ES2385657T3 - Methods and compositions for the inhibition of innate immune responses and autoimmunity - Google Patents

Abstract

An oligonucleotide for use in inhibiting a TLR7 / 8 dependent immune response in an individual, in which the oligonucleotide has less than about 200 bases or base pairs and the oligonucleotide comprises an immunoregulatory sequence, in which the immunoregulatory sequence comprises at least one trinucleotide sequence. TGC at the 5 'end of the oligonucleotide.

Description

Methods and compositions for the inhibition of innate immune responses and autoimmunity.

Cross reference to related requests

This application claims the benefit of US Provisional Patent Application, Serial No. 60 / 606,833, filed on September 1, 2004.

Technical field

The present invention relates to an oligonucleotide for use in inhibiting a TLR7 / 8 dependent immune response in an individual, in which the oligonucleotide has less than about 200 bases or base pairs and the oligonucleotide comprises an immunoregulatory sequence, in which The immunoregulatory sequence comprises at least one TGC trinucleotide sequence at the 5 'end of the oligonucleotide.

Background of the invention

In general, immunity can be classified as innate immunity and adaptive immunity. Typically, innate immune responses occur immediately after an infection to provide an early barrier to an infectious disease, while adaptive immune responses occur later with the generation of antigenically specific effector cells and, often, protective immunity to long term. Innate immune responses do not generate lasting protective immunity, but they appear to play a role in generating the adaptive immune response that arises later.

In innate immunity receptors encoded by the germ line are used to recognize traits that are common to many pathogens and to activate signaling processes that give rise to the expression of effector molecules. Some of these effector molecules may eventually elicit an adaptive immune response. The family of Toll-like receptors (TLRs; Toll-like receptors) has been associated with innate immune response signaling and microbial ligands have been identified for various mammalian TLRs. For example, TLR2 interacts with peptidoglycan, bacterial lipopeptides and certain types of lipopolysaccharide (LPS), TLR3 interacts with double-stranded RNA, TLR4 interacts with LPS and TLR5 interacts with bacterial flagelin. See, for example, Poltorak et al. (1998), Science 282: 2085-2088; Akira et al. (2003), Immunol. Lett. 85: 85-95; Alexopoulou et al. (2001), Nature 413: 732-738; Hayashi et al. (2001), Nature 410: 1099-1103. TLR-7 is activated by guanosine analog compounds, by small antiviral compounds such as imidazoquinoleins, imiquimod and R-848, and by single-chain viral RNA, and TLR-8 is also activated by R-848 and viral RNA from single chain See, for example, Lee et al. (2003), Proc. Natl Acad. Sci. USA 100: 6646-6651; Hemmi et al. (2002), Nat. Immunol. 3: 196-200; Jurk et al. (2002), Nat. Immunol. 3: 499; Heil et al. (2004), Science 303: 15261529; and Diebold et al. (2004), Science 303: 1529-1531. TLR-9 has been shown to recognize immunostimulatory nucleic acid molecules such as bacterial DNA and immunostimulatory DNA containing a 5'CG-3 'sequence. See, for example, Hemmi et al. (2000) Nature, 408: 740-745; Bauer et al. (2001), Proc. Natl Acad. Sci. USA 98: 9237-9242; and Takeshita et al. (2001), J. Immunol. 167: 3555-3558. In addition, certain TLRs (for example, TLR-1, TLR-2 and TLR-6) can heterodimerize, interact with their microbial ligands and lead to cell activation, thus expanding the repertoire of ligands of the TLRs family [Ozinsky et al. (2000), J. Endotoxin Res.

6: 393-396; Ozinsky et al. (2000), Proc. Natl Acad. Sci. USA 97: 13,766-13,771].

Immunostimulatory nucleic acid (ISNA) molecules, such as bacterial DNA and a polynucleotide containing 5'-CG-3 'unmethylated sequences, can stimulate innate immune responses, such as the production of cytokines and the activation of dendritic cells and macrophages, and then lead to a Th1 type immune response. Immunostimulatory nucleic acid molecules stimulate the immune response through interaction with, and signaling through, the mammalian TLR9 receptor [Hemmi et al. (2000), supra]. Mammalian DNA generally does not possess immunostimulatory activity apparently due to a low frequency of CG sequences and because most CG sequences have a methylated cytosine. Thus, it seems that mammalian immune system cells distinguish bacterial DNA from the DNA itself through the TLR9 receptor.

Immunostimulatory nucleic acid molecules have been implicated in the pathogenesis of arthritis. Immunostimulatory nucleic acid has been shown to play a role in the activation of self-reactive B cells such as those that produce a class of autoantibodies known as rheumatoid factor (RF; rheumatoid factor). Therefore, it seems that such immunostimulatory nucleic acids play a role in systemic autoimmunity. In addition, the immunostimulatory nucleic acid can enhance the toxicity of LPS and contribute to the negative effects of vector administration for gene therapy. See, for example, Deng et al. (1999), Nature Med. 5: 702-705; Leadbetter et al. (2002), Nature 416: 603-607; Cowdery et al. (1996), J. Immunol.

156: 4570-4575; and U.S. Pat. No. 6,225,292.

There is a need to identify strategies to control an unwanted immune activation, including an unwanted activation of the innate immune response.

Description of the invention

The invention relates to an oligonucleotide for use in inhibiting a TLR7 / 8 dependent immune response in an individual, in which the oligonucleotide has less than about 200 bases or base pairs and the oligonucleotide comprises an immunoregulatory sequence, in which the immunoregulatory sequence comprises at least one TGC trinucleotide sequence at the 5 'end of the oligonucleotide.

In one aspect, the immune response is associated with an autoimmune disease. In another aspect, inhibition of the immune response improves one or more symptoms of an autoimmune disease. The administration of an oligonucleotide according to the invention improves one or more symptoms of autoimmune disease, including systemic lupus erythematosus (SLE) and systemic lupus erythematosus) and rheumatoid arthritis. In certain embodiments, the oligonucleotide is for use in suppressing an SLE symptom.

In another aspect, the inhibition of the immune response prevents or delays the development of autoimmune disease. The administration of an oligonucleotide according to the invention prevents or delays the development of autoimmune disease.

In another aspect, the immune response is associated with an inflammatory disease. The administration of an oligonucleotide according to the invention improves one or more symptoms of the inflammatory disease or disorder. In certain embodiments, the oligonucleotide is for use in the improvement of a symptom of a chronic inflammatory disease or disorder.

In another aspect, the immune response is associated with chronic pathogen stimulation. The administration of an oligonucleotide according to the invention suppresses chronic stimulation by pathogens in the individual, including that associated with malaria and with chronic viral infections.

In certain embodiments, oligonucleotides for use according to the invention inhibit a response from a B cell or a plasmocytoid dendritic cell. In certain embodiments, the immune responses inhibited by oligonucleotides for use according to the invention include inhibition of cytokine production, such as IL-6, IL-12, IFN-a and / or TNF-a, by the cell. , inhibition of cell maturation and / or inhibition of cell proliferation. Compositions that inhibit a TLR9 dependent cellular response, a TLR7 / 8 dependent cellular response and / or a TLR7 / 8/9 dependent cellular response are described herein.

Kits are also described herein, preferably to carry out the invention. The kits generally comprise an oligonucleotide for use according to the invention (generally in a suitable container) and may further include instructions for the use of the oligonucleotide in the immunoregulation of an individual.

Oligonucleotides are provided herein for use in accordance with the invention comprising the sequence 5'-TGCTTGCAAGCTTGCAAGCA-3 '(SEQ ID NO: __C661) or a fragment of this sequence that includes at least a palindromic portion thereof of 10 bases. Oligonucleotides are provided herein for use according to the invention consisting of the 5'-TGCNm-3 'nucleotide sequence, wherein each N is a nucleotide, m is an integer from 5 to about 50 and the sequence N1-Nm it comprises at least one GC dinucleotide (ie, in which the Nm sequence comprises at least one GC dinucleotide). In some examples, the oligonucleotide consists of the 5'-TGCNmA-3 'nucleotide sequence. In other examples, the oligonucleotide consists of the 5'-TGCNmCA-3 'nucleotide sequence. In other examples, the oligonucleotide consists of the 5'-TGCNmGCA-3 'nucleotide sequence. Oligonucleotides comprising the TGCNmTCCTGGAGGGGTTGT-3 'nucleotide sequence (ID SEQ. # __) are provided herein, in which each n is a nucleotide and m is an integer from 0 to about 100. In some examples of the oligonucleotide, the sequence N1- Nm comprises a fragment of the sequence 5'-TTGACAGCTTGACAGCA-3 '(SEQ ID NO. __).

Methods for regulating an immune response in an individual are also described herein, comprising administering to the individual the oligonucleotide consisting of the nucleotide sequence 5'-TGCNm-3 ', in which each N is a nucleotide, m is an integer of 5 at about 50 and the N1-Nm sequence comprises at least one GC dinucleotide, in an amount sufficient to regulate an immune response in said individual.

Methods for regulating an immune response in an individual are also described herein, comprising administering to the individual the oligonucleotide comprising the nucleotide sequence TGCNmTCCTGGAGGGGTTGT-3 '(SEQ ID No. __), in which each n is a nucleotide and m is a number integer from 0 to about 100, in an amount sufficient to regulate an immune response in said individual.

Methods for inhibiting an innate immune response dependent on TLR7 / 8 in an individual are also described herein, comprising administering to the individual the oligonucleotide consisting of the 5'-TGCNm-3 'nucleotide sequence, in which each N is a nucleotide, m it is an integer from 5 to about 50 and the N1-Nm sequence comprises at least one GC dinucleotide, in an amount sufficient to suppress TLR7 / 8-dependent cytokine production in said individual.

Also described herein are methods for inhibiting an innate immune response dependent on TLR9 and an immune response dependent on TLR7 / 8 in an individual, comprising administering to the individual the oligonucleotide consisting of the nucleotide sequence 5'-TGCNm-3 ', in which each N is a nucleotide, m is an integer from 5 to about 50 and the N1-Nm sequence comprises at least one GC dinucleotide, in an amount sufficient to suppress TLR9-dependent cytokine production and TLR7-dependent cytokine production / 8 in said individual.

Methods for improving one or more symptoms of an autoimmune disease are also described herein, a method comprising administering an effective amount of the oligonucleotide comprising a nucleotide sequence of the formula X1GGGGX2X3 (SEQ ID NO. __), in which X1, X2 and X3 are nucleotides, with the proviso that if X1 = C or A, X2X3 is not AA, to an individual who has an autoimmune disease. In some examples, autoimmune disease is selected from the group consisting of systemic lupus erythematosus (SLE) and rheumatoid arthritis. Methods for improving one or more symptoms of an autoimmune disease are provided herein, a method comprising administering an effective amount of the oligonucleotide consisting of the nucleotide sequence 5'-TGCNm-3 ', in which each N is a nucleotide, m is a number integer from 5 to about 50 and the N1-Nm sequence comprises at least one GC dinucleotide, to an individual having an autoimmune disease. Methods for improving one or more symptoms of an autoimmune disease are also described herein, a method comprising administering an effective amount of the oligonucleotide comprising the TGCNmTCCTGGAGGGGTTGT-3 'nucleotide sequence (SEQ ID NO. __), in which each N is a nucleotide and m is an integer from 0 to about 100, to an individual who has an autoimmune disease. In some examples, autoimmune disease is selected from the group consisting of systemic lupus erythematosus (SLE) and rheumatoid arthritis.

Methods to prevent or delay the development of an autoimmune disease are also described herein, a method comprising administering an effective amount of the oligonucleotide consisting of the nucleotide sequence 5'-TGCNm3 ', in which each N is a nucleotide, m is an integer 5 to about 50 and the N1-Nm sequence comprises at least one GC dinucleotide, to an individual at risk of developing an autoimmune disease.

Methods for preventing or delaying the development of an autoimmune disease are also described herein, a method comprising administering an effective amount of the oligonucleotide comprising the nucleotide sequence TGCNmTCCTGGAGGGGTTGT-3 '(SEQ ID No. __), in which each N is a nucleotide and m is an integer from 0 to about 100, to an individual who is at risk of developing an autoimmune disease.

Methods for improving one or more symptoms of an inflammatory disease or disorder are also described herein, a method comprising administering an effective amount of the oligonucleotide comprising a nucleotide sequence of formula X1GGGGXXXX3 (SEQ ID NO. __), in which X1, X2 and X3 are nucleotides, with the proviso that if X1 = C or A, X2X3 is not AA, to an individual who has an inflammatory disease or disorder. Methods for improving one or more symptoms of an inflammatory disease or disorder are provided herein, a method comprising administering an effective amount of the oligonucleotide consisting of the nucleotide sequence 5'-TGCNm-3 ', in which each N is a nucleotide, m is an integer from 5 to about 50 and the N1-Nm sequence comprises at least one GC dinucleotide, to an individual having an inflammatory disease or disorder. Methods for improving one or more symptoms of an inflammatory disease or disorder are also described herein, a method comprising administering an effective amount of the oligonucleotide comprising the nucleotide sequence TGCNmTCCTGGAGGGGTTGT-3 '(SEQ ID NO. __), in which each N is A nucleotide and m is an integer from 0 to about 100, to an individual who has an inflammatory disease or disorder.

In addition, kits are described herein comprising:

oligonucleotides consisting of the 5'-TGCNm-3 'nucleotide sequence, in which each N is a nucleotide, m is an integer from 5 to about 50 and the N1-Nm sequence comprises at least one GC dinucleotide; or

oligonucleotides comprising the nucleotide sequence TGCNmTCCTGGAGGGGTTGT-3 '(SEQ ID NO. __), in which each N is a nucleotide and m is an integer from 0 to about 100,

wherein the oligonucleotide is in a suitable container and in which said kit comprises instructions for the use of the oligonucleotide in the immunoregulation of an individual.

Brief description of the drawings

Figures 1A-1B are graphs showing the inhibition by IRP of the production of IL-6 and IL-12 from cells stimulated with immunostimulatory nucleic acid (ISNA). The results of murine splenocytes stimulated with ISNA ID are shown in Figure 1A. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (530), IRP ID. SEC. No. __ (C869) or witness ID. SEC. No. __ (C532). The results of murine CD11c + cells stimulated with ISNA ID are shown in Figure 1B. SEC. No. __ (C274) alone and together with IRP ID. SEC. No. __ (530), IRP ID. SEC. No. __ (C869)

or witness ID. SEC. No. __ (C532).

Figure 2 is a graph showing the production of IL-6 from human B cells stimulated with ISNA ID. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (530), IRP ID. SEC. No. __ (C869) or control oligonucleotide ID. SEC. No. __ (C532).

Figure 3 is a graph showing the serum IL-6 levels of mice that have been injected with ISNA ID. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (C869) or control oligonucleotide, and IRP ID. SEC. No. __ (C869) alone. The ratio of IRP: ISNA or IRP: co-administered control oligonucleotide ranged from 3: 1 to 1: 3.

Figure 4 is a graph showing the serum IL-12 levels of mice in which ISNA ID has been injected. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (C869) or control oligonucleotide, and IRP ID. SEC. No. __ (C869) alone. The ratio of IRP: ISNA or IRP: co-administered control oligonucleotide ranged from 3: 1 to 1: 3.

Figure 5 is a graph showing the serum TNF-a levels of mice in which ISNA ID has been injected. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (C869) or control oligonucleotide, and IRP ID. SEC. No. __ (C869) alone. The ratio of IRP: ISNA or IRP: co-administered control oligonucleotide ranged from 3: 1 to 1: 3.

Figure 6 is a graph showing serum IL-6 levels of mice that have been injected subcutaneously with ISNA ID. SEC. No. __ (1018) at a site and control oligonucleotide or IRP ID. SEC. No. __ (C869) administered at the same site or at different sites.

Figure 7 is a graph showing serum IL-12 levels of mice that have been injected subcutaneously with ISNA ID. SEC. No. __ (1018) at a site and control oligonucleotide or IRP ID. SEC. No. __ (C869) administered at the same site or at different sites.

Figures 8A-8B show graphs showing the production of IFN-a (Figure 8A) and IL-12 (Figure 8B) by murine CD11c + splenocytes in response to varying amounts of HSV-1 infection.

Figures 9A-9C show graphs showing IRP inhibition of cytokine production from HSV-1 stimulated cells. Figure 9A depicts the production of IFN-a by murine CD11c + splenocytes in response to HSV-1 in the presence of varying concentrations of IRP ID. SEC. No. __ (C869) or control oligonucleotide. Figure 9B depicts the production of IL-12 by murine CD11c + splenocytes in response to HSV-1 in the presence of varying concentrations of IRP ID. SEC. No. __ (C869) or control oligonucleotide. Figure 9C depicts the production of IFN-a by human PDCs in response to HSV-1 in the presence of varying concentrations of IRP ID. SEC. No. __ (C869) or control oligonucleotide.

Figures 10A-10B show graphs showing IRP inhibition of cytokine production from influenzavirus-stimulated cells (PR / 8). Figure 10A depicts the production of IFN-a by human PDCs in response to varying amounts of influenzavirus. Figure 10B depicts the production of IFN-a by human PDCs in response to influenzavirus in the presence of varying concentrations of IRP ID. SEC. No. __ (C869) or control oligonucleotide.

Figures 11A-11B show graphs showing IRP inhibition of IFN-a production from virally stimulated human PDC cells. The production of IFN-a by cells in response to HSV-1 (Figure 11A, left graph) and influenzavirus (Figure 11B, right graph) in the presence of virus alone, IRP ID is shown. SEC. No. __ (C869), IRP ID. SEC. No. __ (C661) or control oligonucleotide.

Figures 12A-12B show graphs showing the effect of IRP on IL-6 production from splenocytes stimulated with ISNA (Figure 12A) or LPS (Figure 12B), a TLR4 stimulating agent. Stimulated cells were incubated with ISNA or LPS alone and together with IRP ID. SEC. No. __ (530), IRP ID. SEC. No. __ (C869) or control oligonucleotide.

Figures 13A-13D show graphs showing the effect of IRP on the production of IL-6 (Figures 13A-13B) and IL-12 (Figures 13C-13D) from splenocytes stimulated with loxoribin, a TLR7 stimulating agent. Stimulated cells were incubated with loxoribin alone and together with varying amounts of IRP ID. SEC. No. __ (C869) (Figures 13A-13C) or control oligonucleotide (Figures 13B-13D).

Figures 14A-14D show graphs showing the effect of IRP on the production of IL-6 (Figures 14A-14B) and IL-12 (Figures 14C-14D) from splenocytes stimulated with resiquimod (R848), a stimulating agent of TLR7 / 8. Stimulated cells were incubated with R848 alone and together with varying amounts of IRP ID. SEC. No. __ (C869) (Figures 14A-14C) or control oligonucleotide (Figures 14B-14D).

Figures 15A-15D show graphs showing the effect of IRPs on IL-6 production from splenocytes stimulated with TLR stimulating agents: ISNA ID. SEC. No. __ (1018) (Figure 15A), LPS (Figure 15B), loxoribine (Figure 15C) and R848 (Figure 15D). The stimulated cells were incubated with the indicated TLR stimulating agent alone and together with IRP ID. SEC. No. __ (C869), IRP ID. SEC. No. __ (C661) or control oligonucleotide.

Figures 16A-16B show graphs showing IRP inhibition of IL-6 production from cells stimulated with ISNA ID. SEC. No. __ (1018) or stimulated with R848. The results of murine splenocytes stimulated with ISNA ID are shown in Figure 16A. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (869), IRP ID. SEC. No. __ (661) or IRP ID. SEC. No. __ (954). The results of murine splenocytes stimulated with R848 alone and together with IRP ID are depicted in Figure 16B. SEC. No. __ (869), IRP ID. SEC. No. __ (661) or IRP ID. SEC. No. __ (954).

Figures 17A-17B are graphs showing the levels of IL-12 (Figure 17A) and TNF-a (Figure 17B) in mice serum one hour after being injected with R848 alone and together with IRP ID. SEC. No. __ (954) or control oligonucleotide.

Figure 18 is a graph showing the percentage of live mice after a treatment with D-galactosamine and ISNA ID. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (954) or IRP ID. SEC. No. __ (869) or control oligonucleotide.

Figures 19A-19B show graphs showing IRP inhibition of IL-6 production from cells stimulated with ISNA ID. SEC. No. __ (1018) or stimulated with R848. The results of murine splenocytes stimulated with ISNA ID are shown in Figure 19A. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (954), IRP ID. SEC. No. __ (DV019: N-1), IRP ID. SEC. No. __ (DV020: N-2), IRP ID. SEC. No. __ (DV021: N-3), IRP ID. SEC. No. __ (DV022: N-4), IRP ID. SEC. No. __ (DV023: N-5) or IRP ID. SEC. No. __ (DV024: N-6). The results of murine splenocytes stimulated with R848 alone and together with IRP ID are depicted in Figure 19B. SEC. No. __ (954), IRP ID. SEC. No. __ (DV019), IRP ID. SEC. No. __ (DV020), IRP ID. SEC. No. __ (DV021), IRP ID. SEC. No. __ (DV022), IRP ID. SEC. No. __ (DV023) or IRP ID. SEC. No. __ (DV024).

Figure 20 is a graph showing the levels of anti-dsDNA autoantibodies in the serum of mice (NZBxNZW) F1 in the absence of treatment or after injection, twice a week, of 15 μg or 45 μg of IRP ID. SEC. No. __ (954).

Figure 21 is a graph showing the percentage of mice (NZBxNZW) F1 alive after injection, three times a week at 8-9 months of age, of 100 μg of IRP ID. SEC. No. __ (954) or control oligonucleotide.

Figures 22A-22B are graphs showing the production of IL-6 from human B cells stimulated with ISNA ID. SEC. No. __ (1018) (Figure 22A) or R848 (Figure 22B) alone and together with IRP ID. SEC. No. __ (869), IRP ID. SEC. No. __ (661), IRP ID. SEC. No. __ (954) or control oligonucleotide.

Figure 23 is a graph showing the production of IFN-a from human PDC cells stimulated with HSV-1 virus inactivated with UV radiation, alone and together with IRP ID. SEC. No. __ (954) or control oligonucleotide.

Figure 24 is a graph showing the production of IFN-a from human PDC cells stimulated with thermally inactivated influenzavirus, alone and together with IRP ID. SEC. No. __ (954) or control oligonucleotide.

Figure 25 is a graph showing the production of IFN-a from serum-stimulated human PDC cells containing immune complexes (IC) of anti-dsDNA, alone and together with IRP ID. SEC. No. __ (954) or control oligonucleotide.

Figure 26 is a graph showing the production of IFN-a from human PDC cells stimulated with anti-RNP immune complexes, alone and together with IRP ID. SEC. No. __ (954) or control oligonucleotide.

Figure 27 is a graph showing the production of IL-6 from murine splenocytes stimulated with ISNA ID. SEC. No. __ (1018) alone and together with IRP ID. SEC. No. __ (869), IRP ID. SEC. No. __ (661), IRP ID. SEC. No. __ (954), IRP ID. SEC. No. __ (983), IRP ID. SEC. No. __ (984), IRP ID. SEC. No. __ (985), IRP ID. SEC. No. __ (986), IRP ID. SEC. No. __ (987), IRP ID. SEC. No. __ (988), IRP ID. SEC. No. __ (989), IRP ID. SEC. No. __ (990), IRP ID. SEC. No. __ (991) or control oligonucleotide.

Figure 28 is a graph showing the production of IL-6 from murine splenocytes stimulated with R848 alone and together with IRP ID. SEC. No. __ (869), IRP ID. SEC. No. __ (661), IRP ID. SEC. No. __ (954), IRP ID. SEC. No. __ (983), IRP ID. SEC. No. __ (984), IRP ID. SEC. No. __ (985), IRP ID. SEC. No. __ (986), IRP ID. SEC. No. __ (987), IRP ID. SEC. No. __ (988), IRP ID. SEC. No. __ (989), IRP ID. SEC. No. __ (990), IRP ID. SEC. No. __ (991) or control oligonucleotide.

Ways of carrying out the invention

We have discovered immunoregulatory polynucleotides and methods to regulate immune responses in individuals, particularly in humans, using these immunoregulatory polynucleotides. The oligonucleotides for use according to the invention were described above. Oligonucleotides for use according to the invention particularly inhibit innate immune responses in which signaling through TLR7 / 8 is involved.

We have found that oligonucleotides for use according to the invention effectively regulate immune cells, including human cells, in various ways. We have observed that oligonucleotides for use according to the invention can effectively suppress the production of cytokines, including IFN-a, IL-6, IL-12 and TNF-a, from human cells. Oligonucleotides for use according to the invention suppress cellular responses, including the production of cytokines, stimulated through TLR7 / 8 receptors. We have also observed that oligonucleotides for use according to the invention can effectively suppress the proliferation and / or maturation of cells stimulated with an immunostimulatory nucleic acid, including B cells and plasmacytoid dendritic cells. Thus, oligonucleotides for use according to the invention have utility in the suppression of immune responses to ISNA, such as the microbial DNA present due to an infection, or the suppression of nucleic acid vectors administered for gene therapy purposes.

Methods for treating and preventing autoimmune disorders and chronic inflammatory disorders in an individual by administering an immunoregulatory polynucleotide of the invention to the individual are also described herein.

Also described herein are kits comprising oligonucleotides for use according to the invention. The kits may further comprise instructions for administering an oligonucleotide for immunoregulation to a subject.

General techniques

In the practice of the present invention, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art, will be employed. These techniques are explained in detail in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989); Oligonucleotide Synthesis (written by M. J. Gait, 1984); Animal Cell Culture (written by R. I. Freshney, 1987); Handbook of Experimental Immunology (written by D. M. Weir and C. C. Blackwell); Gene Transfer Vectors for Mammalian Cells (written by

J. M. Miller and M. P. Calos, 1987); Current Protocols in Molecular Biology (written by F. M. Ausubel et al., 1987); PCR: The Polymerase Chain Reaction, (written by Mullis et al., 1994); Current Protocols in Immunology (written by J. E. Coligan et al., 1991); The lmmunoassay Handbook (written by D. Wild, Stockton Press NY, 1994); Bioconjugate Techniques (written by Greg T. Hermanson, Academic Press, 1996); and Methods of Immunological Analysis (written by R. Masseyeff, W. H. Albert and N. A. Staines, Weinheim: VCH Verlags gesellschaft mbH, 1993).

Definitions

As used herein, the singular form "a", "a", "the" and "the" includes plural references unless otherwise indicated. For example, "an" IRP includes one or more IRPs.

As used interchangeably herein, the terms "nucleic acid", "polynucleotide" and "oligonucleotide" include single stranded DNA (ssDNA; single stranded DNA), double stranded DNA (dsDNA; doublestranded DNA) , Single stranded RNA (ssRNA) and double stranded RNA (dsRNA), modified oligonucleotides and oligonucleosides and combinations thereof. The oligonucleotide can be linear or circularly configured,

or the oligonucleotide may contain both linear and circular segments. Oligonucleotides are nucleoside polymers generally linked through phosphodiester bonds, although alternate bonds, such as phosphorothioate esters, can also be used in oligonucleotides. A nucleoside consists of a purine base [adenine (A) or guanine (G), or a derivative thereof] or pyrimidine [thymine (T), cytosine (C) or uracil (U), or a derivative thereof ] linked to a sugar. In DNA, the four nucleoside units (or bases) are called deoxyadenosine, deoxyguanosine, deoxythymidine and deoxycytidine. A nucleotide is a phosphate ester of a nucleoside.

The term "immunostimulatory nucleic acid" or "immunostimulatory polynucleotide", as used herein, refers to a nucleic acid molecule (e.g., a polynucleotide) that performs, and / or contributes to, a measurable immune response as measures in vitro, in vivo and / or ex vivo. Examples of measurable immune responses include, but are not limited to, the production of antigenically specific antibodies, cytokine secretion, activation or expansion of lymphocyte populations such as NK cells, CD4 + T cells, CD8 + T cells, B cells, and the like It is known that immunostimulatory nucleic acid (ISNA) sequences stimulate innate immune responses; in particular, the responses that occur through TLR-9 signaling in the cell. As is known in the art, immunostimulatory nucleic acid (ISNA) molecules can be isolated from microbial sources, such as bacteria, can be present in nucleic acid vectors for use in gene therapy, or can be synthesized using techniques and equipment here. described and known in this technical field. In general, an immunostimulatory nucleic acid sequence includes at least one GC dinucleotide, the C of this dinucleotide being unmethylated. Consequently, a microbial infection and administered DNA can lead to stimulation of innate immune responses in some cases.

The term "immunostimulant" or "stimulate an immune response", as used herein, includes the stimulation of cell types that participate in immune reactions and the potentiation of an immune response towards a specific antigenic substance. An immune response that is stimulated by an immunostimulatory nucleic acid is generally an "Th1 type" immune response, as opposed to an "Th2 type" immune response. Th1 type immune responses are typically characterized by "delayed type hypersensitivity" reactions to an antigen and an activated macrophage function, and can be detected at the biochemical level by increased levels of cytokines associated with Th1, such as IFN-y, IL -2, IL-12 and TNF-�. Th2 type immune responses are generally associated with elevated levels of antibody production, especially IgE antibody production and activation and enhanced eosinophil numbers, as well as with the expression of cytokines associated with Th2, such as IL-4, IL-5. and IL-13.

The term "innate immune response" or "innate immunity", as used herein, includes a variety of innate resistance mechanisms by which a cell or individual recognizes, and responds to the presence of, a pathogen. As used herein, an "innate immune response" includes the intracellular and intercellular processes and reactions that occur when the cell recognizes molecular patterns or signals associated with a pathogen. Cellular receptors active in an innate immune response include a family of Toll-like receptors (TLRs) and microbial ligands have been identified for various TLRs, as described herein.

The term "immunoregulatory sequence" or "IRS", as used herein, refers to a nucleic acid sequence that inhibits and / or suppresses a measurable innate immune response as measured in vitro, in vivo. and / or ex vivo. The term "immunoregulatory polynucleotide" or "IRP", as used herein, refers to a polynucleotide comprising at least one IRS that inhibits and / or suppresses a measurable innate immune response as measured in vitro. , in vivo and / or ex vivo. Inhibition of a TLR, for example, TLR-7, 8 or 9, includes, without limitation, inhibition at the receptor site, for example, by blocking ligand-receptor binding, and inhibition of the signaling pathway downstream after ligand receptor binding. Examples of measurable innate immune responses include, but are not limited to, cytokine secretion, activation or expansion of lymphocyte populations such as NK cells, CD4 + T cells, CD8 + T cells and B cells, maturation of such cell populations. as plasmocytoid dendritic cells, and the like.

The term "immunoregulatory compound" or "IRC", as used herein, refers to a molecule that has immunoregulatory activity and that comprises a nucleic acid component comprising an IRS. The IRC may consist of a nucleic acid component that comprises more than one IRS, consists of an IRS or has no immunostimulatory activity itself. The IRC may consist of a polynucleotide (a "polynucleotide IRC") or may comprise additional components. Accordingly, the term IRC includes compounds that incorporate one or more nucleic acid components, at least one of which comprises an IRC, covalently linked to a non-nucleotide spacer component.

The term "palindromic sequence" or "palindrome" refers to a nucleic acid sequence that is an inverted repeat, for example, ABCDD'C'B'A ', in which the bases, for example, A and A', B and B ', C and C', D and D ', are capable of forming the base pairs of Watson-Crick. Said sequences may be single chain or may form double chain structures or may form hairpin loop structures under certain conditions. For example, as used herein, an "8 base palindrome" refers to a nucleic acid sequence whose palindromic sequence is 8 bases long, such as ABCDD'C'B'A '. A palindromic sequence can be part of a polynucleotide that also contains non-palindromic sequences. A polynucleotide may contain a

or more portions of palindromic sequence and one or more portions of non-palindromic sequence. Alternatively, a polynucleotide sequence can be totally palindromic. In a polynucleotide with more than one portion of palindromic sequence, the portions of palindromic sequence may overlap each other or the portions of palindromic sequence may not overlap each other.

In general, the term 3 'refers to a region or position of a polynucleotide or oligonucleotide in 3' (low chain) with respect to another region or position of the same polynucleotide or oligonucleotide. The term 3 'end refers to the 3' limit of the polynucleotide.

In general, the term 5 'refers to a region or position of a polynucleotide or oligonucleotide in 5' (upstream) with respect to another region or position of the same polynucleotide or oligonucleotide. The term 5 'end refers to the 5' limit of the polynucleotide.

The term "conjugation product" refers to a complex in which an IRP and / or an IRC are linked. Such conjugation product links include covalent and / or non-covalent bonds.

"Adjuvant agent" refers to a substance that, when added to an immunogenic agent such as an antigen, increases or potently enhances an immune response to the agent in the recipient host upon exposure to the mixture.

The term "peptide" corresponds to polypeptides having a length and composition sufficient to effect a biological response, such as, for example, an antibody production or a cytokine activity, whether the peptide is a hapten or not. Typically, the peptides have a length of at least six amino acid residues. The term "peptide" also includes modified amino acids (whether present in nature or not), modifications that include, but are not limited to, phosphorylation, glycosylation, pegylation, lipidization and methylation.

A "distribution molecule" or "distribution vehicle" is a chemical component that facilitates, allows and / or enhances the distribution of an IRP and / or IRC at a particular site and / or with respect to a particular temporary regulation.

An "individual" is a vertebrate, such as a bird, and is preferably a mammal, more preferably a human being. Mammals include, but are not limited to, humans, primates, farm animals, sports animals, rodents and pets.

An "effective amount" or a "sufficient amount" of a substance is that amount sufficient to produce beneficial or desired results, including clinical results, and, as such, an "effective amount" depends on the context in which it is applied. In the context of the administration of a composition that suppresses an immune response dependent on TLR-9, an effective amount of an IRP is an amount sufficient to inhibit or decrease a cellular response to stimulation through TLR-9. In the context of the administration of a composition that suppresses an immune response dependent on TLR-7/8, an effective amount of an IRP is an amount sufficient to inhibit or decrease a cellular response to stimulation through TLR-7/8. . The effective amount can be administered in one or more administrations.

The term "co-administration", as used herein, refers to the administration of at least two different substances at moments close enough to regulate an immune response. Preferably, co-administration refers to the simultaneous administration of at least two different substances.

"Suppression" or "inhibition" of a response or parameter includes decreasing that response or parameter compared to otherwise equal conditions except for a state or parameter of interest, or alternatively, compared to another state. For example, a composition comprising an IRP that suppresses the production of cytokines induced by an immunostimulatory nucleic acid reduces the production of cytokines compared to, for example, the production of cytokines induced by the immunostimulatory nucleic acid alone. As another example, a composition comprising an IRP that suppresses the production of cytokines associated with an innate immune response reduces the degree and / or levels of cytokine production compared to, for example, the degree and / or levels of cytokines produced by the innate immune response alone. The "suppression" of B cells includes, for example, a reduced proliferation of B cells, a reduced activation of B cells and / or a reduced production of cytokines, such as IL-6 and / or TNF-a, from cell B stimulated Inhibition of a TLR response, for example, a response of TLR-7, 8 or 9, includes, but is not limited to, inhibition at the receptor site, for example, by preventing or blocking effective ligand binding. receptor, and inhibition of the downstream signaling pathway, for example, after an effective ligand-receptor binding.

The "stimulation" of a response or parameter includes the provocation and / or enhancement of that response or parameter. For example, "stimulation" of an immune response, such as an innate immune response or a Th1 response, means an increase in response, which may arise from the provocation and / or potentiation of a response. Similarly, "stimulation" of a cytokine or a cell type (such as CTLs) means an increase in the amount

or cytokine level or cell type. The "stimulation" of B cells includes, for example, an enhanced proliferation of B cells, an induced activation of B cells and / or an increased production of cytokines, such as IL-6 and / or TNFa, from the stimulated B cell.

As used herein and well understood in the art, a "treatment" is an approach to obtain beneficial or desired results, including clinical results. For the purposes of this invention, beneficial or desired clinical results include, but are not limited to, relief or improvement of one or more symptoms, decrease in the degree of disease, stabilized state (i.e., no worsening) of the disease, avoidance. of the spread of the disease, delay or slowing of morbid progress, improvement or palliation of the morbid state, and remission (partial or total), detectable or undetectable. "Treatment" may also mean prolongation of survival compared to expected survival if no treatment is received.

"Palliation" of a disease or disorder means that the degree and / or undesirable clinical manifestations of a morbid disorder or condition decrease and / or the temporary course of progress is slowed down or prolonged, compared to the lack of treatment of the disorder. Especially in the context of autoimmune diseases, as is well understood by those skilled in the art, palliation can take place after the regulation or reduction of the unwanted immune response. In addition, palliation is not necessarily caused by the administration of a dose but often occurs after the administration of a series of doses. In this way, a sufficient amount can be administered to alleviate a response or disorder in one or more administrations.

As used herein, the expression "comprising" and its related expressions are used in their inclusive sense; that is, equivalent to the expression "that includes" and its corresponding related expressions.

Compositions of the invention

The invention provides an oligonucleotide for use in inhibiting a TLR7 / 8 dependent immune response in an individual, in which the oligonucleotide has less than about 200 bases or base pairs and the oligonucleotide comprises an immunoregulatory sequence, in which the immunoregulatory sequence It comprises at least one TGC trinucleotide sequence at the 5 'end of the oligonucleotide. Immunoregulatory sequences (IRSs), immunoregulatory polynucleotides (IRPs) and immunoregulatory compounds (IRCs) to regulate innate immune responses in individuals are also described herein. Each IRP and IRC comprises at least one IRS.

Compositions comprising an oligonucleotide only for use according to the invention (or a combination of two or more oligonucleotides for use according to the invention) are also described herein. The compositions may comprise an oligonucleotide for use according to the invention and a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients, including buffers, are described herein and are well known in the art [Remington: The Science and Practice of Pharmacy, 20th edition, Mack Publishing (2000)].

Immunoregulatory polynucleotides and immunoregulatory compounds

An oligonucleotide for use according to the invention contains at least one immunoregulatory sequence. An oligonucleotide for use according to the invention comprises a 5'-G, C-3 'sequence. An oligonucleotide for use according to the invention includes at least one TGC trinucleotide sequence at the 5 'end of the polynucleotide (i.e., 5'-TGC). In some cases, an IRS comprises a 5'-GGGG-3 'sequence. In some cases, an IRS does not comprise a 5'-GGGG-3 'sequence. Consequently, in some cases, an IRP or IRC does not comprise a 5'-GGGG-3 'sequence. In some cases, an IRP or IRC comprising a 5'-GGGG-3 'sequence is particularly effective when used in the single chain form. In some cases, an IRP or IRC comprising a 5'-GGGG-3 'sequence is particularly effective when made of a phosphothioate backbone.

As demonstrated here, particular IRPs and IRCs inhibit TLR-7 and / or TLR-8 dependent cellular responses. In addition, particular IRPs and IRCs inhibit TLR-9 dependent cellular responses, and particular IRPs and IRCs inhibit TLR-7/8 dependent cellular responses and TLR-9 dependent cellular responses. As used herein, "TLR-7/8" refers to "TLR-7 and / or TLR-8". Consequently, as used herein, "TLR-7/8/9" refers to "(TLR-7 and / or TLR-8) and TLR-9". As also shown here, certain IRPs do not inhibit TLR4-dependent cellular responses.

Immunostimulatory nucleic acids and other agents stimulating an innate immune response have been described in the art, and their activity can be easily measured using standard assays indicating various aspects of an innate immune response, such as cytokine secretion, antibody production. , NK cell activation, B cell proliferation, T cell proliferation and dendritic cell maturation. See, for example, Krieg et al., (1995), Nature 374: 546-549; Yamamoto et al. (1992), J. Immunol. 148: 40724076; Klinman et al. (1997), J. Immunol. 158: 3635-3639; Pisetsky (1996), J. Immunol. 156: 421-423; Roman et al. (1997), Nature Med. 3: 849-854; Hemmi et al. (2000), supra; Lee et al. (2003), supra; WO 98/16247, WO 98/55495 and WO 00/61151; and US Pat. No. 6,225,292. Consequently, these and other methods can be used to identify, test and / or confirm sequences, polynucleotides and / or immunoregulatory compounds. For example, the effect of IRP or IRC can be determined when cells or individuals in which an innate immune response has been stimulated are contacted with the IRP or IRC.

As it is clearly expressed here, it is understood that, with respect to the formulas described herein, any parameter and all parameters are independently selected. For example, if x = 0-2, and can be independently selected regardless of the values of x (or any other selectable parameter of a formula). Preferably, the IRP or IRC comprising the IRS is an oligonucleotide with at least one phosphothioate backbone link.

As demonstrated here, a class of IRS discovered is particularly effective in inhibiting TLR9-dependent cell stimulation. Consequently, the IRS with this activity is referred to as "class TLR9" IRS.

In some cases, an IRS may comprise a sequence of formula X1GGGGX2X3 (SEQ ID NO. 1) in which X1, X2 and X3 are nucleotides, provided that if X1 = C or A, X2X3 is not AA. In some cases, an IRS may comprise a sequence of formula ID. SEC. No. 1 in which X1 is C or A. In some cases, an IRS may comprise a sequence of formula X1GGGGX2X3 (SEQ ID NO. 2) in which X1, X2 and X3 are nucleotides, provided that if X1 = C or A, X2X3 is not AA, and in which X1 is C or A.

In some cases, an IRS may comprise a sequence of formula GGNnX1GGGGX2X3 (SEQ ID NO. 3) in which n is an integer from 1 to about 100 (preferably, from about 1 to 20), each N is a nucleotide, and X1 , X2 and X3 are nucleotides, provided that if X1 = C or A, X2X3 is not AA. In some cases, an IRS may comprise a sequence of formula ID. SEC. No. 3 in which X1 is C or A.

In some cases, an IRS may comprise a sequence of formula NiTCCNj (GG) kNmX1GGGGX2X3 (SEQ ID NO. 4) in which each N is a nucleotide, in which i is an integer from 1 to about 50, in which j is an integer from 1 to about 50, k is 0 or 1, m is an integer from 1 to about 20, and X1, X2 and X3 are nucleotides, provided that if X1 = C or A, X2X3 is not AA . In some cases, an IRS may comprise a sequence of formula ID. SEC. No. 4 in which X1 is C or A.

In some cases, an IRS may comprise a sequence of formula X1X2X3GGGGAA (SEQ ID NO. 5), in which X1, X2 and X3 are nucleotides, provided that if X3 = C or A, X1X2 is not GG.

Examples of oligonucleotide sequences comprising the ID. SEC. No. 1, 2, 3, 4 or 5 include the following sequences:

5'-TCCTAACGGGGAAGT-3 '[ID. SEC. No. 10 (C827)]; 5'-TCCTAAGGGGGAAGT-3 '[ID. SEC. No. 11 (C828)]; 5-TCCTAACGGGGTTGT-3 '[ID. SEC. No. 12 (C841)]; 5'-TCCTAACGGGGCTGT-3 '[ID. SEC. No. 13 (C842)]; 5'-TCCTCAAGGGGCTGT-3 '[ID. SEC. No. 14 (C843)]; 5'-TCCTCAAGGGGTTGT-3 '[ID. SEC. No. 15 (C844)]; 5'-TCCTCATGGGGTTGT-3 '[ID. SEC. No. 16 (C845)]; 5'-TCCTGGAGGGGTTGT-3 '[ID. SEC. No. 17 (C869)]; 5'-TCCTGGAGGGGCTGT-3 '[ID. SEC. No. 18 (C870)]; 5'-TCCTGGAGGGGCCAT-3 '[ID. SEC. No. 19 (C871)]; 5'-TCCTGGAGGGGTCAT-3 '[ID. SEC. No. 20 (C872)]; 5'-TCCGGAAGGGGAAGT-3 '[ID. SEC. No. 21 (C873)]; and 5'-TCCGGAAGGGGTTGT-3 '[ID. SEC. No. 22 (C874)].

In some cases, an IRS may comprise a sequence of any of the IDs. SEC. numbers 1, 2, 3, 4 and 5, in which at least one G is replaced by 7-desaza-dG. For example, in some cases, the IRS may comprise the sequence 5'-TCCTGGAGZ'GGTTGT-3 '[Z' = 7-desaza-dG; ID. SEC. No. 23 (C920)).

IRPs that comprise the ID. SEC. No. 1, 2, 3, 4 or 5 or an IRP comprising the ID. SEC. No. 1, 2, 3, 4 or 5, in which at least one G is replaced by 7-desaza-dG, they are particularly effective in inhibiting TLR9-dependent cell stimulation. Other IRS sequences that are also effective in inhibiting TLR9-dependent cell signaling include the following:

5'-TGACTGTAGGCGGGGAAGATGA-3 '[ID. SEC. No. 24 (C533)];

5'-GAGCAAGCTGGACCTTCCAT-3 '[ID. SEC. No. 25 (C707)]; Y

5'-CCTCAAGCTTGAGZ'GG-3 '(Z' = 7-desaza-dG; SEQ ID No. 26 (C891)].

As shown here, some IRSs are particularly effective in inhibiting TLR7 / 8-dependent cell stimulation. Consequently, the IRS with this activity is referred to as "class TLR7 / 8" IRS. For example, an oligonucleotide comprising the sequence 5'-TGCTTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 27 * (C661)] inhibits TLR7 / 8-dependent cell stimulation and is an oligonucleotide for use according to the invention.

In certain embodiments, an oligonucleotide for use according to the invention comprises an ID fragment. SEC. No. C661 which includes at least a palindromic portion thereof of 10 bases. For example, said fragments include the following sequences:

5'-TGCTTGCAAGCTTGCAAG-3 '[ID. SEC. No. 28 * (C921)];

5'-TGCTTGCAAGCTTGCA-3 '[ID. SEC. No. 29 * (C922)];

5'-GCTTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 30 (C935)];

5'-CTTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 31 (C936)]; Y

5'-TTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 32 (C937)].

True oligonucleotides for use according to the invention are marked with an asterisk.

In certain embodiments, the oligonucleotide for use according to the invention consists of the ID. SEC. No. 27 * (C661)

or a fragment thereof. In certain embodiments, an oligonucleotide for use according to the invention consists of an ID fragment. SEC. No. 27 * (C661) and includes at least a palindromic portion thereof of 10 bases.

In some embodiments, an oligonucleotide for use according to the invention consists of the sequence 5'-TGCNm3 'in which N is a nucleotide and m is an integer from 5 to about 50, and in which the sequence N1-Nm comprises at least a GC dinucleotide. In some embodiments, said oligonucleotide for use according to the invention consists of the sequence 5'-TGCNmA-3 ', the sequence 5'-TGCNmCA-3' or the sequence 5'-TGCNmGCA-3 '. For example, in some embodiments, the oligonucleotide for use according to the invention may consist of the following sequence:

5'-TGCTTGCAAGCTAGCAAGCA-3 '[ID. SEC. No. 33 * (C917)]; 5'-TGCTTGCAAGCTTGCTAGCA-3 '[ID. SEC. No. 34 * (C918)]; 5'-TGCTTGACAGCTTGACAGCA-3 '[ID. SEC. No. 35 * (C932)]; 5-TGCTTAGCAGCTATGCAGCA-3 '[ID. SEC. No. 36 * (C933)]; or 5'-TGCAAGCAAGCTAGCAAGCA-3 '[ID. SEC. No. 37 * (C934)]. Other IRS sequences that are also effective in inhibiting TLR7 / 8-dependent cell signaling

They include the following: 5'-TGCAAGCTTGCAAGCTTG CAA GCT T-3 '[ID. SEC. No. 38 * (C793)]; 5'-TGCTGCAAGCTTGCAGAT GAT-3 '[ID. SEC. No. 39 * (C794)]; 5'-TGCTTGCAAGCTTGCAAGC-3 '[ID. SEC. No. 40 * (C919)]; 5'-TGCAAGCTTGCAAGCTTGCAAT-3 '[ID. SEC. No. 41 * (C923)]; 5'-TGCTTGCAAGCTTG-3 '[ID. SEC. No. 42 * (C930)]; 5'-AGCTTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 43 (C938)]; 5'-TACTTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 44 (C939)]; 5'-TGATTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 45 (C940)]; 5'-AAATTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 46 (C941)], 5'-TGCTGGAGGGGTTGT-3 '[ID. SEC. No. 47 (C945)]; 5'-AAATTGACAGCTTGACAGCA-3 '[ID. SEC. No. 48 (C951)]; 5'-TGATTGACAGCTTGACAGCA-3 '[ID. SEC. No. 49 (C959)]; 5'-TGATTGACAGATTGACAGCA-3 '[ID. SEC. No. 50 (C960)]; Y 5'-TGATTGACAGATTGACAGAC-3 '[ID. SEC. No. 51 (C961)]. The oligonucleotides for use according to the invention are labeled with an asterisk. Another class of IRSs includes those that are particularly effective in inhibiting cell stimulation of

pending both TLR7 / 8 and TLR9. Accordingly, the IRS with this activity is referred to as "class TLR7 / 8/9" IRS. In some cases, a combination of an IRS of class TLR7 / 8 with an IRS of class TLR9 results in an IRS of class TLR7 / 8/9.

The TLR7 / 8/9 class of IRS includes those comprising the sequence TGCNmTCCTGGAGGGGTTGT-3 '(ID. SEC. # 6), in which each N is a nucleotide and m is an integer from 0 to about 100, in some cases 0 to about 50, preferably 0 to about 20.

In some cases, an IRS comprises the ID. SEC. No. 6, in which the sequence N1-Nm comprises a fragment of the sequence 5'-TTGACAGCTTGACAGCA-3 '(ID. SEQ. No. 7). A fragment of ID. SEC. No. 7 is any portion of that sequence, such as, for example, TTGAC or GCTTGA. In some cases, the ID fragment. SEC. No. 7 is from the 5 'end of the ID. SEC. No. 7, which includes, for example, TTGAC or TTG.

In some cases, the IRS comprises the sequence 5'-TGCRRZNYY-3 '(SEQ ID NO. 8), in which Z is any nucleotide except C, in which N is any nucleotide and in which, when Z is not G nor inosine, N is guanosine or inosine. In other cases, the IRS comprises the sequence 5'-TGCRRZNpoli (pyrimidine) -3 '(SEQ ID NO. 9), in which Z is any nucleotide except C, in which N is any nucleotide and in which, when Z does not It is G or inosine, N is guanosine or inosine.

Examples of IRS sequences that are also effective in inhibiting TLR7 / 8/9 dependent cell signaling include the following:

5'-TGCTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 52 * (C954)];

5'-TGCTTGTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 53 * (C956)];

5'-TGCTTGACATCCTGGAGGGGTTGT-3 '[ID. SEC. No. 54 * (C957)];

5'-TGCTTGACAGCTTGACAGTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 55 * (C962)];

5'-TGCTTGACAGCTTGATCCTGGAGGGGTTGT-3 '[ID. SEC. No. 56 * (C963)];

5'-TGCTTGACAGCTTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 57 * (C964)];

5'-TGCTTGACAGCTTGCTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 58 * (C965)];

5'-TGCTTGACAGCTTGCTTGTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 59 * (C966)];

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT-3 '[ID. SEC. No. 60 * (C967)];

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT-3 '[ID. SEC. No. 61 * (C968)];

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGT-3 '[ID. SEC. No. 62 * (C969)];

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGG-3 '[ID. SEC. No. 63 * (C970)];

5'-TGCTTGCAAGCTTGCTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 64 * (C971)];

5'-TGCTTGCAAGCTTCCTGGAGGGGTTGT-3 '[ID. SEC. No. 65 * (C972)]; Y

5'-TGCTTGCAAGCTTGCAAGCATCCTGGAGGGGTTGT-3 '[ID. SEC. No. 66 * (C908)].

The oligonucleotides for use according to the invention are labeled with an asterisk.

As described herein, some IRPs are particularly effective in suppressing TLR9-dependent cellular responses. Such IRPs include, but are not limited to, ID. SEC. No. 24 (C533); ID. SEC. No. 25 (C707); ID. SEC. No. 86 (1019); ID. SEC. No. 91 (C891); ID. SEC. No. 10 (C827); ID. SEC. No. 11 (C828); ID. SEC. No. 12 (C841); ID. SEC. No. 13 (C842); ID. SEC. No. 14 (C843); ID. SEC. No. 15 (C844); ID. SEC. No. 16 (C845); ID. SEC. No. 17 (C869); ID. SEC. No. 18 (C870); ID. SEC. No. 19 (871); ID. SEC. No. 20 (C872); ID. SEC. No. 21 (C873); ID. SEC. No. 22 (C874); ID. SEC. No. 23 (C920); and ID. SEC. No. 66 * (C908).

As described herein, some IRPs are particularly effective in suppressing TLR7 / 8-dependent cellular responses. Such IRPs include, but are not limited to, ID. SEC. No. 17 (C869); ID. SEC. No. 23 (C920); ID. SEC. No. 27 * (C661); ID. SEC. No. 38 * (C793); ID. SEC. No. 29 * (C794); ID. SEC. No. 33 * (C917); ID. SEC. No. 34 * (C918); ID. SEC. No. 40 * (C919); ID. SEC. No. 28 * (C921); ID. SEC. No. 29 * (C922); ID. SEC. No. 41 * (C923); and ID. SEC. No. 66 * (C908).

An IRP can be single or double stranded DNA, as well as single or double stranded RNA or other modified polynucleotides. An IRP can be linear, can be circular or include circular portions and / or can include a hairpin loop. An IRP may contain bases present in nature or modified bases not present in nature, and may contain modified sugar, phosphate and / or ends. Some of these modifications are described here.

The heterocyclic bases, or nucleic acid bases, that are incorporated into the IRP may be the main purine and pyrimidine bases present in nature (i.e. uracil, thymine, cytosine, adenine and guanine, as mentioned above), as well as synthetic modifications and present in the nature of said main bases. Thus, an IRP can include 2'-deoxyuridine and / or 2-amino-2'-deoxyadenosine.

The IRP may comprise at least one modified base. As used herein, the term "modified base" is synonymous with "base analog compound"; for example, "modified cytosine" is synonymous with "cytosine analog compound". Similarly, "modified" nucleosides or nucleotides are defined herein as synonyms for "analogous" nucleoside or nucleotide compounds. Examples of basic modifications include, but are not limited to, the addition of an electron acceptor group to the C-5 and / or C-6 of an IRP cytosine. Preferably, the electron acceptor group is a halogen, for example, 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine or 5-iodocytosine. Other examples of basic modifications include, but are not limited to, the addition of an acceptor group of

45 electrons at C-5 and / or C-6 of an uracil of the immunoregulatory polynucleotide. Preferably, the electron acceptor group is a halogen. Such modified uracils may include, but are not limited to, 5-bromouracil, 5-chlorouracil, 5-fluorouracil and 5-iodouracil.

Other examples of base modifications include the addition of one or more thiol groups to the base, including, but not limited to, 6-thioguanine, 4-thiothymine and 4-thiouracil. Other examples of basic modifications include, but are not limited to, N4-ethylcytosine, 7-desazaguanine and 5-hydroxycytosine. See, for example, Kandimalla et al. (2001), Bioorg. Med. Chem. 9: 807-813.

The IRP may contain phosphate modified polynucleotides, some of which are known to stabilize the polynucleotide. Accordingly, some embodiments include stabilized immunoregulatory polynucleotides. For example, in addition to phosphodiester bonds, phosphate modifications include, but are not limited to, methyl phosphonate, phosphorothioate, phosphoramidate (bridging or bridging), phosphotriester and phosphorodithioate, and can be used in any combination. . Other non-phosphate bonds can also be used. In some embodiments, oligonucleotides for use in accordance with the present invention comprise only phosphorothioate main chains. In some embodiments, oligonucleotides for use according to the present invention only comprise phosphodiester backbone chains. In some embodiments, an oligonucleotide for use according to the invention may comprise a combination of phosphate bonds in the phosphate backbone, such as a combination of phosphodiester and phosphorothioate linkages.

The IRPs used in the invention may comprise one or more ribonucleotides (containing ribose as the sole or main component of sugar) or deoxyribonucleotides (containing deoxyribose as the principal component of sugar), or, as is known in the art, sugars may be incorporated modified or sugar-like compounds to IRP. Thus, in addition to ribose and deoxyribose, the sugar fraction can be pentose, deoxyipentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose, and a cyclopentyl group of "analogous compound" of sugar. The sugar may be in the form of pyranosyl or in the form of furanosyl. In the IRP, the sugar component is preferably ribose, deoxyribose, arabinose or 2'-O-alkylribose furanoside, and the sugar may be linked to the respective heterocyclic bases in an anomeric configuration at or �. Such modifications include, but are not limited to, 2'-alkoxy-RNA analog compounds, 2'-amino-RNA, 2'-fluoro-DNA analog compounds and 2'-alkoxy- or amino-RNA / DNA chimeras . For example, a modification of sugar in the IRP includes, but is not limited to, 2'-O-methyluridine and 2'-O-methylcytidine. The preparation of these sugars or similar sugar compounds and the respective "nucleosides" in which said sugars or analogous compounds are bound to a heterocyclic base (nucleic acid base) is per se known and it is not necessary to describe it here, except in the extent to which such preparation may be related to a specific example. Such modifications can also be made and combined with any phosphate modification in the preparation of an IRP.

IRP can be synthesized using nucleic acid synthesis techniques and equipment that are well known in the art, including, but not limited to, enzymatic methods, chemical methods and the degradation of larger oligonucleotide sequences. See, for example, Ausubel et al. (1987) and Sambrook et al. (1989). When assembled enzymatically, the individual units can be ligated, for example, with a ligase such as T4 DNA or RNA ligase (US Patent No. 5,124,246). Oligonucleotide degradation can be carried out by exposing an oligonucleotide to a nuclease, as exemplified in US Pat. No. 4,650,675.

IRP can also be isolated using conventional procedures for polynucleotide isolation. Such procedures include, but are not limited to, hybridization of probes with genomic or cDNA banks to detect shared nucleotide sequences, the exploration of antibody expression banks to detect shared structural features, and the synthesis of particular native sequences by the polymerase chain reaction.

A circular immunoregulatory polynucleotide can be isolated, synthesized by recombinant methods, or chemically synthesized. When the circular IRP is obtained by means of isolation or by recombinant methods, the IRP will preferably be a plasmid. The chemical synthesis of smaller circular oligonucleotides can be carried out using any method described in the literature. See, for example, Gao et al. (1995), Nucleic Acids Res. 23: 2025-2029; and Wang et al. (1994), Nucleic Acids Res. 22: 2326-2333.

Techniques for preparing polynucleotides and modified polynucleotides are known in this technical field. The naturally occurring DNA or RNA, which contains phosphodiester bonds, is generally synthesized by sequentially coupling the appropriate nucleoside phosphoramidite with the 5'-hydroxyl group of the growing oligonucleotide attached to a solid support at the 3 'end, and then oxidizing the intermediate phosphite triester to a phosphate triester. Once the desired polynucleotide sequence has been synthesized, the polynucleotide is separated from the support, the triaster phosphate groups are protected to phosphate diesters, and the nucleoside bases are deprotected using aqueous ammonia or other bases. See, for example, Beaucage (1993), "Oligodeoxyribonucleotides Synthesis" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (written by Agrawal), Humana Press, Totowa, New Jersey, USA; Warner et al. (1984), DNA 3: 401; and U.S. Pat. No. 4,458,066.

The synthesis of polynucleotides containing modified phosphate bonds or non-phosphate bonds is also known in the art. For a review, see Matteucci (1997), "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (written by D. J. Chadwick and G. Cardew), John Wiley and Sons, New York, NY, USA). The phosphorus derivative (or modified phosphate group) that can be attached to the sugar fraction or sugar analog compound in the oligonucleotides for use according to the present invention can be a monophosphate, diphosphate, triphosphate, alkyl phosphonate, phosphorothioate, phosphorodithioate , phosphoramidate or the like. The preparation of the aforementioned phosphate analog compounds and their incorporation into nucleotides, modified nucleotides and oligonucleotides is also per se known and it is not necessary to describe it here in detail [Peyrottes et al. (1996), Nucleic Acids Res. 24: 1841-1848; Chaturvedi et al. (1996), Nucleic Acids Res. 24: 2318-2323; and Schultz et al. (1996), Nucleic Acids Res. 24: 2966-2973]. For example, the synthesis of phosphorothioate oligonucleotides is similar to that previously described for oligonucleotides present in nature except that the oxidation operation is replaced by a sulfurization operation [Zon (1993), "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs , Synthesis and Properties (written by Agrawal), Humana Press, pages 165-190]. Similarly, the synthesis of other phosphate analog compounds, such as phosphotriesters [Miller et al. (1971), JACS 93: 6657-6665], phosphoramidates that do not form bridges [Jager et al. (1988), Biochem. 27: 7237-7246], N3 'to P5' phosphoramidates [Nelson et al. (1997), JOC 62: 7278-7287] and phosphorodithioates (US Patent No. 5,453,496). Other modified phosphorus-based oligonucleotides can also be used [Stirchak et al. (1989), Nucleic Acids Res. 17: 6129-6141].

Those skilled in the art will recognize that a large number of "synthetic" artificial nucleosides comprising various heterocyclic bases and various sugar components (and sugar-like compounds) are available in this technical field and that, provided that others are satisfied criteria of the present invention, the IRP may include one or several heterocyclic bases different from the five main basic components of nucleic acids present in nature. However, preferably, the heterocyclic base of the IRP includes, but is not limited to, the groups uracil-5-yl, cytosin-5-yl, adenin-7-yl, adenin-8-yl, guanin-7-yl, guanin-8-yl, 4-aminopyrrolo [2,3-d] pyrimidin-5-yl, 2-amino-4-oxopyrrolo [2,3-d] pyrimidin-5-yl and 2-amino-4-oxopyrrolo [ 2,3-d] pyrimidin-3-yl, in which the purines are bound to the sugar component of the IRP through position 9, pyrimidines through position 1, pyrrolopyrimidines through position 7 and pyrazolopyrimidines through position 1.

In U.S. Pat. Nos. 4,910,300, 4,948,882 and 5,093,232 have been described, for example, the preparation of modified base nucleosides and the synthesis of modified oligonucleotides using said modified base nucleosides as precursors. The modified base nucleosides have been designed so that they can be incorporated by chemical synthesis to terminal or internal positions of an oligonucleotide. Such modified base nucleosides, present in terminal or internal positions of an oligonucleotide, can serve as sites for the fixation of a peptide. Modified nucleosides in their sugar component have also been described (including, but not limited to, for example, U.S. Patent Nos. 4,849,513, 5,015,733, 5,118,800 and 5,118,802), nucleosides that may be used similarly.

The oligonucleotide for use according to the invention is less than about any of the following lengths (in bases or base pairs): 200, 175, 150, 125, 100, 75, 60, 50, 40, 30, 25 , 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4. In some embodiments, the oligonucleotide is longer than about any of the following lengths (in bases or pairs of bases): 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60, 75, 100, 125, 150. Alternatively, the oligonucleotide may have a size in the range that has an upper limit of 175, 150, 125, 100, 75, 60, 50, 40, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, and a lower limit independently selected from 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50 , 60, 75, 100, 125, 150, 175, the lower limit being smaller than the upper limit. The oligonucleotide has a length of 200 bases or less.

Methods for preparing the immunoregulatory polynucleotides described herein are described herein. The methods may be any of those described herein. For example, the method could be to synthesize the IRP (for example, using solid state synthesis) and could also comprise which purification operation (s). Purification methods are known in the art.

Immunoregulatory compounds (IRCs) that have immunoregulatory activity and that comprise a nucleic acid component comprising an IRS are described herein. IRCs contain one or more nucleic acid components and one or more spacer components that are not nucleic acid. For use as IRCs, compounds that conform to a variety of structural formulas are contemplated, including the central structures described later in formulas I-VII. Formulas I-III show central sequences for "linear IRCs". Formulas IV-VI show central sequences for "branched IRCs." Formula VII shows a central structure for "single spacer IRCs".

In each formula provided here, "N" indicates a nucleic acid component (oriented according to orientation 5'�3 '

or 3'�5 ') and "S" indicates a spacer component that is not nucleic acid. A hyphen ("-") indicates a covalent bond between a nucleic acid component and a spacer component that is not nucleic acid. A double dash ("-") indicates covalent bonds between a spacer component that is not nucleic acid and at least 2 nucleic acid components. A triple dash ("---") indicates covalent bonds between a spacer component that is not nucleic acid and multiple (ie, at least 3) nucleic acid components. Subscripts are used to indicate nucleic acid components or spacer components that are not nucleic acid in different positions. However, with the use of subscripts to distinguish different nucleic acid components it is not intended to indicate that the components necessarily have a different structure or sequence. Similarly, with the use

of subscripts to distinguish different spacer components is not intended to indicate that the components necessarily have different structures. For example, in formula II below, the nucleic acid components called N1 and N2 may have the same or different sequences, and the spacer components named S1 and S2 may have the same or different structures. In addition, it is contemplated that, at the ends of the central structures, additional chemical components (eg, phosphate, mononucleotide, additional nucleic acid components, alkyl, amino, thio or disulfide groups or linking groups, and / or may be covalently linked) spacer components).

Linear IRCs have structures whose spacer components that are not nucleic acid of the central structure are covalently bound to no more than two nucleic acid components. Exemplary linear IRCs conform to the following formulas:

N1-S1-N2

(I)

N1-S1-N2-S2-N3

(II)

N1-S1-N2-S2- [Nv-Sv] A

(III)

where A is an integer between 1 and about 100 and [Nv-Sv] indicates A further iterations of nucleic acid components conjugated to spacer components that are not nucleic acid. The subscript "v" indicates that N and S are independently selected in each iteration of "[Nv-Sv]". "A" is sometimes between 1 and about 10, sometimes between 1 and 3, sometimes exactly 1, 2, 3, 4 or 5. In some cases, "A" is an integer in a range defined by a limit lower than 1, 2, 3, 4 or 5 and an independently selected upper limit of 10, 20, 50 or 100 (for example, between 3 and 10).

Exemplary linear IRCs include:

N1-HEG-N2-OH (Ia)

N1-HEG-N1-PO4 (Ib)

N1-HEG-N2-HEG (Ic)

HEG-N1-HEG-N1-HEG (Id)

N1-HEG-N2-HEG-N1 (Ie)

N1-HEG-N2- (HEG) 4-N3 (If)

(N1) 2-glycerol-N1-HEG-N1 (Ig)

PO4-N1-HEG-N2 (Ih)

N1- (HEG) 15-T (Ii)

(N1-HEG) 2-glycerol-HEG-N2 (Ij)

N1-HEG-T-HEG-T (Ik)

in which HEG refers to hexa (ethylene glycol). TEG refers to tetra (ethylene glycol). Preferred linear IRCs include: 5'-TGCTTGCAAGCTTGCAAGCA-HEG-TCCTGGAGGGGTTGT-3 '[ID. SEC. No. 67 * (C907, C661-HEG-C869)]; 5'-TGCTTGCAAGCTAGCAAGCA-HEG-TCCTGGAGGGGTTGT-3 '[ID. SEC. No. 68 * (C913, C917-HEG-C869)]; 5'-TGCTTGCAAGCTTGCTAGCA-HEG-TCCTGGAGGGGTTGT-3 '[ID. SEC. No. 69 * (C914, C918-HEG-C869)]; 5'-TGCTTGCAAGCTTGCTAGCA-HEG-TCCTGGAGZGGTTGT-3 '[ID. SEC. No. 70 * (C916, C661-HEG-C920)]; Y 5'-TCCTGGAGGGGTTGT-HEG-TGCTTGCAAGCTTGCAAGCA-3 '[ID. SEC. No. 71 (C928, C869-HEG-C661)].

The oligonucleotides for use according to the invention are marked with an asterisk.

Branched IRCs comprise a multivalent (Sp) spacer component covalently bonded to at least three (3) nucleic acid components. Exemplary branched IRCs are described according to the following formulas:

[Nv] A --- Sp

(IV)

[Sv-Nv] A --- Sp

(V)

(S1-N1) -Sp - (Nv) A

(SAW)

wherein Sp is a multivalent spacer covalently linked to the "A" amount of independently selected nucleic acid components Nv, Sv-Nv (which comprises a spacer component covalently bonded to a nucleic acid component). For formulas IV and V, A is at least 3. In various cases of formulas IV and V, A is an integer between 3 and 100 (inclusive), although A can be an integer in the range defined by a limit less than about 3, 5, 10, 50 or 100 and an independently selected upper limit of about 5, 7, 10, 50, 100, 150, 200, 250 or 500, or, alternatively, A may be greater than

500. For formula VI, A is at least 2, an integer in the range defined by a lower limit of 2, 5, 10, 50 or 100 and an independently selected upper limit of 5, 10, 50, 100, 150 , 200, 250 or 500, or greater than

500

Exemplary branched IRCs include:

(N1) 2-glycerol-N1 (IVa)

(N2-HEG) 2-glycerol-N1 (IVb)

(N1-HEG-N2) 2-glycerol-N1 (IVc)

[(N1) 2-glycerol-N1] 2-glycerol-N1 (IVd)

Preferred branched IRCs include (5'-N1-3'-HEG) 2-glycerol-HEG-5'-N1-3 'and (5'-N1-3'-HEG) 2-glycerol-HEG-5'- N1 '.

Single spacer IRCs comprise a structure in which there is a single nucleic acid component covalently conjugated to a single spacer component, that is,

N1-S1 (VII)

In a preferred case, S1 has the structure of a multimer comprising smaller units (for example, HEG, TEG, glycerol, 1 ', 2'-dideoxyribose, subunits of C2 alkyl-C12 alkyl, and the like), typically connected by an ester bond (for example, phosphodiester or phosphorothioate ester), as described, for example, below. See below, for example, formula VIIa. The multimer can be heteromeric or homomeric. In one case, the spacer is a heteromer of monomer units (for example, HEG, TEG, glycerol, 1 ', 2'-dideoxyyribose, C2 alkyl to C12 alkyl connectors, and the like) linked by an ester bond (for example, phosphodiester or phosphorothioate ester). See below, for example, formula VIIb.

Exemplary single spacer IRCs include:

N1- (HEG) 15 (VIIa)

N1-HEG-propyl-HEG-propyl-HEG (VIIb)

In certain cases, the terminal structures of the IRC are covalently linked (eg, nucleic acid component to nucleic acid component; spacer component to spacer component; or nucleic acid component to spacer component), to give rise to a circular conformation.

IRCs for use in immunoregulatory compositions include at least one nucleic acid component. As used herein, the term "nucleic acid component" refers to a nucleotide monomer (ie, a mononucleotide) or a nucleotide polymer (that is, comprising at least 2 contiguous nucleotides). As used herein, a nucleotide comprises (1) a purine or pyrimidine base linked to a sugar which is in ester bond with a phosphate group, or (2) an analogous compound in which the base and / or sugar and / or The phosphate ester are substituted by analogous elements, as described, for example, below. In an IRC comprising more than one nucleic acid component, the nucleic acid components may be the same or different.

The nucleic acid components used in IRCs incorporated into the immunoregulatory compositions may comprise any of the IRS sequences described herein, and may also be sequences of six base pairs or less. It is contemplated that in an IRC comprising multiple nucleic acid components, the nucleic acid components may have the same or different lengths. In certain cases where the IRC comprises more than one nucleic acid component, only one of the components needs to comprise the IRS.

It is contemplated that, in an IRC comprising multiple nucleic acid components, the nucleic acid components may be the same or different. Consequently, in several cases, the IRCs incorporated into the immunoregulatory compositions comprise (a) nucleic acid components with the same sequence, (b) more than one iteration of a nucleic acid component or (c) two or more acid components different nucleic. In addition, a single nucleic acid component may comprise more than one IRS, which may be adjacent, overlapping or separated by additional nucleotide bases in the nucleic acid component.

As described herein, some IRPs are particularly effective in suppressing TLR9-dependent cellular responses and some IRPs are particularly effective in suppressing TLR7 / 8-dependent cellular responses. Since an IRC can comprise more than one IRP, IRPs can be combined with different activities to create an IRC with a particular activity for a particular use.

In some cases, the combination of two IRPs in an IRC leads to an immunoregulatory activity of the IRC different from the activity of any of the IRPs alone. For example, the IRC of ID. SEC. No. 68 * (C913) contains the IRP of ID. SEC. No. 33 (C917) attached to the IRP of ID. SEC. No. 17 (C869) through a HEG component. The IRP of ID. SEC. No. 33 (C917) inhibits TLR-7/8 dependent cellular responses but not TLR-9 dependent cellular responses. The IRP of ID. SEC. No. 17 (C869) has greater inhibitory activity for TLR-9 dependent cellular responses than for TLR-7/8 dependent cellular responses. However, the IRC ID. SEC. No. 68 * (C913) is very active in inhibiting both TLR-7/8 dependent cellular responses and TLR-9 dependent cellular responses. The same is also true for the IRC ID. SEC. No. 69 * (C914) and its IRPs ID components. SEC. No. 34 (C918) and ID. SEC. No. 17 (C869).

IRCs comprise one or more spacer components that are not covalently linked nucleic acid to the nucleic acid components. Sometimes, for convenience, spacer components that are not nucleic acid are simply referred to herein as "spacers" or "spacer components." The spacers generally have a molecular weight of from about 50 to about 50,000, typically from about 75 to about 5000, very often from about 75 to about 500, and are covalently bonded, in several cases, to one, two, three or more of Three components of nucleic acid. A variety of agents are suitable for connecting nucleic acid components. For example, as spacers in an IRC, various compounds referred to in the scientific literature can be used as "non-nucleic acid connectors", "non-nucleotide connectors" or "valence platform molecules". In certain cases, a spacer comprises multiple covalently connected subunits and may have a homopolymer or heteropolymer structure. It will be appreciated that mononucleotides and polynucleotides are not included in the definition of spacers that are not nucleic acid, without whose exclusion there would be no difference between nucleic acid component and an adjacent spacer component that is not nucleic acid.

In certain cases, a spacer may comprise one or more Abnormal nucleotides (i.e., they lack a nucleotide base but have the sugar and phosphate portions). Exemplary abbasic nucleotides include 1 ', 2'desoxirribose, 1'-deoxyribose, 1'-deoxyarabinose and polymers thereof.

Other suitable spacers comprise optionally substituted alkyl, optionally substituted polyglycol, optionally substituted polyamine, optionally substituted polyol, optionally substituted polyamide, optionally substituted polyether, optionally substituted polyimine, optionally substituted polyphosphodiester [such as poly (1-phospho-3-propanol)], and the like Optional substituents include alcohol, alkoxy (such as methoxy, ethoxy and propoxy), straight or branched chain alkyl (such as C1-C12 alkyl), amine, aminoalkyl (such as amino-C1-C12 alkyl), phosphoramidite, phosphate, thiophosphate, hydrazide, hydrazine, halogen (such as F, Cl, Br or I), amide, alkylamide (such as amide-C1-C12 alkyl), carboxylic acid, carboxylic ester, carboxylic anhydride, carboxylic acid halide, sulfonyl halide , imidate ester, isocyanate, isothiocyanate, haloformate, carbodiimide adduct, aldehydes, ketone, sulfhydryl, haloacetyl, alkyl halide, alkyl sulfonate, NR1R2 in which R1R2 is -C (= O) CH = CHC (= O) (maleimide ), thioether, cyano, sugar (such as mannose, galactose and glucose), a, �-unsaturated carbonyl, alkylmercury compound, and a, �-unsaturated sulfone.

Suitable spacers may comprise polycyclic molecules, such as those containing phenyl or cyclohexyl rings. The spacer can be a polyether such as polyphosphopropanodiol, polyethylene glycol, polypropylene glycol, a bifunctional polycyclic molecule such as a bifunctional pentalene, indene, naphthalene, blue, heptalene, biphenylene, asymmene, sim-indane, phenocene, phenaceno-ethane, phenaphthalene, phenaphthalene, phenocene anthracene, fluorantene, acefenatrylene, aceantrylene, triphenylene, pyrene, chromene, naphthacene, thiantrene, isobenzofuran, chromene, xanthene, phenoxatiine, which may be substituted or modified, or a combination of polyethers and polycyclic molecules. The polycyclic molecule may be substituted or polysubstituted with a C1-C5 alkyl, C6 alkyl, alkenyl, hydroxyalkyl, halogen or haloalkyl group. Typically, nitrogen-containing polyheterocyclic molecules (for example, indolizine) are not suitable spacers. The spacer may also be a polyol, such as glycerol or pentaerythritol. In one case, the spacer comprises (1-phosphopropane) 3-phosphate or (1-phosphopropane) 4-phosphate (also called tetraphosphopropanediol and pentaphosphopropanodiol). In one case, the spacer comprises derivatized 2,2'-ethylenedioxydiethylamine (EDDA).

Specific examples of non-nucleic acid spacers useful in IRCs include the "connectors" described by Cload et al. (1991), J. Am. Chem. Soc. 113: 6324; Richardson et al. (1991), J. Am. Chem. Soc. 113: 5109; Ma et al. (1993), Nucleic Acids Res. 21: 2585; Ma et al. (1993), Biochemistry 32: 1751; McCurdy et al. (1991), Nucleosides & Nucleotides 10: 287; Jaschke et al. (1993), Tetrahedron Lett. 34: 301; Ono et al. (1991), Biochemistry 30: 9914; and International Publication No. WO 89/02439.

Other suitable spacers include the connectors described by Salunkhe et al. (1992), J. Am. Chem. Soc. 114: 8768; Nelson et al. (1996), Biochemistry 35: 5339-5344; Bartley et al. (1997), Biochemistry 36: 14.502-511; Dagneaux et al. (1996), Nucleic Acids Res. 24: 4506-12; Durand et al. (1990), Nucleic Acids Res. 18: 6353-59; Reynolds et al. (1996), Nucleic Acids Res. 24: 760-65; Hendry et al. (1994), Biochem. Biophys Minutes 1219: 405-12; and Altmann et al. (1995), Nucleic Acids Res. 23: 4827-35. In European Patent No. EP0313219B1 and US Pat. nº

6,117,657 still describe other suitable spacers.

Exemplary non-nucleic acid spacers comprise oligoethylene glycol (eg, triethylene glycol, tetraethylene glycol and hexaethylene glycol spacers, and other polymers comprising up to about 10, about 20, about 40, about 50, about 100 or about 200 ethylene glycol units), alkyl spacers (for example, propyl, butyl, hexyl and other C2-C12 alkyl spacers such as, for example, normally C2-C10 alkyl, very often C2-C6 alkyl), basic nucleotide spacers, symmetric or asymmetric derived spacers of glycerol, pentaerythritol or 1,3,5-trihydroxycyclohexane (for example, the symmetrical double and triple spacer components described herein). The spacers may also comprise heteromeric oligomers and polymers or homomers of the aforementioned compounds (for example, linked by an amide bond, ester, ether, thioether, disulfide, phosphodiester, phosphorothioate, phosphoramidate, phosphotriester, phosphorodithioate, methylphosphonate or other bond).

Suitable spacer components may contribute with load and / or hydrophobia to the IRC, contribute with favorable pharmacokinetic properties (for example, improved stability and longer blood time) to the IRC, and / or lead to the direction of the IRC to cells or particular organs. The spacer components may be selected or modified to adapt the IRC to the desired pharmacokinetic properties or to the suitability for the desired modes of administration (eg, oral administration). The reader will appreciate that, for convenience, a spacer (or spacer component) is sometimes referred to by the chemical name of the compound from which the spacer component (for example, hexaethylene glycol) is derived, with the understanding that the IRC actually comprises the conjugation product of the compound and adjacent nucleic acid components or other spacer portion components.

In an IRC comprising more than one spacer component, the spacers may be the same or different. Thus, in one case, all the spacer components of an IRC that are not nucleic acid have the same structure. In one case, an IRC comprises spacer components that are not nucleic acid with at least 2, at least 3, at least 4, at least 5 or at least 6 or more different structures.

In some contemplated cases, the spacer component of an IRC is defined to exclude certain structures. Thus, in certain cases, a spacer is different from an abyss nucleotide or a polymer of abyss nucleotides. In some cases, a spacer is different from an oligo (ethylene glycol) (for example, HEG, TEG and the like) or a poly (ethylene glycol). In some cases, a spacer is different from a C3 alkyl spacer. In some cases, a spacer is different from a polypeptide. Thus, in some cases, an immunogenic molecule, such as, for example, a protein or a polypeptide, is not suitable as a component of spacer portions. However, as discussed below, it is contemplated that, in certain cases, an IRC is a "protein IRC", that is, it comprises a spacer component comprising a polypeptide. However, in certain cases, the spacer component is not protein and / or is not an antigen (that is, the spacer component, if isolated from the IRC, is not an antigen).

In general, suitable spacer components do not make the IRC of which they are part insoluble in an aqueous solution (eg, PBS, pH 7.0). Thus the definition of spacers excludes microcarriers or nanocarriers. In addition, a spacer component having low solubility is not preferred, such as a dodecyl spacer (solubility <5 mg / ml when measured as a dialcoholic precursor, 1,12-dihydroxidedecane), because it can reduce hydrophilicity and IRC activity. Preferably, the spacer components have solubilities well above 5 mg / ml (e.g., � 20 mg / ml, � 50 mg / ml or � 100 mg / ml) when measured as dialcoholic precursors.

To the load of an IRC can contribute phosphate or thiophosphate groups or other groups of nucleic acid components, as well as groups of spacer components that are not nucleic acid. In some cases, a spacer component that is not nucleic acid carries a net charge (for example, a net positive charge or a negative net charge when measured at a pH of 7). In a useful case, the IRC has a negative net charge. In certain cases, the negative charge of a spacer component of an IRC is increased by derivatizing a spacer subunit described herein to increase its charge. For example, glycerol can be covalently linked to two nucleic acid components and the remaining alcohol can be reacted with an activated phosphoramidite, followed by oxidation or sulfurization to form a phosphate or thiophosphate, respectively. In certain cases, the negative charge with which the spacer components of an IRC contribute that are not nucleic acid (that is, the sum of the charges when there is more than one spacer) is greater than the negative charge with which the acid components contribute IRC nucleic. The charge can be calculated based on the molecular formula or can be experimentally determined by, for example, capillary electrophoresis (Capillary Electrophoresis, Principles, Practice and Application, drafted by Li, 1992, Elsevier Science Publishers, Amsterdam, Netherlands, pages 202-206 ).

As indicated above, suitable spacers can be polymers of compounds that are not smaller nucleic acid (for example, non-nucleotide), such as those described herein, which are themselves useful as spacers, including compounds commonly made reference as non-nucleotide "connectors". Such polymers (ie, "multi-unit spacers") can be heteromers or homomers, and often comprise monomer units (for example, HEG, TEG, glycerol, 1 ', 2'-dideoxyribose, and the like) linked by an ester bond ( for example, phosphodiester or phosphorothioate ester). Thus, in one case, the spacer comprises a polymer structure (for example, heteropolymer) of non-nucleotide units (for example, from 2 to about 100 units, alternatively from 2 to about 50, for example, from 2 to about 5 , alternatively, for example, from about 5 to about 50, for example, from about 5 to about 20).

For illustration, the IRCs that contain the ID. SEC. No. 17 (C869) and multi-unit spacers include

5'-TCCTGGAGGGGTTGT- (C3) 15-T 5'-TCCTGGAGGGGTTGT- (glycerol) 15-T 5'-TCCTGGAGGGGTTGT- (TEG) 8-T 5'-TCCTGGAGGGGTTGT- (HEG) 4-T

wherein (C3) 15 means 15 propyl linkers linked by phosphorothioate esters; (glycerol) means 15 glycerol connectors linked by phosphorothioate esters; (TEG) 8 means 8 triethylene glycol connectors linked by phosphorothioate esters; and (HEG) 4 means 4 hexaethylene glycol linkers linked by phosphorothioate esters. It will be appreciated that certain multi-unit spacers have a negative net charge, and that the negative charge can be increased by increasing the number of, for example, monomer units linked by ester.

In certain cases, a spacer component is a multivalent spacer component that is not a nucleic acid (ie, a "multivalent spacer"). As used in this context, an IRC containing a multivalent spacer contains a spacer covalently bonded to three (3) or more nucleic acid components. Multivalent spacers are sometimes referred to in the art as "platform molecules." Multivalent spacers can be polymers or non-polymers. Examples of suitable molecules include glycerol or substituted glycerol (for example, 2-hydroxymethyl glycerol and levulinyl glycerol); tetraaminobenzene, heptaaminobetacyclodextrin, 1,3,5-trihydroxycyclohexane, pentaerythritol and derivatives of pentaerythritol, tetraaminopentaerythritol, 1,4,8,11-tetraazacyclotetradecane (Cyclam), 1,4,7,10-tetraazacyclododecane (Cyclenin, polyethylene, 1, 3-diamino-2-propanol and substituted derivatives, [propyloxymethyl] ethyl compounds (for example, "triple spacer"), polyethylene glycol derivatives such as the so-called "PEGs Star" and "bPEG" [see, for example, Gnanou et to the. (1988), Makromol. Chem

189: 2885; Rein et al. (1993), Acta Polymer 44: 225; and U.S. Pat. No. 5,171,264], and dendrimers.

Dendrimers are known in the art and are chemically defined globular molecules, generally prepared by gradual or repetitive reaction of multifunctional monomers to obtain a branched structure [see, for example, Tomalia et al. (1990), Angew. Chem. Int. Ed. Engl. 29: 138-75]. A variety of dendrimers is known; for example, polyamidoamine, polyethyleneimine and polypropyleneimine dendrimers terminated in amine). Exemplary dendrimers useful in the present case include polymers ("dense star") or polymers ("star burst") such as those described in US Pat. Nos. 4,587,329, 5,338,532 and 6,177,414, including so-called "poly (amidoamine) dendrimers (" PAMAM ")". Still other multimer spacer molecules suitable for use in the present case include non-polymeric and chemically defined valence platform molecules, such as those described in US Pat. No. 5,552,391 and PCT application publications WO 00/75105, WO 96/40197, WO 97/46251, WO 95/07073 and WO 00/34231. Many other suitable multivalent spacers can be used and will be known to those skilled in the art.

The conjugation of a nucleic acid component with a platform molecule can be carried out in different ways, one or more crosslinking agents and functional groups being typically involved in the nucleic acid component and the platform molecule. Linker groups are added to the platforms using standard synthetic chemistry techniques. Binding groups can be added to the nucleic acid components using standard synthetic techniques.

Multivalent spacers with a variety of valences are useful and, in several cases, the IRC multivalent spacer is attached to between about 3 and about 400 nucleic acid components, often 3 to 100, sometimes 3 to 50, frequently 3 to 10, and sometimes more than 400 components of nucleic acid. In several cases, the multivalent spacer is conjugated with more than 10, more than 25, more than 50 or more than 500 nucleic acid components (which may be the same or different). It will be appreciated that, in certain cases where an IRC comprises a multivalent spacer, the population of IRCs with slightly different molecular structures is described. For example, when an IRC is prepared using a dendrimer as a high valence multivalent spacer, a somewhat heterogeneous mixture of molecules is produced, that is, they comprise different numbers (within or predominantly within a determinable range) of bound nucleic acid components. to each dendrimer molecule.

In IRCs, derivatized polysaccharides can be used as spacers to allow binding to nucleic acid components. Suitable polysaccharides include naturally occurring polysaccharides (e.g., dextran) and synthetic polysaccharides (e.g., Ficoll). For example, aminoethylcarboxymethyl-Ficoll (AECM-Ficoll) can be prepared by the method of Inman (1975), J. Imm. 114: 704-709. The AECM-Ficoll can then be reacted with a heterobifunctional crosslinking agent, such as the N-hydroxysuccinimide ester with 6maleimidocaproic acid, and can then be conjugated with a thiol derivatized nucleic acid component [see Lee et al. (1980), Mol. Imm. 17: 749-56]. Other polysaccharides can be similarly modified.

It will be within the capacity of an expert, guided by this specification and knowledge in the art, to prepare IRCs using routine methods. Techniques for preparing nucleic acid components (eg, oligonucleotides and modified oligonucleotides) are known. Nucleic acid components can be synthesized using techniques that include, but are not limited to, enzymatic methods and chemical methods and combinations of enzymatic and chemical approaches. For example, DNA or RNA containing phosphodiester bonds can be chemically synthesized by sequentially coupling the appropriate nucleoside phosphoramidite with the 5'-hydroxyl group of the growing oligonucleotide, fixed to a solid support at the 3 'end, and then oxidizing the intermediate phosphite triester to a phosphate triester. Solid supports useful for DNA synthesis include Controlled Pore Glass (Applied Biosystems, Foster City, California, USA), polystyrene globules matrix (Primer Support, Amersham Pharmacia, Piscataway, New Jersey, USA). ) and TentGel (Rapp Polymere GmbH, Tubingen, Germany). Once the desired oligonucleotide sequence has been synthesized, the oligonucleotide is separated from the support, the triaster phosphate groups are protected to phosphate diesters, and the nucleoside bases are deprotected using aqueous ammonia or other bases.

For example, DNA or RNA polynucleotides (nucleic acid components) containing phosphodiester bonds are generally synthesized by repetitive iterations of the following operations: a) separation of the 5'-hydroxyl group from the 3'-nucleic acid or nucleoside bound to the solid support, b) coupling of the activated nucleoside phosphoramidite, with the 5'-hydroxyl group, c) oxidation of the phosphite triester to the phosphate triester, and d) terminal termination of the unreacted 5'-hydroxyl groups. The DNA or RNA containing phosphorothioate bonds is prepared in the manner described above except that the oxidation operation is replaced by a sulfurization operation. Once the desired oligonucleotide sequence has been synthesized, the oligonucleotide is separated from the support, the triaster phosphate groups are protected to phosphate diesters, and the nucleoside bases are deprotected using aqueous ammonia or other bases. See, for example, Beaucage (1993) "Oligodeoxyribonucleotide Synthesis" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (written by Agrawal), Humana Press, Totowa, New Jersey, USA; Warner et al. (1984), DNA 3: 401; Tang et al. (2000), Org. Process Res. Dev. 4: 194-198; Wyrzykiewica et al. (1994), Bioorg. & Med. Chem. Lett. 4: 1519-1522; Radhakrishna et

to the. (1989), J. Org. Chem. 55: 4693-4699, and US Pat. No. 4,458,066. Programmable machines that automatically synthesize nucleic acid components of specified sequences are widely available. Examples include the Expedite 8909 automated DNA synthesizer (Perseptive Biosystem, Framington, Massachusetts, USA), ABI 394 (Applied Biosystems, Inc., Foster City, California, USA) and OligoPilot II (Amersham Pharmacia Biotech, Piscataway, New Jersey, USA).

The polynucleotides can be assembled in the 3 'to 5' direction using, for example, protected base nucleosides (monomers) containing a 5'-protective, acid-labile group, and a 3'-phosphoramidite. Examples of such monomers include 5'-O- (4,4'-dimethoxytrityl) -nucleoside-3'-O- (N, Ndiisopropylamino) 2-cyanoethyl phosphoramidite, in which examples of protected nucleosides include, but they are not limited to, N6-benzoyladenosine, N4-benzoylcytidine, N2-isobutyrylguanosine, thymidine and uridine. In this case, the solid support used contains a 3'-linked protected nucleoside. Alternatively, the polynucleotides can be assembled in the 5 'to 3' direction using protected base nucleosides containing a 3'-protective, acid-labile group, and a 5'-phosphoramidite. Examples of said monomers include 3'-O- (4,4'-dimethoxytrityl) -protected nucleoside-5'-O- (N, N-diisopropylamino) 2-cyanoethyl phosphoramidite, wherein examples of protected nucleosides include , but are not limited to, N6-benzoyladenosine, N4-benzoylcytidine, N2-isobutyrylguanosine, thymidine and uridine (Glen Research, Sterling, Virginia, USA). In this case, the solid support used contains a protected 5'-linked nucleoside. They can be isolated, synthesized by recombinant methods or chemically synthesized circular nucleic acid components. Chemical synthesis can be carried out using any method described in the literature. See, for example, Gao et al. (1995), Nucleic Acids Res. 23: 2025-2029; and Wang et al. (1994), Nucleic Acids Res.

22: 2326-2333.

The addition of spacer components that are not nucleic acid can be carried out using routine methods. Methods for the addition of specific spacer components are known in the art and are described, for example, in the references cited above. See, for example, Durand et al. (1990), Nucleic Acids Res. 18: 6353-6359. The covalent bond between a spacer component and a nucleic acid component can be any of several types, including phosphodiester, phosphorothioate, amide, ester, ether, thioether, disulfide, phosphoramidate, phosphotriester, phosphorodithioate, methylphosphonate and other bonds. It will often be convenient to combine a spacer component (s) and a nucleic acid component (s) using the same phosphoramidite type chemistry used for the synthesis of the nucleic acid component. For example, IRCs can be conveniently synthesized using an automated DNA synthesizer (eg, Expedite 8909, Perseptive Biosystem, Framington, Massachusetts, USA) using phosphoramidite chemistry (see, for example, Beaucage, 1993, supra ; Current Protocols in Nucleic Acid Chemistry, supra). However, those with experience will understand that, if desired, the same (or equivalent) synthesis operations carried out by an automated DNA synthesizer can also be carried out manually. In said synthesis, one end of the spacer (or spacer subunit in the case of multimer spacers) is typically protected with a 4,4'-dimethoxytrityl group, while the other end contains a phosphoramidite group.

A variety of spacers are commercially available with the required protecting groups and reagents, for example:

Triethylene glycol or 9-O- (4,4'-dimethoxytrityl) triethylene glycol-1-O- [N, N-diisopropylphosphoramidite (2) spacer

cyanoethyl)] (Glen Research, 22825 Davis Drive, Sterling, Virginia, USA) "TEG spacer"

Hexaethylene glycol 18-O- (4,4'-dimethoxytrityl) hexaethylene glycol-1-O- [N, N-diisopropylphosphoramidite (2-cyanoethyl)] spacer (Glen Research, Sterling, Virginia, USA)

or "HEG spacer"

Propyl 3- (4,4'-dimethoxytrityloxy) propyloxy-1-O- [N, N-diisopropylphosphoramidite (2-cyanoethyl)] spacer (Glen Research, Sterling, Virginia, USA)

Butyl spacer 4- (4,4'-dimethoxytrityloxy) butyloxy-1-O- [N, N-diisopropylphosphoramidite (2-cia

noetyl)] (Chem Genes Corporation, Ashland Technology Center, 200 Homer

Ave, Ashland, Massachusetts, USA)

Hexyl spacer 6- (4,4'-dimethoxytrityloxy) hexyloxy-1-O- [N, N-diisopropylphosphoramidite of (2-cyanoethyl)]

2- (hydroxymethyl) ethyl 1- (4,4'-dimethoxytrityloxy) -3- (levulinyloxy) -propyloxy-2-O- [N, N-diisopropylphosphoramidite (2-cyanoethyl)] spacer; also called asymmetric branched spacer

or "HME spacer" "Abnormal nucleotide spacer" 5-O- (4,4'-dimethoxytrityl) -1,2-dideoxyribose-3-O- [N, N-diisopropylphosphoramidite

or "abasic spacer" of (2-cyanoethyl)] (Glen Research, Sterling, Virginia, USA)

"Symmetric branched spacer" 1,3-O, O-bis (4,4'-dimethoxytrityl) glycerol-2-O- [N, N-diisopropylphosphoramidite from (2cyanoethyl)] (Chem Genes, Ashland, Massachusetts, USA) .)

or "glycerol spacer"

"Triple spacer"

2,2,2-O, O, O-tris [3-O- (4,4'-dimethoxytrityloxy) propyloxymethyl] ethyl-1-O- [N, N-diisopropylphosphoramidite of (2-cyanoethyl)] (Glen Research , Sterling, Virginia, USA)

"Symmetric double spacer"

1,3-O, O-bis [5-O- (4,4'-dimethoxytrityloxy) pentylamido] propyl-2-O- [N, N-diisopropylphosphoramidite of (2-cyanoethyl)] (Glen Research, Sterling, Virginia , USA)

"Dodecil Spacer"

12- (4,4'-dimethoxytrityloxy) dodecyloxy-1-O- [N, N-diisopropylphosphoramiditacyanoethyl)] (Glen Research, Sterling, Virginia, USA) from (2-

These and a wide variety of other protected spacer component precursors (for example, which comprise protective groups of DMT and phosphoramidite groups) can be acquired or can be synthesized using routine methods for use in preparing IRCs described herein. The instrument is programmed according to the manufacturer's instructions to add nucleotide monomers and spacers in the desired order.

Although the use of phosphoramidite chemistry is convenient for the preparation of certain IRCs, it will be appreciated that IRCs are not limited to compounds prepared by any particular method of synthesis or preparation.

In one case, IRCs are prepared with multivalent spacers conjugated with more than one type of nucleic acid component. For example, platforms containing two maleimide groups (which can react with polynucleotides containing thiols), and two activated ester groups (which can react with nucleic acids containing aminos) have been described (see, for example, PCT application publication WO 95/07073). These two activated groups can be reacted independently of each other. This would result in an IRC that would contain a total of four nucleic acid components, two of each sequence.

IRCs can also be prepared with multivalent spacers containing two different nucleic acid sequences, using the above-described symmetric branched spacer and conventional phosphoramidite chemistry (for example, using manual or automated methods). The symmetric branched spacer contains a phosphoramidite group and two protective groups that are equal and are separated simultaneously. In one approach, for example, a first nucleic acid is synthesized and coupled with the symmetric branched spacer, and the spacer protecting groups are separated. Two additional nucleic acids (of the same sequence) are then synthesized on the spacer (using in each operation double the amount of reagents used for the synthesis of a single nucleic acid component).

A similar method can be used to connect three different nucleic acid components (referred to below as nucleic acids I, II and III) to a multivalent platform (for example, an asymmetric branched spacer). This is very conveniently carried out using an automated DNA synthesizer. In one case, the asymmetric branched spacer contains a phosphoramidite group and two orthogonal protecting groups that can be separated independently. First, nucleic acid I is synthesized, the asymmetric branched spacer is then coupled with nucleic acid I, and then nucleic acid II is added after selective separation of one of the protecting groups. The nucleic acid II is deprotected and terminally terminated and then the other protecting group is separated from the spacer. Finally, the nucleic acid is synthesized

III.

In some cases, a nucleic acid component (s) is synthesized and a reactive linker group (for example, amino, carboxylate, thio, disulfide and the like) is added using standard synthetic chemistry techniques. The reactive linking group (of which it is considered to form a portion of the resulting spacer component) is conjugated with compounds that are not additional nucleic acid to form the spacer component. Binding groups are added to nucleic acids using standard methods for nucleic acid synthesis, using a variety of reagents described in the literature or commercially available. Examples include reagents containing an amino group, carboxylate group, thiol group or disulfide group protected and a phosphoramidite group. Once these compounds have been incorporated into the nucleic acids, through the activated phosphoramidite group, and have been unprotected, they provide nucleic acids with amino, carboxylate or thiol reactivity.

Hydrophilic connectors of varying lengths are useful, for example, for linking nucleic acid components and platform molecules. A variety of suitable connectors is known. Suitable connectors include, without limitation, linear oligomers or polymers of ethylene glycol. Such connectors include connectors with the formula R1S (CH2CH2O) nCH2CH2O (CH2) mCO2R2 in which n = 0-200, m = 1 or 2, R1 = H or a protecting group such as trityl, R2 = H or alkyl or aryl, by example, 4-nitrophenyl ester. These connectors are useful for connecting a molecule containing a thiol reactive group, such as haloacetyl, maleimide, etc., through a thioether, with a second molecule containing an amino group through an amide bond. The fixing order may vary; that is, the thioether bond can be formed before or after the amide bond has formed. Other useful connectors include Sulfo-SMCC [4- (N-maleimidomethyl) -cyclohexane-1-sulfosuccinimidyl carboxylate] from Pierce Chemical Co., product 22322; Sulfo-EMCS [N- (£ -maleimidocaproyloxy) -sulfosuccinimide ester] from Pierce Chemical Co., product 22307; Sulfo-GMBS [N- (y-maleimidobutyryloxy) -sulfosuccinimide ester] from Pierce Chemical Co., product 22324 (Pierce Chemical Co., Rockford, Illinois, USA), and similar compounds of general formula maleimido ester-RC (O) NHS, in which R = alkyl, cyclic alkyl, ethylene glycol polymers, and the like.

Particularly useful methods for covalently linking nucleic acid components with multivalent spacers are described in the references cited above.

In certain cases, a polypeptide is used as a multivalent spacer component to which a plurality of nucleic acid components are covalently conjugated, directly or via linkers, to form a "protein IRC." The polypeptide can be a vehicle (for example, albumin). Typically, a protein IRC comprises at least one nucleic acid component, and usually several or many nucleic acid components, which (a) have a length of between 2 and 7, more often between 4 and 7, nucleotides, alternatively a length between 2 and 6, 2 and 5, 4 and 6, or 4 and 5, nucleotides, and / or (b) have a lower isolated immunomodulatory activity or have no isolated immunomodulatory activity. The methods for preparing a protein CRI will be evident to those who have experience after reviewing this description. For example, a nucleic acid can be covalently conjugated with a polypeptide spacer component by methods known in the art that include bonds between a 3 'or 5' end of a nucleic acid component (or on a suitably modified base at an internal position of the nucleic acid component) and a polypeptide with a suitable reactive group (for example, an N-hydroxysuccinimide ester, which can be reacted directly with the N4-amino group of cytosine residues). As a further example, a polypeptide can be attached to the 5 'free end of a nucleic acid component through an amine, thiol or carboxyl group that has been incorporated into the nucleic acid component. Alternatively, the polypeptide can be conjugated with a spacer component, as described herein. In addition, a linker group comprising a protected amine, thiol or carboxyl at one end and a phosphoramidite can be covalently attached to a hydroxyl group of a polynucleotide and, after deprotection, the functionality to covalently fix the IRC to a peptide

IRP and / or IRC complexes and compositions

IRPs or IRCs can be administered directly to the individual or can be administered in a composition or complex to enhance the distribution of IRP or IRC to cells and / or cell incorporation. Compositions or complexes can also be used to enhance the joint distribution of two or more different IRP and / or IRC species to a cell. In certain cases, a mixture of IRCs and IRPs can be complexed in order to distribute at least one species of IRC and IRP. Such compositions or complexes for distribution include, but are not limited to, encapsulation complexes and colloidal dispersion systems, as described herein and known in the art. Examples of such compositions for distribution include oil-in-water emulsions, micelles and liposomes. Compositions or complexes for distribution also include an IRC and / or IRC attached to a connecting molecule, a platform molecule, a nanoparticle or a microparticle, as described herein. Such links include both covalent and non-covalent bonds. Unless otherwise indicated, the formulations of complexes and compositions described herein for use with IRPs are also suitable for use with IRCs.

In some cases, the IRP and / or IRC is conjugated with a connecting molecule. The IRP and / or IRC portion can be coupled to the connecting portion of a conjugation product in various ways, including by covalent and / or non-covalent interactions.

The connection between the portions can be carried out at the 3 'or 5' end of the IRP and / or IRC, or at any suitably modified base in an internal position of the IRP and / or IRC. If the linker is a peptide and contains a suitable reactive group (for example, an N-hydroxysuccinimide ester), it can be reacted directly with the N4 amino group of cytosine residues. Depending on the number and position of the cytosine residues in the IRP and / or IRC, a specific coupling can be achieved in one or more residues.

Alternatively, modified oligonucleosides, such as those known in the art, can be incorporated at either end or internal positions of the IRP and / or IRC. These may contain blocked functional groups that, once unlocked, are reactive with a variety of functional groups that may be present in, or attached to, the connector of interest.

When the linker is a peptide, this portion of the conjugation product can be fixed to the 3 'end of the IRP and / or IRC by means of solid support chemistry. For example, the IRP portion can be added to a peptic portion that has been previously synthesized on a support [Haralambidis et al. (1990a), Nucleic Acids Res. 18: 493499; and Haralambidis et al. (1990b), Nucleic Acids Res. 18: 501-505]. Alternatively, the IRP can be synthesized so that it is connected to a solid support by means of a cleavable connector extending from the 3 'end. Following the chemical cleavage of the IRP from the support, a thiol terminal group remains at the 3 'end of the oligonucleotide [Zuckermann et al. (1987), Nucleic Acids Res. 15: 5305-5321, and Corey et al. (1987), Science 238: 1401-1403] or a terminal amino group remains at the 3 'end of the oligonucleotide [Nelson et al. (1989), Nucleic Acids Res. 17: 17811794]. The conjugation of the IRP and / or IRC amino-modified with amino groups of the peptide can be carried out in the manner described by Benoit et al. (1987), Neuromethods 6: 43-72. The conjugation of the IRP and / or IRC thiol-modified with carboxyl groups of the peptide can be carried out in the manner described by Sinah et al. (1991), Oligonucleotide Analogues: A Practical Approach, IRL Press. The coupling of an oligonucleotide carrying an added maleimide, with the thiol side chain of a cysteine residue of a peptide [Tung et al. (1991), Bioconjug. Chem. 2: 464-465].

The peptide linker portion of the conjugation product can be attached to the 5 'end of the IRP and / or IRC through an amine, thiol or carboxyl group that has been incorporated into the oligonucleotide during its synthesis. Preferably, although the oligonucleotide is attached to the solid support, a linker group comprising an amine, a thiol or a carboxyl protected at one end and a phosphoramidite at the other is covalently bound to 5'-hydroxyl [Agrawal et al. (1986), Nucleic Acids Res. 14: 6227-6245; Connolly (1985), Nucleic Acids Res. 13: 4485-4502; Kremsky et al. (1987), Nucleic Acids Res. 15: 2891-2909; Connolly (1987), Nucleic Acids Res. 15: 3131-3139; Bischoff et al. (1987), Anal. Biochem 164: 336-344; Blanks et al. (1988), Nucleic Acids Res. 16: 10.283-10.299; and U.S. Pat. Nos. 4,849,513, 5,015,733, 5,118,800 and 5,118,802]. After deprotection, the amine, thiol and carboxyl functions can be used to covalently fix the oligonucleotide to a peptide [Benoit et al. (1987); and Sinah et al. (1991)].

An IRP and / or IRC conjugation product can also be formed through non-covalent interactions, such as ionic bonds, hydrophobic interactions, hydrogen bonds and / or van der Waals attractions.

Non-covalently linked conjugation products may include a non-covalent interaction such as a biotin-streptavidin complex. A biotinyl group can be attached to, for example, a modified base of an IRP and / or IRC [Roget et al. (1989), Nucleic Acids Res. 17: 7643-7651]. The incorporation of a streptavidin component into the peptide portion allows the formation of a non-covalently bound complex of the biotinylated oligonucleotide and the streptavidin conjugated peptide.

Non-covalent associations can also be produced through ionic interactions in which an IRP and / or IRC are involved through the use of a connective portion comprising charged moieties that can interact with an oligonucleotide. For example, a non-covalent conjugation can occur between a generally negatively charged IRP and / or IRC and positively charged amino acid residues of a peptide linker, such as, for example, polylysine, polyarginine and polyhistidine residues.

The linking of the IRP and / or IRC with a lipid can be formed using standard methods. These methods include, but are not limited to, the synthesis of oligonucleotide-phospholipid conjugation products [Yanagawa et al. (1988), Nucleic Acids Symp. Ser. 19: 189-192], oligonucleotide-fatty acid conjugation products [Grabarek et al. (1990), Anal. Biochem 185: 131-135; and Staros et al. (1986), Anal. Biochem 156: 220-222], and oligonucleotide-sterol conjugate products [Boujrad et al. (1993), Proc. Natl Acad. Sci. USA 90: 5728-5731].

The oligonucleotide bonding with an oligosaccharide can be formed using known standard methods. These methods include, but are not limited to, the synthesis of oligonucleotide-oligosaccharide conjugate products, in which the oligosaccharide is a component of an immunoglobulin [O'Shannessy et al. (1985), J. Applied Biochem. 7: 347-355].

The linkage of an IRP and / or circular IRC with a peptide connector can be formed in various ways. When IRP and / or circular IRC are synthesized using recombinant or chemical methods, a modified nucleoside [Ruth (1991) in Oligonucleotides and Analogues: A Practical Approach, IRL Press] is suitable. A standard linker technology can then be used to connect the IRP and / or circular IRC to the peptide [Goodchild (1990), Bioconjug. Chem. 1: 165]. When IRP and / or circular IRC is isolated or synthesized using recombinant or chemical methods, the bond can be formed by chemically activating, or photoactivating, a reactive group (eg, a carbine radical) that has been incorporated into the peptide.

In US Pat. No. 5,391,723; Kessler (1992), "Nonradioactive labeling methods for nucleic acids" in Nonisotopic DNA Probe Techniques, Kricka (editor), Academic Press; and Geoghegan et al. (1992), Bioconjug. Chem. 3: 138-146, additional methods for fixing peptides and other molecules to oligonucleotides can be found.

An IRP and / or IRC can be associated soon in other ways. In certain cases, an IRP and / or IRC are soon associated by encapsulation. In other cases, an IRP and / or IRC are soon associated by bonding with a platform molecule. A "platform molecule" (also called a "platform") is a molecule that contains sites that allow the fixation of IRP and / or IRC. In other cases, an IRP and / or IRC are soon associated by adsorption on a surface, preferably a vehicular particle.

In certain cases, an encapsulating agent is used in association with the IRP and / or IRC in the methods described herein. Preferably, the composition comprising IRP and / or IRC and encapsulating agent is in the form of adjuvant oil emulsions in water, microparticles and / or liposomes. More preferably, the adjuvant oil emulsions in water, the microparticles and / or the liposomes in which an IRP and / or IRC are encapsulated are in the form of particles with a size of about 0.04 µm to about 100 µm, preferably a size within any of the following ranges: from about 0.1 µm to about 20 µm; from about 0.15 μm to about 10 μm; from about 0.05 μm to about 1.00 μm; from about 0.05 μm to about 0.5 μm.

Colloidal dispersion systems, such as microspheres, globules, macromolecular complexes, nanocapsules and lipid-based systems, such as oil-in-water emulsions, micelles, mixed micelles and liposomes, can provide effective encapsulation of compositions containing IRP and / or IRC

The encapsulation composition further comprises any of a wide variety of components. These include, but are not limited to, alum, lipids, phospholipids, membrane lipid structures (LMS), polyethylene glycol (PEG) and other polymers, such as polypeptides, glycopeptides and polysaccharides.

Suitable polypeptides for encapsulation components include any known in the art and include, but are not limited to, fatty acid binding proteins. The modified polypeptides contain any of a variety of modifications that include, but are not limited to, glycosylation, phosphorylation, myristylation, sulphation and hydroxylation. As used herein, a suitable polypeptide is one that will protect a composition containing IRP and / or IRC to preserve their immunoregulatory activity. Examples of binding proteins include, but are not limited to, albumin such as bovine serum albumin (BSA) and pea albumin.

Other suitable polymers may be any known in the technical field of pharmaceuticals and include, but are not limited to, naturally occurring polymers such as dextrans, hydroxyethylamidon and polysaccharides, and synthetic polymers. Examples of polymers present in nature include proteins, glycopeptides, polysaccharides, dextran and lipids. The additional polymer may be a synthetic polymer. Examples of synthetic polymers that are suitable for use include, but are not limited to, polyalkyl glycols (PAG) such as PEG, polyoxyethylated polyols (POP), such as polyoxyethylated glycerol (POG), polytrimethylene glycol (PTG), polypropylene glycol (PPG), poly (hydroxyethyl methacrylate), poly (vinyl alcohol) (PVA; English, polyvinylalcohol), poly (acrylic acid), polyethyloxazoline, polyacrylamide, polyvinylpyrrolidone (PVP), polyamino acids, polyurethane and polyphosphazene. Synthetic polymers can also be linear or branched, substituted or unsubstituted, homopolymers, copolymers, or block copolymers of two or more different synthetic monomers.

PEGs for use in encapsulation compositions of the present invention are obtained from chemical suppliers.

or are synthesized using techniques known to those who have experience in this technical field.

As used herein, the term "LMS" means laminar lipid particles in which polar head groups of a polar lipid are disposed against an aqueous phase of an interface to form membrane structures. Examples of the LMSs include liposomes, micelles, cochleates (ie, generally cylindrical liposomes), microemulsions, unilamellar vesicles, multilamellar vesicles, and the like.

An optional colloidal dispersion system is a liposome. As used herein, a "liposome" or "lipid vesicle" is a small vesicle attached by at least one, and possibly more than one, two-layer lipid membrane. Liposomes are artificially prepared from phospholipids, glycolipids, lipids, steroids such as cholesterol, related molecules, or a combination thereof, by any technique known in this technical field, including, but not limited to, sonication, extrusion, or Detergent removal of detergent lipid complexes. A liposome may also optionally comprise additional components, such as a component for tissue direction. It is understood that it is not necessary that a "lipid membrane" or "lipid bilayer" consist exclusively of lipids, but may also contain any other suitable components, including, but not limited to, cholesterol and other steroids, lipid soluble chemicals, proteins of any length and other amphipathic molecules, as long as the general structure of the membrane is a sheet of two hydrophilic surfaces that enclose a hydrophobic core. For a general discussion on membrane structure, see The Encyclopedia of Molecular Biology, by J. Kendrew (1994). For suitable lipids, see, for example, Lasic (1993), "Liposomes: from Physics to Applications", Elsevier, Amsterdam.

Methods for preparing liposomes containing IRP and / or IRC compositions are known in the art. Lipid vesicles can be prepared by any suitable technique known in this technical field. The methods include, but are not limited to, microencapsulation, microfluidization, LLC method, ethanol injection, freon injection, the "bubble" method, detergent dialysis, hydration, sonication, and reverse phase evaporation [reviewed by Watwe et al. (1995), Curr. Sci. 68: 715-724]. Techniques can be combined in order to obtain vesicles with the most desirable characteristics.

The use of LMSs containing components for targeting tissues or cells is covered. Said address components are components of an LMS that, when administered to an intact animal, organ or cell culture, enhance its accumulation in certain tissue or cell sites, preferably to other tissue or cell sites. A steering component is generally accessible from outside the liposome and, therefore, preferably, is attached to the outer surface or inserted into the external lipid bilayer. An address component may be, inter alia, a peptide, a region of a larger peptide, an antibody specific for a cell surface marker or molecule, or a fragment thereof that binds antigens, a nucleic acid, a carbohydrate, a region of a complex carbohydrate, a special lipid, or a small molecule, such as a drug, a hormone or a hapten, fixed to any of the aforementioned molecules. Antibodies with specificity to cell surface markers specific to a cell type are known in the art and are readily prepared by methods known in the art.

The LMSs can be directed to any cell type to which a therapeutic treatment will be directed, such as, for example, a cell type that can regulate an immune response and / or participate in it. Such target cells and organs include, but are not limited to, APCs, such as macrophages, dendritic cells and lymphocytes, lymphatic structures, such as lymph nodes and spleen, and non-lymphatic structures, particularly those in which dendritic cells are found.

The LMS compositions may further comprise surfactants. The surfactants can be cationic, anionic, amphipathic or non-ionic. A preferred class of surfactants are non-ionic surfactants. Particularly preferred are those that are soluble in water.

In some cases in which an IRP and / or IRC are soon associated by bonding with a platform molecule, the platform may be protein or non-protein (i.e. organic). Examples of protein platforms include, but are not limited to, albumin, gamma globulin, immunoglobulin (IgG) and ovalbumin [Borel et al. (1990), Immunol. Methods 126: 159-168; Dumas et al. (1995), Arch. Dermatol. Res. 287: 123-128; Borel et al. (1995), Int. Arch. Allergy Immunol. 107: 264-267; Borel et al. (1996), Ann. N.Y. Acad. Sci. 778: 80-87]. A platform is multivalent (that is, it contains more than one binding or binding site) to provide binding to more than 1 IRP and / or IRC. Accordingly, a platform may contain 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more binding or binding sites. Other examples of polymer platforms are dextran, polyacrylamide, Ficoll, carboxymethyl cellulose, polyvinyl alcohol, and poly (D-glutamic acid / D-lysine).

The principles of the use of platform molecules are well understood in the art. Generally, a platform contains, or is derivatized to contain, appropriate binding sites for IRP and / or IRC. In addition or alternatively, the IRP and / or IRC is derivatized to provide appropriate link groups. For example, a simple platform is a bifunctional linker (that is, it has two binding sites), such as a peptide. Further examples are discussed below.

The platform molecules can be biologically stabilized, that is, they often have a half-life of excretion in vivo from hours to days to months to confer therapeutic efficacy and are preferably composed of a single synthetic chain of defined composition. They generally have a molecular weight in the range of about 200 to about 1,000,000, molecular weight that this preferably in any of the following ranges: from about 200 to about 500,000, from about 200 to about 200,000, from about 200 to about 50,000 ( or less, such as 30,000). Examples of valence platform molecules are polymers (or are composed of polymers) such as polyethylene glycol (PEG; which preferably has a molecular weight of about 200 to about 8000), poly-Dlisine, polyvinyl alcohol, polyvinylpyrrolidone, and acid D-glutamic and D-lysine (in a ratio of 3: 2). Other molecules that can be used are albumin and IgG.

Other suitable platform molecules for use are the non-polymeric and chemically defined platform molecules described in US Pat. No. 5,552,391. Other homogeneously and chemically defined valence platform molecules, suitable for use in the present invention, are 2,2'-ethylenedioxydiethylamine (EDDA) and derivatized triethylene glycol (TEG).

Additional suitable valence platform molecules include, but are not limited to, tetraaminobenzene, heptaaminobetacyclodextrin, tetraaminopentaerythritol, 1,4,8,11-tetraazacyclotetradecane (Cyclam) and 1,4,7,10-tetraazacyclododecane (Cyclen).

In general, these platforms are prepared using standard chemical synthesis techniques. The PEG must be derivatized and made multivalent, which is carried out using standard techniques. Some substances suitable for the synthesis of conjugation products, such as PEG, albumin and IgG, are commercially available.

The conjugation of an IRP and / or IRC with a platform molecule can be carried out in various ways, one or more crosslinking agents and functional groups of the IRP and / or IRC and the platform molecule being typically involved. Platforms and IRPs and / or IRCs must have appropriate linking groups. Linker groups are added to the platforms using standard synthetic chemistry techniques. Linker groups can be added to polypeptide platforms and IRP and / or IRC using standard solid phase synthetic techniques or standard recombinant techniques. Recombinant approaches may require post-translational modification in order to fix a connector, and such methods are known in the art.

As an example, the polypeptides contain amino acid side chain components that contain functional groups, such as amino, carboxyl and sulfhydryl groups, which serve as sites for coupling the polypeptide with the platform. Residues having said functional groups can be added to the polypeptide if the polypeptide does not already contain those groups. Such moieties can be incorporated by solid phase synthesis techniques or recombinant techniques, both of which are well known in the technical fields of peptide synthesis. When the polypeptide has a carbohydrate side chain (s) (or if the platform is a carbohydrate), functional amino, sulfhydryl and / or aldehyde groups can be incorporated herein by conventional chemistry. For example, primary amino groups can be incorporated by reacting ethylenediamine with oxidized sugar in the presence of sodium cyanoborohydride and sulfhydryls can be introduced by reaction of cysteamine dihydrochloride followed by reduction with a standard disulfide reducing agent, while groups can be generated aldehyde after oxidation with periodate. Similarly, the platform molecule can also be derivatized to contain functional groups if it does not already have appropriate functional groups.

Hydrophilic connectors of varying lengths are useful for connecting IRP and / or IRC to platform molecules. Suitable connectors include ethylene glycol linear oligomers or polymers. Such connectors include connectors with the formula R1S (CH2CH2O) nCH2CH2O (CH2) mCO2R2 in which n = 0-200, m = 1 or 2, R1 = H or a protecting group such as trityl, R2 = H or alkyl or aryl, by example, 4-nitrophenyl ester. These connectors are useful for connecting a molecule containing a thiol reactive group, such as haloacetyl, maleimide, etc., through a thioether, with a second molecule containing an amino group through an amide bond. These connectors are flexible in the order of fixation, that is, the thioether can be formed first or last.

In cases in which an IRP and / or IRC are soon associated by adsorption by a surface, the surface may be in the form of a vehicular particle (for example, a nanoparticle) made of an inorganic or organic core. Examples of such nanoparticles include, but are not limited to, nanocrystalline particles, nanoparticles prepared by polymerization of alkyl cyanoacrylates, and nanoparticles prepared by polymerization of methyliedenmalonate. Additional surfaces that can adsorb an IRP and / or IRC include, but are not limited to, activated carbon particles and protein-ceramic nanoplates. Here are other examples of vehicular particles.

The adsorption of polynucleotides and polypeptides on a surface for the purpose of distribution of adsorbed molecules to cells is well known in the art. See, for example, Douglas et al. (1987), Crit. Rev. Ther. Drug Carrier Syst. 2: 233-261; Hagiwara et al. (1987), In Vivo 1: 241-252; Bousquet et al. (1999), Pharm. Res. 16: 141147; and Kossovsky et al., U.S. Pat. No. 5,460,831. Preferably, the material comprising the adsorbent surface is biodegradable. The adsorption of an IRP and / or IRC by a surface can take place through non-covalent interactions, including ionic and / or hydrophobic interactions.

In general, the characteristics of vehicles such as nanoparticles, such as surface charge, particle size and molecular weight, depend on the polymerization conditions, the concentration of monomers and the presence of stabilizers during the polymerization process (Douglas et al. ., 1987). The surface of the vehicular particles can be modified, for example, with a surface coating, to allow or enhance the adsorption of the IRP and / or IRC. Vehicle particles with IRP and / or adsorbed IRC can also be coated with other substances. The addition of said other substances may, for example, prolong the half-life of the particles once administered to the subject and / or direct the particles to a specific tissue or cell type, as described herein.

Nanocrystalline surfaces that can adsorb an IRP and / or IRC have been described (see, for example, US Patent No. 5,460,831). Nanocrystalline core particles (with diameters of 1 μm or less) are coated with a surface energy modifying layer that activates the adsorption of polypeptides, polynucleotides and / or other pharmaceutical agents. Another adsorbent surface is the nanoparticles prepared by the polymerization of alkyl cyanoacrylates. They can be made to polymerize alkyl cyanoacrylates in acidified aqueous media, by an anionic polymerization process. Depending on the polymerization conditions, small particles tend to have sizes in the range of 20 to 3000 nm, and it is possible to prepare nanoparticles with specific surface characteristics and with specific surface charges (Douglas et al., 1987). For example, nanoparticles of poly (isobutyl cyanoacrylate) and poly (isohexyl cyanoacrylate) can adsorb oligonucleotides in the presence of hydrophobic cations such as tetraphenylphosphonium chloride or quaternary ammonium salts such as cetyltrimethylammonium bromide. It appears that the adsorption of oligonucleotides by these nanoparticles is mediated by the formation of ionic pairs between negatively charged phosphate groups of the nucleic acid chain and hydrophobic cations. See, for example, Lambert et al. (1998), Biochimie 80: 969-976; Chavany et al. (1994), Pharm. Res. 11: 1370-1378; and Chavany et al. (1992), Pharm. Res. 9: 441-449. Another adsorbent surface is the nanoparticles prepared by the polymerization of methylidenemalonate.

IRPs and / or IRCs can be administered in the form of microcarrier complexes (MC; microcarrier). Accordingly, compositions comprising IRP / MC or IRC / MC complexes are described. The IRP / MC complexes comprise an IRP attached to the surface of a microcarrier (ie, the IRP is not encapsulated in the MC) and preferably comprise multiple IRP molecules attached to each microcarrier. In certain cases, a mixture of different IRPs can be complexed with a microcarrier, so that the microcarrier is attached to more than one species of IRP. The link between the IRP and the MC can be covalent or non-covalent. As one who has experience in the art will understand, the IRP can be modified or derivatized and the composition of the microcarrier can be selected and / or modified, to adjust them to the type of junction desired for the formation of the IRP / MC complex. This same description applies to IRC / MC complexes. In certain cases, a mixture of IRCs and IRPs can be complexed with a microcarrier so that the microcarrier is attached to at least one species of IRC and IRP.

The microcarriers useful in this case have a size less than about 150, 120 or 100 µm, more commonly a size less than about 50-60 µm, preferably a size less than about 10 µm, and are insoluble in pure water. The microcarriers used are preferably biodegradable, although non-biodegradable microcarriers are acceptable. Microcarriers are usually in solid phase, such as "globules" or other particles, although microcarriers in liquid phase such as oil-in-water emulsions comprising biodegradable oils or polymers are also contemplated. A wide variety of biodegradable and non-biodegradable materials, acceptable for use as microcarriers, are known in the art.

The microcarriers for use in the compositions or methods described herein have a size generally less than about 10 µm (for example, they have an average diameter of less than about 10 µm, or at least about 97% of the particles pass through a 10-filter screen μm) and include nano vehicles (i.e. vehicles with a size less than about 1 μm). Preferably, microcarriers having sizes in a range with an upper limit of approximately 9, 7, 5, 2 or 1 µm or 900, 800, 700, 600, 500, 400, 300, 250, 200 or 100 nm are selected, and an independently selected lower limit of approximately 4, 2 or 1 μm or approximately 800, 600, 500, 400, 300, 250, 200, 150, 100, 50, 25 or 10 nm, the lower limit being smaller than the limit higher. In some cases, the microcarriers have a size of approximately 1.0-1.5 μm, approximately 1.0-2.0 μm or approximately 0.9-1.6 μm. In certain preferred cases, the microcarriers have a size of about 10 nm to about 5 µm or about 25 nm to about 4.5 µm, about 1 µm, about 1.2 µm, about 1.4 µm, about 1.5 μm, approximately 1.6 μm, approximately 1.8 μm, approximately 2.0 μm, approximately 2.5 μm or approximately 4.5 μm. When the microcarriers are nanocarriers, preferred cases include nanocarriers of about 25 to about 300 nm, 50 to about 200 nm, about 50 nm or about 200 nm.

Solid phase biodegradable microcarriers can be manufactured from biodegradable polymers that include, but are not limited to: biodegradable polyesters, such as poly (lactic acid), poly (glycolic acid), and copolymers (including block copolymers) thereof. , as well as block copolymers of poly (lactic acid) and polyethylene glycol; polyorthoesters such as polymers based on 3,9-diethylidene-2,4,8,10-tetraoxaespiro [5.5] undecano (DE-TOSU); polyanhydrides such as polyanhydride polymers based on relatively hydrophilic monomers such as sebacic acid; poly (anhydride-imides), such as polyanhydride polymers based on sebacic acid-derived monomers that incorporate amino acids (i.e., linked to sebacic acid by imide bonds through amino-terminal nitrogen) such as glycine and alanine; poly (anhydride esters); polyphosphazenes, especially polyphosphazenes containing hydrolysis sensitive ester groups that can catalyze the degradation of the polymer backbone by generating carboxylic acid groups [Schacht et al. (1996), Biotechnol. Bioeng 1996: 102]; and polyamides such as poly (lactic acid-co-lysine).

A wide variety of non-biodegradable materials suitable for manufacturing microcarriers are also known, including, but not limited to, polystyrene, polypropylene, polyethylene, silica, ceramic products, polyacrylamide, dextran, hydroxyapatite, latex, gold and ferromagnetic or paramagnetic materials. In certain cases, gold, latex and / or magnetic globules are excluded. In certain cases, the microcarriers may be made of a first material (for example, a magnetic material) encapsulated with a second material (for example, polystyrene).

Solid phase microspheres are prepared using techniques known in this technical field. For example, they can be prepared by an emulsion-extraction / evaporation technique of the solvent. Generally, in this technique, biodegradable polymers such as polyanhydrates, alkyl poly (a-cyanoacrylates) and poly (a-hydroxy esters) are dissolved, for example, poly (lactic acid), poly (glycolic acid), poly (D acid, L-lactic-co-glycolic) and polycaprolactone, in a suitable organic solvent, such as methylene chloride, to constitute the dispersed phase (DP) of the emulsion. The DP is emulsified by high speed homogenization in an aqueous continuous phase (CP) volume containing an aqueous continuous surfactant containing a dissolved surfactant, such as, for example, polyvinyl alcohol (PVA) or polyvinylpyrrolidone (PVP). The surfactant of the CP is to ensure the formation of discrete and suitable sized emulsion droplets. The organic solvent is then extracted to the CP and is subsequently evaporated raising the temperature of the system. The solid microparticles are then separated by centrifugation or filtration and dried, for example, by lyophilization or vacuum application, before storage at 4 ° C.

Physicochemical characteristics such as average size, size distribution and surface charge of dried microspheres can be determined. The size characteristics are determined, for example, by the dynamic light scattering technique, and the surface charge is determined by measuring the zeta potential.

Liquid phase microcarriers include liposomes, micelles, oil droplets and other lipid-based particles

or oil that incorporates polymers or biodegradable oils. In certain cases, the biodegradable polymer is a surfactant. In other cases, the liquid phase microcarriers are biodegradable due to the inclusion of a biodegradable oil such as squalene or a vegetable oil. A preferred liquid phase microcarrier is the oil droplets in an oil-in-water emulsion. Preferably, oil-in-water emulsions used as microcarriers comprise biodegradable substituents such as squalene.

Covalently linked IRP / MC complexes can be linked using any covalent cross-linking technology known in this technical field. Typically, the IRP portion will be modified to incorporate an additional component (for example, a free amine, carboxyl or sulfhydryl group) or to incorporate modified nucleotide bases (for example, phosphorothioate) in order to provide a site through which it can be attached the portion of IRP to the microcarrier. Binding between the IRP and MC portions of the complex can be performed at the 3 'or 5' end of the IRP, or on a suitably modified base of an internal IRP position. In general, the microcarrier is also modified to incorporate components through which a covalent bond can be formed, although the functional groups normally present in the microcarrier can also be used. The IRP / MC is formed by incubating the IRP with a microcarrier under conditions that allow the formation of a covalent complex (for example, in the presence of a cross-linking agent or by using an activated microcarrier comprising an activated component that will form an covalent bond with the IRP).

A wide variety of cross-linking technologies are known in this technical field, including cross-linking agents reactive with amino, carboxyl and sulfhydryl groups. As will be apparent to those skilled in the art, the selection of a crosslinking agent and a crosslinking protocol will depend on the configuration of the IRP and the microcarrier as well as the desired final configuration of the IRP / MC complex. The crosslinking agent can be homobifunctional or heterobifunctional. When a homobifunctional crosslinking agent is used, the crosslinking agent exploits the same component of the IRP and the MC (for example, an aldehyde crosslinking agent can be used to covalently bond an IRP and an MC each of which comprises one or more free amines ). Heterobifunctional crosslinking agents use different components of IRP and MC (for example, a maleimido-N-hydroxysuccinimide ester can be used to covalently bind an IRP free sulfhydryl and a MC free amine), and are preferred to minimize formation of inter-microvehicular links. In most cases, it is preferable to cross-link by means of a first cross-linking component of the microcarrier and a second cross-linking component of the IRP, in which the second cross-linking component is not present in the microcarrier. A preferred method of producing the IRP / MC complex is by "activating" the microcarrier by incubation with a heterobifunctional crosslinking agent, and then forming the IRP / MC complex by incubating the activated MC and the IRP under appropriate conditions for the reaction. The crosslinking agent may have a "spacer" arm incorporated between the reactive components, or the two reactive components of the crosslinking agent may be directly attached.

In a preferred case, the IRP portion comprises at least one free sulfhydryl (for example, provided by a connector or a base modified with 5'-thiol) for cross-linking with the microcarrier, while the microcarrier comprises free amine groups. A heterobifunctional crosslinking agent reactive with these two groups is used (for example, a crosslinking agent comprising a maleimide group and an NHS-ester), such as succinimidyl 4- (Nmaleimidomethyl) cyclohexane-1-carboxylate, to activate the MC and then cross this one covalently with the IRP to form the IRP / MC complex.

Non-covalent IRP / MC complexes can be linked by any non-covalent bond or interaction, including ionic (electrostatic) bonds, hydrophobic interactions, hydrogen bonds, van der Waals attractions, or a combination of two or more different interactions, such as This is normally the case when a binding pair is to link the IRP and the MC.

Preferred non-covalent IRP / MC complexes are typically complexed by hydrophobic or electrostatic (ionic) interactions or a combination thereof (e.g., through base pairing between an IRP and a polynucleotide attached to an MC by the use of a binding pair). Due to the hydrophilic nature of the polynucleotide backbone chain, IRP / MC complexes that depend on hydrophobic interactions for the complex to form generally require modification of the IRP portion of the complex to incorporate a very hydrophobic component. Preferably, the hydrophobic component is biocompatible and non-immunogenic and is naturally present in the individual to whom the composition is intended (for example, it is found in mammals, particularly in humans). Examples of preferred hydrophobic components include lipids, steroids, sterols such as cholesterol, and terpenes. Of course, the method of attaching the hydrophobic component to the IRP will depend on the configuration of the IRP and the identity of the hydrophobic component. The hydrophobic component can be added at any convenient IRP site, preferably at the 5 'or 3' end; in the case of the addition of a cholesterol component to an IRP, the cholesterol component is preferably added to the 5 'end of the IRP using conventional chemical reactions [see, for example, Godard et al. (1995), Eur. J. Biochem. 232: 404-410]. Preferably, microcarriers for use in IRP / MC complexes linked by hydrophobic bonds are prepared from hydrophobic materials, such as oil droplets or hydrophobic polymers, although modified hydrophilic materials can also be used to incorporate hydrophobic components. When the microcarrier is a liposome or other liquid phase microcarrier comprising a cavity, and it is desired that the IRP be associated with the outer surface of the MC, the IRP / MC complex is formed by mixing the IRP and the MC after preparation. of the MC in order to avoid the encapsulation of the IRP during the MC preparation process.

Non-covalent IRP / MC complexes linked by electrostatic bonds typically exploit the very negative charge of the polynucleotide backbone. Consequently, microcarriers for use in non-covalently bound IRP / MC complexes are generally positively charged (cationic) at the physiological pH (for example, a pH of about 6.8-7.4). The microcarrier may intrinsically have a positive charge, but microcarriers made of compounds that do not normally have a positive charge can be derivatized or, if not, modified to be positively charged (cationic). For example, the polymer used to prepare the microcarrier can be derivatized to add positively charged groups, such as primary amines. Alternatively, positively charged compounds can be incorporated into the microcarrier formulation during manufacturing [for example, positively charged surfactants can be used during the manufacture of poly (lactic acid) poly (glycolic acid) copolymers to confer a positive charge on the resulting microcarrier particles].

For example, to prepare cationic microspheres, cationic lipids or polymers, for example, 1,2-dioleyl-1,2,3-trimethylammoniopropane (DOTAP), cetyltrimethylammonium bromide (CTAB) or polylysine is added to the DP or CP , according to its solubility in these phases.

IRP / MC complexes can be preformed by adsorption by cationic microspheres by incubating the polynucleotide and particles, preferably in an aqueous mixture. Such incubation may be carried out under any desired conditions, including ambient temperature (for example, approximately 20 ° C) or under refrigeration (for example, 4 ° C). Since cationic microspheres and polynucleotides associate relatively quickly, incubation can be for any convenient period of time, such as 5, 10, 15 or more minutes, including overnight and longer incubations. For example, IRPs can be caused to be adsorbed by cationic microspheres by a nightly aqueous incubation of the polynucleotide and particles at 4 ° C. However, since cationic microspheres and polynucleotides spontaneously associate, the IRP / MC complex can be formed by simple co-administration of the polynucleotide and the MC. The microspheres can be characterized in terms of size and surface charge before and after the association of the polynucleotide. The activity of selected batches can then be evaluated against suitable controls in, for example, assays with human peripheral blood mononuclear cells (PBMC) and mouse splenocytes. The formulations can also be evaluated in suitable animal models.

Non-covalent complexes of bound IRP / MC can be produced by pairing nucleotide bases, using conventional methodologies. In general, base-coupled IRP / MC complexes are produced using a microcarrier comprising a bound polynucleotide (the "capture polynucleotide"), preferably covalently linked, which is at least partially complementary to the IRP. The segment of complementarity between the IRP and the capture nucleotide is preferably at least 6, 8, 10 or 15 pairs of contiguous bases, more preferably at least 20 pairs of contiguous bases. The capture nucleotide can be attached to the MC by any method known in the art, and is preferably covalently linked to the IRP at the 5 'or 3' end. In some cases, an IRP comprising a 5'-GGGG-3 'sequence will retain this portion of the sequence in the form of a single chain.

In other cases, a binding pair can be used to join the IRP and the MC in an IRP / MC complex. The binding pair can be a receptor and a ligand, an antibody and an antigen (or epitope), or any other binding pair that binds with high affinity (eg, Kd less than about 10-8). A preferred type of binding pair is that of biotin and streptavidin or biotin and avidin, which form very strong complexes. When a binding pair is used to mediate the binding of the IRP / MC complex, the IRP is derivatized, typically by a covalent bond, with a member of the binding pair, and the MC is derivatized with the other member of the binding pair. The mixing of the two derivatized compounds results in the formation of the IRP / MC complex.

Methods

Methods for regulating an immune response in an individual, preferably a mammal, more preferably a human being, comprising administering to the individual a polynucleotide such as the one described herein containing IRS are described herein. Immunoregulation methods include those that allow suppressing and / or inhibiting an innate immune response, including, but not limited to, an immune response stimulated by immunostimulating nucleic acid molecules such as bacterial DNA. Methods for inhibiting a cellular response induced by TLR7 / 8 and / or TLR9 are also described. Methods for improving symptoms associated with an unwanted immune activation, including, but not limited to, symptoms associated with autoimmunity are also described herein.

The polynucleotide containing IRS is administered in an amount sufficient to regulate an immune response. As described herein, the regulation of an immune response can be humoral and / or cellular, and is measured using standard techniques in this technical field and as described herein.

In certain cases, the individual suffers from a disorder associated with an unwanted immune activation, such as an allergic disease or condition, allergy and asthma. An individual who has an allergic disease or asthma is an individual with a recognizable symptom of an existing allergic disease or asthma.

In certain cases, the individual suffers from a disorder associated with an unwanted immune activation, such as an autoimmune disease or an inflammatory disease. An individual who has an autoimmune disease or an inflammatory disease is an individual with a recognizable symptom of an existing autoimmune disease or inflammatory disease.

Autoimmune diseases can be divided into two broad categories: organ-specific and systemic. Autoimmune diseases include, without limitation, rheumatoid arthritis (RA; rheumatoid arthritis), systemic lupus erythematosus (SLE), type I diabetes mellitus, type II diabetes mellitus, multiple sclerosis (MS; multiple sclerosis) , immune system-mediated infertility, such as premature ovarian failure, scleroderma, Sjogren's disease, vitiligo, alopecia (baldness), polyglandular insufficiency, Graves' disease, hypothyroidism, polymyositis, vulgar pemphigus, foliaceous pemphigus, inflammatory bowel disease, including disease Crohn's disease and ulcerative colitis, autoimmune hepatitis including that associated with hepatitis B virus (HBV) and hepatitis C virus (HCV; English, hepatitis C virus), hypopituitarism, disease of graft versus host (GvHD; English, graft-versus-host disease), myocarditis, Addison's disease, autoimmune skin diseases, uvei Tis, pernicious anemia and hypoparathyroidism.

Autoimmune diseases may also include, without limitation, Hashimoto's thyroiditis, autoimmune polyglandular syndromes of type I and type II, paraneoplastic pemphigus, bullous pemphigoid, herpetiformis dermatitis, linear IgA disease, acquired bullous epidermolysis, erythema nodos, gestational penis , mixed essential cryoglobulinemia, chronic childhood bullous disease, hemolytic anemia, thrombocytopenic purpura, Goodpasture syndrome, autoimmune neutropenia, myasthenia gravis, Eaton-Lambert myasthenic syndrome, acute disseminated encephalomyelitis, Guillain-Barre syndrome , chronic inflammatory demyelinating polyradiculoneuropathy, multifocal motor neuropathy with conduction block, chronic neuropathy with monoclonal gammopathy, opsoclonus-myoclonus syndrome, cerebellar degeneration, encephalomyelitis, retinopathy, primary biliary sclerosis, sclerotic cholangitis Bone, gluten-sensitive enteropathy, ankylosing spondylitis, reactive arthritis, polymyositis / dermatomyositis, mixed connective tissue disease, Bechet syndrome, psoriasis, polyarteritis nodosa, angeitis and allergic granulomatosis (Churg-Strauss disease), polyangiitis overlap syndrome , hypersensitivity vasculitis, Wegener's granulomatosis, temporal arteritis, Takayasu arteritis, Kawasaki disease, isolated vasculitis of the central nervous system, thromboangiitis obliterans, sarcoidosis, glomerulonephritis and cryopathies. These states are well known in medical settings and are described in, for example, Harrison's Principles of Internal Medicine, 14th edition, written by A. S. Fauci et al., New York: McGraw-Hill, 1998.

Systemic SLE disease is characterized by the presence of antibodies to antigens that are abundant in almost all cells, such as anti-chromatin antibodies, anti-splenicosome antibodies, anti -ibosome antibodies and anti-DNA antibodies. Consequently, the effects of SLE are seen in a variety of tissues, such as the skin and kidneys. Self-reactive T cells also play a role in the SLE. For example, studies in a murine model of lupus have shown that non-DNA nucleosomal antigens, for example, histones, stimulate autoreactive T cells that can propel anti-DNA-producing B cells. Increased serum levels of IFN-a have been observed in patients with SLE and have been shown to correlate with both the activity and the severity of the disease, including fever and rashes, as well as essential markers associated with the morbid process (due to example, anti-dsDNA antibody titers). It has also been shown that immune complexes present in the circulation could trigger IFN-a in these patients and, thus, maintain this chronic presence of elevated levels of IFN-a. It has been described that two different types of immune complexes trigger IFN-a from human PDCs: DNA complexes / anti-DNA antibodies and RNA complexes / anti-ribonucleoprotein-RNA antibodies. Since DNA is a TLR-9 ligand and RNA is a TLR-7/8 ligand, TLR-9 and TLR-7/8 signaling are expected to be used in these two ways, respectively, in order of chronically inducing IFN-a and, thus, participating in the etiopathogenesis of SLE. Consequently, IRP and / or IRC compositions that are effective in inhibiting responses of TLR-7/8 and TLR-9 may be particularly effective in the treatment of SLE.

In certain cases, a patient is at risk of developing an autoimmune disease and is given an IRP or IRC in an amount effective to delay or prevent autoimmune disease. Individuals who are at risk of developing an autoimmune disease include, for example, those with a genetic predisposition or other predisposition to the development of an autoimmune disease. In humans, susceptibility to particular autoimmune diseases is associated with one type of HLA, some being more strongly linked to particular alleles of MHC class II and others to particular alleles of MHC class I. For example, ankylosing spondylitis, Acute anterior uveitis and juvenile rheumatoid arthritis are associated with HLA-B27, Goodpasture syndrome and MS are associated with HLA-DR2, Graves disease, myasthenia gravis and SLE are associated with HLA-DR3, rheumatoid arthritis and pemphigus vulgaris are associated with HLA-DR4, and Hashimoto's thyroiditis is associated with HLA-DR5. Other genetic predispositions to autoimmune diseases are known in the art, and an individual can be examined for the existence of such predispositions by assays and methods well known in the art. Consequently, in some cases, an individual who is at risk of developing an autoimmune disease can be identified.

As described herein, IRPs can particularly inhibit the production of a cytokine, including, but not limited to, IL-6, IL-12, TNF-a and / or IFN-a, and can suppress B-cell proliferation and / or the activation of plasmocytoid dendritic cells to differentiate. Consequently, IRPs and IRCs are particularly effective in suppressing an immune response to an immunostimulatory nucleic acid in an individual.

Animal models are known in the art for the study of autoimmune diseases. For example, animal models that seem very similar to a human autoimmune disease include animal breeds that spontaneously develop the particular disease with high incidence. Examples of such models include, but are not limited to, the non-obese diabetic mouse (NOD), which develops a disease similar to type 1 diabetes, and animals susceptible to a type disease lupus, such as the New Zealand hybrid, MRL-Faslpr and BXSB mice. Animal models in which an autoimmune disease has been induced include, but is not limited to, experimental autoimmune encephalomyelitis (EAE), which is a model for multiple sclerosis, collagen-induced arthritis (CIA), collagen-induced arthritis), which is a model for rheumatoid arthritis, and experimental autoimmune uveitis (UAE), which is a model for uveitis. Animal models have also been created for autoimmune diseases by genetic manipulation, which include, for example, inactivated mice ("knockout") for IL-2 / IL-10 for inflammatory bowel disease, inactivated for Fas or ligands of Fas for SLE, and inactivated in terms of IL-1 receptor antagonists for rheumatoid arthritis.

Consequently, standard animal models are available in the art for the exploration and / or evaluation of the activity and / or efficacy of the methods and compositions for the treatment of autoimmune disorders.

In certain cases, the individual suffers from a disorder associated with a chronic inflammatory response. The administration of an IRP results in immunomodulation, lowering the levels of one or more cytokines associated with an innate immune response, which may result in a reduction of the inflammatory response. Immunoregulation of individuals with the unwanted immune response associated with the disorders described results in a reduction or improvement of one or more of the symptoms of the disorder.

Other cases refer to an immunoregulatory therapy for individuals who have been exposed to a virus or have been infected by it. The administration of an IRP or IRC to an individual who has been exposed to a virus or has been infected by it results in a suppression of cytokine production induced by the virus. Cytokine produced in response to a virus can contribute to a favorable environment for viral infection. The suppression of cytokine production induced by a virus can serve to limit or prevent viral infection.

In certain cases, the individual suffers from a disease or disorder associated with chronic pathogen stimulation, such as that associated with chronic viral infections and malaria. Compositions of IRP and / or IRC that are effective in inhibiting TLR-7/8 responses may be particularly effective in the treatment of diseases and symptoms related to chronic pathogen stimulation.

The methods can be implemented in combination with other therapies that complete the standard of assistance for the disorder, such as the administration of anti-inflammatory agents such as those of a systemic corticosteroid therapy (eg, cortisone).

In certain situations, peripheral tolerance to an autoantigen is lost (or broken) and an autoimmune response originates. For example, in an animal model for EAE, the activation of antigen presenting cells (APCs) was shown through the innate immune receptor TLR9 or TLR4 to break self-tolerance and lead to induction of EAE [Waldner et al. (2004), J. Clin. Invest. 113: 990-997].

Consequently, methods for suppressing or reducing a TLR9-dependent cell stimulation are also described. The administration of an IRP results in the suppression of cellular responses dependent on TLR9, including decreased levels of one or more cytokines associated with TLR9. Appropriate IRPs for use in suppressing TLR9-dependent cell stimulation are those IRPs that inhibit or suppress cellular responses associated with TLR9.

Methods to suppress or reduce a TLR7 / 8-dependent cell stimulation are also described. The administration of an IRP results in the suppression of cellular responses dependent on TLR7 / 8, including decreased levels of one or more cytokines associated with TLR7 / 8. Appropriate IRPs for use in suppressing TLR7 / 8-dependent cell stimulation are those IRPs that inhibit or suppress cellular responses associated with TLR7 / 8.

As demonstrated here, some IRPs suppress both TLR9-dependent cellular responses and TLR7 / 8-dependent cellular responses. Some IRPs suppress TLR9-dependent cellular responses but not TLR7 / 8-dependent cellular responses. Some IRPs suppress TLR7 / 8-dependent cellular responses but not TLR9-dependent cellular responses. Consequently, a particular IRP can be administered to regulate particular immune responses.

Administration and evaluation of the immune response

IRP or IRC can be administered in combination with other pharmaceutical agents, as described herein, and can be combined with a physiologically acceptable carrier thereof (and, as such, these compositions are described). The IRP or IRC can be any of those described here.

As with all compositions for the modulation of an immune response, the effective amounts and the method of administration of the particular IRP or IRC formulation may vary depending on the individual, the condition to be treated and other factors evident to those skilled in the art. The technique. The factors to be considered include whether or not the IRP or IRC will be administered with, or will be covalently or not fixed to, a distribution molecule, the route of administration and the number of doses to be administered. Said factors are known in the art and, within the experience of the technicians, it is to perform said determinations without excessive experimentation. A suitable dosage range is one that provides the desired regulation of the immune response (for example, suppression of the production of IFN-a or other cytokine in response to an immunostimulatory nucleic acid). When suppression of an immune response to an immunostimulatory nucleic acid is desired, a suitable dosage range is one that provides the desired suppression of immune stimulation by the immunostimulatory nucleic acid. In general, the dosage is determined by the amount of IRP administered to the patient rather than by the overall amount of administered composition containing IRP. The useful dosage ranges of IRP, given in amounts of IRP supplied, can be, for example, any of the following: from 0.5 to 10 mg / kg, from 1 to 9 mg / kg, from 2 to 8 mg / kg, 3 to 7 mg / kg, 4 to 6 mg / kg, 5 mg / kg, 1 to 10 mg / kg, 5 to 10 mg / kg. The absolute amount provided to each patient depends on pharmacological properties such as bioavailability, clearance rate and route of administration.

The effective amount and method of administration of the particular IRP or IRC formulation may vary depending on the individual patient, the desired outcome and / or the type of disorder, the stage of the disease and other factors evident to those skilled in the art. The route (s) of administration useful (s) in a particular application is evident to those who have experience in the art. The routes of administration include, but are not limited to, topical, dermal, transdermal, transmucosal, epidermal, parenteral, gastrointestinal, and nasopharyngeal and pulmonary, including transbronchial and transalveolar. A suitable dosage range is one that provides sufficient composition containing IRP to reach a tissue concentration of approximately 1-50 μM, as measured by blood levels. The absolute amount provided to each patient depends on pharmacological properties such as bioavailability, clearance rate and route of administration.

As described herein, the tissues in which an unwanted immune activation occurs, or is likely to occur, are preferred targets for IRP or IRC. Thus, administration of IRP or IRC to lymph nodes, spleen, bone marrow, blood and also tissues exposed to a virus, are preferred sites of administration.

IRP or IRC formulations suitable for topical application are described, including, but not limited to, physiologically acceptable implants, ointments, creams, lotions and gels. Exemplary dermal routes of administration are those that are less invasive, such as transdermal transmission, epidermal administration and subcutaneous injection.

Transdermal administration is carried out by applying a cream, lotion, gel, etc. capable of allowing the IRP or IRC to penetrate the skin and enter the bloodstream. Compositions suitable for transdermal administration include, but are not limited to, pharmaceutically acceptable suspensions, oils, creams and ointments, applied directly to the skin or incorporated into a protective vehicle such as a transdermal device (called a "patch"). In, for example, "The Physician's Desk Reference" you can find examples of creams, ointments, etc. adequate. Transdermal transmission can also be carried out by iontophoresis using, for example, commercially available patches that continuously distribute your product through intact skin for periods of several days or more. The use of this method allows the controlled transmission of pharmaceutical compositions in relatively large concentrations, allows the injection of drugs in combination and allows the simultaneous use of an absorption promoter.

Parenteral routes of administration include, but are not limited to, electric (iontophoresis) or direct injection, such as direct injection into a central venous line, and intravenous, intramuscular, intraperitoneal, intradermal and subcutaneous injections. IRP or IRC formulations suitable for parenteral administration are generally formulated in USP water or water for injection and may further comprise pH buffers, volume saline agents, preservatives and other pharmaceutically acceptable excipients. The immunoregulatory polynucleotide for parenteral injection can be formulated in pharmaceutically acceptable sterile isotonic solutions, such as saline and phosphate buffered saline for injection.

Gastrointestinal routes of administration include, but are not limited to, ingestion and rectal routes, and may include the use of, for example, pharmaceutically acceptable powders, pills or liquids for ingestion and suppositories for rectal administration.

Nasopharyngeal and pulmonary administrations are carried out by inhalation and include distribution routes such as intranasal, transbronchial and transalveolar. IRP or IRC formulations suitable for administration by inhalation are described which include, but are not limited to, liquid suspensions to form aerosols as well as powder forms for dry powder inhalation distribution systems. Suitable devices for administration of IRP or IRC formulations by inhalation include, but are not limited to, atomizers, vaporizers, nebulizers and dry powder inhalation distribution devices.

As is well known in the art, the solutions or suspensions used for the routes of administration described herein may include any or more of the following components: a sterile diluting agent such as water for injection, saline solution, nonvolatile oils, polyethylene glycols, glycerol , propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol and methyl parabens; antioxidants such as ascorbic acid and sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates and phosphates; and agents for the adjustment of tonicity such as sodium chloride and dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid and sodium hydroxide. Parenteral preparation can be enclosed in ampoules, disposable syringes or multi-dose vials made of glass or plastic.

As is well known in the art, pharmaceutical compositions suitable for injectable use include sterile aqueous dispersions or solutions (when water soluble) and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable vehicles include physiological saline solution, bacteriostatic water, Cremophor EL ™ (BASF, Parsippany, New Jersey, USA) and phosphate buffered saline solution (PBS; phosphate buffered saline). In all cases, the composition should be sterile and should be fluid to the extent that there is simple use with a syringe. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof. Appropriate fluidity can be maintained by, for example, the use of a coating such as lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be carried out by various antibacterial and antifungal agents, such as, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. It may be preferable to include isotonic agents, such as, for example, sugars, polyalcohols such as mannitol, sorbitol and sodium chloride, in the composition. Prolonged absorption of the injectable compositions can be achieved by including in the composition an agent that delays absorption, such as, for example, aluminum monostearate or gelatin.

As is well known in the art, sterile injectable solutions can be prepared by incorporating the active compound (s) in the required amount in an appropriate solvent with one, or a combination, of the ingredients listed above, according to required, followed by sterilization by filtration. In general, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other required ingredients from among those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation methods are vacuum drying and lyophilization, which produces a powder of the active ingredient plus any additional desired ingredient from a previously sterilized solution thereof. by filtration

The above-mentioned compositions and methods of administration are intended to describe, but not limit, the methods for administering the formulations of IRPs and IRCs. The methods for producing the different compositions and devices are within the skill of one skilled in the art and are not described herein in detail.

The analysis (both qualitative and quantitative) of the activity of an IRP or IRC regarding the suppression of an immune stimulation can be by any method described herein or known in the art, including, but not limited to, the measurement of a suppression or decreased proliferation of specific cell populations such as B cells, measurement of a suppression of maturation of specific cell populations such as dendritic cells (including dendritic plasma cells) and T cells, and measurement of suppression of the production of cytokines such as, but not limited to, IFN-a, TNF-a, IL-6 and / or IL-12. The measurement of various specific cell types can be carried out, for example, by fluorescence-activated cell separation (FACS). The measurement of the maturation of particular populations of cells can be carried out by determining the expression of markers, for example, cell surface markers, specific to a particular phase of cell maturation. The expression of cell markers can be measured, for example, by measuring the expression of RNA or by measuring the expression of the particular marker on the cell surface by, for example, FACS analysis. The measurement of dendritic cell maturation can be carried out, for example, in the manner described by Hartmann et al. (1999), Proc. Natl Acad. Sci. USA 96: 9305-9310. Cytokine concentrations can be measured, for example, by ELISA. These and other assays to evaluate the suppression of an immune response, including an innate immune response, are well known in the art.

Kits

Kits are described here. In certain cases, the kits generally comprise one or more containers comprising any IRP and / or IRC as described herein. The kits may further comprise a suitable set of instructions, generally written instructions, relating to the use of IRP and / or IRC for any of the methods described herein (for example, the suppression of a response to an immunostimulatory nucleic acid, the suppression of a response dependent on TLR-7/8 and / or TLR-9, the improvement of one or more symptoms of an autoimmune disease, the improvement of a symptom of a chronic inflammatory disease, and the decrease in cytokine production in response to a virus).

The kits may comprise IRP and / or IRC packaged in any suitable suitable container. For example, if the IRP or IRC is a dry formulation (for example, a freeze-dried or dry powder), a vial with an elastic cap is normally used so that the IRP or IRC can be easily resuspended by injecting fluid through the elastic cap . Blisters with separable non-elastic closures (for example, sealed glass) or elastic caps are very conveniently used for liquid formulations of IRP or IRC. Containers are also contemplated for use in combination with a specific device, such as an inhaler, a device for nasal administration (for example, an atomizer), a syringe or an injection device such as a minipump.

The instructions regarding the use of IRP and / or IRC generally include information regarding the dosage, dosing schedule and route of administration for the intended method of use. The IRP or IRC containers may be unit doses, large volume containers (eg, multi dose packages) or subunit doses. The instructions supplied in the kits are typically instructions written on a label or on a package leaflet (for example, a sheet of paper included in the kit), but instructions readable by a machine are also acceptable (for example, the instructions included on a magnetic or optical storage disk).

In some cases, the kits comprise materials for the production of IRP and / or IRC as complexes for administration, such as, for example, an encapsulation material, a material for microcarrier complexes, etc. Generally, the kit includes separate containers of IRP or IRC and the material (s) for complexes. The IRP or IRC and the complexes are preferably supplied in a form that allows the formation of the IRP- or IRC-complex after mixing of the IRP or IRC and the complex material supplied. This configuration is preferred when the IRP-or IRC-complex is linked by non-covalent bonds. This configuration is also preferred when the IRP- or IRC complex is to be crosslinked by means of a heterobifunctional crosslinking agent, the IRP / IRC or the complex (for example, attached to the heterobifunctional crosslinking agent is supplied in an "activated" form) so that it is a reactive component available with the IRP / IRC).

The following examples are provided to illustrate, but not limit, the invention. The oligonucleotides for use according to the invention are indicated with an asterisk.

Examples

Example 1: Regulation of innate immune responses of cells by polynucleotides containing IRS

Immunoregulatory polynucleotides (IRPs) (ie, polynucleotides containing at least one IRS) were tested.

or control samples for the immunoregulatory (IR) activity of innate immune responses in human and mouse cells. IR activity was tested by measuring various indicators of an innate immune response, including cytokine response, cell maturation and cell proliferation. Unless otherwise indicated, the polynucleotides examined were fully modified phosphorothioate oligodeoxynucleotides.

An innate immune response was stimulated in the cells being tested, by the addition of an immunostimulatory nucleic acid (ISNA) to the cell culture. The IRPs or control samples were then added to the cell culture. After incubation of the cells, culture media and / or cells were examined for the level of a particular cytokine in the culture media and the state of cell maturation and / or cell proliferation.

For mouse cell assays, BALB / c or C57B1 / 6 mouse spleen fragments were mechanically dispersed by forcing the digested fragments through metal gratings. The dispersed splenocytes were collected as sediment by centrifugation and were then resuspended in fresh medium (RPMI 1640 with 10% fetal calf serum, plus 50 units / ml penicillin, 50 μg / ml streptomycin, 2 mM glutamine and �-mercaptoethanol 0.05 mM). For some assays, purified murine CD11c + cells isolated from the splenocytes were used using CD11c coated microbeads from Miltenyi Biotec (Auburn, California, USA, catalog number 130-052501) and following the manufacturer's guidelines.

Mouse splenocytes were distributed in the wells of 96-well plates (7x107 cells / ml). An ISNA was added, such as ID. SEC. No. __ (1018) or ID. SEC. No. __ (C274), to the cells in a concentration of 0.7 μM and the IRP test sample or control sample was added to the cells. The cells were incubated another 48 hours. Medium was collected from each well and examined for concentrations of cytokines IL-6 and IL-12 using the ELISA immunoassay. To carry out the ELISA, we use anti-IL-6 antibodies (numbers 554400 and 554402 from the catalog, Pharmingen, San Diego, California, USA) and anti-IL-12 antibodies (numbers 551219 and 554476 from the catalog, Pharmingen , San Diego) and the protocols recommended by the manufacturer. IRPs were examined at various concentrations that included 1.4 μM, 0.7 μM, 0.14 μM and 0.07 μM, or IRP: ISNA ratios of 2: 1, 1: 1, 1: 5 and 1: 10. Other relationships were examined depending on the experimental design. Control samples included ISNA alone, IRP alone, media alone and a control oligonucleotide containing neither ISNA nor IRS, ID. SEC. No. __ (C532).

IRPs inhibited the secretion of IL-6 and IL-12 by murine splenocytes and CD11c + cells stimulated with ISNA. Examples of results of such murine cell assays are presented in Figures 1A-1B. The results of splenocytes stimulated with ISNA (1018) alone and with ISNA (1018) are shown in Figure 1A together with varying amounts of two different IRPs, ID. SEC. No. 92 (530) and ID. SEC. No. 17 (C869), and the control sequence (C532). The results of CD11c + cells stimulated with ISNA ID are shown in Figure 1B. SEC. No. __ 5'-TCG TCG AAC GTT CGA GAT GAT-3 '(C274) alone and with ISNA ID. SEC. No. __ (C274) together with two different IRPs, ID. SEC. No. 92 (530) and ID. SEC. No. 17 (C869), and the control sequence (C532). As indicated in Figures 1A and 1B, the presence of any IRP resulted in a reduction in the amounts of IL-6 and IL-12 produced by the cells in response to ISNA. The inhibition of cytokine production by the IRP was dose sensitive to the IRP.

For human cell assays, peripheral blood was collected from volunteers by venipuncture using heparinized syringes. A layer of blood was placed on a bed of FICOLL® (Amersham Pharmacia Biotech) and centrifuged. The PBMCs, located at the FICOLL® interface, were collected and then washed twice with cold phosphate buffered saline (PBS). The cells were resuspended and cultured in 48 or 96 well plates, in the amount of 2 x 106 cells / ml, in RPMI 1640 with 10% human AB serum, thermally inactivated, plus 50 units / ml of penicillin, 50 μg / ml of streptomycin, 300 μg / ml of glutamine, 1 mM sodium pyruvate, and non-essential amino acids (NEAA; non-essential amino acids) in MEM 1x.

Human B cells and human PDCs were isolated using procedures described by Marshall et al. (2003), J. Leukoc. Biol. 73: 781-92. Human B cells were distributed and incubated, and medium was collected from each well and examined for concentrations of cytokine IL-6 by ELISA in the manner described by Marshall et al. (2003). IRPs ID were examined. SEC. No. 92 (530) and ID. SEC. No. 17 (869) at various concentrations that included 2.8 μM, 0.7 μM and 0.175 μM or IRP: ISNA ratios of 4: 1, 1: 1 and 1: 4. Control samples included ISNA (1018), IRP only [ID. SEC. No. 92 (530) and ID. SEC. No. 17 (869)], media alone and a control oligonucleotide (532) that does not contain ISNA or IRS.

As shown in Figure 2, the presence of any of the IRPs resulted in a reduction in the amount of IL-6 produced by purified human B cells stimulated with ISNA.

The in vivo activity of the IRPs in mice was examined. 25 μg of ISNA (1018) was injected subcutaneously alone or in combination with 75 μg, 25 μg or 8.5 μg of control oligonucleotide or IRP ID. SEC. No. 17 (C869) to each mouse of a group of mice (five animals per group). IRP: ISNA ratios of 3: 1, 1: 1 and 1: 3 were co-administered to the animals. Other control groups were injected with saline solution, control oligonucleotide alone or IRP ID. SEC. No. 17 (C869) alone. Serum was collected 2 hours after nucleic acid injection and levels of IL-6, IL-12 and TNF-a in the serum were determined using an immunoassay as described above for IL-6 and IL-12, and using Quantikine (R&D Systems, Inc., Minneapolis, Minnesota, USA) mouse anti-TNF-a. The results of these tests are depicted in Figures 3-5. The administration of the IRP together with the ISNA resulted in a decreased amount of each of the cytokines in the sera with respect to the amount of the cytokines in the sera of the animals that received the ISNA alone.

As shown in Figure 3, administration of the IRP with the ISNA in any of the relationships examined resulted in a reduction of at least approximately 6 orders of magnitude at the serum level of IL-6 compared to the administration of ISNA alone. . Figure 4 shows that the inhibition of IL-12 production by the IRP was dose dependent, giving rise to all the ratios of IRP: ISNA examined at a reduction of the cytokine with respect to the administration of ISNA alone. Figure 5 demonstrates that all IRP: ISNA ratios examined resulted in a reduction of TNF-a with respect to ISNA administration alone.

IRP activity was also examined in vivo when IRP and ISNA were administered to the animal at separate sites from the animal. In this experiment, cytokine responses were compared in groups of mice (five animals per group) to which 25 μg of ISNA (1018) were injected subcutaneously alone or in combination with 25 μg of IRP ID. SEC. No. 17 (C869). While the ISNA was injected subcutaneously to all animals, the IRP was injected subcutaneously in the same outflow as the ISNA (SC1), subcutaneously in the opposite path to that of the ISNA (SC2), intraperitoneally (IP), intravenously (IV) , intramuscularly (IM) or intranasally (IN). The control groups were injected with saline solution, IRP ID. SEC. No. 17 (C869) alone or control oligonucleotide with ISNA (1018) subcutaneously in the same slit.

Serum was collected 2 hours after nucleic acid injection and the levels of IL-6 and IL12 in the serum were determined. As shown in Figure 6, administration of the IRP at all sites tested (i.e. SC1, SC2, IP, IV, IM and IN) resulted in a clear suppression of the amount of IL-6 produced in response to ISNA As shown in Figure 7, administration of IRP at all sites tested also resulted in a suppression of the amount of serum IL-12 in response to ISNA.

The tests carried out in vitro and in vivo demonstrate that it is not necessary for IRP and ISNA to be co-administered at the same time or in the same place in order for IRP to inhibit the stimulatory activity of ISNA.

Example 2: IRP activity and TLR-dependent cellular response

As demonstrated here, IRPs inhibit activities or responses associated with TLR-9 signaling. Experiments were conducted to further investigate the activity of IRPs and the activities or responses associated with TLR-9 and other TLRs.

Murine splenocytes and human PBMCs and PDCs infected with herpes simplex virus type 1 (HSV-1; herpes simplex virus type 1) respond by producing IFN-a, and this response depends on TLR-9 signaling. Murine splenocytes and human PBMCs and PDCs infected with influenzavirus (strain PR / 8) also respond by producing IFN-a; however, this response depends on the signaling of TLR-7/8 and is independent of TLR-9. The effect of IRPs on cytokine production by infected cells in an innate immune response was examined.

Murine CD11 + splenocytes, prepared in the manner described above, were infected with varying amounts of HSV-1. The amounts of IFN-a, measured by an immunoassay (PBL Biomedical Laboratories, Piscataway, New Jersey, USA), and IL-2 produced by the cells were measured and compared with the amount of virus used for infection. An example of the production of IFN-a and IL-12 in response to the amount of HSV-1 [multiplicity of infection (MOI) used for infection is depicted in Figures 8A-8B. Cells infected with 10 MOI of HSV-1 clearly produced both IFN-a and IL-12.

Then murine CD11 + splenocytes were infected with 10 MOI of HSV-1 in the presence of varying amounts of IRP ID. SEC. No. 17 (C869) (7, 3.5 or 1.75 μM) or control oligonucleotide and the quantities of IFN-a and IL-12 produced were determined. As shown in Figures 9A and 9B, the IRP ID. SEC. No. C869 clearly inhibited the production of IFN-a and IL-12 by splenocytes with each of the concentrations examined. The IRP ID. SEC. No. 17 (C869) also inhibited the production of IFN-a by human PDCs infected with HSV-1, as shown in Figure 9C. These results are consistent with the inhibition of TLR-9 dependent cellular responses by the IRP ID. SEC. No. 17 (C869).

Human PDCs with varying amounts of influenzavirus (strain PR / 8) were also infected. The amount of IFN-a produced by the cells was measured and compared with the amount of virus used for the infection. An example of IFN-a production in response to the amount of influenzavirus [multiplicity of infection (MOI)] used for infection is depicted in Figure 10A. Cells infected with 10 MOI influenzavirus (strain PR / 8) clearly produced IFN-a in response to infection.

Human PDCs were then infected with 10 MOI of influenzavirus (strain PR / 8) in the presence of varying amounts of IRP ID. SEC. No. 17 (C869) (7, 3.5 or 1.75 μM) or control oligonucleotide and the amount of IFN-a produced was determined. As shown in Figure 10B, the IRP ID. SEC. No. 17 (C869) clearly inhibited the production of IFN-a by cells in a dose-dependent manner. These results are also consistent with the inhibition of TLR-7/8-dependent cellular responses by the IRP ID. SEC. No. 17 (C869).

The ID was found. SEC. No. 27 * (C661) differentially inhibited cells stimulated with HSV-1 and influenzavirus (PR / 8). Human PDCs were infected with HSV-1 in 30 MOI, in the presence of the ID. SEC. No. 17 (C869), the ID. SEC. No. 27 * (C661) or a control oligonucleotide. In some experiments other concentrations of HSV-1 were used with similar results. PDCs were enriched in the manner described by Duramad et al. (2003), Blood 102: 4487, and incubated with lethally irradiated HSV-1 with UV light. As shown in Figures 11A-11B, the ID. SEC. No. 27 (C661) showed no inhibitory effect on the production of IFN-a by the cells, while the IRP ID. SEC. No. 17 (C869) completely inhibited the production of IFN-a. Human PDCs were infected with influenzavirus (PR / 8) in 10 MOI, in the presence of the ID. SEC. No. 17 (C869), the ID. SEC. No. 27 * (C661) or a control oligonucleotide. As shown in Figures 11A-11B, the inhibitory effect of ID. SEC. No. 27 * (C661) on the production of IFN-a by cells was comparable to the effect of IRP ID. SEC. No. 17 (C869). Consequently, different species of IRP can exert different inhibitory effects on cells. For example, the IRP ID. SEC. No. 27 * (C661) inhibits TLR-7/8 dependent cellular responses but not TLR-9 dependent cellular responses.

Murine splenocytes produce IL-6 in response to LPS through a stimulation of TLR-4. IRPs ID were examined. SEC. No. 17 (C869) and ID. SEC. No. 92 (530) and a control oligonucleotide regarding its effect on the production of IL-6 by spleen cells stimulated with LPS. As depicted in Figures 12A-12B, neither IRP inhibited the production of IL-6 by spleen cells stimulated with LPS. In contrast, a four-order concentration of lesser magnitude of any IRP inhibited the production of IL-6 by splenic cells stimulated with ISNA. Consequently, neither the IRP ID. SEC. No. 17 (C869) or IRP ID. SEC. No. 92 (530) inhibit this TLR-4 dependent cellular response.

The effect of IRP ID was further examined. SEC. No. 17 (C869) on TLR-7/8 dependent responses with the use of two TLR activators. Loxoribine (7-allyl-7,8-dihydro-8-oxo-guanosine) acts as a synthetic adjuvant agent in antitumor responses, and has been shown to selectively activate cells of the innate immune system through the signaling pathway dependent on TLR-7 [Heil et al. (2003), Eur. J. Immunol. 33: 29872997)]. Murine splenic cells were stimulated with loxoribin (100 μM) in the presence of varying concentrations of the IRP ID. SEC. No. 17 (C869) or a control oligonucleotide and the quantities of IL-6 and IL-12 produced were determined. As shown in Figures 13A-13D, the IRP ID. SEC. No. 17 (C869) inhibited the production of IL-6, induced by TLR-7, by the cells in a dose-dependent manner but did not affect the production of IL-12 by the cells.

Resiquimod (R-848) is a stimulus for signaling TLR-7 and TLR-8. Murine splenic cells were stimulated with R-848 (1 μM) in the presence of varying concentrations of IRP 17 (C869) or a control oligonucleotide, and the quantities of IL-6 and IL-12 produced were determined. As shown in Figures 14A-14D, the IRP ID. SEC. No. 17 (C869) inhibited the production of IL-6, induced by TLR-7/8, by the cells in a dose-dependent manner but did not affect the production of IL-12 by the cells.

When examined for the inhibition of various TLR stimulations, the ID was found again. SEC. No. 27 * (C661) inhibited TLR-7/8-dependent cellular responses but not TLR-4-dependent or TLR-9-dependent cellular responses. As depicted in Figures 15A-15D, the IRP ID. SEC. No. 27 * (C661) inhibited the production of IL-6 by splenic cells stimulated with 100 μM loxoribin and by splenic cells stimulated with 1 μM R848. This shows that the ID. SEC. No. 27 * (C661) is effective in inhibiting TLR-7/8-dependent cellular responses. However, the ID is also shown in Figures 15A-15D. SEC. No. 27 (C661) does not inhibit the production of IL-6 by splenic cells stimulated with ISNA or by splenic cells stimulated with LPS. In this way, the ID. SEC. No. 27 * (C661) is not effective in inhibiting TLR-9 or TLR-4 dependent cell responses.

The IRP ID. SEC. No. 17 (C869) inhibits the production of cytokines dependent on both TLR-7/8 and TLR-9 in response to an ISNA stimulation, a viral infection and a chemical stimulation. The IRP ID. SEC. No. 27 * (C661) inhibits the production of TLR-7/8-dependent cytokines but not TLR-9-dependent in response to viral infection, chemical stimulation and ISNA stimulation. Neither the IRP ID. SEC. No. 17 (C869), nor IRP ID. SEC. No. 92 (530) or IRP ID. SEC. No. 27 * (C661) inhibit the production of TLR-4-dependent IL-6.

Example 3: TLR-dependent activities of polynucleotides containing IRS

In a series of experiments, mouse splenocytes were stimulated with R848 (TLR-7/8 signaling) or ISNA (1018) (TLR-9 signaling) together with various IRPs or control oligonucleotides. Table 1 contains the results of 2 experiments. The given value is the percentage of the IL-6 response in the presence of the IRP or the control oligonucleotide, compared to the IL-6 response with R848 alone.

Table 1. Production of IL-6 by splenocytes stimulated with R848 and IRP

% of R848 (IL-6)

Oligonucleotide

μM Exp. No. 1 Exp. No. 2 Half

Without oligonucleotide

- 100 100 100

5'-TGCTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C661 *

2.8 0.7 24 49 27 53 26 51

5'-TGCAAGCTTGCAAGCTTGCAAGCTT-3 ', ID. SEC. No. __C793 *

2.8 0.7 23 48 27 58 25 53

5'-TGCTGCAAGCTTGCAGATGAT-3 ', ID. SEC. No. __C794 *

2.8 24 26 25

0.7

 43 51 47

5'-TGCAAGCTTGCAAGCTTGCAAT-3 ', ID. SEC. No. __C923 *

2.8 0.7 29 54 31 69 30 61

5'-TGCTTGCAAGCTTGCAAGC-3 ', ID. SEC. No. __C919 *

2.8 0.7 22 41 25 43 23 42

5'-TGCTTGCAAGCTTGCAAG-3 ', ID. SEC. No. __C921 *

2.8 0.7 18 36 18 36 18 36

5'-TGCTTGCAAGCTTGCA-3 ', ID. SEC. No. __C922 *

2.8 0.7 20 36 22 37 21 36

5'-TGCTTGCAAGCTTG-3 ', ID. SEC. No. __C930 *

2.8 0.7 48 60 42 63 45 62

5'-TGCTTGCAAGC-3 ', ID. SEC. No. __C931 *

2.8 0.7 64 77 74 90 69 84

5'-GCTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C935

2.8 0.7 31 57 32 70 32 63

5'-CTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C936

2.8 0.7 39 65 41 71 40 68

5'-TTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C937

2.8 0.7 25 49 26 54 26 52

5'-AGCTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C938

2.8 0.7 28 56 27 54 27 55

5'-TACTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C939

2.8 0.7 23 39 22 46 22 43

5'-TGATTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C940

2.8 0.7 29 43 25 46 27 44

5'-AAATTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C941

2.8 0.7 21 47 24 48 23 48

5'-CTTGCAAGCTTGCAAG-3 ', ID. SEC. No. __C909

2.8 0.7 61 84 70 91 66 88

5'-TGCAAGCTTGCA-3 ', ID. SEC. No. __C910 *

2.8 0.7 62 73 62 80 62 77

5'-TGCTTGCAAGCTAGCAAGCA-3 ', ID. SEC. No. __C917 *

2.8 0.7 25 43 30 59 27 51

5'-TGCTTGCAAGCTTGCTAGCA-3 ', ID. SEC. No. __C918 *

2.8 0.7 17 34 18 40 17 37

5'-TGCTTGACAGCTTGACAGCA-3 ', ID. SEC. No. __C932 *

2.8 0.7 16 35 19 43 18 39

5-TGCTTAGCAGCTATGCAGCA-3 ', ID. SEC. No. __C933 *

2.8 0.7 18 34 20 41 19 38

5'-TGCAAGCAAGCTAGCAAGCA-3 ', ID. SEC. No. __C934 *

2.8 0.7 22 36 24 52 23 44

5'-TCCTGGAGGGGTTGT-3 ', ID. SEC. No. __C869

2.8 0.7 78 82 94 119 86 100

5'-TGCTGGAGGGGTTGT-3 ', ID. SEC. No. __C945 *

2.8 0.7 20 37 24 49 22 43

Table 2 contains the results of cells stimulated with ISNA (1018) (TLR-9 signaling). The given value is the percentage of the IL-6 or IL-12 response in the presence of the IRP or the control oligonucleotide compared to the IL-6 or IL-12 response with the ISNA alone.

Table 2. Production of IL-6 and IL-12 by splenocytes stimulated with ISNA and IRP

Oligonucleotide

μM IL-6 ISNA% IL-12 ISNA%

ISNA ID. SEC. No. _1018

0.7 12,875 100 3489 100

ISNA + ID. SEC. No. _C869

0.7 1234 10 1228 35

ISNA + ID. SEC. No. _C945 *

0.7 5664 44 1605 46

ISNA + ID. SEC. No. _C661 *

0.7 11,376 88 2591 74

Table 3 contains the results of 3 experiments. The given value is the percentage of the IL-6 response in the presence of the IRP or the control oligonucleotide compared to the IL-6 response with R848 alone (TLR-7/8 signaling).

Table 3. Production of IL-6 by splenocytes stimulated with R848 and IRP% of R848 (IL-6)

Oligonucleotide

μM Exp. 1 Exp. 2 Exp. 3 Half

Without oligonucleotide

- 100 100 100 100

5'-TCCTGCAGGTTAAGT-3 ', C532

2.8 96 2 88 92

0.7

98 79  95  91

5'-TGCTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C661 *

 2.8 14 7 2. 3 fifteen

0.7

27 18  70  38

5'-TCCTGGAGGGGTTGT-3 ', ID. SEC. No. __C869

2.8 47 94 117 86

0.7

 fifty 76 106 78

5'-TGCTGGAGGGGTTGT-3 ', ID. SEC. No. __C945 *

2.8 18 twenty 24 twenty-one

0.7

30 38  47  38

5'-TACTGGAGGGGTTGT-3 ', ID. SEC. No. __C946

2.8 33 28 43 35

0.7

fifty 48  73  57

5'-TTCTGGAGGGGTTGT-3 ', ID. SEC. No. __C947

2.8 56 131 82 90

0.7

 77 79 101 86

5'-TGCTGCTGGAGZ'GGTTGT-3 ', ID. SEC. No. __C949 * (Z '= 7-desaza-dG)

2.8 26 twenty-one  26  24

0.7

46 46  54  49

5'-TGCTGGAGZ'GGTTGT-3 ', ID. SEC. No. __C950 * (Z '= 7-desaza-dG)

2.8 27 26  36  29

0.7

41 42  fifty  44

Tables 4 and 5 contain the results of cells stimulated with ISNA (1018) (TLR-9 signaling). The given value is the percentage of the response of IL-6 (Table 4) or IL-12 (Table 5) in the presence of the IRP or the control oligonucleotide compared to the response of IL-6 or IL-12 with ISNA alone .

Table 4. Production of IL-6 by splenocytes stimulated with ISNA and IRP

% ISNA (IL-6)

Oligonucleotide

μM Exp. No. 1 Exp. No. 2 Half

Without oligonucleotide

- 100 100 100

5'-TCCTGCAGGTTAAGT-3 ', C532

2.8 104 93 98

0.7

 86 184 135

5'-TGCTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C661 *

 2.8 61 62 61

0.7

 142 119 130

5'-TCCTGGAGGGGTTGT-3 ', ID. SEC. No. __C869

2.8 10 8 9

0.7

 35 25 30

5'-TGCTGGAGGGGTTGT-3 ', ID. SEC. No. __C945 *

 2.8 30 41 35

0.7

 54 59 56

5'-TACTGGAGGGGTTGT-3 ', ID. SEC. No. __C946

2.8 twenty twenty twenty

0.7

 38 56 47

5'-TTCTGGAGGGGTTGT-3 ', ID. SEC. No. __C947

2.8 52 116 84

0.7

 64 3. 4 49

5'-TGCTGCTGGAGZ'GGTTGT-3 ', ID. SEC. No. __C949 * (Z '= 7-desaza-dG)

2.8  25 18 twenty-one

0.7

 62 93 77

5'-TGC TGG AGZ 'GGT TGT-3', ID. SEC. No. __C950 * (Z '= 7-desaza-dG)

2.8  86 47 66

0.7

 118 146 132

Table 5. Production of IL-12 by splenocytes stimulated with ISNA and IRP% of ISNA (IL-12)

Oligonucleotide

μM Exp. No. 1 Exp. No. 2 Half

Without oligonucleotide

- 100 100 100

5'-TCCTGCAGGTTAAGT-3 ', C532

2.8 101 94 98

0.7

 74 74 74

5'-TGCTTGCAAGCTTGCAAGCA-3 ', ID. SEC. No. __C661 *

 2.8 64 59 61

0.7

 58 63 61

5'-TCCTGGAGGGGTTGT-3 ', ID. SEC. No. __C869

2.8 19 twenty-one twenty

0.7

 35 40 38

5'-TGCTGGAGGGGTTGT-3 ', ID. SEC. No. __C945 *

 2.8 48 35 42

0.7

 49 44 46

5'-TACTGGAGGGGTTGT-3 ', ID. SEC. No. __C946

2.8 30 2. 3 26

0.7

 42 37 39

5'-TTCTGGAGGGGTTGT-3 ', ID. SEC. No. __C947

2.8 Four. Five 44 Four. Five

0.7

 53 42 47

5'-TGCTGCTGGAGZ'GGTTGT-3 ', ID. SEC. No. __C949 * (Z '= 7-desaza-dG)

2.8  39 Four. Five 42

0.7

 53 44 49

5'-TGC TGG AGZ 'GGT TGT-3', ID. SEC. No. __C950 * (Z '= 7-desaza-dG)

2.8  68 69 68

0.7

 66 65 65

Table 6 lists exemplary IRS and its effectiveness in inhibiting the signaling of TLRs. Table 6. Immunoregulatory DNA Sequences (IRS)

ID. SEC. nº

TLR-9 inhibition TLR-7/8 inhibition

C532

5'-TCCTGCAGGTTAAGT- 3 '(witness) - -

C869

5'-TCCTGGAGGGGTTGT-3 ' +++  +/-

C661 *

5'-TGCTTGCAAGCTTGCAAGCA-3 ' - +++

C907 *

5'-TGCTTGCAAGCTTGCAAGCA-HEG-TCCTGGAGGGGTTGT-3 ' +++  +++

C945 *

5'-TGCTGGAGGGGTTGT-3 ' ++ / +++

1040

 5'-TGACTGTGAACCTTAGAGATGA-3 '(witness) - -

C709

5'-GCTAGAGCTTAGGCT-3 '(witness) - -

C533

5'-TGACTGTAGGCGGGGAAGATGA-3 ' ++ -

C217

5'-GCGGCGGGCGGCGCGCGCCC-3 ' + -

C218

5'-GCGCGCGCGCGCGCGCGCGC-3 ' + -

C219

5'-CCGGCCGGCCGGCCGGCCGG-3 ' + -

C707

5'-GAGCAAGCTGGACCTTCCAT-3 ' + -

1019

5'-TGACTGTGAAGGTTAGAGATGA-3 ' ++ -

C708

5'-CCTCAAGCTTGAGGGG-3 ' +++ +

C888

5'-TTAGGGTTAGGGTTAGGGTTAGGG-3 ' ++ ND

C889

5'-TTAGGGTTAGGGTTAGGGTTAGGG-3 ' - ND

C890

5'-CCTCAAGCTTGAGGGG-3 ' - ND

C891

5'-CCTCAAGCTTGAGZ'GG-3 ' +++ ND

530

 5'-TCCTGGCGGGGAAGT-3 ' +++ +

C823

5'-TCCTGGCGZ'GGAAGT-3 ' +++ +

C824

5'-TCCTGGCGAGGAAGT-3 ' - ND

C825

5'-TCCTGGCGGGAAAGT-3 ' + ND

C826

5'-TCCTGGCGGAAAAGT-3 ' - -

C827

5'-TCCTAACGGGGAAGT-3 ' +++ ND

C531

5'-TCCTGGAGGGGAAGT-3 ' +++ +

C828

5'-TCCTAAGGGGGAAGT-3 ' +++ ND

C841

5'-TCCTAACGGGGTTGT-3 ' +++ ND

C842

5'-TCCTAACGGGGCTGT-3 ' +++ ND

C843

5'-TCCTCAAGGGGCTGT-3 ' ++ ND

C844

5'-TCCTCAAGGGGTTGT-3 ' ++ ND

C845

5'-TCCTCATGGGGTTGT-3 ' ++ ND

C892

5'-TCCTGGCGGGGAAGT-3 ' - ND

C869

5'-TCCTGGAGGGGTTGT-3 ' +++ ++ / -

C870

5'-TCCTGGAGGGGCTGT-3 ' +++ ND

C871

5'-TCCTGGAGGGGCCAT-3 ' +++ ND

C872

 5'-TCCTGGAGGGGTCAT-3 ' +++ ND

C873

5'-TCCGGAAGGGGAAGT-3 ' ++ ND

C874

5'-TCCGGAAGGGGTTGT-3 ' ++ ND

C920

5'-TCCTGGAGZ'GGTTGT-3 ' +++ ++ / -

C661

5'-TGCTTGCAAGCTTGCAAGCA-3 ' - +++

C793

5'-TGCAAGCTTGCAAGCTTGCAAGCTT-3 ' + / +++

C794 *

5'-TGCTGCAAGCTTGCAGATGAT-3 ' + / +++

C909

5'-CTTGCAAGCTTGCAAG-3 ' - -

C910

5'-TGCAAGCTTGCA-3 ' - -

C917 *

5'-TGCTTGCAAGCTAGCAAGCA-3 ' - +++

C918 *

5'-TGCTTGCAAGCTTGCTAGCA-3 ' - +++

C919 *

5'-TGCTTGCAAGCTTGCAAGC-3 ' - +++

C921 *

5'-TGCTTGCAAGCTTGCAAG-3 ' - +++

C922 *

5'-TGCTTGCAAGCTTGCA-3 ' - +++

C923 *

5'-TGCAAGCTTGCAAGCTTGCAAT-3 ' - +++

C907 *

5'-TGCTTGCAAGCTTGCAAGCA-HEG-TCCTGGAGGGGTTGT-3 ' +++  +++

C908 *

5'-TGCTTGCAAGCTTGCAAGCATCCTGGA GGGGTTGT-3 ' +++ +++

C913 *

5'-TGCTTGCAAGCTAGCAAGCA-HEG-TCCTGGAGGGGTTGT-3 ' +++  +++

C914 *

5'-TGCTTGCAAGCTTGCTAGCA-HEG-TCCTGGAGGGGTTGT-3 ' +++  +++

C916 *

5'-TGCTTGCAAGCTTGCTAGCA-HEG-TCCTGGAGZ'GGTTGT-3 ' +++  +++

Z '= 7-desaza-dG; +++ a - indicates the range of activity: from very active to inactive; ND: not determined.

In a series of dose-response experiments, mouse splenocytes were stimulated with R848 (TLR-7/8 signaling) or ISNA (1018) (TLR-9 signaling) together with various IRPs or control oligonucleotides. Table 7 contains the results of IL-6 production in the presence of IRP: ISNA in variable relationships. The given value is the percentage of the IL-6 response in the presence of the IRP or the control oligonucleotide, compared to the IL-6 response with ISNA alone.

Table 7. Production of IL-6 by splenocytes stimulated with ISNA and IRP

ISNA% (IL-6) IRP ratio: ISNA

2: 1 1: 1 1: 2 1: 4 1: 8

1:16 ISNA 1018

100 100 100 100 100

100 Culture medium

1 1 1 1 1 1

5'-TCCTGCAGGTTAAGT, ID. SEC. No. __C532

132 104 102 97 88 105

5'-TGCTTGCAAGCTTGCAAGCA, ID. SEC. No.__C661 *

58 78 81 84 85 104

5'-TCCTGGAGGGGTTGT, ID. SEC. No.__C869

2 7 12 32 53 79

5'-TGCTCCTGGAGGGGTTGT, ID. SEC. No.__C954 *

2 4 7 19 41 80

5'-TCCTGCTGGAGGGGTTGT, ID. SEC. nº__C955

14 29 39 55 67 85

5'-TGCTTGTCCTGGAGGGGTTGT, ID. SEC. No.__C956 *

2 2 4 10 25 72

5'-TGCTTGACATCCTGGAGGGGTTGT, ID. SEC. No.__C957 *

2 2 4 10 26 76

5'-TGCTTGACAGCTTGACAGTCCTGGAGGGGTTGT, ID. SEC. No.__C962 *

2 2 3 9 31 71

5'-TGCTTGACAGCTTGATCCTGGAGGGGTTGT ID. SEC. No. __C963 *

3 2 3 4 22 58

5'-TGCTTGACAGCTTCCTGGAGGGGTTGT, ID. SEC. No.__C964 *

3 one 2 7 24 55

5'-TGCTTGACAGCTTGCTCCTGGAGGGGTTGT, ID. SEC. No.__C965 *

2 one 2 4 24 53

5'-TGCTTGACAGCTTGCTTGTCCTGGAGGGGTTGT, ID. SEC. No.__C966 *

2 one 2 7 29 63

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT, ID. SEC. No.__C967 *

2 one 2 8 33 62

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT, ID. SEC. nº_C968 *

2 one 2 2 12 46

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGT, ID. SEC. No.__C969 *

2 one one 2 8 44

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGG, ID. SEC. No.__C970 *

2 one 2 3 19 59

5'-TGCTTGCAAGCTTGCTCCTGGAGGGGTTGT, ID. SEC. No. __C971 *

2 2 3 9 31 58

5'-TGCTTGCAAGCTTCCTGGAGGGGTTGT, ID. SEC. No. __C972 *

2 2 3 8 28 56

Table 8 contains the results of IL-12 production by murine splenocytes in the presence of IRP: ISNA in variable relationships. The given value is the percentage of the IL-12 response in the presence of the IRP or the control oligonucleotide, compared to the IL-12 response with ISNA alone.

Table 8. Production of IL-12 by splenocytes stimulated with ISNA and IRP

ISNA ID. SEC. No. __1018

100 100 100 100 100 100

Culture medium

6 6 6 6 6 6

5'-TCCTGCAGGTTAAGT, ID. SEC. No. __C532

108 96 84 80 74 93

5'-TGCTTGCAAGCTTGCAAGCA, ID. SEC. No.__C661 *

44 61 61 61 61 74

5'-TCCTGGAGGGGTTGT, ID. SEC. No.__C869

6 twenty 22 27 35 60

5'-TGCTCCTGGAGGGGTTGT, ID. SEC. No.__C954 *

7 19 twenty 24 35 58

5'-TCCTGCTGGAGGGGTTGT, ID. SEC. nº__C955

27 43 47 43 fifty 65

5'-TGCTTGTCCTGGAGGGGTTGT, ID. SEC. No.__C956 *

8 22 26 33 43 59

5'-TGCTTGACATCCTGGAGGGGTTGT, ID. SEC. No.__C957 *

8 2. 3 30 38 46 60

5'-TGCTTGACAGCTTGACAGTCCTGGAGGGGTTGT, ID. SEC. No.__C962 *

8 9 17 32 46 71

5'-TGCTTGACAGCTTGATCCTGGAGGGGTTGT ID. SEC. No. __C963 *

5 5 8 18 29 53

5'-TGCTTGACAGCTTCCTGGAGGGGTTGT, ID. SEC. No.__C964 *

5 10 16 25 33 53

5'-TGCTTGACAGCTTGCTCCTGGAGGGGTTGT, ID. SEC. No.__C965 *

5 5 9 18 31 51

5'-TGCTTGACAGCTTGCTTGTCCTGGAGGGGTTGT, ID. SEC. No.__C966 *

5 6 10 19 31 54

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT, ID. SEC. No.__C967 *

5 5 8 19 33 54

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT, ID. SEC. nº_C968 *

5 4 9 eleven twenty-one 46

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGT, ID. SEC. No.__C969 *

6 4 6 9 18 Four. Five

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGG, ID. SEC. No.__C970 *

6 5 9 16 30 52

5'-TGCTTGCAAGCTTGCTCCTGGAGGGGTTGT, ID. SEC. No. __C971 *

6 8 eleven twenty-one 33 54

5'-TGCTTGCAAGCTTCCTGGAGGGGTTGT, ID. SEC. No. __C972 *

7 eleven fifteen 22 35 57

Table 9 contains the results of IL-6 production by murine splenocytes in the presence of IRP at varying concentrations, in the presence of R848 (TLR-7/8 signaling). The given value is the percentage of the IL-6 response in the presence of the IRP or the control oligonucleotide, compared to the IL-6 response with R848 alone.

Table 9. Production of IL-6 by splenocytes stimulated with R848 and IRP

% of R848 (IL-6)

5.6 μM

IRP concentration 2.8 μM 1.4 μM 0.7 μM 0.35 μM

R848

100 100 100 100 100

Culture medium

0 0 0 0 0

5'-TCCTGCAGGTTAAGT, ID. SEC. No. __C532

108 104 108 108 105

5'-TGCTTGCAAGCTTGCAAGCA, ID. SEC. No.__C661 *

twenty-one 31 47 59 77

5'-TCCTGGAGGGGTTGT, ID. SEC. No.__C869

93 106 110 109 104

5'-TGCTCCTGGAGGGGTTGT, ID. SEC. No.__C954 *

2. 3 31 44 56 72

5'-TCCTGCTGGAGGGGTTGT, ID. SEC. nº__C955

73 87 107 101 108

5'-TGCTTGTCCTGGAGGGGTTGT, ID. SEC. No.__C956 *

twenty 28 Four. Five 66 75

5'-TGCTTGACATCCTGGAGGGGTTGT, ID. SEC. No.__C957 *

17 27 39 63 78

5'-TGCTTGACAGCTTGACAGTCCTGGAGGGGTTGT, ID. SEC. No.__C962 *

17 36 51 75 83

5'-TGCTTGACAGCTTGATCCTGGAGGGGTTGT ID. SEC. No. __C963 *

26 35 54 77 93

5'-TGCTTGACAGCTTCCTGGAGGGGTTGT, ID. SEC. No.__C964 *

fifteen 30 Four. Five 68 89

5'-TGCTTGACAGCTTGCTCCTGGAGGGGTTGT, ID. SEC. No.__C965 *

16 31 48 72 82

5'-TGCTTGACAGCTTGCTTGTCCTGGAGGGGTTGT, ID. SEC. No.__C966 *

18 40 60 78 92

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT, ID. SEC. No.__C967 *

16 41 49 68 80

5'-TGCTTGACAGCTTGACAGCATCCT GGAGGGGTTGT ID. SEC. nº_C968 *

13 29 43 67 83

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGT, ID. SEC. No.__C969 *

14 26 Four. Five 62 80

5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGG, ID. SEC. No.__C970 *

16 25 Four. Five 54 74

5'-TGCTTGCAAGCTTGCTCCTGGAGGGGTTGT, ID. SEC. No. __C971 *

fifteen 29 58 66 67

5'-TGCTTGCAAGCTTCCTGGAGGGGTTGT, ID. SEC. No. __C972 *

17 28 41 54 64

As shown in Tables 7-9, the ID. SEC. No. 52 * (C954), the ID. SEC. No. 53 * (C956), the ID. SEC. No. 54 * (C957) and IDs. SEC. Numbers 55-65 * (C962-C972) are particularly effective in inhibiting cell responses dependent on both TLR-7/8 and TLR-9.

Example 4

Murine splenic cells were activated with ISNA (1018) (0.7 μM) or R848 (1 μM) alone and together with increasing amounts of IRP ID. SEC. No. 17 (869), IRP ID. SEC. No. 27 * (661) or IRP ID. SEC. No. 52 * (954). As depicted in Figures 16A-16B, the IRP ID. SEC. No. 17 (869) and IRP ID. SEC. No. 52 * (954) are potent inhibitors of IL-6 production in response to ISNA (1018), while IRP ID. SEC. No. 27 * (661) and IRP ID. SEC. No. 52 *

(954) are potent inhibitors of R848 activation.

2.5 μg of R848 was injected subcutaneously alone or in combination with 450-500 μg or 100-150 μg of control oligonucleotide or IRP ID. SEC. No. 52 * (954) to each mouse of a group of mice. Serum was collected 1 hour after the injection of R848 and the levels of IL-12 and TNF-a in the serum were determined using an immunoassay as described above. The results of these tests are shown in Figures 17A-17B. The administration of the IRP together with R848 resulted in a decreased amount of each of the cytokines in the sera, with respect to the amounts of the cytokines in the sera of the animals that received R848 alone.

BALB / c mice 6 to 12 weeks of age were injected intraperitoneally with 20 mg of D-galactosamine in saline solution and subcutaneously 50 μg of ISNA (1018) alone or in combination with 200 μg, 100 μg or 50 μg of IRP ID . SEC. No. 52 * (954) or IRP ID. SEC. No. 17 (869) or a control ODN oligonucleotide. The survival of the mice was then evaluated over a period of 7 days. In normal mice, 50 μg of ISNA (1018) does not cause death; however, when mice are pretreated with D-galactosamine, they become very susceptible to inflammation and die quickly. As depicted in Figure 18, the IRS was able to prevent death in a dose-dependent manner, while the inactive-ODN control failed. 100% of the mice were protected with the highest dose (200 μg of IRS), almost 90% with 100 μg of IRS, and even more than 60% with a ratio of 1: 1. In this way, these data support an intense activity in vivo of the IRS.

Mouse splenocytes were activated with ISNA (1018) (Figure 19A) or R848 (Figure 19B) alone and together with IRP ID. SEC. No. 52 * (954) or with IRP ID degradation products. SEC. No. 52 * (954): IRP ID. SEC. No. __ (DV019) *, IRP ID. SEC. No. __ (DV020) *, IRP ID. SEC. No. __ (DV021) *, IRP ID. SEC. No. __ (DV022) *, IRP ID. SEC. No. __ (DV023) * and IRP ID. SEC. No. __ (DV024) *.

The DV0 sequences are the "IRS 954 N minus sequences" (IRS 954 with N = 1 to 6 nucleotides suppressed from the 3 'end):

ID. SEC. No. __DV019: 5'-TGC TCC TGG AGG GGT TG * ID. SEC. No. __DV020: 5'-TGC TCC TGG AGG GGT T * ID. SEC. No. __DV021: 5'-TGC TCC TGG AGG GGT * ID. SEC. No. __DV022: 5'-TGC TCC TGG AGG GG * ID. SEC. No. __DV023: 5'-TGC TCC TGG AGG G * ID. SEC. No. __DV024: 5'-TGC TCC TGG AGG *

As depicted in Figures 19A and 19B, IL-6 production was decreased when cells were cultured in the presence of IRP ID. SEC. No. 52 * (954), IRP ID. SEC. No. __ (DV019) *, IRP ID. SEC. No. __ (DV020) *, IRP ID. SEC. No. __ (DV021) *, IRP ID. SEC. No. __ (DV022) * and IRP ID. SEC. No. __ (DV023) *, with little to no inhibition with IRP ID. SEC. No. __ (DV024) *. This suggests that the IRP ID activity. SEC. No. 52 * (954) is retained even after degradation of the 3 'end of the sequence.

Mice (NZBxNZW) F1 were left untreated or were treated twice a week with 15 μg or 45 μg of IRP ID. SEC. No. 52 * (954). The treatment began at 4-5 months of age, when the first signs of disease appeared in the mice. As depicted in Figure 20, the levels of anti-dsDNA autoantibodies in the serum in the absence of treatment increased over time. The mice to which IRP ID had been injected. SEC. No. 52 * (954) had reduced levels of autoantibodies, demonstrating the ability of these lupus-susceptible mice to affect disease progression.

Mice (NZBxNZW) F1 of 8-9 months of age and already ill were injected with 100 μg of IRP ID. SEC. No. 52 *

(954) or control oligonucleotide three times a week. As depicted in Figure 21, the treatment with IRP ID. SEC. No. 52 * (954) reduced the mortality of mice compared to the control oligonucleotide.

Purified human B cells were activated with ISNA (1018) or R848 alone and together with IRP ID. SEC. No. 17 (869), IRP ID. SEC. No. 27 * (661), IRP ID. SEC. No. 52 * (954) or control oligonucleotide. As shown in Figure 24, the pattern of inhibitory activity of these oligonucleotides is similar in mouse and man. In particular, the IRP ID. SEC. No. 52 * (954) inhibited the production of IL-6 by human B cells stimulated with both stimuli.

Human PDCs were infected with HSV-1 virus inactivated with UV radiation, alone (MOI: 5) and together with IRP ID. SEC. No. 52 * (954) or control oligonucleotide. An example of the potent inhibitory effect of IRP ID is depicted in Figure 23. SEC. No. 52 * (954) on the production of IFN-a in response to the virus alone.

Human PDCs were infected with thermally inactivated influenzavirus, alone (MOI: 2) and together with IRP ID. SEC. No. 52 * (954) or control oligonucleotide. An example of the potent inhibitory effect of IRP ID is depicted in Figure 24. SEC. No. 52 * (954) on the production of IFN-a in response to the virus alone.

Human PDCs were cultured in the presence of U937 cells irradiated with UV light (60 mJ), in the presence of 10% serum obtained from patients with SLE positive for anti-dsDNA, alone and together with IRP ID. SEC. No. 52 * (954) or control oligonucleotide. As depicted in Figure 25, serum containing anti-dsDNA can activate PDCs and induce IFN-a. However, when added to the culture, the IRP ID. SEC. No. 52 * (954) was able to inhibit the IFN-a response, while the control oligonucleotide had no effect. This shows that the IRP ID. SEC. No. 52 * (954) can significantly inhibit the activation of PDCs in this in vitro assay in which samples from patients with SLE are used.

Human PDCs were cultured in the presence of U937 cells irradiated with UV light (60 mJ), in the presence of 0.5 mg / ml of purified IgG from patients with SLE positive for anti-RNP, alone and together with IRP ID. SEC. No. 5 52 * (954) or control oligonucleotide. IgG was purified from the serum of patients using a HiTrap Protein G HP column (GE Healthcare, Waukesha, Wisconsin, USA). Once purified, the IgG was desalted and then quantified. As depicted in Figure 26, anti-RNP specific IgG can activate PDCs and induce IFN-a. However, when added to the culture, the IRP ID. SEC. No. 52 * (954) was able to inhibit the IFN-a response, while the control oligonucleotide had no effect. This shows that the IRP ID. SEC. No. 52 * (954) can inhibit significance

The activation of PDCs is widely used in this in vitro assay in which samples from patients with SLE are used.

Murine splenocytes were activated with ISNA (1018) or R848 alone and together with IRP ID. SEC. No. 17 (869), IRP ID. SEC. No. 77 (661), IRP ID. SEC. No. 52 * (954), IRP ID. SEC. No. __ (983), IRP ID. SEC. No. __ (984), IRP ID. SEC. No. __ (985), IRP ID. SEC. No. __ (986), IRP ID. SEC. No. __ (987), IRP ID. SEC. No. __ (988), IRP ID. SEC. No. __ (989), IRP ID. SEC. No. __ (990), IRP ID. SEC. No. __ (991) or control oligonucleotide. As depicted in Figure 27 and Figure 28, the

The addition of non-nucleotide groups did not lead to a complete loss of activity even though it allowed modulating the level of response.

Claims (15)

one.

 An oligonucleotide for use in inhibiting a TLR7 / 8 dependent immune response in an individual, in which the oligonucleotide has less than about 200 bases or base pairs and the oligonucleotide comprises an immunoregulatory sequence, in which the immunoregulatory sequence comprises at least a trinucleotide sequence TGC at the 5 'end of the oligonucleotide.

2.

 The oligonucleotide for use according to Claim 1, wherein the immune response is associated with an autoimmune disease.

3.

 The oligonucleotide for use according to Claim 2, wherein inhibition of the immune response improves one or more symptoms of autoimmune disease.

Four.

 The oligonucleotide for use according to Claim 2, wherein inhibition of the immune response prevents or retards the development of autoimmune disease.

5.

 The oligonucleotide for use according to any one of Claims 2 to 4, wherein the autoimmune disease is selected from the group consisting of systemic lupus erythematosus (SLE), rheumatoid arthritis and autoimmune skin diseases.

6.

 The oligonucleotide for use according to Claim 1, wherein the immune response is associated with chronic pathogen stimulation.

7.

 The oligonucleotide for use according to Claim 1, wherein the immune response is associated with an inflammatory disease.

8.

 The oligonucleotide for use according to any one of Claims 1 to 7, wherein the oligonucleotide is 50 bases or base pairs in length or less.

9.

 The oligonucleotide for use according to any one of Claims 1 to 8, wherein the oligonucleotide consists of the 5'-TGCNm-3 'nucleotide sequence,

in which each N is a nucleotide, m is an integer from 5 to about 50, and the N1-Nm sequence comprises at least one GC dinucleotide.

10.

 The oligonucleotide for use according to Claim 9, wherein the oligonucleotide consists of the nucleotide sequence selected from the group consisting of 5'-TGCNmA-3 ', 5'-TGCNmCA-3', and 5'-TGCNmGCA-3 ' .

eleven.

 The oligonucleotide for use according to any one of Claims 1 to 8, wherein the oligonucleotide comprises the sequence 5'-TGCTTGCAAGCTTGCAAGCA-3 'or a fragment of this sequence that includes at least a palindromic portion thereof of 10 bases.

12.

 The oligonucleotide for use according to any one of Claims 1 to 8, wherein the oligonucleotide is selected from the group consisting of:

5'-TGCTTGCAAGCTTGCAAGCA-3 ', 5'-TGCTTGCAAGCTTGCAAG-3', 5'-TGCTTGCAAGCTTGCA-3 ', 5'-TGCTTGCAAGCTAGCAAGCA-3', 5'-TGCTTGCAAGCTTGCTAGCA-3 ', 5'-TGCTT' ' -TGCTTAGCAGCTATGCAGCA-3 ', 5'-TGCAAGCAAGCTAGCAAGCA-3', 5'-TGCAAGCTTGCAAGCTTGCAAGCTT-3 ', 5'-TGCTGCAAGCTTGCAGATGAT-3', 5'-TGCTTGCAAGCTTGCAAGC-3 ', 5 -TGCAAGCTTGCAAGCTTGCAAT-3', 5'-TGCTTGCAAGCTTG- 3 ', 5 -TGCTGGAGGGGTTGT-3', 5'-TGCTCCTGGAGGGGTTGT-3 ', 5'-TGCTTGTCCTGGAGGGGTTGT-3', 5'-TGCTTGACATCCTGGAGGGGTTGT-3 ', 5'-TGCTTGACAGCTTGACAGTCCTGGAGGGGTTGT-3', 5'-TGCTTGACAGCTTGATCCTGGAGGGGTTGT-3 ', TGCTTGACAGCTTCCTGGAGGGGTTGT 5'-3 ', 5'-TGCTTGACAGCTTGCTCCTGGAGGGGTTGT-3', 5'-TGCTTGACAGCTTGCTTGTCCTGGAGGGGTTGT-3 ', 5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGTTGT-3', 5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGGT-3 ', 5'-TGCTTGACAGCTTGACAGCATCCTGGAGGGG-3', 5 ' -TGCTTGCAAGCTTGCTCCTGGAGGGGTTGT-3 ', 5'-TGCTTGCAAGCTTCCTGGAGGGGTTGT-3', 5'-TGCTTGCAAGCTTGCAAGCATCCTGGAGGGGTTGT-3 ', 5'-TGCTTGCAAGCTTGCAAGCA-HEG-TCCTGGAGGGGTTGT-3 ', 5'-TGCTTGCAAGCTAGCAAGCA-HEG-TCCTGGAGGGGTTGT-3 ', 5'-TGCTTGCAAGCTTGCTAGCA-HEG-TCCTGGAGGGGTTGT-3 ', 5 5'-TGCTTGCAAGCTTGCTAGCA-HEG-TCCTGGAGZGGTTGT-3 ', 5'-TGCTGCTGGAGZ'GGTTGT-3 ', and 5'-TGCTGGAGZ'GGTTGT-3 ', in which HEG is hexa- (ethylene glycol) and Z' is 7-desaza-dG. 13. The oligonucleotide for use according to any of the preceding claims, wherein the oligonucleotide contains phosphate modified polynucleotides. The oligonucleotide for use according to any of the preceding claims, wherein the oligonucleotide comprises phosphorothioate bonds. 15. The oligonucleotide for use according to any of the preceding claims, wherein the individual is a human being. 16. The oligonucleotide for use according to any one of Claims 1 to 7, wherein oligonucleotide 15 is 200 bases in length or less.