ES2480840B1 - Method of obtaining useful data to predict the response to Hepatitis C treatment - Google Patents

Abstract

The use of the KIR3DS1 gene to predict or predict an individual's response to HCV treatment with IFN-Peg plus a guanosine analog, preferably ribavirin (RBV), method, kit and uses.

Description

DESCRIPTION

Method of obtaining useful data to predict the response to Hepatitis C treatment.

FIELD OF THE INVENTION

The present invention is within medicine and molecular biology, and refers to a method of obtaining useful data to evaluate the response to hepatitis C treatment, and in particular, the use of the KIR3DS1 gene to predict the response to Hepatitis C treatment with pegylated interferon plus ribavirin analogues.

BACKGROUND OF THE INVENTION

The treatment of chronic hepatitis caused by HCV genotype 1 has experienced remarkable progress in recent months. The availability of direct-acting drugs (FAD) against HCV has allowed the construction of new treatment regimens that have greatly outperformed the previous regimens based on the association of pegylated interferon (PEG) plus ribavirin (RBV). However, the use of FAD implies some drawbacks that may limit its use, especially among patients co-infected with HIV. First, the formulations currently available increase the number of tablets that an HIV-infected patient needs to take to simultaneously treat both infections, which can make it difficult to adhere to both treatments. Secondly, the FADs currently available have a high potential for interactions with antiretroviral drugs (FAR) that will limit the possibilities of simultaneous treatment of both infections. Thirdly, the simultaneous use of FAD and FAR implies a potential increase in the incidence of adverse effects. Finally, the high cost of FADs represents an important limitation to its use at times like the current one, of serious economic difficulties. On the other hand, clinical trials of development of FAD have demonstrated an efficacy of PEG / RBV-based regimens in patients co-infected with HIV and HCV that are superior to those obtained in the initial clinical trials of development of the PEG / RBV combination. This greater efficacy may be due to both the most appropriate use of the FAR, as well as to the greater experience in the treatment of HCV, which implies a better management of the adverse effects caused by it.

The possibility of identifying a population of patients co-infected with HIV / HCV with a high probability of responding to the treatment of HCV genotype 1 without the use of FAD would mean avoiding the increased risk of adverse effects and interactions and would allow significant economic savings without reducing effectiveness. This fact, demonstrated at least in the case of patients who achieve RVR, currently justifies the indication of PEG / RBV as an elective treatment of HCV-genotype 1 in a subgroup of patients.

Treatment of HCV genotype 1 with PEG / RBV

In patients monoinfected with HCV, several clinical trials demonstrated the superiority of PEG-a 2a and 2b over Interferon-a 2a and 2b, and that it was possible to obtain higher response rates when using PEG in combination with RBV. Although some studies suggested greater efficacy of PEG-a 2a, randomized clinical trials in which both forms of PEG were confronted head to head did not show significant differences in efficacy between them (McHutchison et al., 2009. PN Engl J Med. 361 : 580-93). The dose used and selected as optimal for the treatment of HCV genotype 1 in the clinical trials of development of PEG-a 2a was 180 mg / week and in those of PEG-a 2b of 1.5 mg / kg / week.

In coinfected patients, the combination of PEG / RBV has also obtained better results than Interferon-a 2a and 2b, both with PEG-a 2a at a dose of 180 mg / week, and with PEG-a 2b at a dose of 1.5 mg / kg / week. Neither in coinfected patients has significant differences in efficacy been demonstrated between both forms of PEG.

In patients monoinfected with HCV, dosing the RBV adjusting it to the patient's weight (1,000 or 1,200 mg / day respectively for patients with <75 kg or ≥75 kg) obtains higher rates of SVR compared to fixed doses of 800 mg / day. The dose of RBV used in clinical trials of coinfected patients has not been uniform. In some it has been 800 mg for fear of higher rates of adverse effects than in monoinfected patients and / or the development of drug interactions. In others, higher doses have been used, reaching 1,000 mg / c, adjusting the dose to the patient's weight weight (<60 kg: 800 mg / d, 60-75 kg: 1,000 mg / d and> 75 kg: 1,200 mg / d ). In clinical trials in which weight-adjusted RBV has been used, higher SVR rates have been obtained, which is why it is the recommended strategy.

Higher doses of RBV or PEG as an induction strategy during the first weeks of treatment have not obtained higher response rates.

The duration of treatment in patients monoinfected with HCV genotype 1 is usually scheduled for 48 weeks, although in patients reaching RVR some studies suggest that the duration of treatment could be shortened to 24 weeks without compromising efficacy. In patients co-infected with HIV / HCV, the optimal duration of treatment for chronic hepatitis caused by HCV genotype 1 is unknown. Clinical trials have been routinely designed for a duration of treatment of 48 weeks. Several studies have suggested that the duration of treatment could be conditioned by the response to it. So it has been suggested in slow responders (patients who do not reach RVR or patients who do not get a complete RVP) the treatment should be extended until 72 weeks are completed.

The absence of RVP (reduction ³2 log10 with respect to baseline or negative viremia at 12 weeks of treatment) has a high negative predictive value on SVR, so, in this situation, treatment discontinuation is recommended.

Treatment of HCV genotype 1 with PEG / RBV plus Telaprevir or Boceprevir in monoinfected.

The first available drugs with direct anti-HCV action are Boceprevir (BOC) and Telaprevir (TEL) (Liu et al., 2012. Ann Intern Med. 156: 279-290.). Both drugs are potent inhibitors of HCV NS3 protease. Clinical trials of the development of both drugs have been carried out with different treatment strategies. In the case of clinical trials of BOC, the so-called lead-in strategy has been used, in which patients are treated during the first 4 weeks of treatment with PEG / RBV, adding BOC from the fourth week of treatment. On the other hand, in the clinical trials of the development of TEL, the combination PEG / RBV / TEL was used since the beginning of the treatment.

The dose of boceprevir is 800 mg (4 capsules) every 8 hours, administered with food. The dose of telaprevir is 750 mg (2 tablets) every 8 hours, administered with food. In both drugs, patients should swallow the tablets whole (without chewing, crushing or dissolving).

Boceprevir and telaprevir are not currently indicated in the treatment of chronic hepatitis due to HCV caused by genotypes other than genotype 1.

Evidence in "Naive" patients:

In patients monoinfected with HCV genotype 1, several clinical trials have been carried out to evaluate the efficacy and safety of BOC (SPRINT-1 and SPRINT-2) and TEL (ILLUMINATE) in naive patients (Poordad et al., 2011. N Engl J Med 364: 1195-206, Jacobson et al., 2011. N Engl J Med 364: 2405-16).

In clinical trials of BOC development, SVR rates were significantly higher in each of the groups treated with the PEG / RBV / BOC association [63% in a group of patients with response-guided therapy (TGR = treatment time established in 24 or 48 weeks depending on whether or not extended RVR was defined as undetectable HCV viral load from week 8 to 24) and 66% in the 48-week group of patients] than in patients who received standard PEG therapy / RBV (38%). Regarding the IL28B polymorphism, no differences were observed in terms of SVR between the experimental groups and the control group in patients with CC genotype. However, if significant differences were observed in patients with non-CC genotypes. Finally, no differences were observed between the experimental groups and standard therapy in those patients who achieved RVR (Poordad et al., 2011. N Engl J Med 364: 1195-206).

In the clinical trials of the development of TEL, the rates of SVR were significantly higher in the groups treated with the PEG / RBV / TEL association than in those who received PEG / RBV (75% in the group of patients who received TEL for 8 months, 69% in which they received TEL for 12 months vs. 44% in the control group). The SVR rate increased significantly in favor of the groups that received TEL in both patients with CC and non-CC polymorphism of IL28. Finally, in patients who achieved RVR, treatment with PEG / RBV higher rates of SVR were achieved than in those who received TEL (94% and 84% respectively) (Jacobson et al., 2011. N Engl J Med 364: 2405- 16).

Evidence in patients with previous treatment

In patients monoinfected with HCV genotype 1, several clinical trials have been carried out to evaluate the efficacy and safety of BOC (RESPOND-2) and TEL (ADVANCE and REALIZE) in pretreated patients (Bacon et al., 2011. N Engl J Med 364: 1207-17; Zeuzem et al., 2011. N Engl J Med 364: 2417-28).

In the RESPOND-2 study, SVR rates were significantly higher in patients (both relapses and partial responders) treated with boceprevir. The SVR rates in patients with recurrence were 59% (response-guided therapy), 66% (48-week treatment) vs. 21% (PEG / RBV). The SVR rates in partial responders were 40% (response-guided therapy), 52% (48-week treatment) vs. 7% (PEG / RBV). Statistically significant differences were observed in terms of SVR between the experimental group (treatment 48 weeks) and the PEG / RBV group in patients with fibrosis F0 / F1 (70% vs. 25%), F2 (64% vs. 15%) and F3 / F4 (68% vs. 13%). In this clinical trial, patients with no response (null responders) to previous treatment were not included.

In the REALIZE study, the rates of SVR were significantly higher in patients treated with TEL (administered for 12 weeks), both in relapses (83% vs. 24%), as in partial responses (59% vs. 15%) and in non-patients. responders (29% vs. 5%). These differences were observed independently of the IL28B genetic polymorphism and the degree of fibrosis (minimum fibrosis: 85% vs. 35%, portal fibrosis: 81% vs. 28% and bridging fibrosis / cirrhosis: 84% vs. 13%).

Stop Rules

In the case of treatment with PEG / RBV + TEL, all HCV treatment should be stopped if the determination of HCV-RNA at week 4 or 12 is> 1000 IU / mL.

In the case of treatment with PEG / RBV + BOC, all HCV treatment should be stopped if the determination of HCV-RNA at week 12 is> 100 IU / mL or if it remains detectable at week 24.

If for any reason the treatment with PEG / RBV had to be suspended, the treatment with BOC or TEL should also be suspended.

Chronic HCV hepatitis treatment with TEL or BOC in patients co-infected with HIV / HCV genotype 1

Evidence Boceprevir and telaprevir have been authorized by the European Commission through a centralized procedure for use in patients monoinfected with HCV genotype 1. At present, their indication for HIV-infected patients is not approved. In Spain, access to medicines under conditions other than those authorized is regulated by Royal Decree 1015/2009, of June 19. This regulation establishes that the Spanish Agency for Medicines and Health Products (AEMPS) "may elaborate recommendations for the use of medicines under conditions not contemplated in the technical file when the use of the drug in these conditions supposes a relevant healthcare impact". Thus, AEMPS has developed recommendations that regulate and allow the use of Boceprevir and Telaprevir in patients co-infected with HIV / HCV. Experience in clinical trials with both drugs is limited.

In a randomized (2: 1) double-blind, placebo-controlled clinical trial, the efficacy and safety of BOC plus PEG / RBV versus PEG / RBV in patients co-infected with HIV / HCV genotype 1 was compared. 98 patients were included in the study. of which 34 received PEG / RBV and 64 BOC / PEG / RBV. Patients who received BOC had an SVR rate (measured at week + 12 of treatment) higher than those who received PEG / RBV (60.7% vs. 26.5%, p <0.01). It should be noted that in the study of patients who received ART based on IP / r (Atazanavir, Darunavir or Lopinavir), 67% achieved SVR. The percentage of patients who abandoned the study due to adverse effects was higher in the BOC branch (20% vs. 9%).

A randomized, double-blind, placebo-controlled clinical trial compared the efficacy and safety of TEL plus PEG / RBV versus PEG / RBV in patients co-infected with HIV / HCV genotype 1. Sixty naive patients were included in the study. 22 received PEG / RBV and 38 TEL / PEG / RBV. Patients who received TEL had an SVR rate (measured at week + 12 of treatment) higher than those who received PEG / RBV (74% vs. 45%). The percentage of patients who abandoned the study due to adverse effects was higher in the TEL branch (8% vs. 0%).

Indication of treatment in patients co-infected with HIV / HCV

For the use of BOC or TEL in patients co-infected with HIV, the following criteria are required (10):

HCV dependent criteria

A.- Genotype 1 HCV infection, regardless of whether or not the patient has received prior treatment for HCV

B.- Fibrosis F3 and F4 confirmed by liver biopsy or liver stiffness measured by Fibroscan> 9.5 Kilopascals. Regardless of the degree of fibrosis, treatment with BOC or TEL may be considered in patients with severe extrahepatic manifestations of HCV infection such as those derived from polyclonal mixed cryoglobulinemia.

C.- Compensated chronic liver disease (Child-Pugh grade A)

D.- Hemoglobin concentration> 11 g / dl in women and> 12 g / dl in men

HIV dependent criteria

E.- Total CD4 + lymphocytes in peripheral blood> 100 / ml or percentage of CD4 + lymphocytes> 12%

F.- Plasma viral load of HIV <1000 copies / ml (patients in ART)

Treatment strategy according to the performance or not of prior treatment and the response to it.

a) Naive patients:

It is recommended to consider the start of treatment for HCV genotype 1 in all patients with a degree of fibrosis F3-F4. With regardless of the genotype of the ILB28 and other baseline characteristics of the patient, it is recommended to start treatment with PEG / RBV at a standard dose for 4 weeks, subsequently acting on the basis of the response obtained. Those patients who achieve RVR (undetectable HCV-RNA at week 4) could continue treatment with PEG / RBV without adding TEL or BOC. Those patients who do not reach at least a 1-HCV-RNA decrease at week 4 of the PEG / RBV treatment have a low probability of achieving SVR. Therefore, in these cases, it will act according to the degree of fibrosis of the patients. In those patients with a high risk of hepatopathy progression (Fibroscan> 40 kPa), treatment by adding TEL or BOC will continue as this therapy is the only option to avoid, even with a very low probability of success, hepatopathy decompensation. In those patients with a lower probability of liver disease progression (F3 or liver stiffness below 40 kPa), treatment will be suspended pending future therapeutic options. In those patients with a decrease in HCV-RNA greater than 1 log in week 4 but who do not reach RVR, the treatment will be continued by adding TEL or BOC.

The HEPAVIR group recommends considering the use of PEG / RBV without FAD in patients with IL28 CC genotype and low HCV viral load (less than 600.00o copies / mL).

b) Relapses after treatment with PEG / RBV.

In these cases, a degree of fibrosis F3 or F4, or liver stiffness> 9.5 kPa will also be required to consider starting treatment. In case of recurrence, it is recommended to start the treatment following the recommendations of the data sheet of each of the medications without the need to assess the response to the fourth week of treatment.

c) Partial responders to a PEG / RBV treatment

It is recommended to start treatment with PEG / RBV at a standard dose for 4 weeks, subsequently acting according to the response obtained. The same criteria expressed for the naive patient will be used for decision making.

d) Null responders to a PEG / RBV treatment

Null responders are considered to be those who have not achieved a decrease in HCV-RNA greater than 2 log at 12 weeks after a previous PEG / RBV treatment. The probability of achieving SVR with a new treatment with a regimen that includes BOC or TEL is very low. For this reason, these patients will act according to the risk of progression of their liver disease. In the case of cirrhotic patients with a very high probability of short-term decompensation (hepatic stiffness> 40 kPa) it is recommended to start treatment since treatment with BOC or TEL is the only option to avoid, even with a very low probability of success, decompensation of liver disease. In the rest of the patient, the beginning of the treatment will be considered deferred with close monitoring of the patients waiting for new treatment options.

e) Patients with suboptimal therapy or response to unknown prior treatment.

In patients with prior suboptimal treatment (monotherapy with PEG, combined therapy with non-pegylated Interferon plus RBV), abandonment of treatment without medical cause, withdrawal of toxicity treatment that could be managed successfully today (anemia without use of Erythropoietin, reduction of doses of ribavirin or transfusions, neutropenia without the use of granulocyte colony stimulating factors, toxicity due to concomitant use of DDI, D4T or AZT, depression without treatment or prophylaxis ...), or response to unknown prior treatment, it is recommended to act as in the case of naive patients.

Antiretroviral treatment compatible with BOC or TEL

BOC and TEL have interactions with antiretroviral drugs that limit their joint use. The use of BOC with the following antiretroviral drugs is currently allowed: Nucleoside analogues (Abacavir; Emtricitabine, Lamivudine and Tenofovir) and integrase inhibitors (raltegravir). The use of BOC with non-nucleoside analogues, Protease inhibitors is not allowed (there are discrepancies between studies of pharmacokinetic interactions conducted in healthy volunteers and the results of clinical trials that have demonstrated high rates of SVR with ATV / r, DRV / r and LPV / r), CCR5 correceptor inhibitors and input inhibitors.

The use of TEL with the following antiretroviral drugs is currently allowed: Nucleoside analogues (Abacavir; Emtricitabine, Lamivudine and Tenofovir), integrase inhibitors (raltegravir), No Nucleoside analogues (Efavirenz, increasing the dose of telaprevir at 1,125 mg / 8, Etravirine and Rilpivirine) and protease inhibitors (Atazanavir / ritonavir). The use of TEL with CCR5 inhibitors and input inhibitors is not allowed (10).

Treatment Response Prediction

The response to HCV treatment is associated with a lower progression of liver fibrosis and, therefore, with a lower probability of death from liver disease in patients co-infected with HIV and HCV. In the last decade, the standard treatment against HCV has been pegylated interferon bite therapy (IFN-Peg) plus ribavirin (RBV). However, the rates of sustained virological response (SVR) achieved with this regimen are suboptimal (Neukam et al., 2009. Exp Opin Pharmacother 10: 417-433), obtaining SVR rates of 27-50%. In addition, the treatment is not without adverse effects, which can even be serious. In patients co-infected with HIV, there are also interactions with antiretroviral therapy (ART), which is a limitation of great clinical relevance. Therefore, the estimation of the probability of the response to HCV treatment has an important clinical implication so that the identification of patients with a very low probability of achieving SVR could help improve the management of this treatment. Thus, treatment could be postponed in patients without potential advanced hepatic fibrosis not responding to treatment, until the new direct-acting antivirals are approved for the patient co-infected with HIV / HCV, in order to achieve greater efficacy. On the contrary, individuals with a very high probability of achieving SVR with IFN-Peg plus RBV may not benefit from the use of the new antiviral drugs and for this reason they could be treated with bi-therapy.

Among the pre-treatment predictors of SVR described in patients co-infected with HIV and HCV, those with the highest predictive value are HCV genotype, HCV baseline viral load and host genetic variations. Thus, while the response rate to treatment with IFN-Peg plus RBV observed in patients infected by genotype 2 or 3 ranges between 44-72%, in patients infected by genotype 1 or 4, the SVR rates are found between 17-35%. Similarly, a baseline plasma viral load of less than 600-800 kIU / ml is associated with a higher rate of SVR in this population.

On the other hand, several genetic markers of the host with high predictive value for treatment response have recently been described. In this sense, the polymorphism (single nucleotide polymorphism, SNP) rs12979860 of the single nucleotide located on chromosome 19, in the vicinity of the interleukin 28B gene (IL28B), is closely associated with HCV clearance induced by IFN treatment -Peg plus RBV (12-14). Thus, 71% of the carriers of the CC genotype (defined as favorable genotype) of IL28B achieve SVR compared to 34% observed in non-CC genotype carriers. However, the response rates observed in the population infected by genotype 1 or 4, carriers of the favorable IL28B genotype, are 50% among patients, therefore, a significant proportion of patients are poorly classified. Similarly, SNP rs14158 has been identified in the low density lipoprotein receptor (LDL) gene as an important predictor of the response to treatment with IFN-Peg plus RBV in patients co-infected with HIV / HCV (Pineda et al. ., 2011. AIDS 25: 1415–1420). However, the great importance of this marker lies in its synergistic effect with the IL28B genotype in patients infected with HCV genotype 1 or 4. In this sense, coinfected patients with both favorable IL28B and rs14158 genotypes (CC / CC) have an SVR rate of 70%, while only 14% of patients with both unfavorable genotypes (non-CC) / non-CC) reach RVS (15-17).

Finally, viral kinetics in response to HCV treatment is very useful both to predict the likelihood of response to treatment and to identify the duration, treatment regimen, and its need for discontinuation. In this sense, the response at week 4 after initiation of treatment is the best predictive factor for both standard treatment and triple therapy (Jacobson et al., 2011. N Engl J Med 364: 2405-16). On the other hand, it has been observed that viral kinetics in the first days of HCV treatment is a very useful tool in the evaluation of predictive response factors and in comparing the efficacy of different treatment regimens (Rivero-Juárez et al. ., 2012. J Antimicrob Chemother. Jan; 67 (1): 202-5,).

NK cells play an important role in the innate immune response and at the same time are the most predominant lymphocytes in the liver [Borrego et al., 2002. Mol Immunol. 38: 637–60]. It has been reported that a decrease in intrahepatic NK cells and in peripheral blood HCV infection [Neukam et al., 2099. Exp Opin Pharmacother 10: 417-433] leads to deficiencies in the activation of NK cells that could favor disease chronification. HCV treatment, however, seems to lead to a massive activation of the innate immune response [Rivero-Juárez et al., 2012. J Antimicrob Chemother. Jan; 67 (1): 202-5] and NK cells due to the fact that IFN-α is a potent activator of these cells [Pineda et al., 2010. Clin Infect Dis. Oct 1; 51 (7): 788-95]. Natural Killer cell receptors (KIR receptors) are receptors that are found on their surface associated with either the activation of these cells (S-KIR or its inhibition L-KIR [Pineda et al., AIDS 2011, 25: 1415 - 1420] The presence of several KIR receptors (2DL2, 2DL3, 2DS1 2DS2 and 3DL1) has been associated with the degree of efficiency of the HCV virus treatment [Neukam et al., 2011. J Acquir Immune Defic Syndr. Dec 1; 58 (4): e115-7] Thus, the expression of S-KIR on the surface of the NK cell promotes cytolysis and IFN-gamma production against target cells that specifically express ligands of the major class I histocompatibility complex. [Borrego et al., 2002. Mol Immunol. 38: 637-60] This indicates that the KIR action is conditioned by the presence of a specific ligand in the target cell, therefore and, in order to assess the possible influence of the KIRs in response to treatment, it is necessary to determine the presence of their specific ligand.

The KIR3DS1 receptor, which we know has an activating action on NK cells, has been described as having a protective role against the development of hepatocellular carcinoma in patients infected with HCV [Borrego et al., 2002. Mol Immunol. 38: 637–60]. However, its impact on the result of HCV treatment has not been described.

It is important, therefore, to find new biomarkers that can be used to predict the response to HCV treatment.

.

DESCRIPTION OF THE INVENTION

The present invention provides a method of obtaining useful data to predict or predict the response to HCV treatment, and specifically, to treatment with Peg-IFN / RBV. The authors of the present invention have found a biomarker useful for predicting the response to hepatitis C treatment, which is a key feature of clinical practice to determine treatment in genotype 1 HCV patients co-infected with HIV, and who could lead doctors to detect those patients most likely to respond to Peg-IFN / RBV therapy.

Therefore, a first aspect of the invention relates to the use of the KIR3DS1 gene to predict an individual's response to HCV treatment with IFN-Peg plus a guanosine analog. In a preferred embodiment, the guanosine analog is ribavirin (RBV).

In another preferred embodiment of this aspect of the invention, the individual is co-infected with HIV and HCV. In another preferred embodiment, the HCV is genotype 1.

Antiviral therapy is basically aimed at achieving virological, biochemical and histological objectives. The evaluation of the response to the treatment, is based on the effect of the same on the virological state, not only at the end of the treatment but, more importantly, in its follow-up after the end of the treatment. As understood herein, it is called "sustained virological response" or "sustained viral response" (SVR) the viremia negativization (negative viral RNA by polymerase chain reaction techniques -PCR-) that is maintained at least 24 weeks after the end of treatment; In other words, the absence of HCV-RNA in the serum 6 months after the end of treatment.

The negativization of the viremia at the end of the treatment, with the reappearance of the RNA once it is finished, defines the “virological response with relapse”. The absence of viremia negativization at the end of the treatment defines the "virological non-response" to the treatment.

"Interferon alfa" (IFN-α) is an immunomodulatory cytokine that has antiviral activity, antiangiogenic and antiproliferative properties. IFN-Peg is obtained by the physicochemical binding of polyethylene glycol (PEG) to recombinant interferon alfa (peginterferon α-2a and α-2b), which increases its permanence in the blood requiring a lower frequency of injections.

There are currently two types of commercial pegylated interferons whose application has been extended: peginterferon alfa – 2a (Pegasys®, Roche) and peginterferon alfa – 2b (Pegintron®, Schering – Plow). These two products are similar with respect to their efficacy and safety but their dosage regimens differ slightly.

Ribavirin (1-β-D-ribofuranosyl-1H-1, 2,4-triazol-3-carboxamide) is a synthetic nucleotide analogous to guanidine, with antiviral properties and immunoregulatory activity. It was one of the first drugs that demonstrated its effectiveness in reducing the ability to reproduce viruses. It is described in the Merck Index, compound No. 8199, eleventh edition. Its manufacture and formulation are described in US Pat. n. No. 4,211,771.

The rapid erythrocyte uptake of ribavirin and its phosphorylation are responsible for significant dose-dependent hemolytic anemia. In order to avoid this unwanted effect, the design of the new drugs contemplates that they are not captured or phosphorylated by erythrocytes or that they are rapidly captured and phosphorylated in the liver. Both approaches have the potential disadvantage that they can override fundamental steps that contribute to the therapeutic efficacy of ribavirin.

Other derivatives, prodrugs or analogs of ribavirin are viramidine and levovirin.

Viramidine is a prodrug of RBV, in the liver it is converted to RBV by the action of hepatic adenosinedeaminase. RBV and viramidine are rapidly eliminated, their molecules and metabolites are excreted by the kidney and have a Tmax of 1.5-3 h. Experimentally, hepatic retention of RBV derived from an oral dose of viramidine is 3 times higher than oral RBV. In contrast, the concentration of RBV phosphates in red blood cells is much lower, hence a more stable hemoglobin concentration can be maintained. It is a safe drug and is well tolerated. The adverse effects with doses of 200, 600 and 1,200 mg were: 0, 26 and 50%, respectively; mostly mild and disappeared without sequelae.

Levovirin is the L-enantiomer of RBV and does not cause hemolytic anemia. It has an immunomodulatory activity similar to RBV, but it has no direct antiviral activity.

Other possible analogs are described, for example, but not limited to, in WO 2010/135520.

Ribavirin alone is not effective against HCV, but when combined with interferon, viral eradication rates are much better compared to those achieved only with interferon.

The "HCV genotype", or "viral strain" is determined by a blood test. The hepatitis C virus has been classified into six different genotypes based on differences in their genomes, these genotypes in turn are subdivided. The preponderance and distribution of these genotypes varies globally. For example, in North America, genotype 1 predominates, followed by 2 and 3. In Europe, genotype 1 predominates, followed by 3, 4 and 2. Genotype 4 predominates in Egypt, 5 occurs almost exclusively in Africa, and genotype 6 in the Southeast Asian.

The genotype is of clinical importance since it determines the potential response of the current therapy and the duration that it will require. Genotypes 1 and 4 respond less to this treatment than the others (genotypes 2, 3, 5 and 6). The duration of standard interferon-based therapy for genotypes 1 and 4 is 48-72 weeks, while for genotypes 2 and 3 it is only 12-24 weeks. In summary, some HCV genotypes, such as types 2 and 3, are easier to eradicate than type 1.

The amount of HCV RNA in the blood (serum) is called “basal plasma viral load of HCV RNA”. Its presence is indicative of an active infection with ongoing viral reproduction. The viral load is usually expressed in logarithmic units [log10 IU / ml].

For the prognosis, the higher the baseline viral load, the lower the likelihood of a sustained response. The response to antiviral treatment is evaluated with a baseline viral load (pre-treatment) and at least one viral load at the end of it and at 24 weeks post treatment. A response to antiviral treatment is considered if an undetectable viral load is obtained at the end of the treatment and an undetectable viral load and / or qualitative negative RNA at 24 weeks (sustained viral response). Likewise, it has been determined that a fall in the early viral load (early viral response), with a decrease of 2 log10 IU / ml or more at 12 weeks intra-treatment, allows an early evaluation of the probability of obtaining a sustained virological response at the end of the therapy.

Another aspect of the invention relates to the simultaneous use of the KIR3DS1 and IL28B genes to predict or predict an individual's response to HCV treatment with IFN-Peg plus a guanosine analog.

The genotyping of the "IL28B" gene can be obtained, preferably, but not limited to, by sequencing the complete gene but even more preferably, it is obtained by analyzing the single nucleotide polymorphism (single nucleotide polymorphism, SNP) rs12979860 (SEQ ID NO: 5) located on chromosome 19, in the vicinity of the interleukin 28B gene (IL28B).

The nuleotide sequence of SEQ ID NO: 6 is:

CTGAACCAGGGAGCTCCCCGAAGGCG [C / T] GAACCAGGGTTGAATTGCACTCCGC

METHOD OF OBTAINING USEFUL DATA, METHOD OF FORECAST AND PREDICTION OF THE SUSTAINED VIRAL RESPONSE TO THE TREATMENT OF HCV WITH CHEMOTHERAPY

Another aspect of the invention relates to a method of obtaining useful data for predicting or predicting SVR for treatment of HCV with IFN-Peg plus a guanosine analog, hereafter referred to as the first method of the invention, comprising:

a) obtain an isolated biological sample from an individual, and

b) determine the genotype of the KIR3DS1 gene and its Bw4 ligand in the sample isolated from (a).

The presence in a patient of the KIR3DS1 gene favors the response to treatment with pegylated Interferon (IFN-PEG) and Ribavirin (or analogues). In addition, the authors of the present invention have determined that:

1. The joint presence of the KIR3DS1 gene and its HLA-Bw4 ligand is a better response factor than when only KIR3DS1 occurs.

2. The joint presence of the KIR3DS1 gene without the HLA-Bw4 ligand and the polymorphic variant of IL28B CC respond better than those patients who possess only the KIR3DS1 gene or the IL28B CC variant.

3. In any case, the best predictive combination of good response occurs in those patients who present simultaneously with the genes KIR3DS1, HLA-Bw4 and also IL28B CC.

Another aspect of the invention relates to a method for predicting or predicting SVR to the treatment of HCV with IFN-Peg plus a guanosine analogue, hereafter referred to as the second method of the invention, comprising steps (a) and (b ) of the first method of the invention, and further comprises:

 c) classify the individuals who present the KIR3DS1 genotype, in the group of patients who respond to the treatment or have a better prognosis.

In a preferred embodiment, the method makes it possible to classify the individuals who present the KIR3DS1 genotype and its functional ligand Bw4, in the group of patients who respond well to the treatment or with a better prognosis.

In another preferred embodiment, the guanosine analog is ribavirin (RBV).

In another preferred embodiment of this aspect of the invention, the individual is co-infected with HIV and HCV. In another preferred embodiment, the HCV is genotype 1.

The steps (b) and / or (c) of the methods described above can be totally or partially automated, for example, by means of a robotic sensor device for the detection of the quantity in step (b) or the computerized comparison in step (c).

The term "isolated biological sample" includes, but is not limited to, cells, tissues and / or biological fluids of an organism, such as blood, serum, urine, saliva, cerebrospinal fluid, or a solid or semi-solid sample, such as tissues, feces, and similar, or alternatively, a solid tissue such as those commonly used in histological diagnosis, obtained by any method known to a person skilled in the art.

There are more than 100 different methods of genotyping SNPs, whichever is applicable in the present invention. For example, without limiting ourselves, it can be detected using restriction enzymes or by simple sequencing by PCR, ASO probes and hybridization in DNA microarrays or spheres. Thus, for example, as methods of amplification of SNPs are PCR, the Invader method, amplification by rolling circle DNA, etc. As allelic discrimination methods, allele-specific hybridization, allele-specific oligonucleotide ligation, probe mini-sequencing or extension (SBE, Single Base Extension), allele-specific invasive breakage (Invader), etc. can be used, but not limited to. Depending on the detection format, we can mention, also without limiting ourselves, the use of Taqman probes, molecular beacons, scorpion, etc. Regarding reactions on a solid support, we have, for example, biochips and microarrays of DNA, or other methods that employ particles, such as, for example, Luminex 100, BeadArray, etc. There are also methods of mass detection, such as pyrosequencing, or miniaturization.

In another preferred embodiment, genotyping of KIR3DS1 is performed by PCR, and more preferably, with sequence primers SEQ ID NO: 3 and SEQ ID NO: 5, or with primers SEQ ID NO: 4 and SEQ ID NO: 5 .

In a preferred embodiment of the present invention, genotyping of KIR3DS1 has been performed following the method described in Vilches et al., 2007. Tissue Antigens. Nov; 70 (5): 415-22.

In a particular embodiment, in each reaction 100 ng of genomic DNA is amplified in 10 µl of PCR buffer (67 mM Tris-HCL pH 8.8, 16 mM (NH4) 2 SO4, 2 mM MgCl2, 0.01% Tween 20, 100 ˜ M dNTP containing 0.3 u of Taq polymerase (ECO Taq, Ecogen SRL, Barcelona, Spain).

The PCR conditions were:

2 min at 95 ° denaturation followed by 10 cycles of 10 s at 94 ° C, 40 s at 65 ° C and 20 cycles of 20 s at 94 ° C, 20 s at 61 ° C and 30s at 72 ° C. 5 μl of the amplification product was run on a 3% agarose gel with a migration distance of 3 cm.

In another preferred embodiment, step (b) of any of the methods of the invention further comprises determining the genotype of the IL28B gene. More preferably, the determination of the IL28B genotype is performed by analyzing the variations in the SNP rs12979860.

The KIR3DS1 gene, or also killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 (KIR-G1; NKAT10; CD158E2; KIR-123FM) belongs to the genes of the KIR family, killer cell immunoglobulin-like receptors ( KIRs), and are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. KIR genes are polymorphic and highly homologous, and are found in a cluster on chromosome 19 (19q13.4) in the leukocyte receptor complex (LRC).

In the context of the present invention, KIR3DS1 is also defined by a nucleotide or polynucleotide sequence, which constitutes the coding sequence of the protein collected in SEQ ID NO: 1, and which would comprise various variants from:

a) nucleic acid molecules encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 1,

b) nucleic acid molecules whose complementary hybrid chain with the polynucleotide sequence of a),

c) nucleic acid molecules whose sequence differs from a) and / or b) due to the degeneracy of the genetic code,

d) nucleic acid molecules encoding a polypeptide comprising the amino acid sequence with an identity of at least 80%, 90%, 95%, 98% or 99% with SEQ ID NO: 1, and in which the polypeptide encoded by said nucleic acids possesses the activity and structural characteristics of the KIR3DS1 protein. Among these nucleic acid molecules is the collection in SEQ ID NO: 2.

In the present invention "prognosis" is understood as the expected evolution of a disease and refers to the assessment of the probability according to which a subject suffers from a disease as well as the assessment of its onset, developmental status, evolution, or its regression, and / or the prognosis of the course of the disease in the future. As those skilled in the art will understand, such assessment, although preferred, may not be correct for 100% of the subjects to be diagnosed. The term, however, requires that a statistically significant part of the subjects can be identified as having the disease or having a predisposition to it. If a part is statistically significant, it can be determined by the person skilled in the art using several well-known statistical evaluation tools, for example, determination of confidence intervals, determination of p-values, Student's t-test, Mann-Whitney test , etc. Preferred confidence intervals are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%. P values are preferably 0.2, 0.1, 0.05.

"Prediction of the response" means, in the context of the present invention, the determination of the probability that the patient responds favorably or unfavorably to a particular therapy or treatment. Especially, the term "prediction", as used herein, refers to an individual evaluation of any parameter that may be useful in determining the evolution of a patient. As those skilled in the art will understand, the prediction of the clinical response to treatment, although it is preferred, does not need to be correct for 100% of the subjects to be diagnosed or evaluated. The term, however, requires that a statistically significant part of the subjects can be identified as having an increased probability of having a positive response. The person skilled in the art can easily determine if a subject is statistically significant using several well-known statistical evaluation tools, for example, determination of confidence intervals, determination of p-values, Student's t-test, Mann Whitney test, etc. . Preferred confidence intervals are at least 50%>, at least 60%>, at least 70%>, at least 80%>, at least 90%), at least 95%>. P values are preferably 0.2, 0.1 or 0.05. The prediction of the clinical response can be made using any assessment criteria used in oncology and known to the person skilled in the art.

In turn, according to the method of the present invention, other subclassifications could be established within this principal, thus facilitating the choice and establishment of appropriate therapeutic regimens or treatment. This discrimination, as understood by one skilled in the art, is not intended to be correct in 100% of the samples analyzed. However, it requires that a statistically significant amount of the analyzed samples be classified correctly. The amount that is statistically significant can be established by a person skilled in the art by using different statistical tools, for example, but not limited, by determining confidence intervals, determining the significance value P, Student test or discriminant functions. Fisher, non-parametric measurements of Mann Whitney, Spearman correlation, logistic regression, linear regression, area under the ROC curve (AUC). Preferably, the confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99%. Preferably, the value of p is less than 0.1, 0.05, 0.01, 0.005 or 0.0001. Preferably, the present invention makes it possible to correctly detect the disease differentially by at least 60%, more preferably at least 70%, much more preferably at least 80%, or even much more preferably at least 90%. of the subjects of a certain group or population analyzed.

The term "individual", as used in the description, refers to animals, preferably mammals, and more preferably, humans. The term "individual" is not intended to be limiting in any aspect, and may be of any age, sex and physical condition.

KIT OR DEVICE FOR DIAGNOSIS, MICROARRAY AND USES

Another aspect of the present invention relates to a kit or device, hereinafter kit or device of the invention, comprising the elements necessary to analyze the genotype of the KIR3DS1 gene

In another preferred embodiment the kit may contain oligonucleotides designed from a known sequence or an mRNA of the KIR3DS1 gene (SEQ ID NO: 1).

More preferably, the kit of the invention comprises sequence oligonucleotides SEQ ID NO: 3 to SEQ ID NO: 5

 Initiator or direct primer

 Initiator or reverse primer

 cat cgg ttc cat gat gcg (SEQ ID NO: 3)

 cca cga tgt cca gggga (SEQ ID NO: 5)

 cat cag ttc cat gat gcg (SEQ ID NO: 4)

Said kit may contain all those reagents necessary to analyze the genotype of the KIR3DS1 gene by means of any of the methods described hereinbefore. The kit can also include, without any limitation, buffers, agents to prevent contamination, inhibitors of protein degradation, etc. On the other hand, the kit can include all the supports and containers necessary for commissioning and optimization. Preferably, the kit further comprises instructions for carrying out any of the methods of the invention.

It is also possible that the oligonucleotide (s) or probes are immobilized in spots on a (preferably solid) surface. In one of its embodiments, the kit comprises a microarray, or microarray of the invention. An RNA microarray is a matrix on a solid substrate (usually a glass holder or a cell of a thin silicon film) that evaluates large amounts of different RNAs that are detectable by specific probes immobilized on spots on a solid substrate. Each spot contains a specific nucleic acid sequence, which normally corresponds to a specific DNA sequence. Although the number of spots is not limited in any way, there is a preferred embodiment in which the microarray is customized for the methods of the invention.

Therefore, another aspect of the invention relates to a microarray, hereafter referred to as a microarray of the invention, comprising at least one probe for detecting the genotype of the KIR3DS1 gene.

Thus, for example, oligonucleotide sequences are constructed on the surface of a chip by sequential elongation of a growing chain with a single nucleotide using photolithography. Thus, the oligonucleotides are anchored at the 3 'end by a method of selective activation of nucleotides, protected by a photolabile reagent, by the selective incidence of light through a photomask. The photomask can be physical or virtual.

Thus, oligonucleotide probes can be between 10 and 100 nucleotides, more preferably, between 20 and 70 nucleotides, and even more preferably, between 24 and 30 nucleotides. For the quantification of gene expression, preferably about 40 oligonucleotides per gene are used.

Synthesis in situ on a solid support (for example, glass) could be done using ink-jet technology, which requires longer probes. The supports could be, but not limited to, filters or membranes of NC or nylon (charged), silicon, or glass slides for microscopes covered with aminosilanes, polylysine, aldehydes or epoxy. The probe is each of the chip samples. The target is the sample to be analyzed: messenger RNA, total RNA, a PCR fragment, etc.

More preferably, the kit or device, and / or the microarray further comprises one or more probes necessary to detect the haplotype of the IL28B gene

Another aspect of the invention relates to the use of the kit or device, the microarray, or the microarray of the invention, to predict or predict an individual's response to HCV treatment with IFN-Peg plus a guanosine analog. In a preferred embodiment, the guanosine analog is ribavirin (RBV).

Another aspect of the invention relates to a computer-readable storage medium comprising program instructions capable of having a computer perform the steps of any of the methods of the invention (of the first or second method of the invention ).

Another aspect of the invention relates to a transmissible signal comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.

The terms "polynucleotide" and "nucleic acid" are used interchangeably herein, referring to polymeric forms of nucleotides of any length, both ribonucleotides (RNA or RNA) and deoxyribonucleotides (DNA or DNA). The terms "amino acid sequence", "peptide", "oligopeptide", "polypeptide" and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which may be coding or non-coding, Chemically or biochemically modified.

Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and drawings are provided by way of illustration, and are not intended to be limiting of the present invention.

BRIEF DESCRIPTION OF THE FIGURES

 Fig. 1. Viral HCV decline for KIR3DS1 and its ligands in patients carrying IL28B-CC (1A) or non-CC IL28B (1B) genotypes.

Fig. 2. Viral HCV decreases significantly in patients who possess the KIR3DS1 gene and its HLA-Bw4 ligand in patients who possess the IL28B-CC (2A) or IL28B non-CC genotypes (2B) during the first hours of treatment with Peg-IFN / RBV

EXAMPLES OF THE INVENTION

The invention will now be illustrated by exposing the results obtained by the inventors. These show the specificity and efficacy of the invention to obtain useful data in predicting the response to treatment of individuals coinfected with HIV and HCV.

Patients

The prospective study included patients with chronic hepatitis C, genotype 1, receiving combined Peg-IFN / RBV therapy. The criteria used to determine hepatitis therapy was followed by international guidelines (20). Clinical, virological and host characteristics were collected. The fibrosis status was determined by biopsy or transient hepatic elastography (FibroScan ®, Echosen, Paris). Significant fibrosis is defined as an F3-F4 fibrosis METAVIR score in liver biopsy or a liver stiffness value of ≥ 11 kPa.

Treatment regimens

All individuals were treated with Peg-IFN α2 at a dose of 180 μg, combined with a dose of ribavirin adjusted to weight (1000 mg / day for <75 kg, 1200 mg / day for ≥ 75 kg), in accordance with the guidelines international (20), and completed at least 4 months of treatment.

Virological evaluation and definition of the response to treatment

 Plasma loads of HCV RNA RNA were measured at the beginning of the study and at weeks 1, 2 and 4, using a quantitative PCR assay (Cobas TaqMan, Roche Diagnostic Systems Inc., Pleasanton, CA, USA), with a detection limit of 15 IU / ml.

Sustained virological response (SVR SVR) is defined as an undetectable level of serum HCV RNA 24 weeks after the end of HCV therapy. Undetectable plasma HCV RNA at week 4 is considered a rapid virological response (RVR).

Genotyping of single nucleotide polymorphisms (SNPs)

DNA was extracted using the MagNA Pure automated DNA extraction method (Roche Diagnostics Corporation. Indianapolis, IN 46250, USA). SNP rs129679860, located 3 kilobases upstream of IL28B and in linkage disequilibrium was genotyped with a non-synonymous coding variant of the IL28B gene (213A> G, K70R; rs81031142). Genotyping was carried out using the usual TaqMan assay (Applied Biosystems, Foster City, California, USA), on DNA isolated from whole blood samples, using a thermocycler with Stratagene MX3005 MxPro software (Stratagene, La Jolla, California, USA), according to manufacturer's instructions. The researchers responsible for genotyping did not have access to patient data. The IL28B genotype was defined as CC or non-CC (TT / CT).

KIR genotyping

KIR genotyping was performed with sequence specific primers capable of detecting the presence of 16 different KIR genes previously used by Gómez-Lozano et al [21]. This method provides a high degree of resolution, since each pair of primers identifies two linked, cis-located polymorphic sites (Invitrogen Corporation).

Genotyping human leukocyte antigen (HLA) -B

HLA-B genotyping was performed with the INNO-LiPA HLA-B Multiplex Kit (Innogenetics NV), using HLA-B multiplex primers for nucleic acid amplification of the second to fourth exons of the HLA-B locus, and HLA- primers Bw4 for exon 2 of the HLA-BW4 alleles. This procedure is based on the reverse PCR-SSO method. Following alleles HLA-B and BW4 or Bw6 specificities were determined with LIRASTM software for INNOLIPA HLA. Patients carrying KIR3DS1 were defined on the basis of specific ligands Bw4 (KIR3DS1 / Bw4) or Bw6 (KIR3DS1 / Bw6) [22].

Statistic analysis

Continuous variables were expressed as mean ± standard deviation or median and quartiles (Q1-Q3) and were analyzed by Student's t-test, Mann-Whitney U-test or Kruskal-Wallis test. Categorical variables were expressed as number of cases (in percentage). Frequencies were compared using the χ2 test or Fisher's exact test. Significance was set at a value of p less than 0.05. Plasma reductions in HCV RNA were analyzed by IL28B and KIR3DS1 between the start and week 1, week 2 and at 4 weeks. The rates of SVR and RVR were analyzed in terms of the KIR3DS1 and IL28B genotypes. For the purposes of this analysis, the SVR was evaluated in the treatment approach, excluding those who voluntarily abandoned or discontinued treatment due to adverse events. A linear regression model of the HCV viral decrease was made from the beginning until weeks 1, 2 and 4.

The analysis was performed with the statistical package SPSS version 18.0 (IBM Corporation, Somers, NY, USA).

Ethical aspects

The study was designed and carried out according to the Declaration of Helsinki and approved by the ethical committee of the Reina Sofía Hospital, Córdoba, Spain. All patients gave informed consent before participating in the study.

RESULTS

Baseline characteristics of the patients.

Sixty patients co-infected with HIV / HCV genotype 1 were included in this prospective study. Baseline characteristics are shown in Table 1. 21 (35%) patients carried the IL28B-CC genotype and 39 (65%), the non-CC IL28B genotype.

Twenty-four (40%) patients had KIR3DS1, and 36 (60%) did not. Among patients with KIR3DS1, 13 (54.1%) had specific ligand Bw4 and

11 (45.9%) Bw6. The distribution of KIR3DS1 and its ligands by IL28B genotype is shown in Table 2. In our study, all IL28B-CC patients with KIR3DS1 had the Bw4 specific ligand, while only 38.8% IL28B of non-CC patients carrying of KIR3DS1 had this ligand (p = 0.016).

Influence of KIR3DS1 and IL28B on HCV viral decline

As shown in Figure 1, patients with KIR3DS1 and specific ligand Bw4 showed a greater viral decrease in HCV than those who did not carry KIR3DS1 or with KIR3DS1 / Bw6 at week 1 (KIR3DS1 / Bw4: 1.47 ± 0.49 ; KIR3DS1 / Bw6: 0.508 ± 0.41; No KIR3DS1: 0.48 ± 0.37 IU log10 / ml, p = 0.01), week 2 (KIR3DS1 / Bw4: 1.82 ± 0.47; KIR3DS1 / Bw6: 1.29 ± 0.61; No KIR3DS1: 0.77 ± 0.49 IU log10 / ml, p = 0.038) and week 4 (KIR3DS1 / Bw4: 2.53 ± 0.56; KIR3DS1 / Bw6 : 1.71 ± 0.74; No. KIR3DS1: 1.47 ± 0.81 IU log10 / ml, p = 0.03). A key point of the results is that no differences were found in any of the time points analyzed between patients with KIR3DS1 / Bw6 and those without KIR3DS1 (week1: p = 0.527; Week2: p = 0.173; 4 weeks: p = 0.358) (Fig. 1).

The carriers of the IL28-CC genotype showed a greater reduction in the plasma levels of HCV RNA than the non-carriers of the CC genotype at each time analyzed (week 1: 0.98 ± 0.72 versus 0.39 ± 0.51 IU log10 / ml, p = 0.017; week 2: 1.67 ± 0.81 versus 0.83 ± 0.77 IU log10 / ml, p = 0.028; 4 weeks: 2.28 ± 0.62 versus 1 , 47 ± 1.06 IU log10 / ml, p = 0.037).

Influence of both IL28B and KIR3DS1 genotype on HCV viral clearance

Among the carriers of the IL28B-CC genotype, those with KIR3DS1 / Bw4 had higher rates of HCV viral clearance than those who did not carry KIR3DS1 (week 1: 2.51 ± 0.67 versus 0.501 ± 0.41 IU log10 / ml, p <0.001, week 2: 2.82 ± 0.73 versus 1.39 ± 0.72 IU log10 / ml, p = 0.01; 4 weeks: 3.62 ± 0.78 versus 1 , 98 ± 0.98 IU log10 / ml, p = 0.02) (Fig. 2A). However, among patients with non-CC IL28B genotype, there were differences in viral clearance of HCV between those who carry KIR3DS1 / Bw4 and those who are not carrying KIR3DS1 / Bw4 (week 1: 0.78 ± 0.57 versus at 0.41 ± 0.39 IU log10 / ml, p = 0.476; week 2: 1.01 ± 0.67 versus 1.03 ± 0.82 IU log10 / ml, p = 0.699; 4 weeks: 1, 97 ± 0.86 vs. 1.51 ± 0.84 IU log10 / ml, p = 0.755) (Fig. 2B)

When HCV virus elimination was compared in KIR3DS1 / Bw4 patients, those with the IL28B-CC genotype had higher rates of viral decline than those with the non-CC genotype IL28B (week 1: p <0.001, week 2: p = 0.03; 4 weeks: p = 0.037). On the other hand, when compared to patients who did not carry KIR3DS1 / Bw4, there were no differences in HCV virus elimination in the first weeks of treatment on the basis of the IL28B genotype (week 1: p = 0.827; week 2: p = 0.725; 4 weeks: p = 0.429).

The linear regression models of HCV viral decline from baseline to weeks 1, 2 and 4 are shown in Table 3.

Treatment of the response rate

Eleven (18.3%) patients dropped out due to abandonment of therapy or an adverse event. Patients carrying KIR3DS1 / Bw4 achieved higher rates of RVR and SVR than those who did not carry KIR3DS1 / Bw4 (RVR: 6 [46.15%] versus 8 [17.02%], p = 0.012; SVR: 7 [63 , 6%] versus 13 [26.5%], p = 0.031). Patients with the IL28B-CC genotype showed higher rates of RVR and SVR than those with the IL28B non-CC genotype (RVR: 8 [38.01%] versus 5 [12.8%], p = 0.03; SVR: 10 [55.5%] versus 10 [32.2%], p = 0.027) RVR and SVR rates according to the IL28B genotype and the presence of KIR3DS1 are shown in Table 4.

Claims (24)

1.- The use of the KIR3DS1 gene to predict or predict an individual's response to HCV treatment with IFN-Peg plus a guanosine analog. 2. The use of the KIR3DS1 gene according to the preceding claim, wherein the guanosine analog is ribavirin (RBV). 3. The use of the KIR3DS1 gene according to any of claims 1-2, wherein the individual is co-infected with HIV and HCV. 4. The use of the KIR3DS1 gene according to any of claims 1-3, wherein the HCV is of genotype 1. 5. The use of the KIR3DS1 gene according to any of claims 1-4, in combination with the IL28B gene. 6. A method of obtaining useful data for predicting or predicting SVR for the treatment of HCV with IFN-Peg plus a guanosine analog, hereafter referred to as the first method of the invention, comprising: a) obtain an isolated biological sample from an individual, and b) detect the genotype of the KIR3DS1 gene, in the sample isolated from (a). 7. The method according to the preceding claim, which comprises detecting the genotype of the KIR3DS1 gene, and also that of its ligand Bw4, in the sample isolated from (a). 8. A method for predicting or predicting the Sustained Viral Response (SVR) to the treatment of HCV with IFN-Peg plus a guanosine analog, comprising steps (a) and (b) any of claims 6-7, and It also includes:  c) classify the individuals who present the KIR3DS1 genotype, in the group of patients who respond to the treatment or have a better prognosis. 9. A method for predicting or predicting the Sustained Viral Response to the treatment of HCV with IFN-Peg plus a guanosine analog, comprising steps (a) and (b) any of claims 6-7, and further comprises: c) classify the individuals who present the KIR3DS1 genotype, or its Bw4 ligand, in the group of patients who respond to the treatment or have a better prognosis. 10. The method according to any of claims 6-9, wherein the guanosine analog is ribavirin (RBV). 11. The method according to any of claims 6-10, wherein the individual is co-infected with HIV and HCV. 12. The method according to any of claims 6-11, wherein the HCV is of genotype 1. 13. The method according to any of claims 6-12, which further comprises determining the genotype of the IL28B gene. 14. The method according to any of claims 6-13, wherein the determination of the genotype of KIR3DS1 is performed by PCR. 15. The method according to the preceding claim, wherein the PCR is carried out using the sequence primers SEQ ID NO: 3 and SEQ ID NO: 5. 16. The method according to claim 14, wherein the PCR is carried out using sequence primers SEQ ID NO: 4 and SEQ ID NO: 5. 17. The method according to any of claims 13-16, wherein the determination of the IL28B genotype is performed by analyzing the SNP rs12979860. 18. The method according to any of claims 6-17, wherein the guanosine analog is ribavirin (RBV). 19. The method according to any of claims 6-18, wherein the biological sample is or is obtained from peripheral blood. 20.- A kit or device comprising one or several nucleotide sequences necessary to detect the genotype of the KIR3DS1 gene. 21. The kit or device according to the preceding claim, comprising the sequence primers SEQ ID NO: 3 and SEQ ID NO: 4, or the sequence primers SEQ ID NO: 3 and SEQ ID NO: 5. 22. The kit or device according to any of claims 20-21, which further comprises one or more probes necessary to detect the genotype of the IL28B gene. 23.- The use of a kit or device according to any of claims 20-22, to predict or predict an individual's response to HCV treatment with IFN-Peg plus a guanosine analog. 24. The use of a kit or device according to the preceding claim, wherein the guanosine analog is ribavirin (RBV).