary by one or two amino acids depending on the species studied. Of the possible peptides that are encoded by the GnIH gene, only those that have a role in inhibiting gonadotrophin secretion are referred to as GnIH.

La familia de la GnIH incluye diferentes péptidos, que dependiendo del grupo filogenético, han recibido distintos nombres. Así, en mamíferos están caracterizados los péptidos RFRP-l, RFRP-2 Y RFRP-3; en aves se ha descrito un péptido GnIH, y dos péptidos relacionados con la GnIH denominados GnIHRP-l y GnIHRP-2; en ranas se ha denominado al péptido GnIH como fGRP, y a los péptidos relacionados codificados por este precursor como fGRP-RP-l, fGRP-RP2; en peces teleósteos, tales como el pez cebra o el carpín dorado, se han descrito tres posibles péptidos GnIH, denominados LPXRFa-l, LPXRFa-2 y LPXRFa-3, pudiendo ser la X=L o Q(Parhar et al., 2012). The GnIH family includes different peptides, which, depending on the phylogenetic group, have received different names. Thus, in mammals the RFRP-1, RFRP-2 and RFRP-3 peptides are characterized; in birds, a GnIH peptide has been described, and two GnIH-related peptides called GnIHRP-1 and GnIHRP-2; in frogs the GnIH peptide has been designated as fGRP, and related peptides encoded by this precursor as fGRP-RP-1, fGRP-RP2; In teleost fish, such as zebrafish or goldfish, three possible GnIH peptides, called LPXRFa-l, LPXRFa-2 and LPXRFa-3, may be described as X = L or Q (Parhar et al., 2012 ).

La identificación y localización cerebral de este neuropéptido, mediante técnicas ELISA, técnicas inmunohistoquímicas, técnicas de hibridación in situ (Tsutsui et al., 2000; Tsutsui y Ukena, 2006; Tsutsui et al., 2007), así como la distribución de las fibras en zonas donde se ubican las células liberadoras de gonadotrofinas, sugieren que la GnIH tiene un efecto modulador de la síntesis y liberación de la propia GnRH además de ejercer sus efector inhibidores directos sobre la secreción de gonadotrofinas (hormona luteinizante (LH) y hormona estimulante del foliculo (FSH)) como se ha demostrado en vertebrados tales como aves y mamíferos. Además de 10 mencionado anteriormente, la GnIH también impide el desarrollo gonadal, la síntesis de esteroides y la actividad espermatogénica en aves, 10 que sugiere que este neuropéptido puede actuar a distintos niveles del eje reproductivo (Tsutsui et al., 2007; Bentley et al., 2009). The identification and cerebral location of this neuropeptide, through ELISA techniques, immunohistochemical techniques, in situ hybridization techniques (Tsutsui et al., 2000; Tsutsui and Ukena, 2006; Tsutsui et al., 2007), as well as the fiber distribution In areas where gonadotrophin-releasing cells are located, they suggest that GnIH has a modulating effect on the synthesis and release of GnRH itself, in addition to exerting its direct inhibitor effector on the secretion of gonadotrophins (luteinizing hormone (LH) and hormone stimulating follicle (FSH)) as demonstrated in vertebrates such as birds and mammals. In addition to the aforementioned 10, GnIH also prevents gonadal development, steroid synthesis and spermatogenic activity in birds, 10 which suggests that this neuropeptide can act at different levels of the reproductive axis (Tsutsui et al., 2007; Bentley et al ., 2009).

La presencia de células GnIH en el hipotálamo posterior parece ser una característica conservada a 10 largo de la evolución de vertebrados (Tsutsui et al., 2007). Así, recientemente se ha puesto también de manifiesto la presencia de un péptido similar de tipo LPXRF-amida en peces (Sawada et al., 2002; Osugi et al., 2006; Tsutsui et al., 2007). La localización del péptido del tipo LPXRF-amida (homologo a la GnIH de aves y mamíferos) en peces, incluida la lubina europea, ha permitido caracterizar la presencia del mismo en células de áreas cerebrales tales como el bulbo olfativo/nervio terminal, y en el área preóptica, zonas donde se encuentran ubicadas las células de tipo GnRH-III y GnRH-I, respectivamente (González-Martínez et al., 2001, 2002). También se han localizado células GnIH en la región del tegmento mesencefálico, donde se encuentran las células de tipo GnRH-II (González-Martínez et al., 2001, 2002). La presencia de inervación GnIH en áreas neuroendocrinas relacionadas con la reproducción como el área preóptica y el hipotálamo, la inervación GnIH presente en la hipófisis y la expresión de GnIH en las gónadas de la lubina, hace pensar que la GnIH también puede estar ejerciendo efectos inhibidores a distintos niveles del eje reproductivo en peces perciformes y, mas concretamente, en la lubina europea, donde se ha centrado nuestro estudio. The presence of GnIH cells in the posterior hypothalamus seems to be a conserved characteristic throughout the evolution of vertebrates (Tsutsui et al., 2007). Thus, the presence of a similar peptide of the LPXRF-amide type in fish has recently been revealed (Sawada et al., 2002; Osugi et al., 2006; Tsutsui et al., 2007). The location of the peptide of the LPXRF-amide type (homologous to the GnIH of birds and mammals) in fish, including European sea bass, has allowed characterizing its presence in cells of brain areas such as the olfactory bulb / terminal nerve, and in the preoptic area, areas where GnRH-III and GnRH-I type cells are located, respectively (González-Martínez et al., 2001, 2002). GnIH cells have also been located in the region of the mesencephalic tegment, where GnRH-II type cells are found (González-Martínez et al., 2001, 2002). The presence of GnIH innervation in neuroendocrine areas related to reproduction such as the preoptic area and the hypothalamus, GnIH innervation present in the pituitary gland and GnIH expression in sea bass gonads, suggests that GnIH may also be exerting inhibitory effects. at different levels of the reproductive axis in perciform fish and, more specifically, in European sea bass, where our study has focused.

La relación entre la función reproductiva y el balance energético esta bien establecida y, como regla general, aquellos péptidos que estimulan la ingesta suprimen la función reproductiva y viceversa. Estudios recientes han demostrado que además de sus funciones reproductivas, la GnIH puede también tener un efecto estimulador en la ingesta de alimentos. Este efecto estimulador ha sido observado en diferentes especies de pájaros (Tachaibana et al., 2005, 2008) y roedores (Johnson et al., 2007; Johnson y Fraley, 2008, Murakami et al., 2008). Sin embargo, el tratamiento con GnIH humana en gallos tiene un efecto inhibidor de la ingesta (eline et al., 2008), 10 que sugiere la importancia especie-especifica de la secuencia de aminoácidos de la GnIH para su efecto fisiológico. El hallazgo de proyecciones GnIH en el cerebro de oveja en el entorno de las células secretoras de neuropéptido Y (NPY) Y de las propiomelacortinas (POMC), concuerda con el efecto descrito de la GnIH sobre la ingesta de alimento y sugiere que estas interacciones pueden mediar en estos efectos (Qi et al., 2009). Por todo 10 dicho anteriormente, la GnIH parece ser un neuropéptido multifuncional, que controla el balance que existe entre reproducción, ingesta y crecimiento. The relationship between reproductive function and energy balance is well established and, as a general rule, those peptides that stimulate intake suppress reproductive function and vice versa. Recent studies have shown that in addition to its reproductive functions, GnIH can also have a stimulating effect on food intake. This stimulatory effect has been observed in different species of birds (Tachaibana et al., 2005, 2008) and rodents (Johnson et al., 2007; Johnson and Fraley, 2008, Murakami et al., 2008). However, treatment with human GnIH in roosters has an inhibitory effect on intake (eline et al., 2008), 10 which suggests the species-specific importance of the amino acid sequence of GnIH for its physiological effect. The finding of GnIH projections in sheep's brain in the environment of neuropeptide-secreting cells Y (NPY) and propiomelacortins (POMC), agrees with the described effect of GnIH on food intake and suggests that these interactions may mediate these effects (Qi et al., 2009). For all the above, GnIH seems to be a multifunctional neuropeptide, which controls the balance between reproduction, intake and growth.

Problemática planteada. Issue raised.

La producción de mundial de alimentos deberá crecer un 70% entre 2010 y 2050. En relación a los alimentos de origen acuáticos, más de la mitad del total consumido hoy en el mundo procede de granjas de acuicultura. En 2030 se estima World food production should grow 70% between 2010 and 2050. In relation to food of aquatic origin, more than half of the total consumed today in the world comes from aquaculture farms. In 2030 it is estimated

que esta producción rondara el 65%. ASÍ, la producción de pescado de acuicultura en la Unión Europea en 2011 fue 647.156 Toneladas, siendo España el Estado miembro de la UE con mayor volumen de producción en acuicultura con 271.963 That this production is around 65%. Thus, aquaculture fish production in the European Union in 2011 was 647,156 Tons, with Spain being the EU Member State with the highest volume of aquaculture production with 271,963

t. en 2011, un 7,8% más que en 2010 (frente al 2,3% de incremento de la pesca) y con un valor económico de 457 millones de euros, un 9,7% más que en 2010 (Informe APROMAR 2013). t. in 2011, 7.8% more than in 2010 (compared to 2.3% increase in fishing) and with an economic value of 457 million euros, 9.7% more than in 2010 (APROMAR 2013 Report) .

La lubina, Dicentrarchus labrax, es junto a la dorada, una de las especies que sostienen la producción de la acuicultura marina en Andalucía, en España y en Europa. Entre las principales especies acuÍcolas de la Unión Europea, la lubina se situó en el 6° lugar en cuanto a producción (73.196 Tn), yen 5° lugar en cuanto a valor económico (casi 400 millones de euros). En la Comunidad de Andalucía la lubina acumuló en 2012 el 66% de la producción de peces, con 4.150 Toneladas y un valor de 29,4 millones de euros. The sea bass, Dicentrarchus labrax, is next to the sea bream, one of the species that sustains the production of marine aquaculture in Andalusia, in Spain and in Europe. Among the main aquaculture species of the European Union, sea bass was in 6th place in terms of production (73,196 tons), and in 5th place in terms of economic value (almost 400 million euros). In the Community of Andalusia, sea bass accumulated in 2012 66% of fish production, with 4,150 tons and a value of 29.4 million euros.

No obstante, aunque el cultivo de lubina está en la actualidad ampliamente distribuido, la reproducción controlada de esta especie y su producción son manifiestamente mejorables. En el caso de la lubina, uno de los principales problemas que se presentan es el adelanto de la pubertad y de la primera reproducción en condiciones de cultivo, en particular en machos. Este aspecto debe ser tenido muy en cuenta por su implicación práctica en la productividad de las piscifactorías (Carrillo et al., 1993; 1995; 2009). Un desarrollo gonadal precoz conlleva crecimientos pobres y un deterioro de la calidad de la carne, como se ha puesto de manifiesto en salmónidos, carpas, lubina y bacalao, por 10 que en estas especies es conveniente suprimir o retrasar la pubertad para permitir un mayor crecimiento somático adecuado del animal. However, although the cultivation of sea bass is currently widely distributed, the controlled reproduction of this species and its production are manifestly improvable. In the case of sea bass, one of the main problems that arise is the advancement of puberty and the first reproduction in growing conditions, particularly in males. This aspect must be taken into account by its practical implication in the productivity of the farms (Carrillo et al., 1993; 1995; 2009). Early gonadal development leads to poor growth and a deterioration in meat quality, as has been shown in salmonids, carp, sea bass and cod, because in these species it is convenient to suppress or delay puberty to allow for greater growth. adequate somatic of the animal.

Además, hay que tener en cuenta que la temperatura representa un factor limitante en la reproducción de esta especie. Las ovulaciones y las puestas en hembras sólo se producen de forma espontánea cuando el rango de temperatura es 9-17°C, y por encima de 16-17°C la puesta se bloquea a pesar de que las hembras han alcanzado la maduración (Carrillo et al., 2009). Ello implica en muchos casos la necesidad de enfriar el agua en las instalaciones acuícolas, con el consiguiente coste In addition, it should be borne in mind that temperature represents a limiting factor in the reproduction of this species. Ovulations and laying in females only occur spontaneously when the temperature range is 9-17 ° C, and above 16-17 ° C the laying is blocked even though the females have reached maturation (Carrillo et al., 2009). This implies in many cases the need to cool water in aquaculture facilities, with the consequent cost

económico. Sin embargo, los mecanismos mediante los cuales las temperaturas elevadas inhiben el proceso reproductivo están aún sin esclarecer. economic. However, the mechanisms by which elevated temperatures inhibit the reproductive process are still unclear.

Por ello, la presente invención se centra en la clonación y caracterización del precursor de la hormona inhibidora de gonadotrofinas o GnIH, síntesis de los S péptidos maduros sbGnIH-l y sbGnIH-2, generación de anticuerpos específicos contra los péptidos sbGnIH-l y sbGnIH-2, su uso para identificar las células GnIH y sus proyecciones, así como en la determinación de los efectos de la GnIH en la lubina europea Dicentrarchus 1abrax. Estas herramientas generadas pueden ser de gran utilidad para solventar estos problemas de pubertad precoz en la lubina Therefore, the present invention focuses on the cloning and characterization of the gonadotrophin inhibitor hormone or GnIH, synthesis of mature S peptides sbGnIH-l and sbGnIH-2, generation of specific antibodies against sbGnIH-l and sbGnIH peptides -2, its use to identify GnIH cells and their projections, as well as in determining the effects of GnIH on European sea bass Dicentrarchus 1abrax. These generated tools can be very useful to solve these problems of precocious puberty in sea bass

10 y dilucidar los mecanismos mediante los cuales se inhibe la reproducción en la lubina, proporcionando la posibilidad de generar antagonistas funcionales de la GnIH que sean usados para favorecer la reproducción de esta especie. 10 and to elucidate the mechanisms by which reproduction in sea bass is inhibited, providing the possibility of generating functional GnIH antagonists that are used to favor the reproduction of this species.

Bibliographic references used

1. one.: Aizen, J., 1. Meiri, 1. Tzchori, B. Levavi-Sivan, H. Rosenfeld, 2005. Enhancing spawning in the grey mullet (Mugil cephalus) by removal of dopaminergic inhibition. Gen Comp EndocrinolI42:2l2-221. Aizen, J., 1. Meiri, 1. Tzchori, B. Levavi-Sivan, H. Rosenfeld, 2005. Enhancing spawning in the gray mullet (Mugil cephalus) by removal of dopaminergic inhibition. Gene Comp Endocrinol I42: 2l2-221.

2. 2.: APROMAR. 2013. La Acuicultura Marina de Peces en España 2013. Fondo Europeo de la Pesca (Unión Europea), Ministerio de Medio Ambiente y Medio Rural y Marino APPROVE. 2013. Marine Fish Aquaculture in Spain 2013. European Fisheries Fund (European Union), Ministry of Environment and Rural and Marine Affairs

3. 3.: Bentley GE, Ubuka T, McGuire NL, Calisi R, Perfito N, Kriegsfeld LJ, Wingfield JC, Tsutsui K. 2009. Gonadotrophin-inhibitory hormone: a multifunctional neuropeptide. J Neuroendocrinol. 21: 276-281. Bentley GE, Ubuka T, McGuire NL, Calisi R, Perfito N, Kriegsfeld LJ, Wingfield JC, Tsutsui K. 2009. Gonadotrophin-inhibitory hormone: a multifunctional neuropeptide. J Neuroendocrinol. 21: 276-281.

4. Four.: Carrillo, M., S. Zanuy, F. Prat, R. Serrano, N. R. Bromage. 1993. Environmental induction of spawning in sea bass, pp. 43-54 in Recent advances in Aquaculture, vol 4, edited by R. J. Roberts and 1. Muir. Blackwell Scientific publications, London. Carrillo, M., S. Zanuy, F. Prat, R. Serrano, N. R. Bromage. 1993. Environmental induction of spawning in sea bass, pp. 43-54 in Recent advances in Aquaculture, vol 4, edited by R. J. Roberts and 1. Muir. Blackwell Scientific publications, London.

5. 5.: Carrillo, M., S. Zanuy, F. Prat, 1. Cerdá, J. Ramos, E. Mañanós, N. Bromage. 1995. Sea bass, pp. 138-168 in Broodstock management and egg and larval quality, edited by N. R. Bromage and R. 1. Roberts. Blackwell, Oxford, U.K. Carrillo, M., S. Zanuy, F. Prat, 1. Cerdá, J. Ramos, E. Mañanós, N. Bromage. 1995. Sea bass, pp. 138-168 in Broodstock management and egg and larval quality, edited by N. R. Bromage and R. 1. Roberts. Blackwell, Oxford, U.K.

6. 6.: Carrillo M., Zanuy S., Bayarri M.J. 2009. El control ambiental de la reproduccion de los peces con especial referencia al control del ciclo sexual, de la pubertad y de la precocidad. Capítulo 3. En "La Reproducción de los peces: aspectos básicos y sus aplicaciones en acuicultura". Manuel Adrian Carrillo Estévez (Coordinador), Juan Espinosa de los Monteros (Editor científico). Serie: Publicaciones Científicas y Tecnológicas de la Fundación Observatorio Español de Acuicultura. Fundación Observatorio Español de Acuicultura, Consejo Superior de Investigaciones Científicas y Ministerio de Medio Ambiente y Medio Rural Marino. Madrid. ISBN: 978-6-1. pp: 173-246. Carrillo M., Zanuy S., Bayarri M.J. 2009. Environmental control of fish reproduction with special reference to the control of the sexual cycle, puberty and precocity. Chapter 3. In "The Reproduction of fish: basic aspects and their applications in aquaculture". Manuel Adrian Carrillo Estévez (Coordinator), Juan Espinosa de los Monteros (Scientific Editor). Series: Scientific and Technological Publications of the Spanish Aquaculture Observatory Foundation. Spanish Aquaculture Observatory Foundation, Higher Council for Scientific Research and Ministry of Environment and Marine Rural Environment. Madrid. ISBN: 978-6-1. pp: 173-246.

7. 7.: Chang, JE, Peter, RE. 1983. Effects of pimozide and Des GlylO, (D Ala6) luteinizing hormone-releasing hormone ethyalmide on serum gonadotropin Chang, JE, Peter, RE. 1983. Effects of pimozide and Des GlylO, (D Ala6) luteinizing hormone-releasing hormone ethyalmide on serum gonadotropin

concentration, germinal vesicle migration, and ovulation in female goldfish, Carassius auratus. Gen Comp Endocrinol. 52: 30-37 concentration, germinal vesicle migration, and ovulation in female goldfish, Carassius auratus. Endocrinol Comp gene. 52: 30-37

8. Chang, lP, Cook, RE, Peter, RE. 1983. Influence of catecholamines on gonadotropin secretion in goldfish, Carassius auratus. Gen Comp Endocrinol. 8. Chang, lP, Cook, RE, Peter, RE. 1983. Influence of catecholamines on gonadotropin secretion in goldfish, Carassius auratus. Endocrinol Comp gene.

49: 22-31 49: 22-31

9. Cline, M.A., Bowden, C.N., Calchary, W.A., Layne, l.E., 2008. Short-term anorexigenic effects of central neuropeptide VF are associated with hypothalamic changes in chicks. lournal of Neuroendocrinology 20, 9719. Cline, M.A., Bowden, C.N., Calchary, W.A., Layne, l.E., 2008. Short-term anorexigenic effects of central neuropeptide VF are associated with hypothalamic changes in chicks. lournal of Neuroendocrinology 20, 971

977. 977

10. 10.: Copeland, P.A., Thomas, P. 1989. Control of gonadotropin release in the Atlantic croaker Micropogonias undulatus: evidence for lack of dopaminergic inhibition. Gen. Comp. Endocrinol. 74,474-483. Copeland, P.A., Thomas, P. 1989. Control of gonadotropin release in the Atlantic croaker Micropogonias undulatus: evidence for lack of dopaminergic inhibition. Gen. Comp. Endocrinol 74,474-483.

11. eleven.: Dufour, S., F.-A. Weltzien, M.-E. Sebert, N. Le Belle, B. Vidal, P. Vernier, Dufour, S., F.-A. Weltzien, M.-E. Sebert, N. Le Belle, B. Vidal, P. Vernier,

C. Pasqualini. 2005. Dopaminergic inhibition of reproduction in teleost fishes: ecophysiological and evolutionary implications. Ann NY Acad Sci 1040:9-22. C. Pasqualini. 2005. Dopaminergic inhibition of reproduction in teleost fishes: ecophysiological and evolutionary implications. Ann NY Acad Sci 1040: 9-22.

12. 12.: González-Martínez, D., Madigou, T., Zmora, N., Anglade, l., Zanuy, S., Zohar, Y., Elizur, A., Muñoz-Cueto, l.A. y Kah, O. 2001. Differential expression of three different prepro-GnRH (Gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). l. Comp. Neurol. 429:144-155. González-Martínez, D., Madigou, T., Zmora, N., Anglade, l., Zanuy, S., Zohar, Y., Elizur, A., Muñoz-Cueto, l.A. and Kah, O. 2001. Differential expression of three different prepro-GnRH (Gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). l. Comp. Neurol 429: 144-155.

13. 13.: González-Martínez D., Zmora N., Mañanos E., Saligaut D., Zanuy S., Zohar Y., Elizur A., Kah O. and Muñoz-Cueto l. A. 2002. Immunohistochemical localization of three different prepro-GnRHs (Gonadotrophin-releasing hormones) in the brain and pituitary ofthe European sea bass (Dicentrarchus labrax) using antibodies to the corresponding GnRH-associated peptides. 1. Comp. Neurol. 446: 95-113. González-Martínez D., Zmora N., Mañanos E., Saligaut D., Zanuy S., Zohar Y., Elizur A., Kah O. and Muñoz-Cueto l. A. 2002. Immunohistochemical localization of three different prepro-GnRHs (Gonadotrophin-releasing hormones) in the brain and pituitary of the European sea bass (Dicentrarchus labrax) using antibodies to the corresponding GnRH-associated peptides. 1. Comp. Neurol 446: 95-113.

14. 14.: Holland, M.C.H., y. Gothilf, 1. Meiri, lA. King, K. Okuzawa, A. Elizur, Y. Zohar. 1998a. Levels of the native forms of GnRH in the pituitary of the Holland, M.C.H., and. Gothilf, 1. Meiri, lA. King, K. Okuzawa, A. Elizur, Y. Zohar. 1998a. Levels of the native forms of GnRH in the pituitary of the

gilthead seabream, Sparus aurata, at several characteristic stages of the gonadal cyc1e. Gen Comp Endocrinoll12: 394-405. gilthead seabream, Sparus aurata, at several characteristic stages of the gonadal cyc1e. Gene Comp Endocrinoll12: 394-405.

15. fifteen.: Holland, M.C., S. Hassin, Y. Zohar. 1998b. Effects of long-term testosterone, gonadotropin-releasing hormone agonist, and pimozide treatments on gonadotropin II levels and ovarian development in juvenile female striped bass (Morone saxatilis). Biol Reprod 59:1153-1162. Holland, M.C., S. Hassin, Y. Zohar. 1998b. Effects of long-term testosterone, gonadotropin-releasing hormone agonist, and pimozide treatments on gonadotropin II levels and ovarian development in juvenile female striped bass (Morone saxatilis). Biol Reprod 59: 1153-1162.

16. 16.: Johnson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide3 stimu-lates GH secretion inhibits LH secretion, and has variable effects on sex behavior in the adult mal e rat. Hormones and Behavior 51, 171-180. Johnson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide3 stimu-lates GH secretion inhibits LH secretion, and has variable effects on sex behavior in the adult mal e rat. Hormones and Behavior 51, 171-180.

17. 17.: Johnson, M.A., Fraley, G.S., 2008. Rat RFRP-3 alters hypothalamic GHRH expression and growth hormone secretion but does not affect KiSS-l gene expression or the onset of puberty in male rats. Neuroendocrinology 88, 305Johnson, M.A., Fraley, G.S., 2008. Rat RFRP-3 alters hypothalamic GHRH expression and growth hormone secretion but does not affect KiSS-l gene expression or the onset of puberty in male rats. Neuroendocrinology 88, 305

315. 315

18. 18.: Kah, O., J.G. Dulka, P. Dubourg, J. Thibault, R.E. Peter. 1987. Neuroanatomical substrate for the inhibition of gonadotropin secretion in goldfish: existence of a dopaminergic preoptico-hypophyseal pathway. Neuroendocrinology 45:451-458. Kah, O., J.G. Dulka, P. Dubourg, J. Thibault, R.E. Peter 1987. Neuroanatomical substrate for the inhibition of gonadotropin secretion in goldfish: existence of a dopaminergic preoptico-hypophyseal pathway. Neuroendocrinology 45: 451-458.

19. 19.: Kah, O., J.M. Danger, P. Dubourg, G. Pelletier, H. Vaudry, A. Calas. 1989. Characterization, cerebral distribution and gonadotropin-release activity of neuropeptide Y (NPY) in the goldfish. Fish Physiol Biochem 7: 69-76. Kah, O., J.M. Danger, P. Dubourg, G. Pelletier, H. Vaudry, A. Calas. 1989. Characterization, cerebral distribution and gonadotropin-release activity of neuropeptide Y (NPY) in the goldfish. Fish Physiol Biochem 7: 69-76.

20. twenty.: Kah, O., V.L. Trudeau, B.D. Sloley, P. Dubourg, J.P. Chang, K.L. Yu, R.E. Peter. 1992. Involvement of GABA in the neuroendocrine regulation of gonadotrophin release in the goldfish.Neuroendocrinology 55: 396-404. Kah, O., V.L. Trudeau, B.D. Sloley, P. Dubourg, J.P. Chang, K.L. Yu, R.E. Peter 1992. Involvement of GABA in the neuroendocrine regulation of gonadotrophin release in the goldfish.Neuroendocrinology 55: 396-404.

21. twenty-one.: Kah, O., 1. Anglade, E. Leprétre, P. Dubourg, D. de Monbrison. 1993. The reproductive brain in fish. Fish Physiol Biochem 11 :85-98. Kah, O., 1. Anglade, E. Leprétre, P. Dubourg, D. de Monbrison. 1993. The reproductive brain in fish. Fish Physiol Biochem 11: 85-98.

22. 22: King, W.V., Thomas, P., Harrell, R.M., Hodson, R.G., Sullivan, C.V. 1994. Plasma levels of gonadal steroids during final oocyte maturation of striped bass, Morone saxatilis L. Gen. Comp. Endocrinol. 95,178-191. King, W.V., Thomas, P., Harrell, R.M., Hodson, R.G., Sullivan, C.V. 1994. Plasma levels of gonadal steroids during final oocyte maturation of striped bass, Morone saxatilis L. Gen. Comp. Endocrinol 95,178-191.

23. 2. 3.: Levavi-Sivan, B., A. Avitan, T. Kanias, 2003. Characterization of the inhibitory dopamine receptor from the pituitary of tilapia. Fish Physiol Biochem 28:73-75. Levavi-Sivan, B., A. Avitan, T. Kanias, 2003. Characterization of the inhibitory dopamine receptor from the pituitary of tilapia. Fish Physiol Biochem 28: 73-75.

24. 24.: Osugi, T., K. Ukena, S.A. Sower, H. Kawauchi, K. Tsutsui. 2006. Evolutionary origin and divergence of PQRFamide peptides and LPXRFamide peptides in the RFamide peptide fami1y. Insights from novel lamprey RFamidepeptides. FEBS J. 273: 1731-1743. Osugi, T., K. Ukena, S.A. Sower, H. Kawauchi, K. Tsutsui. 2006. Evolutionary origin and divergence of PQRFamide peptides and LPXRFamide peptides in the RFamide peptide fami1y. Insights from novel lamprey RFamidepeptides. FEBS J. 273: 1731-1743.

25. 25.: Parhar 1., Ogawa S., Kitahashi T. 2012 RFamide peptides as mediators in environmental control of GnRH neurons. Progress in Neurobiology 98: 176Parhar 1., Ogawa S., Kitahashi T. 2012 RFamide peptides as mediators in environmental control of GnRH neurons. Progress in Neurobiology 98: 176

196. 196

26. 26.: Peter, RE, Paulencu, C. 1980. Involvement of the preoptic region in gonadotropin release-inhibition m goldfish, Carassius auratus. Neuroendocrinology. 31: 133-141 Peter, RE, Paulencu, C. 1980. Involvement of the preoptic region in gonadotropin release-inhibition m goldfish, Carassius auratus. Neuroendocrinology 31: 133-141

27. 27.: Prat, F., S. Zanuy, M. Carrillo, 2001 Effect of gonadotropin-releasing honnone analogue GnRHa and pimozide on plasma levels of sex steroids and ovarian development in sea bass Dicentrarchus labrax L. Aquaculture 198: 325-338 Prat, F., S. Zanuy, M. Carrillo, 2001 Effect of gonadotropin-releasing honnone analogue GnRHa and pimozide on plasma levels of sex steroids and ovarian development in sea bass Dicentrarchus labrax L. Aquaculture 198: 325-338

28. 28.: Qi, Y., Oldfield, B.J., Clarke, !.J., 2009. Projections of RFamide-related peptide-3 neurones in the ovine hypothalamus, with special reference to regions regulating energy balance and reproduction. Journal of Neuroendocrinology 21,690-697. Qi, Y., Oldfield, B.J., Clarke,! .J., 2009. Projections of RFamide-related peptide-3 neurons in the ovine hypothalamus, with special reference to regions regulating energy balance and reproduction. Journal of Neuroendocrinology 21,690-697.

29. 29.: Sawada, K., K. Ukena, H. Satake, E. Iwakoshi, H. Minakata, K.Tsutsui. 2002. Novel fish hypothalamic neuropeptide: Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide. Eur J Biochem 269:6000-6008. Sawada, K., K. Ukena, H. Satake, E. Iwakoshi, H. Minakata, K. Tsutsui. 2002. Novel fish hypothalamic neuropeptide: Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide. Eur J Biochem 269: 6000-6008.

30. 30: Tachibana, T., Sato, M., Takahashi, H., Ukena, K., Tsutsui, K., Furuse, M., 2005. Gonadotropin-inhibiting honnone stimulates feeding behavior in chicks. Brain Research 1050,94-100. Tachibana, T., Sato, M., Takahashi, H., Ukena, K., Tsutsui, K., Furuse, M., 2005. Gonadotropin-inhibiting honnone stimulates feeding behavior in chicks. Brain Research 1050.94-100.

31. 31.: Tachibana, T., Masuda, N., Tsutsui, K., Ukena, K., Ueda, H., 2008. The orexigenic effect of GnIH is mediated by central opio id receptors in chicks. Comparative Bio-chemistry and Physiology Part A: Molecular & Integrative Physiology 150,21-25. Tachibana, T., Masuda, N., Tsutsui, K., Ukena, K., Ueda, H., 2008. The orexigenic effect of GnIH is mediated by central opio id receptors in chicks. Comparative Bio-chemistry and Physiology Part A: Molecular & Integrative Physiology 150,21-25.

32. 32: Trudeau, V.L. 1997. Neuroendocrine regulation of gonadotrophin II release and gonadal growth in the goldfish, Carassius auratus. Rev Reprod 2: 55-68. Trudeau, V.L. 1997. Neuroendocrine regulation of gonadotrophin II release and gonadal growth in the goldfish, Carassius auratus. Rev Reprod 2: 55-68.

33. 33.: Tsutsui, K., and K. Ukena. 2006. Review: Hypothalamic LPXRF-amide peptides in vertebrates: identification, 10calization and hypophysiotropic activity. Peptides 27: 1121-1129. Tsutsui, K., and K. Ukena. 2006. Review: Hypothalamic LPXRF-amide peptides in vertebrates: identification, 10calization and hypophysiotropic activity. Peptides 27: 1121-1129.

34. 3. 4.: Tsutsui, K., E. Saigoh, K. Ukena, H. Teranishi, Y. Fujisawa, M. Kikuchi, S. Ishii, P.l Sharp. 2000. A novel avian hypotha1amic peptide inhibiting gonadotropin release. Biochem Biophys Res Commun 275: 661-667. Tsutsui, K., E. Saigoh, K. Ukena, H. Teranishi, Y. Fujisawa, M. Kikuchi, S. Ishii, P.l Sharp. 2000. A novel avian hypotha1amic peptide inhibiting gonadotropin release. Biochem Biophys Res Commun 275: 661-667.

35. 35: Tsutsui, K., G.E. Bentley, T. Ubuka, E. Saigoh, H. Yin, T. Osugi, K. Inoue, Tsutsui, K., G.E. Bentley, T. Ubuka, E. Saigoh, H. Yin, T. Osugi, K. Inoue,

V.S. Chowdhury, K. Ukena, N.Ciccone, P.J. Sharp, lC. Wingfie1d. 2007. The general and comparative biology of gonadotropin-inhibitory hormone (GnIH). Gen Comp Endocrinol153: 365-370. V.S. Chowdhury, K. Ukena, N. Cycone, P.J. Sharp, lC. Wingfie1d. 2007. The general and comparative biology of gonadotropin-inhibitory hormone (GnIH). Gene Comp Endocrinol153: 365-370.

36. 36.: Van Asselt, L.A., H.J. Goos, W. Smit-van Dijk, P.A.M. Speetjens, P.G. Van Oordt. 1988. Evidence for the involvement of D2 receptors in the dopaminergic inhibition of gonadotropin release in the African catfish, C1arias gariepinus. Aquaculture; 72:369-378. Van Asselt, L.A., H.J. Goos, W. Smit-van Dijk, P.A.M. Speetjens, P.G. Van Oordt 1988. Evidence for the involvement of D2 receptors in the dopaminergic inhibition of gonadotropin release in the African catfish, C1arias gariepinus. Aquaculture; 72: 369-378.

37. 37.: Vidal, B., C. Pasqualini, N. Le BeBe, M.C.H. HoBand, M. Sbaihi, P. Vernier, Vidal, B., C. Pasqualini, N. Le BeBe, M.C.H. HoBand, M. Sbaihi, P. Vernier,

y. Zohar, S. Dufour, 2004 Dopamine inhibits 1uteinizing hormone synthesis and release in the juvenile European eel: a neuroendocrine lock for the onset ofpuberty. Biol Reprod 71:1491-1500. Y. Zohar, S. Dufour, 2004 Dopamine inhibits 1uteinizing hormone synthesis and release in the juvenile European eel: a neuroendocrine lock for the onset of public. Biol Reprod 71: 1491-1500.

38. 38.: Zohar, Y., C.C. Mylonas. 2001 Endocrine manipulations of spawning In cultured fish: from hormones to genes. Aquaculture 197: 99-136. Zohar, Y., C.C. Mylonas 2001 Endocrine manipulations of spawning In cultured fish: from hormones to genes. Aquaculture 197: 99-136.

39. 39.: Zohar Y., Muñoz-Cueto lA., Elizur A., Kah 0.2010. Neuroendocrinology of reproduction in teleost fish. Gen Comp Endocrino!. 165: 438-455. Zohar Y., Muñoz-Cueto l., Elizur A., Kah 0.2010. Neuroendocrinology of reproduction in teleost fish. Endocrine Gene Comp! 165: 438-455.

BRIEF DESCRIPTION OF THE INVENTION

La presente invención hace referencia al hallazgo y aislamiento del ADN copia de un nuevo neuropéptido correspondiente al precursor de la hormona inhibidora de gonadotrofinas (GnIH o LPXRFa) en peces perciformes y, mas concretamente, en la lubina europea, Dicentrarchus labrax. Además, hemos diseñado y sintetizado a partir de dicho precursor dos péptidos maduros denominados sbGnIH-1 o sbLPXRFa-l y sbGnIH-2 o sbLPXRFa-2. Estos péptidos han sido modificados con una amidación e-terminal y un residuo de cisteína N-terminal para su acoplamiento a KLH, con objeto de favorecer el proceso de inmunización y la generación de anticuerpos específicos contra la GnIH-l y la GnIH-2 de lubina en conejos (anti-sbGnIH-l y anti-sbGnIH-2) y en cabras (anti-sbGnIH-2). Estos anticuerpos han sido utilizados para caracterizar el patrón de localización de las células GnIH-inmunopositivas y sus proyecciones en el cerebro y la hipófisis de la lubina. La invención incluye también ensayos de inyección que ponen de manifiesto un claro efecto inhibidor de la GnIH sobre diferentes factores neuroendocrinos y endocrinos que controlan el proceso reproductivo de la lubina. The present invention refers to the finding and isolation of the DNA copy of a new neuropeptide corresponding to the precursor of the gonadotropin inhibitor hormone (GnIH or LPXRFa) in perciform fish and, more specifically, in European sea bass, Dicentrarchus labrax. In addition, we have designed and synthesized from said precursor two mature peptides called sbGnIH-1 or sbLPXRFa-l and sbGnIH-2 or sbLPXRFa-2. These peptides have been modified with an e-terminal amidation and an N-terminal cysteine residue for coupling to KLH, in order to favor the immunization process and the generation of specific antibodies against GnIH-1 and GnIH-2. sea bass in rabbits (anti-sbGnIH-l and anti-sbGnIH-2) and in goats (anti-sbGnIH-2). These antibodies have been used to characterize the localization pattern of GnIH-immunopositive cells and their projections in the brain and the pituitary gland of sea bass. The invention also includes injection assays that demonstrate a clear inhibitory effect of GnIH on different neuroendocrine and endocrine factors that control the reproductive process of sea bass.

Esta invención nos ha permitido profundizar en el conocimiento de los mecanismos mediante los cuales se controla y se inhibe la reproducción en la lubina. Esta invención puede ser de gran utilidad para controlar la pubertad de la lubina y solventar los problemas de pubertad precoz en los machos de esta especie. Dado que el desarrollo gonadal precoz conlleva crecimientos pobres y un deterioro de la calidad de la carne, suprimir o retrasar la pubertad puede permitir un mayor crecimiento somático del animal, con los consiguientes beneficios para la producción en la práctica acuícola. Asimismo, esta invención abre la posibilidad de usar el ADN copia y los anticuerpos específicos generados para bloquear los efectos inhibidores de la GnIH sobre la reproducción, así como generar antagonistas funcionales de la GnIH que sean usados para promover el desarrollo gonadal, la maduración, la puesta y favorecer la reproducción de la lubina. Por tanto, la aplicación de esta invención permitirá resolver problemáticas reales que se presentan en el cultivo acuícola de la lubina y que afectan a la reproducción y el crecimiento de esta especie. Además, es de esperar que estas herramientas generadas puedan ser de aplicación a especies próximas a la lubina y, en particular, a peces percomorfos como la dorada, la serio1a, la corvina o el atún. This invention has allowed us to deepen our knowledge of the mechanisms by which reproduction in sea bass is controlled and inhibited. This invention can be very useful to control the puberty of sea bass and solve the problems of precocious puberty in males of this species. Since early gonadal development leads to poor growth and a deterioration in meat quality, suppressing or delaying puberty can allow greater somatic growth of the animal, with the consequent benefits for production in aquaculture practice. Also, this invention opens the possibility of using the copy DNA and the specific antibodies generated to block the inhibitory effects of GnIH on reproduction, as well as generate functional antagonists of GnIH that are used to promote gonadal development, maturation, laying and favor the reproduction of the sea bass. Therefore, the application of this invention will solve real problems that occur in the aquaculture of sea bass and that affect the reproduction and growth of this species. In addition, it is expected that these generated tools can be applied to species close to sea bass and, in particular, to percomorphic fish such as sea bream, serious fish, sea bass or tuna.

DESCRIPCIÓN DETALLADA DE LA INVENCIÓN DETAILED DESCRIPTION OF THE INVENTION

1. Clonación y caracterización del ADN copia de la GnIH de lubina 1. Cloning and characterization of the DNA copy of the GnIH of sea bass

Para la clonación de la GnIH de lubina hemos partido de una librería de expresión de cerebro y hemos seguido una estrategia basada en el uso de cebadores degenerados para la amplificación por PCR sobre la misma. La amplificación mediante PCR y la posterior e1ectroforesis permitieron identificar bandas del tamaño esperado. Estas bandas fueron aisladas, los ácidos nucleicos fueron e1uídos y la secuenciación de estos fragmentos de ADN y su posterior comparación y alineamiento con las secuenCIas GnIH de otras especies disponibles en las bases de datos nos permitió determinar que se trataba de una secuencia parcial del precursor de la hormona inhibidora de gonadotrofinas de la lubina (GnIH o precursor LPXRFamida). For the cloning of the GnIH of sea bass, we started from a brain expression library and followed a strategy based on the use of degenerate primers for PCR amplification on it. PCR amplification and subsequent electrophoresis allowed bands of the expected size to be identified. These bands were isolated, the nucleic acids were eluted and the sequencing of these DNA fragments and their subsequent comparison and alignment with the GnIH sequences of other species available in the databases allowed us to determine that it was a partial sequence of the precursor of the gonadotrophin inhibitor hormone of sea bass (GnIH or precursor LPXRFamide).

Posteriormente, utilizando oligonucleótidos específicos diseñados a partir de la secuencia parcial clonada de lubina, y mediante la modificación de los extremos 5'y 3' y la utilización de kits comerciales (SMARTer RACE cDNA C10ntech), obtuvimos la secuencia completa de nucleótidos que codifican para el precursor de la GnIH (o precursor LPXRFamida) de lubina. La secuencia completa clonada de la GnIH de lubina consta de 878 nucleótidos (SEQ ID NO 1), de los cuales 600 nucleótidos (SEQ ID NO 2) codifican el péptido precursor de la GnIH de lubina (ORF) de 200 aminoácidos (SEQ ID NO 3), 49 nucleótidos corresponden al extremo 5 'UTR y 226 nucleótidos corresponden al extremo 3 'UTR y a la cola poli-A. A diferencia de otros vertebrados, en los que se han descrito tres posibles péptidos GnIH, en este precursor de lubina hemos identificado solo dos posibles péptidos funcionales, denominados sbGnIH-l o sbLPXRFa-l (PLHLHANMPMRF, SEQ ID NO 4) Y sbGnIH-2 o sbLPXRFa-2 (SPNSTPNMPQRF, SEQ ID NO 5) (Figura 1 y 2). El análisis filogenético identificó claramente la secuencia clonada en la lubina dentro de la rama en la que se ubican las secuencias GnIHILPXRFa de peces y otros vertebrados (Figura 3). Subsequently, using specific oligonucleotides designed from the partial cloned sequence of sea bass, and by modifying the 5'and 3 'ends and using commercial kits (SMARTer RACE cDNA C10ntech), we obtained the complete sequence of nucleotides that code for the precursor of GnIH (or LPXRFamide precursor) of sea bass. The complete cloned sequence of sea bass GnIH consists of 878 nucleotides (SEQ ID NO 1), of which 600 nucleotides (SEQ ID NO 2) encode the precursor peptide of sea bass GnIH (ORF) of 200 amino acids (SEQ ID NO 3), 49 nucleotides correspond to the 5'UTR end and 226 nucleotides correspond to the 3'UTR end and the poly-A tail. Unlike other vertebrates, in which three possible GnIH peptides have been described, in this seabass precursor we have identified only two possible functional peptides, called sbGnIH-l or sbLPXRFa-l (PLHLHANMPMRF, SEQ ID NO 4) and sbGnIH-2 or sbLPXRFa-2 (SPNSTPNMPQRF, SEQ ID NO 5) (Figure 1 and 2). The phylogenetic analysis clearly identified the cloned sequence in the sea bass within the branch in which the GnIHILPXRFa sequences of fish and other vertebrates are located (Figure 3).

2. Expresión de la GnIH de lubina en tejidos centrales y periféricos 2. GnIH expression of sea bass in central and peripheral tissues

Una vez clonada e identificada la secuencia, se diseñaron cebadores específicos para estudiar, mediante PCR convencional (RT-PCR), la distribución tisular del ARN mensajero en tejidos centrales (bulbo olfativo, telencéfalo, diencéfalo, techo óptico, cerebelo, medula espinal, retina e hipófisis) y periféricos (corazón, hígado, riñón, intestino, músculo, ovario y testículo) de la lubina. En tejidos centrales, la expresión fue muy evidente en telencéfalo, diencéfalo, techo óptico, cerebelo y retina (Figura 4). En tejidos periféricos, los ARN mensajero de la GnIH fueron evidenciados en el testículo, ovario, riñón e intestino (Figura 4). La expresión de la GnIH en áreas centrales sensoriales como la retina, el techo óptico y el cerebelo, en áreas neuroendocrinas del telencéfalo y el diencéfalo, así como en el ovario y el testículo refuerzan la implicación de la GnIH en el control de la reproducción de la lubina. Once the sequence was cloned and identified, specific primers were designed to study, by conventional PCR (RT-PCR), the tissue distribution of messenger RNA in central tissues (olfactory bulb, telecephalus, diencephalon, optic ceiling, cerebellum, spinal cord, retina and pituitary gland) and peripherals (heart, liver, kidney, intestine, muscle, ovary and testis) of the sea bass. In central tissues, the expression was very evident in telencephalon, diencephalon, optic ceiling, cerebellum and retina (Figure 4). In peripheral tissues, GnIH messenger RNAs were evidenced in the testis, ovary, kidney and intestine (Figure 4). The expression of GnIH in central sensory areas such as the retina, the optic ceiling and the cerebellum, in neuroendocrine areas of the telencephalon and the diencephalon, as well as in the ovary and the testis reinforce the involvement of GnIH in the control of the reproduction of the sea bass.

3. Diseño y síntesis de los péptidos sbGnIH-I y sbGnIH-2 3. Design and synthesis of sbGnIH-I and sbGnIH-2 peptides

Como hemos indicado anteriormente, en la secuencia de la GnIH de lubina deducida identificamos dos posibles péptido maduros, a los cuales hemos denominado sbGnIH-I (sbLPXRFa-l) y sbGnIH-2 (sbLPXRFa-2). El siguiente paso fue sintetizar esos péptidos, que fueron modificados con una amidación en su extremo C-terminal, característica de los péptidos GnIH funcionales. Ambos péptidos fueron utilizados para los ensayos funcionales que se detallarán más adelante. As we have indicated previously, in the sequence of the deduced sea bass GnIH we identify two possible mature peptides, which we have called sbGnIH-I (sbLPXRFa-l) and sbGnIH-2 (sbLPXRFa-2). The next step was to synthesize those peptides, which were modified with an amidation at their C-terminal end, characteristic of the functional GnIH peptides. Both peptides were used for the functional tests that will be detailed later.

Las secuencias de los péptidos sintetizados fue la siguiente: The sequences of the synthesized peptides were as follows:

sbGnIH-l: NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) sbGnIH-2: NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7) sbGnIH-l: NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) sbGnIH-2: NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7)

El péptido sbGnIH-l sintetizado (12 aminoácidos) tenía un peso molecular estimado de 1462,81 Da y un peso molecular experimental de 1461,75 Da, tal como se observó mediante análisis de espectrofotometría de masas (Figura 5). Este péptido fue purificado mediante HPLC, mostrando un pico principal con un tiempo de retención de 13,75 minutos, y un nivel de pureza del 95,2% (Figura 5). La secuencia fue verificada mediante espectrometría de masas en tándem (MSIMS). The synthesized sbGnIH-1 peptide (12 amino acids) had an estimated molecular weight of 1462.81 Da and an experimental molecular weight of 1461.75 Da, as observed by mass spectrophotometry analysis (Figure 5). This peptide was purified by HPLC, showing a main peak with a retention time of 13.75 minutes, and a purity level of 95.2% (Figure 5). The sequence was verified by tandem mass spectrometry (MSIMS).

El péptido sbGnIH-2 sintetizado (12 aminoácidos) tenía un peso molecular estimado de 1374,54 Da y un peso molecular experimental de 1373,65 Da, tal como se observó mediante análisis de espectro fotometría de masas (Figura 6). Este péptido fue purificado mediante HPLC, mostrando un pico principal con un tiempo de retención de 13,1 minutos, y un nivel de pureza del 95,1 % (Figura 6). La secuencia fue verificada mediante espectrometría de masas en tándem (MSIMS). The synthesized sbGnIH-2 peptide (12 amino acids) had an estimated molecular weight of 1374.54 Da and an experimental molecular weight of 1373.65 Da, as observed by mass photometry spectrum analysis (Figure 6). This peptide was purified by HPLC, showing a main peak with a retention time of 13.1 minutes, and a purity level of 95.1% (Figure 6). The sequence was verified by tandem mass spectrometry (MSIMS).

4. Generación de anticuerpos anti-sbGnIH-l yanti-sbGnIH-2 4. Generation of anti-sbGnIH-l yanti-sbGnIH-2 antibodies

Asimismo, estos péptidos sbGnIH-l y sbGnIH-2 han sido utilizados para la generación de anticuerpos específicos dirigidos contra los mismos, obtenidos en conejo y cabra. Estos péptidos tenían una amidación C-terminal y un residuo de cisteína N-terminal para su acoplamiento a KLH, con objeto de favorecer el proceso de inmunización. En el caso del péptido sbGnIH-l, los anticuerpos fueron generados en conejo. En el caso del péptido sbGnIH-2, se generaron anticuerpos tanto en conejo como en cabra. El protocolo de inmunización fue el siguiente: Likewise, these sbGnIH-1 and sbGnIH-2 peptides have been used for the generation of specific antibodies directed against them, obtained in rabbit and goat. These peptides had a C-terminal amidation and an N-terminal cysteine residue for coupling to KLH, in order to favor the immunization process. In the case of the sbGnIH-1 peptide, the antibodies were generated in rabbit. In the case of the sbGnIH-2 peptide, antibodies were generated in both rabbit and goat. The immunization protocol was as follows:

Apéndice 1. Producción de anticuerpos en conejo Appendix 1. Production of antibodies in rabbit

Fecha Date: Inmunización Sangrado Suero Immunization Bleeding Serum

Semana O Week O: Pre-serum 3 mi + test Pre-serum 3 mi + test

Semana 1 Week 1: I I

Semana 5 Week 5: Il Il

Semana 9 Week 9: III III

Semana 11 Week 11: ELISA + test ELISA + test

Semana 11 Week 11: III+2v :::020 mi III + 2v ::: 020 mi

Semana 13 Week 13: IV IV

Semana 15 Week 15: IV+2v+sangrado final 50-70 mi + test IV + 2v + final bleeding 50-70 mi + test

Apéndice 2. Producción de anticuerpos en cabra Appendix 2. Production of goat antibodies

Fecha Date: Inmunización Sangrado Suero Immunization Bleeding Serum

Semana O Week O: Pre-serum 3 mi + test Pre-serum 3 mi + test

Semana 1 Week 1: I I

Semana 5 Week 5: Il Il

Semana 9 Week 9: III III

Semana 11 Week 11: ELISA + test ELISA + test

Semana 11 Week 11: III+2v :::050 mi + test III + 2v ::: 050 mi + test

Semana 13 Week 13: IV IV

Tras el periodo de inmunización (15 semanas) se procedió al sangrado de los animales, a la obtención del suero con los anticuerpos y a la realización de pruebas de ELISA para su titulación. Se utilizaron placas de ELISA NuncImmunoTM Plate MaxiSorpTM Surface cubiertas con péptido libre (0.004 mg/ml) y proteína (0.002 mg/ml) y un rango de dilución de las muestras de 1: 121After the immunization period (15 weeks) the animals were bled, the serum was obtained with the antibodies and ELISA tests were performed for titration. NuncImmunoTM Plate MaxiSorpTM Surface ELISA plates coated with free peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a sample dilution range of 1: 121 were used

1: 161 051 (suero). Como anticuerpos secundarios se usaron inmunoglobulinas anti-Ig de conejo obtenidas en cabra (Agrisera) a una dilución 1 :6667 e inmunoglobulinas anti-Ig de cabra obtenidas en conejo (DAKO) a una dilución 1: 161 051 (serum). As secondary antibodies, goat anti-rabbit immunoglobulins obtained in goat (Agrisera) at a 1: 6667 dilution and goat anti-goat Ig immunoglobulins obtained in rabbit (DAKO) at dilution

1:10.000. 1: 10,000

Los ensayos de ELISA obtenidos muestran las respuestas de los anticuerpos generados frente a los antígenos, en relación al suero preinmune (Figuras 7, 8 Y 9), en las que se evidencia la curva sigmoidea característica en función de la dilución del suero. Todos los sueros generados mostraron un buen título, con rangos óptimos de dilución entre 1 :7000-1: 11000 para los anticuerpos generados en conejo (anti-sbGnIH-1 y anti-sbGnIH-2), y de 1 :2000-1 :6000 para el anticuerpo generado en cabra (anti-sbGnIH-2). The ELISA assays obtained show the responses of the antibodies generated against the antigens, in relation to the preimmune serum (Figures 7, 8 and 9), in which the characteristic sigmoid curve is evidenced as a function of serum dilution. All sera generated showed a good titer, with optimal dilution ranges between 1: 7000-1: 11000 for rabbit-generated antibodies (anti-sbGnIH-1 and anti-sbGnIH-2), and 1: 2000-1: 6000 for the antibody generated in goat (anti-sbGnIH-2).

5. Localización inmunohistoguímica de la GnIH en el cerebro y la hipófisis de la lubina 5. Immunohistoguimic localization of GnIH in the brain and pituitary gland of sea bass

La obtención de anticuerpos específicos contra los péptidos sbGnIH-l y sbGnIH-2 ha permitido esclarecer el patrón de distribución espacial de las células GnIH y sus proyecciones por medio de técnicas inmunohitoquímicas. La tinción inmunohistoquímica reveló una alta señal especifica cuando incubamos las seCCIOnes con los anticuerpos generados, no mostrando ninguna reacción incspccífica al incubar con el suero pre-inmune o cuando suprimimos los anticuerpos secundarios. Los resultados obtenidos fueron altamente consistentes y no se han encontrado diferencias en el inmunomarcaje entre los anticuerpos contra los péptidos GnIH-1 y GnIH-2 en los ejemplares de lubina analizados. Obtaining specific antibodies against the sbGnIH-1 and sbGnIH-2 peptides has allowed clarifying the spatial distribution pattern of GnIH cells and their projections by means of immunohitochemical techniques. Immunohistochemical staining revealed a high specific signal when we incubated the sections with the generated antibodies, showing no incspific reaction when incubating with the pre-immune serum or when we suppressed the secondary antibodies. The results obtained were highly consistent and no differences were found in the immunomarking between the antibodies against the GnIH-1 and GnIH-2 peptides in the sea bass specimens analyzed.

Así, los sueros anti-sbGnIH-I y anti-sbGnIH-2 de lubina nos pennitieron realizar un análisis completo en secciones seriadas del cerebro, desde las porciones más rostrales (bulbos olfativos) a las más caudales (médula). Tanto para la fonna sbGnIH-I como sbGnIH-2, hemos detectado la presencia de cuerpos celulares en el bulbo olfativo, en particular en las células ganglionares del nervio tenninal, en la transición entre la zona mas caudal del bulbo olfativo y la más rostral del telencéfalo, diferenciándose dos poblaciones celulares independientes: una población más rostral y dorsal, en la porción medial de los bulbos y otra población más caudal y ventral en la región del nervio tenninal. La inmunoreactividad también fue evidente en células de los núcleos central y lateral del telencéfalo ventral, en el núcleo posterior periventricular del área preóptica. Además, detectamos células inmunorreactivas de gran tamaño en la zona dorsal-lateral del sinencéfalo rostral. También encontramos células inmunorreactivas en el núcleo gustatorio secundario, siendo estas células de la zona central del tegmento mucho mas numerosas y de menor tamaño que las descritas anterionnente. Además fueron detectadas células en la pars distal proximal y en la pars intennedia de la adenohipófisis. Thus, the anti-sbGnIH-I and anti-sbGnIH-2 sera from sea bass allowed us to perform a complete analysis on serial sections of the brain, from the most rostral portions (olfactory bulbs) to the most caudal (medulla). For both the sbGnIH-I and sbGnIH-2 fonna, we have detected the presence of cell bodies in the olfactory bulb, particularly in the ganglion cells of the tenninal nerve, in the transition between the most caudal area of the olfactory bulb and the most rostral of the telencephalon, differentiating two independent cell populations: a more rostral and dorsal population, in the medial portion of the bulbs and another more caudal and ventral population in the tenninal nerve region. Immunoreactivity was also evident in cells of the central and lateral nuclei of the ventral telencephalon, in the periventricular posterior nucleus of the preoptic area. In addition, we detect large immunoreactive cells in the dorsal-lateral area of the rostral syncephalon. We also found immunoreactive cells in the secondary gustatory nucleus, these cells being in the central zone of the tegment much more numerous and smaller than those described above. In addition, cells were detected in the proximal distal pars and in the parsy of the adenohypophysis.

En cuanto al patrón de inervación, detectamos fibras sbGnIH-I-y sbGnIH-2inmunorreactivas principalmente en el cerebro anterior y medio. Las fibras fueron mas evidentes en el telencéfalo ventral, área preóptica, tálamo ventral, hipotálamo medio-basal, receso lateral, techo óptico, torus semicircularis, tegmento rostrallateral y en la región caudal del tegmento (núcleo gustatorio secundario). Además hemos localizado fibras en el telencéfalo dorsal, el romboencéfalo ventral, el nervio óptico y en el órgano pineal, así como en la pars distal proximal y pars intennedia de la adenohipófisis. Regarding the innervation pattern, we detect sbGnIH-I-and sbGnIH-2 immunoreactive fibers mainly in the anterior and middle brain. The fibers were most evident in the ventral telencephalon, preoptic area, ventral thalamus, mid-basal hypothalamus, lateral recess, optic roof, torus semicircularis, rostrallateral tegment and in the caudal region of the tegment (secondary gustatory nucleus). In addition, we have located fibers in the dorsal telencephalon, the ventral rhomboencephalus, the optic nerve and in the pineal organ, as well as in the proximal distal pars and the paned throat of the adenohypophysis.

Este patrón de distribución de células y fibras GnIH en áreas sensoriales olfativas (bulbo olfativo, nervio tenninal), fotosensitivas (nervio óptico, techo óptico) y gustativas (núcleo gustatorio secundario), así como en áreas neuroendocrinas relacionadas con la reproducción (telencéfalo ventral, área preóptica, hipotálamo mediobasal) y en la propia adenohipófisis refuerzan la consideración de la implicación de la GnIH de lubina en el control de procesos como la reproducción, la ingesta y el metabolismo. This pattern of distribution of GnIH cells and fibers in olfactory sensory areas (olfactory bulb, tenninal nerve), photosensitive (optic nerve, optic roof) and gustatory (secondary gustatory nucleus), as well as in neuroendocrine areas related to reproduction (ventral telencephalon, preoptic area, midbasal hypothalamus) and in the adenohypophysis itself reinforce the consideration of the involvement of sea bass GnIH in the control of processes such as reproduction, intake and metabolism.

6. Determinación de los efectos de la GnIH en la lubina 6. Determination of the effects of GnIH on sea bass

Una vez caracterizados los posibles péptidos GnIH maduros, se diseñó un experimento para comprobar cual es el efecto in vivo de la GnIH sobre la lubina europea. Los ensayos se realizaron con la forma sbGnIH-2. Los resultados obtenidos nos mostraron un marcado efecto inhibidor de la GnIH sobre diversos genes cerebrales e hipofisarios que se encuentran implicados en la estimulación de la reproducción. ASÍ, pudimos observar una disminución de la expresión del ARN mensajero en la hormona liberadora de las gonadotrofinas de tipo II (GnRH-2) a las 6 horas post-inyección (hpi) a todas las dosis analizadas (1, 2 y 4 ¡.tg) Y una inhibición en la expresión de GnRH-l a las 12 hpi a la dosis más alta (4 ¡.tg)(Figura 10). No se observaron efectos de la sbGnIH-2 sobre los niveles de ARN mensajero de la forma GnRH-3 de lubina, a ninguna de las dosis y tiempos de post-inyección analizados. Las kisspeptinas también fueron inhibidas tras el tratamiento con sbGnIH-2 a las 6 hpi (Figura 10). La inhibición de las kisspeptinas de tipo 1 (Kissl) fue evidente con la dosis intermedia (2 ¡.tg), mientras que en el caso de la Kiss2 esta inhibición tuvo lugar a la dosis más alta de 4 ¡.tg (Figura 10). Once the possible mature GnIH peptides were characterized, an experiment was designed to verify what the in vivo effect of GnIH is on European sea bass. The tests were performed in the form sbGnIH-2. The results obtained showed a marked inhibitory effect of GnIH on various brain and pituitary genes that are involved in the stimulation of reproduction. Thus, we were able to observe a decrease in the expression of messenger RNA in the releasing hormone of gonadotrophins type II (GnRH-2) at 6 hours post-injection (hpi) at all the doses analyzed (1, 2 and 4 ¡. tg) And an inhibition in the expression of GnRH-1 at 12 hpi at the highest dose (4¡tg) (Figure 10). No effects of sbGnIH-2 on messenger RNA levels of the GnRH-3 form of sea bass were observed, at any of the doses and post-injection times analyzed. Kisspeptins were also inhibited after treatment with sbGnIH-2 at 6 hpi (Figure 10). Inhibition of type 1 kisspeptins (Kissl) was evident with the intermediate dose (2 .tg), while in the case of Kiss2 this inhibition took place at the highest dose of 4 .tg (Figure 10). .

A nivel hipofisario también se observó un efecto inhibidor de la GnIH sobre la expresión de la hormona estimulante del folículo (FSH), que está implicada en la maduración inicial de los ovocitos y en la vitelogénesis, y sobre la hormona luteinizante (LH), encargada de la maduración final y puesta, siendo más marcados los efectos sobre esta última (Figura 11). Este efecto inhibidor fue evidente tanto a las 6 hpi (a todas las dosis para la LH y a dosis de 2 y 4 ¡.tg para FSH) como a las 12 hpi (a la dosis de 2 ¡.tg tanto para FSH como para LH)( Figura 11). Esta inhibición de los ARN mensajeros de estos factores neuroendocrinos y endocrinos estimuladores de la reproducción muestran la inactivación del eje reproductivo que provoca la GnIH a distintos niveles del eje cerebro-hipófisisgónada de la lubina. At the pituitary level, a GnIH inhibitory effect was also observed on the expression of follicle stimulating hormone (FSH), which is involved in the initial maturation of oocytes and in vitellogenesis, and on luteinizing hormone (LH), responsible of the final ripening and setting, the effects on the latter being more marked (Figure 11). This inhibitory effect was evident both at 6 hpi (at all doses for LH and at doses of 2 and 4¡tg for FSH) and at 12 hpi (at the dose of 2 ¡.tg for both FSH and LH ) (Figure 11). This inhibition of messenger RNAs of these neuroendocrine and endocrine factors that stimulate reproduction show inactivation of the reproductive axis that causes GnIH at different levels of the brain-pituitary axis of sea bass.

Por 10 tanto, esta invención aborda aspectos novedosos sobre el control neuroendocrino del proceso reproductivo en peces, en general, y en la lubina 5 europea en particular. Como novedades podemos destacar la generación de herramientas para identificar la presencia y los niveles de la honnona inhibidora de las gonadotrofinas en la lubina en distintos estadios (estadios larvarios, juveniles y adultos) y el desarrollo de procedimientos para caracterizar los efectos de este nuevo factor neuroendocrino en peces. Además proponemos una 10 aplicación de esta herramienta, ya que esta invención proporciona una metodología a seguir para inhibir la pubertad precoz de esta especie mediante el uso de inyecciones o implantes de GnIH. Asimismo, esta invención puede pennitir la generación de agonistas y/o antagonistas de la GnIH, a través de la modificación de distintos aminoácidos de las secuencias descritas, que pueden ser Therefore, this invention addresses novel aspects of neuroendocrine control of the reproductive process in fish, in general, and in European sea bass 5 in particular. As novelties we can highlight the generation of tools to identify the presence and levels of gonadotrophin inhibitory honnone in sea bass at different stages (larval, juvenile and adult stages) and the development of procedures to characterize the effects of this new neuroendocrine factor in fish We also propose an application of this tool, since this invention provides a methodology to be followed to inhibit the early puberty of this species through the use of GnIH injections or implants. Also, this invention can penetrate the generation of agonists and / or antagonists of GnIH, through the modification of different amino acids of the described sequences, which can be

15 utilizados para inhibir o estimular la reproducción en animales adultos, respectivamente, con el consiguiente beneficio para el control y la mejora de la productividad de esta especie en acuicultura. 15 used to inhibit or stimulate reproduction in adult animals, respectively, with the consequent benefit to control and improve the productivity of this species in aquaculture.

DESCRIPCIÓN DEL CONTENIDO DE LAS FIGURAS DESCRIPTION OF THE CONTENT OF THE FIGURES

Figura 1. Secuencia de 878 nucleótidos del precursor de GnIH de la lubina europea, Dicentrarchus labrax (SEQ ID NO 1). La secuencia presenta extremos 5'UTR y 3'UTR, de 49 nucleótidos y 226 nucleótidos, respectivamente. La secuencia de 600 nucleótidos comprendida entre el atg (primer codon, metionina) y el tga (codón stop) marcados en gris se corresponde con la región codificante u ORF (SEQ ID NO 2). La secuencia de 200 aminoácidos codificada se muestra en mayúsculas con letra cursiva. En negrita y subrayadas se muestran dos posibles señales de poliadenilación (aataaa) presentes en el extremo 3'UTR. Figure 1. 878 nucleotide sequence of the GnIH precursor of European sea bass, Dicentrarchus labrax (SEQ ID NO 1). The sequence has 5'UTR and 3'UTR ends, of 49 nucleotides and 226 nucleotides, respectively. The 600 nucleotide sequence between the atg (first codon, methionine) and the tga (stop codon) marked in gray corresponds to the coding region or ORF (SEQ ID NO 2). The 200 amino acid sequence encoded is shown in uppercase with italics. In bold and underlined, two possible polyadenylation (aataaa) signals present at the 3'UTR end are shown.

Figura 2. Secuencia completa de 200 aminoácidos del precursor de la GnIH de la lubina europea (SEQ ID NO 3). El fragmento que se muestra corresponde a la zona codificante de la secuencia de nucleótidos aislada. Los péptidos maduros sbGnIH-1 o sbLPXRFa-1 (PLHLHANMPMRF, posición 94-105, SEQ ID NO 4) Y sbGnIH-2 o sbLPXRFa-2 (SPNSTPNMPQRF, posición 116-127, SEQ ID NO 5) aparecen marcados en negrita y sombreados en color gris. Nótese los aminoácidos de procesamiento de estos péptidos, que son K o R en el extremo 5', Y GR en el extremo 3'. El codón stop se encuentra indicado por un asterisco. Figure 2. Complete 200 amino acid sequence of the precursor of the European sea bass GnIH (SEQ ID NO 3). The fragment shown corresponds to the coding zone of the isolated nucleotide sequence. Mature peptides sbGnIH-1 or sbLPXRFa-1 (PLHLHANMPMRF, position 94-105, SEQ ID NO 4) and sbGnIH-2 or sbLPXRFa-2 (SPNSTPNMPQRF, position 116-127, SEQ ID NO 5) are marked bold and shaded in gray color Note the processing amino acids of these peptides, which are K or R at the 5 'end, and GR at the 3' end. The stop codon is indicated by an asterisk.

Figura 3. Árbol filogenético del precursor identificado del péptido LPXRFamida y los posibles péptidos RFamidas de otros vertebrados. El método usado para construir el árbol filogenético fue el "Neightbour-joining method". Los datos fueron obtenidos mediante 1 000 repeticiones, para determinar los índices de confianza dentro del árbol filogenético. Los ortólogos de GnIH comparten el extremo C-terminal común LPXRFamida (X = L o Q o M en el caso de peces) el cual ha sido identificado en otros vertebrados desde humanos a peces. Los péptidos de lubina también sustituyen el aminoácido Lisina (L) por el aminoácido metionina (M). Figure 3. Phylogenetic tree of the identified precursor of the LPXRFamide peptide and the possible RFamide peptides of other vertebrates. The method used to construct the phylogenetic tree was the "Western-joining method". The data were obtained by 1,000 repetitions, to determine the confidence indices within the phylogenetic tree. GnIH orthologs share the common C-terminal end LPXRFamide (X = L or Q or M in the case of fish) which has been identified in other vertebrates from humans to fish. Sea bass peptides also substitute the amino acid Lysine (L) for the amino acid methionine (M).

Figura 4. Expresión del péptido precursor de la GnIH en tejidos centrales y periféricos de lubina mediante RT-PCR. Figure 4. Expression of the GnIH precursor peptide in central and peripheral tissues of sea bass by RT-PCR.

Figura 5. Síntesis del péptido sbGnIH-l de lubina, modificado con una amidación en su extremo C-terminal (NH2-PLHLHANMPMRF-CONH2, SEQ ID NO 6). Se presenta el análisis mediante espectrofotometría de masas, que muestra un pico de peso molecular 1461,75 Da y el análisis de HPLC, que evidencia el pico correspondiente a la sbGnIH-l con un tiempo de retención de 13,75 minutos y una pureza del 95,2%. La secuencia fue verificada mediante espectrometría de masas en tándem (MSIMS). Figure 5. Synthesis of sea bass sbGnIH-1 peptide, modified with an amidation at its C-terminal end (NH2-PLHLHANMPMRF-CONH2, SEQ ID NO 6). The analysis is presented by mass spectrophotometry, which shows a peak of 1461.75 Da molecular weight and HPLC analysis, which shows the peak corresponding to sbGnIH-1 with a retention time of 13.75 minutes and a purity of 95.2% The sequence was verified by tandem mass spectrometry (MSIMS).

Figura 6. Síntesis del péptido sbGnIH-2 de lubina, modificado con una amidación en su extremo C-terminal (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7). Se presenta el análisis mediante espectrofotometría de masas, que muestra un pico de peso molecular 1373,65 Da y el análisis de HPLC, que evidencia el pico correspondiente a la sbGnIH-2 con un tiempo de retención de 13,1 minutos y una pureza del 95,1%. La secuencia fue verificada mediante espectrometría de masas en tándem (MSIMS). Figure 6. Synthesis of sea bass sbGnIH-2 peptide, modified with an amidation at its C-terminal end (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7). The analysis is presented by mass spectrophotometry, which shows a peak of 1373.65 Da molecular weight and HPLC analysis, which shows the peak corresponding to sbGnIH-2 with a retention time of 13.1 minutes and a purity of 95.1% The sequence was verified by tandem mass spectrometry (MSIMS).

Figura 7. Test de ELISA del suero anti-sbGnIH-l obtenido en coneJo. Se muestra la respuesta obtenida en un ensayo del suero anti-sbGnIH-l generado frente al suero preinmune del mismo conejo. Se utilizaron placas de ELISA cubiertas con el péptido sbGnIH-l1ibre (0.004 mg/ml) y proteína (0.002 mg/ml) y un rango de dilución de los sueros de 1:121-1:161051. El ensayo muestra un título óptimo a diluciones entre 1 :9000 y 1: 11500 (parte lineal de la curva entre 1 y 2 de absorbancia a 650 nm). Figure 7. ELISA test of the anti-sbGnIH-1 serum obtained in rabbit. The response obtained in an assay of the anti-sbGnIH-1 serum generated against the preimmune serum of the same rabbit is shown. ELISA plates coated with the sbGnIH-l1ibre peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a serum dilution range of 1: 121-1: 161051 were used. The test shows an optimal titre at dilutions between 1: 9000 and 1: 11500 (linear part of the curve between 1 and 2 absorbance at 650 nm).

Figura 8. Test de ELISA del suero anti-sbGnIH-2 obtenido en conejo. Se muestra la respuesta obtenida en un ensayo del suero anti-sbGnIH-2 generado frente al suero preinmune del mismo conejo. Se utilizaron placas de ELISA cubiertas con el péptido sbGnIH-2 libre (0.004 mg/ml) y proteína (0.002 mg/ml) y un rango de dilución de los sueros de 1: 121-1: 161051. El ensayo muestra un título óptimo a diluciones entre 1:7000 y 1: 11 000 (parte lineal de la curva entre 1 y 2 de absorbancia a 650 nm). Figure 8. ELISA test of the anti-sbGnIH-2 serum obtained in rabbit. The response obtained in an assay of the anti-sbGnIH-2 serum generated against the preimmune serum of the same rabbit is shown. ELISA plates coated with the free sbGnIH-2 peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a serum dilution range of 1: 121-1: 161051 were used. The assay shows an optimal titer. at dilutions between 1: 7000 and 1: 11 000 (linear part of the curve between 1 and 2 absorbance at 650 nm).

Figura 9. Test de ELISA del suero anti-sbGnIH-2 obtenido en cabra. Se muestra Figure 9. ELISA test of the anti-sbGnIH-2 serum obtained in goat. It shows

la respuesta obtenida en un ensayo del suero anti-sbGnIH-2 generado frente al the response obtained in an anti-sbGnIH-2 serum test generated against the

suero preinmune de la misma cabra. Se utilizaron placas de ELISA cubiertas con Preimmune serum from the same goat. ELISA plates covered with

el péptido sbGnIH-2 libre (0.004 mg/ml) y proteína (0.002 mg!ml) y un rango de the free sbGnIH-2 peptide (0.004 mg / ml) and protein (0.002 mg! ml) and a range of

S S: dilución de los sueros de 1: 121-1 : 161051. El ensayo muestra un título óptimo a dilution of sera from 1: 121-1: 161051. The test shows an optimal titer at

diluciones entre 1 :2000 y 1 :6000 (parte lineal de la curva entre 1 y 2 de dilutions between 1: 2000 and 1: 6000 (linear part of the curve between 1 and 2 of

absorbancia a 650 nm). absorbance at 650 nm).

Figura 10. Efecto del tratamiento intracerebroventricular (lCV) con el péptido Figure 10. Effect of intracerebroventricular (lCV) treatment with the peptide

sbGnIH-2 sobre la expresión de GnRH-l, GnRH-2, Kiss-l y Kiss-2 en el cerebro sbGnIH-2 on the expression of GnRH-l, GnRH-2, Kiss-l and Kiss-2 in the brain

10 10: de ejemplares machos de lubina europea. Las dosis empleadas fueron l¡.tg, 2¡.tg Y of male specimens of European sea bass. The doses used were l¡.tg, 2¡.tg Y

4¡.tg totales de sbGnIH-2 disuelto en PBS. Los controles fueron tratados solo con Total 4¡.tg of sbGnIH-2 dissolved in PBS. Controls were treated only with

vehículo (PBS). Los ejemplares fueron muestreados a las 6 y 12 horas postvehicle (PBS). The specimens were sampled at 6 and 12 hours post

inyección (6 hpi y 12 hpi, respectivamente). La expresión relativa para los genes injection (6 hpi and 12 hpi, respectively). The relative expression for genes

objeto de estudio fue determinada mediante PCR cuantitativa, usando el gen 18s object of study was determined by quantitative PCR, using the 18s gene

lS lS: como normalizador. Cada valor representa la media ± error estándar de 5 as normalizer Each value represents the mean ± standard error of 5

individuos diferentes (n=5). Las diferentes letras indican diferencias estadísticas different individuals (n = 5). The different letters indicate statistical differences

significativas entre grupos, tras aplicar ANOV A de una vía (p ::; 0.05) seguido del significant between groups, after applying ANOV A one way (p ::; 0.05) followed by

test de Tukey. Tukey test.

Figura 11. Efecto del tratamiento intracerebroventricular (lCV) con el péptido Figure 11. Effect of intracerebroventricular (lCV) treatment with the peptide

20 twenty: sbGnIH-2 sobre la expresión FSH y LH en la hipófisis de ejemplares machos de sbGnIH-2 on FSH and LH expression in the pituitary of male specimens of

lubina europea. Las dosis empleadas fueron 1 ¡.tg, 2¡.tg Y4¡.tg totales de sbGnIH-2 European sea bass. The doses used were 1¡tg, 2¡.tg Y4¡.tg total of sbGnIH-2

disuelto en PBS. Los controles fueron tratados solo con vehículo (PBS). Los dissolved in PBS. Controls were treated with vehicle only (PBS). The

ejemplares fueron muestreados a las 6 y 12 horas post-inyección (6 hpi y 12 hpi, specimens were sampled at 6 and 12 hours post-injection (6 hpi and 12 hpi,

respectivamente). La expresión relativa para los genes objeto de estudio fue respectively). The relative expression for the genes under study was

2S 2S: determinada mediante PCR cuantitativa, usando el gen 18s como normalizador. determined by quantitative PCR, using the 18s gene as a normalizer.

Cada valor representa la media ± error estándar de 5 individuos diferentes (n=5). Each value represents the mean ± standard error of 5 different individuals (n = 5).

Las diferentes letras indican diferencias estadísticas significativas entre grupos, The different letters indicate significant statistical differences between groups,

tras aplicar ANO VA de una vía (p ::; 0.05) seguido del test de Tukey. after applying ANO VA one way (p ::; 0.05) followed by the Tukey test.

EMBODIMENT OF THE INVENTION

La estrategia de clonación descrita anteriormente nos permitió obtener la secuencia completa de nucleótidos, que codifican para el precursor de la los hormona inhibidora de gonadotrofinas (GnIH) de la lubina Dicentrarchus 1abrax. El análisis de la secuencia de aminoácidos de la misma nos ha permitido postular la secuencia de dos péptidos maduros potencialmente funcionales de la familia RF-amida, denominados sbGnIH-l o sbLPXRFa-1 (secuencia NH2PLHLHANMPMRF-CONH2) y sbGnIH-2 o sbLPXRFa-2 (secuencia NH2SPNSTPNMPQRF-CONH2). Estos péptidos fueron sintetizados, su peso molecular determinado por espectrofotometría de masas, purificados mediante HPLC y su secuencia verificada mediante espectrometría de masas en tándem (MSIMS). La actividad de estos péptidos en lubina fue determinada mediante ensayos in vivo, tal como se describe a continuación. The cloning strategy described above allowed us to obtain the complete sequence of nucleotides, which code for the precursor of the gonadotrophin inhibitor hormone (GnIH) of sea bass Dicentrarchus 1abrax. The analysis of the amino acid sequence thereof has allowed us to postulate the sequence of two potentially functional mature peptides of the RF-amide family, called sbGnIH-l or sbLPXRFa-1 (NH2PLHLHANMPMRF-CONH2 sequence) and sbGnIH-2 or sbLPXRFa- 2 (NH2SPNSTPNMPQRF-CONH2 sequence). These peptides were synthesized, their molecular weight determined by mass spectrophotometry, purified by HPLC and their sequence verified by tandem mass spectrometry (MSIMS). The activity of these peptides in sea bass was determined by in vivo assays, as described below.

Animales y recogidas de muestras Animals and sample collection

Un total de 40 lubinas (Dicentrarchus 1abrax), con un peso comprendido 839,03g ± 10,12g se obtuvieron en el "Laboratorio de Cultivos Marinos" de la Universidad de Cádiz (Puerto Real, España), donde se mantuvieron en condiciones de fotoperiodo natural, temperatura de 19°C ± 1°C y salinidad constante de 39 ppt. Los peces fueron distribuidos en 8 tanques (5 ejemplares en cada tanque) con una capacidad total 1,3 m3 totales, un radio de 61 cm y 90 cm de altura. La cantidad de agua efectiva, teniendo en cuenta la densidad de carga, fue de 1 m3. A total of 40 sea bass (Dicentrarchus 1abrax), weighing 839.03g ± 10.12g, were obtained at the "Laboratory of Marine Cultures" of the University of Cádiz (Puerto Real, Spain), where they were kept in photoperiod conditions natural, temperature of 19 ° C ± 1 ° C and constant salinity of 39 ppt. The fish were distributed in 8 tanks (5 specimens in each tank) with a total capacity of 1.3 m3 total, a radius of 61 cm and a height of 90 cm. The amount of effective water, taking into account the charge density, was 1 m3.

Para determinar la funcionalidad de la GnIH sobre el eje reproductivo de la lubina se analizaron sus efectos sobre los niveles de ARN mensajero de diversos genes implicados en la estimu1ación de la reproducción (GnRH-l, GnRH-2, GnRH-3, Kisspeptina-l, Kisspeptina-2, FSH y LH) mediante PCR cuantitativa. Para ello, los peces fueron anestesiados con MS-222 (Sigma St Louis, MO), medidos, y pesados. Se les realizó una pequeña incisión en el cráneo con un microta1adro a modo de vía, y se inyectaron intracerebroventricu1armente (lCV) con la ayuda de un micromanipulador l!lg, 2!lg o 4!lg del péptido sbGnIH-2 (NH2SPNSTPNMPQRF-CONH2), utilizando como vehículo PBS. Los individuos controles fueron inyectados exclusivamente con PBS. Los individuos tratados y sus controles fueron sacrificados a las 6 horas y 9 horas después de la inyección. Los cerebros y las hipófisis de los ejemplares se extrajeron mediante disección, y las muestras se congelaron inmediatamente en nitrógeno líquido y se almacenaron seguidamente a -80°C hasta su posterior análisis. El ARN total de las muestras fue extraído usando TRIsure (Bioline, Londres, Reino Unido) siguiendo las recomendaciones del fabricante, fue cuantificado mediante espectro fotometría en un equipo NANODROP (Eppendort) y su pureza fue evaluada por la relación de absorbancias Abs260 nmlAbs280 nm. El ARN total (1 J.1g) fue retrotranscrito a ADN copia (ADNc) y el ADN genómico fue eliminado usando el QuantiTect® Reverse Transcription Kit (Qiagen, Hilden, Alemania). El análisis de la expresión génica se llevó a cabo en un equipo de PCR cuantitativa un equipo CFX96 Manager System (Bio-Rad, Alcobendas, España) y el kit SensiF AST SYBR NoROX (Bioline, Londres, Reino Unido). Las reacciones de qPCR se llevaron a cabo por duplicado en un volumen total de 20 J.11, a partir de 5 ng de ADNc, con cebadores específicos obtenidos a partir de las secuencias GnRH-l, GnRH-2, GnRH-3, Kisspeptina-l, Kisspeptina-2, FSH y LH de lubina disponibles en las bases de datos, usando el gen l8S de lubina como gen normalizador (Ver Tabla). El protocolo seguido en la PCR cuantitativa fue el siguiente: a) Activación de la enzima: 950C durante 2 minutos; b) 40 ciclos: Desnaturalización a 95°C durante 10 s; Anillamiento y extensión a 60°C (GnRH-l, GnRH-3, FSH, LH, l8S); 6l0C (Kiss-l, Kiss-2) y 63°C (GnRH-2), durante 25 segundos; c). Curva de melting de 70°C a 95°C cada 0.5°C durante 5 segundos. Se generaron curvas de melting de cada muestra, para corroborar que presentaban un único pico y solo se amplificaba el gen objeto de estudio. Para descartar la posible contaminación del agua se realizaron controles negativos sustituyendo el ADNc por agua DEPC. La expresión de los genes estudiados se calculó mediante el método ~~Ct. Las posibles diferencias significativas en la expresión de los genes objeto de estudio entre los animales inyectados con las distintas dosis de sbGnIH-2 (1!lg, 2!lg o 4f!g) Y los controles (PBS) en los distintos tiempos post-inyección (6 y 12 horas post-inyección), se analizaron mediante el estadístico ANOVA de una vía, seguido del test de Tukey. Cuando los requerimientos de normalidad y homogeneidad de varianza no fueron satisfechos, se realizaron las To determine the functionality of GnIH on the reproductive axis of sea bass, its effects on the levels of messenger RNA of various genes involved in the estimation of reproduction (GnRH-l, GnRH-2, GnRH-3, Kisspeptin-1) were analyzed. , Kisspeptin-2, FSH and LH) by quantitative PCR. For this, the fish were anesthetized with MS-222 (Sigma St Louis, MO), measured, and weighed. A small incision was made in the skull with a microtota1adra as a way, and they were injected intracerebroventricularly (lCV) with the help of a micromanipulator l! Lg, 2! Lg or 4! Lg of the sbGnIH-2 peptide (NH2SPNSTPNMPQRF-CONH2 ), using PBS as a vehicle. Control individuals were injected exclusively with PBS. The treated individuals and their controls were sacrificed at 6 hours and 9 hours after the injection. The brains and pituitary glands of the specimens were removed by dissection, and the samples were immediately frozen in liquid nitrogen and then stored at -80 ° C until further analysis. The total RNA of the samples was extracted using TRIsure (Bioline, London, United Kingdom) following the manufacturer's recommendations, was quantified by photometry spectrum in a NANODROP (Eppendort) equipment and its purity was evaluated by the absorbance ratio Abs260 nmlAbs280 nm. Total RNA (1 J.1g) was retrotranscribed to copy DNA (cDNA) and genomic DNA was removed using the QuantiTect® Reverse Transcription Kit (Qiagen, Hilden, Germany). The gene expression analysis was carried out in a quantitative PCR equipment, a CFX96 Manager System (Bio-Rad, Alcobendas, Spain) and the SensiF AST SYBR NoROX kit (Bioline, London, United Kingdom). The qPCR reactions were carried out in duplicate in a total volume of 20 J.11, from 5 ng cDNA, with specific primers obtained from the sequences GnRH-1, GnRH-2, GnRH-3, Kisspeptin -l, Kisspeptin-2, FSH and LH of sea bass available in the databases, using the l8S gene of sea bass as a normalizing gene (See Table). The protocol followed in the quantitative PCR was the following: a) Enzyme activation: 950C for 2 minutes; b) 40 cycles: Denaturation at 95 ° C for 10 s; Banding and extension at 60 ° C (GnRH-l, GnRH-3, FSH, LH, l8S); 610C (Kiss-l, Kiss-2) and 63 ° C (GnRH-2), for 25 seconds; C). Melting curve from 70 ° C to 95 ° C every 0.5 ° C for 5 seconds. Melting curves of each sample were generated, to corroborate that they had a single peak and only the gene under study was amplified. To rule out possible water contamination, negative controls were performed by replacing the cDNA with DEPC water. The expression of the genes studied was calculated using the method ~~ Ct. The possible significant differences in the expression of the genes under study between the animals injected with the different doses of sbGnIH-2 (1 µg, 2 µg or 4f! G) and the controls (PBS) at different post-times injection (6 and 12 hours post-injection), were analyzed using the one-way ANOVA statistic, followed by the Tukey test. When the requirements for normality and homogeneity of variance were not satisfied, the

5 transformaciones necesarias (transformación logarítmica o raíz) para cumplir con estos requisitos. Las diferencias se consideraron significativas con P<O.05. 5 necessary transformations (logarithmic or root transformation) to meet these requirements. The differences were considered significant with P <O.05.

Los resultados obtenidos demostraron el efecto inhibidor de la sbGnIH-2 sobre la GnRH-l, GnRH-2, Kisspeptina-l, Kisspeptina-2, FSH y LH de lubina, mostrando su efectividad para provocar un bloqueo del eje reproductivo en esta especie. Esta 10 evidencia demuestra la utilidad de la GnIH de lubina para reducir la incidencia de la pubertad precoz o frenar el proceso reproductivo en la lubina. Estos efectos inhibidores de la reproducción pueden incidir de forma positiva en el crecimiento y la productividad de esta especie en la práctica acuícola ya que está claramente demostrado que la energía destinada a la reproducción representa un límite para The results obtained demonstrated the inhibitory effect of sbGnIH-2 on GnRH-1, GnRH-2, Kisspeptin-1, Kisspeptin-2, FSH and LH of sea bass, showing its effectiveness in causing a blockage of the reproductive axis in this species. This evidence demonstrates the usefulness of sea bass GnIH to reduce the incidence of precocious puberty or slow down the reproductive process in sea bass. These inhibitory effects of reproduction can have a positive impact on the growth and productivity of this species in aquaculture practice since it is clearly demonstrated that the energy destined to reproduction represents a limit for

15 los recursos energéticos destinados al crecimiento. 15 energy resources for growth.

Tabla: Cebadores usados en PCR cuantitativa Table: Primers used in quantitative PCR

Nombre del cebador Primer Name: Secuencia (5 -3') Sequence (5 -3 ')

GnRH1(F) GnRH1 (F): GGTCCTATGGACTGATCCAGG GGTCCTATGGACTGATCCAGG

GnRH1(R) GnRH1 (R): TGATTCCTCTGCACAACCTAA TGATTCCTCTGCACAACCTAA

GnRH2(F) GnRH2 (F): TGG.GCfGcttctATGTGT' '~///", '" <""»T'X ' TGG.GCfGcttctATGTGT '' ~ /// ", '" <"" »T'X'

GnRH2(R) GnRH2 (R): CCAGCTCCCTCTTGCCTC CCAGCTCCCTCTTGCCTC

GnRH3(F) GnRH3 (F): TGt~GQAGAGCfAGA~G~C TGt ~ GQAGAGCfAGA ~ G ~ C

GnRH3(R) GnRH3 (R): GTTTGGGCACTCGCCTCTT GTTTGGGCACTCGCCTCTT

Kissl(F) Kissl (F): GtATCAAfA,CTGGCATCAGCAAAGA GtATCAAfA, CTGGCATCAGCAAAGA

Kissl(R) Kissl (R): TCAACCATTCTGACCTGGGAAACTT TCAACCATTCTGACCTGGGAAACTT

Kiss2(F) Kiss2 (F): GGGAGGATTCCAGCCCGTGTTTCT GGGAGGATTCCAGCCCGTGTTTCT

Kiss2(R) Kiss2 (R): GAGGCCGAACGGGTTGAAGTTGAA GAGGCCGAACGGGTTGAAGTTGAA

LH~ (F) LH ~ (F): TTGAGCTTCC1GA~GfCCA TTGAGCTTCC1GA ~ GfCCA

LH~ (R) LH ~ (R): GCAGGCTCTCGAAGGTACAG GCAGGCTCTCGAAGGTACAG

FSH~ (F) FSH ~ (F): ACCAACATCAGCATttAAGTG ACCAACATCAGCATttAAGTG

18S (F) 18S (F): TCAGACCCAAAACCCATGCG TCAGACCCAAAACCCATGCG

18S (R) 18S (R): ACCCTGATTCCCCGTTACCC ACCCTGATTCCCCGTTACCC

Claims

1. one.: Un po1inuc1eótido aislado cuya secuencia de nuc1eótidos presenta una identidad de secuencia de al menos un 80% con (a) la SEQ ID NO 1, o (b) la secuencia complementaria de dicha secuencia de nuc1eótidos, o (c) ambos (a) y (b). An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) SEQ ID NO 1, or (b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).

2. 2.: Un po1inuc1eótido aislado cuya secuenCIa de nuc1eótidos presenta una identidad de secuencia de al menos un 80% con (a) la SEQ ID NO 2, o (b) la secuencia complementaria de dicha secuencia de nuc1eótidos, o (c) ambos (a) y (b). An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) SEQ ID NO 2, or (b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).

3. 3.: Un po1inuc1eótido aislado cuya secuencia de nuc1eótidos presenta una identidad de secuencia de al menos un 80% con (a) la secuencia que codifica un po1ipéptido que tiene la secuencia de aminoácidos presentada en la SEQ ID NO 3 desde el residuo aminoacídico número 1 al 93, o (b) la secuencia complementaria de dicha secuencia de nuc1eótidos, o (c) ambos (a)y(b). An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a polypeptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 1 to 93, or (b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).

4. Four.: Un po1inuc1eótido aislado cuya secuencia de nuc1eótidos presenta una identidad de secuencia de al menos un 80% con (a) la secuencia que codifica un péptido que tiene la secuencia de aminoácidos presentada en la SEQ ID NO 3 desde el residuo aminoacídico número 94 al 105, o (b) la secuencia complementaria de dicha secuencia de nuc1eótidos, o (c) ambos An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 94 to 105, or (b) the complementary sequence of said nucleotide sequence, or (c) both

(a) and (b).

5. 5.: Un po1inuc1eótido aislado cuya secuenCIa de nuc1eótidos presenta una identidad de secuencia de al menos un 80% con (a) la secuencia que codifica un péptido que tiene la secuencia de aminoácidos presentada en la SEQ ID NO 3 desde el residuo aminoacídico número 106 al 115, o (b) la An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 106 to 115, or (b) the

complementary sequence of said nucleotide sequence, or (c) both

(a) and (b).

6. An isolated polynuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 116 to 127, or (b) the complementary sequence of said nucleotide sequence, or (c) both

(a) and (b).

7. An isolated polynuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a polypeptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 128 to 200, or

(b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).

8. 8.: Los polinuc1eótidos aislados en las reivindicaciones 1 a 7 en forma de ADN The polynuc1eotides isolated in claims 1 to 7 in the form of DNA

9. 9.: Los polinuc1eótidos aislados en las reivindicaciones 1 a 7 en forma de The polynuc1eotides isolated in claims 1 to 7 in the form of

RNA

10. 10.: Un polipéptido precursor sbGnIH de 200 aminoácidos que tiene una identidad de secuencia de al menos un 80% con la secuencia descrita en la figura 2 (SEQ ID NO 3) o una sal no tóxica del mismo. A 200 amino acid sbGnIH precursor polypeptide having a sequence identity of at least 80% with the sequence described in Figure 2 (SEQ ID NO 3) or a non-toxic salt thereof.

11. eleven.: Un péptido sbGnIH-l de 12 aminoácidos que tiene una identidad de secuencia de al menos un 80% con la secuencia NH2-PLHLHANMPMRFCOOH (SEQ ID NO 4) o una sal no tóxica del mismo. A 12 amino acid sbGnIH-1 peptide having a sequence identity of at least 80% with the NH2-PLHLHANMPMRFCOOH sequence (SEQ ID NO 4) or a non-toxic salt thereof.

12. 12.: Un péptido como el descrito en la SEQ ID NO 4, modificado con una amidación en su extremo C-terminal, que tiene una identidad de secuencia de al menos un 80% con la secuencia NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) o una sal no tóxica del mismo. A peptide as described in SEQ ID NO 4, modified with an amidation at its C-terminal end, which has a sequence identity of at least 80% with the sequence NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) or a non-toxic salt thereof.

13. 13.: Un péptido como los descritos en las reivindicaciones 11 y 12, en los cuales se han eliminado 1 o más aminoácidos. A peptide as described in claims 11 and 12, in which 1 or more amino acids have been removed.

14. 14.: Un péptido como los descritos en las reivindicaciones 11 y 12, en los cuales se han añadido 1 o más aminoácidos. A peptide as described in claims 11 and 12, in which 1 or more amino acids have been added.

15. fifteen.: Un péptido como los descritos en las reivindicaciones 11, 12, 13 Y 14 en los cuales se han modificado 1 o más aminoácidos. A peptide as described in claims 11, 12, 13 and 14 in which 1 or more amino acids have been modified.

16. 16.: Un péptido sbGnIH-2 de 12 aminoácidos que tiene una identidad de secuencia de al menos un 80% con la secuencia NH2-SPNSTPNMPQRFCOOH (SEQ ID NO 5) o una sal no tóxica del mismo. A 12 amino acid sbGnIH-2 peptide having a sequence identity of at least 80% with the NH2-SPNSTPNMPQRFCOOH sequence (SEQ ID NO 5) or a non-toxic salt thereof.

17. 17.: Un péptido como el descrito en la SEQ ID NO 5, modificado con una amidación en su extremo C-terminal, que tiene una identidad de secuencia de al menos un 80% con la secuencia NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7) o una sal no tóxica del mismo. A peptide as described in SEQ ID NO 5, modified with an amidation at its C-terminal end, which has a sequence identity of at least 80% with the sequence NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7) or a non-toxic salt thereof.

18. Un péptido como los descritos en las reivindicaciones 16 y cuales se han eliminado 1 o más aminoácidos. 18. A peptide as described in claims 16 and which 1 or more amino acids have been removed.: 17, en los 17, in the

s s: 19. Un péptido como los descritos en las reivindicaciones 16 y cuales se han añadido 1 o más aminoácidos. 17, en los 19. A peptide as described in claims 16 and which 1 or more amino acids have been added. 17, in the

20. Un péptido como los descritos en las reivindicaciones 16, 17, 18 Y 19, en los cuales se han modificado 1 o más aminoácidos. 20. A peptide as described in claims 16, 17, 18 and 19, in which 1 or more amino acids have been modified.

10 10: 21. Un anticuerpo capaz de unirse específicamente a péptidos que tienen una identidad de secuencia de al menos un 80% con los péptidos descritos en las reivindicaciones 11 y 12. 21. An antibody capable of specifically binding peptides having a sequence identity of at least 80% with the peptides described in claims 11 and 12.

lS lS: 22. El uso del anticuerpo descrito en la reivindicación 21 en inmunocitoquímicas e inmunohistoquímicas, de Westem-blot, BIot, de ELISA y de EIA. técnicas de Dot 22. The use of the antibody described in claim 21 in immunocytochemical and immunohistochemical, Westem-blot, BIot, ELISA and EIA. Dot techniques

20 twenty: 23. Un anticuerpo capaz de unirse específicamente a péptidos que tienen una identidad de secuencia de al menos un 80% con los péptidos descritos en las reivindicaciones 16 y 17. 23. An antibody capable of specifically binding peptides having a sequence identity of at least 80% with the peptides described in claims 16 and 17.

2S 2S: 24. El uso del anticuerpo descrito en la reivindicación 23 en inmunocitoquímicas e inmunohistoquímicas, de Westem-blot, BIot, de ELISA y de EIA. técnicas de Dot 24. The use of the antibody described in claim 23 in immunocytochemical and immunohistochemical, Westem-blot, BIot, ELISA and EIA. Dot techniques

25. A method of inhibiting or stimulating fish reproduction by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptide described in

claim 12 (NH2-PLHLHANMPMRF-CONH2, SEQ ID NO 6) or

a non-toxic salt thereof.

26. 26.: Un método según la reivindicación 25, en el que dicha administración es mediante inyección. A method according to claim 25, wherein said administration is by injection.

27. 27.: Un método según la reivindicación 25, en el que dicha administración es la implantación. A method according to claim 25, wherein said administration is implantation.

28. 28.: Un método según la reivindicación 25, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 25, wherein said administration is by dissolving in water in which the fish are swimming.

29. 29.: Un método según la reivindicación 25, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 25, wherein said administration is orally through feeding.

30. 30: Un método según la reivindicación 25, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 25, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.

31. 31.: Un método de inhibir la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con el péptido descrito en la reivindicación 17 (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7) o una sal no tóxica del mismo. A method of inhibiting fish reproduction by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptide described in claim 17 (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7) or a non-toxic salt thereof.

32. 32: Un método según la reivindicación 31, en el que dicha administración es mediante inyección. A method according to claim 31, wherein said administration is by injection.

33. 33.: Un método según la reivindicación 31, en el que dicha administración es la implantación. A method according to claim 31, wherein said administration is implantation.

34. 3. 4.: Un método según la reivindicación 31, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 31, wherein said administration is by dissolving in water in which the fish are swimming.

35. 35: Un método según la reivindicación 31, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 31, wherein said administration is orally through feeding.

36. 36.: Un método según la reivindicación 31, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 31, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.

37. 37.: Un método de inhibir o estimular la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con los péptidos descritos en la reivindicaciones 10,11,13,14,15,16,18, 19y20 A method of inhibiting or stimulating the reproduction of fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10,11,13,14 , 15,16,18, 19 and 20

38. 38.: Un método según la reivindicación 37, en el que dicha administración es mediante inyección. A method according to claim 37, wherein said administration is by injection.

39. 39.: Un método según la reivindicación 37, en el que dicha administración es la implantación. A method according to claim 37, wherein said administration is implantation.

40. 40: Un método según la reivindicación 37, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 37, wherein said administration is by dissolving in water in which the fish are swimming.

41. 41.: Un método según la reivindicación 37, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 37, wherein said administration is orally through feeding.

42. 42: Un método según la reivindicación 37, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 37, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.

43. 43: Un método de inhibir o estimular el crecimiento de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con los péptidos descritos en la reivindicaciones 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 y 20. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19 and 20.

44. 44.: Un método según la reivindicación 43, en el que dicha administración es mediante inyección. A method according to claim 43, wherein said administration is by injection.

45. Four. Five.: Un método según la reivindicación 43, en el que dicha administración es la implantación. A method according to claim 43, wherein said administration is implantation.

46. 46.: Un método según la reivindicación 43, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 43, wherein said administration is by dissolving in water in which the fish are swimming.

47. 47: Un método según la reivindicación 43, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 43, wherein said administration is orally through feeding.

48. 48.: Un método según la reivindicación 43, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 43, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.

49. 49.: Un método de inhibir o estimular la ingesta de los peces mediante la administración a dicho pez de una cantidad eficaz de un péptido que tiene una identidad de secuencia de al menos un 80% con los péptidos descritos en la reivindicaciones 10,11,12,13,14,15,16,17,18, 19y20. A method of inhibiting or stimulating the intake of fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10,11,12,13 , 14,15,16,17,18, 19 and 20.

50. fifty.: Un método según la reivindicación 49, en el que dicha administración es mediante inyección. A method according to claim 49, wherein said administration is by injection.

51. 51.: Un método según la reivindicación 49, en el que dicha administración es la implantación. A method according to claim 49, wherein said administration is implantation.

52. 52: Un método según la reivindicación 49, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 49, wherein said administration is by dissolving in water in which the fish are swimming.

53. 53.: Un método según la reivindicación 49, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 49, wherein said administration is orally through feeding.

54. 54: Un método según la reivindicación 49, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho péptido. A method according to claim 49, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.

55. 55.: Un método de inhibir o estimular la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de po1inucleótidos que tienen una identidad de secuencia de al menos un 80% con los po1inucleótidos descritos en las reivindicaciones 8 y 9. A method of inhibiting or stimulating the reproduction of the fish by administering to said fish an effective amount of po1inucleotides having a sequence identity of at least 80% with the po1inucleotides described in claims 8 and 9.

56. 56.: Un método según la reivindicación 55, en el que dicha administración es mediante inyección. A method according to claim 55, wherein said administration is by injection.

57. 57.: Un método según la reivindicación 55, en el que dicha administración es la implantación. A method according to claim 55, wherein said administration is implantation.

58. 58.: Un método según la reivindicación 55, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 55, wherein said administration is by dissolving in water in which the fish are swimming.

59. 59.: Un método según la reivindicación 55, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 55, wherein said administration is orally through feeding.

60. 60: Un método según la reivindicación 55, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho po1inucleótido. A method according to claim 55, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said po1inucleotide at will.

61. 61.: Un método de inhibir o estimular el crecimiento de los peces mediante la administración a dicho pez de una cantidad eficaz de po1inucleótidos que tienen una identidad de secuencia de al menos un 80% con los po1inucleótidos descritos en las reivindicaciones 8 y 9. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of po1inucleotides having a sequence identity of at least 80% with the po1inucleotides described in claims 8 and 9.

62. 62: Un método según la reivindicación 61, en el que dicha administración es mediante inyección. A method according to claim 61, wherein said administration is by injection.

63. 63.: Un método según la reivindicación 61, en el que dicha administración es la implantación. A method according to claim 61, wherein said administration is implantation.

64. 64.: Un método según la reivindicación 61, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 61, wherein said administration is by dissolving in water in which the fish are swimming.

65. 65: Un método según la reivindicación 61, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 61, wherein said administration is orally through feeding.

66. 66.: Un método según la reivindicación 61, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho polinucleótido. A method according to claim 61, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said polynucleotide at will.

67. 67.: Un método de inhibir o estimular la ingesta de los peces mediante la administración a dicho pez de una cantidad eficaz de polinucleótidos que tienen una identidad de secuencia de al menos un 80% con los polinucleótidos descritos en las reivindicaciones 8 y 9. A method of inhibiting or stimulating the intake of fish by administering to said fish an effective amount of polynucleotides having a sequence identity of at least 80% with the polynucleotides described in claims 8 and 9.

68. 68.: Un método según la reivindicación 67, en el que dicha administración es mediante inyección. A method according to claim 67, wherein said administration is by injection.

69. 69.: Un método según la reivindicación 67, en el que dicha administración es la implantación. A method according to claim 67, wherein said administration is implantation.

70. 70.: Un método según la reivindicación 67, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 67, wherein said administration is by dissolving in water in which the fish are swimming.

71. 71.: Un método según la reivindicación 67, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 67, wherein said administration is orally through feeding.

72. 72.: Un método según la reivindicación 67, en el que dicha administración es por transgénesis a través de un vector que incluye un promotor que permita sobreexpresar o dejar de expresar a voluntad dicho po1inucleótido. A method according to claim 67, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said po1inucleotide at will.

73. 73: Un método de inhibir o estimular la reproducción de los peces mediante la administración a dicho pez de una cantidad eficaz de los anticuerpos descritos en las reivindicaciones 21 y 23. A method of inhibiting or stimulating the reproduction of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.

74. 74.: Un método según la reivindicación 73, en el que dicha administración es mediante inyección. A method according to claim 73, wherein said administration is by injection.

75. 75.: Un método según la reivindicación 73, en el que dicha administración es la implantación. A method according to claim 73, wherein said administration is implantation.

76. 76: Un método según la reivindicación 73, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 73, wherein said administration is by dissolving in water in which the fish are swimming.

77. 77.: Un método según la reivindicación 73, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 73, wherein said administration is orally through feeding.

78. 78.: Un método de inhibir o estimular el crecimiento de los peces mediante la administración a dicho pez de una cantidad eficaz de los anticuerpos descritos en las reivindicaciones 21 y 23. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.

79. 79.: Un método según la reivindicación 78, en el que dicha administración es mediante inyección. A method according to claim 78, wherein said administration is by injection.

80. 80.: Un método según la reivindicación 78, en el que dicha administración es la implantación. A method according to claim 78, wherein said administration is implantation.

81. 81.: Un método según la reivindicación 78, en el que dicha administración es mediante la disolución en agua en la que los peces están nadando. A method according to claim 78, wherein said administration is by dissolving in water in which the fish are swimming.

82. 82.: Un método según la reivindicación 78, en el que dicha administración es por vía oral a través de la alimentación. A method according to claim 78, wherein said administration is orally through feeding.

83. 83.: Un método de inhibir o estimular la ingesta de los peces mediante la administración a dicho pez de una cantidad eficaz de los anticuerpos descritos en las reivindicaciones 21 y 23. A method of inhibiting or stimulating the intake of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.

84. 84.: Un método según la reivindicación 83, en el que dicha administración es mediante inyección. A method according to claim 83, wherein said administration is by injection.

85. 85.: Un método según la reivindicación 83, en el que dicha administración es la implantación. A method according to claim 83, wherein said administration is implantation.

86. A method according to claim 83, wherein said administration is by dissolving in water in which the fish are swimming.

87. A method according to claim 83, wherein said administration is orally through feeding.