ES2380452T3 - Antibodies to inhibit blood coagulation and methods of use thereof - Google Patents

Antibodies to inhibit blood coagulation and methods of use thereof Download PDF

Info

Publication number
ES2380452T3
ES2380452T3 ES98910277T ES98910277T ES2380452T3 ES 2380452 T3 ES2380452 T3 ES 2380452T3 ES 98910277 T ES98910277 T ES 98910277T ES 98910277 T ES98910277 T ES 98910277T ES 2380452 T3 ES2380452 T3 ES 2380452T3
Authority
ES
Spain
Prior art keywords
antibody
fragment
seq id
tf
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
ES98910277T
Other languages
Spanish (es)
Inventor
Jin-An Jiao
Lawrence Luepschen
Esperanza Liliana Nieves
Hing C. Wong
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US814806 priority Critical
Priority to US08/814,806 priority patent/US5986065A/en
Application filed by Genentech Inc filed Critical Genentech Inc
Priority to PCT/US1998/004644 priority patent/WO1998040408A1/en
Application granted granted Critical
Publication of ES2380452T3 publication Critical patent/ES2380452T3/en
Anticipated expiration legal-status Critical
Application status is Expired - Lifetime legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/36Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against blood coagulation factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Abstract

Anticuerpo o fragmento del mismo que se une a factor tisular ("TF") humano, en el que el anticuerpo o fragmento comprende: (i) regiones hipervariables de cadena ligera CDR1, CDR2, y CDR3, en las que: CDR1 comprende la secuencia de SEC ID NO: 5; Antibody or fragment thereof that binds to tissue factor ( "TF") human, wherein the antibody or fragment comprises: (i) hypervariable regions CDR1 light chain, CDR2, and CDR3, wherein: CDR1 comprises the sequence SEQ ID NO: 5; CDR2 comprende la secuencia de SEC ID NO: 6; CDR2 comprises the sequence of SEQ ID NO: 6; y CDR3 comprende la secuencia de SEC ID NO: 7; and CDR3 comprises the sequence of SEQ ID NO: 7; y (ii) regiones hipervariables de cadena pesada CDR1, CDR2 y CDR3, en las que: CDR1 comprende la secuencia de SEC ID NO: 8; and (ii) hypervariable regions CDR1 heavy chain, CDR2 and CDR3, wherein: CDR1 comprises the sequence of SEQ ID NO: 8; CDR2 comprende la secuencia de SEC ID NO: 9; CDR2 comprises the sequence of SEQ ID NO: 9; y CDR3 comprende la secuencia de SEC ID NO: 10. and CDR3 comprises the sequence of SEQ ID NO: 10.

Description

Anticuerpos para inhibir la coagulación de la sangre y métodos de utilización de los mismos. Antibodies to inhibit blood coagulation and methods of use thereof.

ANTECEDENTES DE LA INVENCIÓN BACKGROUND OF THE INVENTION

1. one.
Campo de la invención Field of the Invention

[0001] La presente invención se refiere a nuevos anticuerpos y métodos de utilización de los anticuerpos para inhibir la coagulación de la sangre. [0001] The present invention relates to novel antibodies and methods of using the antibodies to inhibit blood coagulation. En particular, la presente invención se refiere a nuevos anticuerpos que se unen específicamente al factor tisular humano nativo con elevada afinidad. In particular, the present invention relates to novel antibodies that specifically bind native human tissue factor with high affinity. Los anticuerpos de la invención son útiles para una serie de aplicaciones, particularmente para reducir la coagulación de la sangre in vivo. The antibodies of the invention are useful for a number of applications, particularly for reducing blood coagulation in vivo.

2. two.
Antecedentes Background

[0002] La coagulación de la sangre ayuda a la homeostasis minimizando la pérdida de sangre. [0002] Blood clotting assists homeostasis by minimizing blood loss. En general, la coagulación de la sangre requiere un daño en los vasos, la agregación plaquetaria, factores de coagulación y la inhibición de fibrinólisis. Generally, blood clotting requires vessel damage, platelet aggregation, coagulation factors and fibrinolysis inhibition. Los factores de coagulación actúan a través de una cascada que relaciona el daño en los vasos con la formación de un coágulo de sangre (véase en general L. Stryer, Biochemistry, 3rd Ed, WH Freeman Co., New York; and AG Gilman et al., The Pharmacological Basis of Therapeutics, 8th Edition, McGraw Hill Inc., New York, pág. 1311-1331). Clotting factors act through a cascade that relates the vessel damage to formation of a blood clot (see generally L. Stryer in Biochemistry, 3rd Ed, WH Freeman Co., New York; and AG Gilman et al., the Pharmacological Basis of Therapeutics, 8th Edition, McGraw Hill Inc., New York, pp. 1311-1331).

[0003] Existe un acuerdo general de que la activación del factor X en el factor Xa (FXa) es una etapa crítica en el proceso de coagulación de la sangre. [0003] There is general agreement that factor X activation factor Xa (FXa) is a critical step in the process of blood clotting. En general, FX se convierte en FXa mediante la unión de un complejo catalíticamente activo que incluye “factor tisular” (TF). Generally, FX is converted to FXa by binding a catalytically active complex that includes "tissue factor" (TF). TF es una proteína de membrana celular expresada de forma controlada que se une al factor VII/VIIa para producir el complejo catalíticamente activo (TF:VIIa). TF is a cell membrane protein expressed in a controlled manner that binds factor VII / VIIa to produce the catalytically active complex (TF: VIIa). El coágulo de sangre sigue a la activación mediada por FXa de la protrombina. The blood clot follows FXa-mediated activation of prothrombin. La coagulación de la sangre se puede minimizar mediante la inactivación de TF en las formas no nativas que no puede producir de manera óptima el complejo TF:VIIa. The blood clotting can be minimized by inactivation of TF in the non-native forms which can not optimally produce the TF: VIIa complex. La formación excesiva de FXa se cree que contribuye a varias trombosis, incluyendo reestenosis. Excessive formation of FXa is believed to contribute to various thrombosis, including restenosis.

[0004] La trombosis puede estar asociada con procedimientos médicos invasivos, tales como cirugía cardiaca (por ejemplo, angioplastia), cirugía abdominotorácica, cirugía arterial, despliegue de dispositivos (por ejemplo, un stent o catéter), o endarterectomía. [0004] Thrombosis may be associated with invasive, such as cardiac surgery (e.g., angioplasty), abdominothoracic surgery, arterial surgery, deployment of devices (e.g., a stent or catheter), or endarterectomy medical procedures. Además, la trombosis puede estar acompañada de varios trastornos tromboembólicos y coagulopatías, tales como embolia pulmonar (por ejemplo, fibrilación atrial con embolización) y coagulación intravascular diseminada, respectivamente. Furthermore, thrombosis may accompany various thromboembolic and coagulopathies of such as pulmonary embolism (e.g., atrial fibrillation with embolization) and disseminated intravascular coagulation respectively disorders. La manipulación de fluidos corporales también puede dar lugar a trombos no deseados, particularmente en transfusiones de sangre o muestreo de fluidos, así como procedimientos que implican la circulación extracorpórea (por ejemplo, cirugía cardiopulmonar con bypass) y diálisis. Manipulation of body fluids can also result in unwanted thrombus, particularly in blood transfusions or fluid sampling, as well as procedures involving extracorporeal circulation (e.g., cardiopulmonary bypass surgery) and dialysis.

[0005] Los anticoagulantes se utilizan a menudo para aliviar o evitar coágulos de sangre asociados con trombosis. [0005] Anticoagulants are often used to relieve or avoid blood clots associated with thrombosis. La coagulación de sangre se puede minimizar o eliminar a menudo mediante la administración de un anticoagulante adecuado o una mezcla de los mismos, incluyendo uno o más de un derivado de cumarina (por ejemplo, warfarina y dicumarol) o un polímero cargado (por ejemplo, heparina, hirudina o Bivalirrudina). Blood clotting can be minimized or often eliminated by administering a suitable anti-coagulant or mixture thereof, including one or more of a coumarin derivative (e.g., warfarin and dicumarol) or a charged (eg polymer, heparin, hirudin or bivalirudin). Véase, por ejemplo, Gilman et al., supra, RJ Beigering et al., Ann. See for example, Gilman et al., Supra, Beigering RJ et al., Ann. Hemathol., Hemathol.,

72:177 (1996); 72: 177 (1996); JD Willerson, Circulation, 94:866 (1996). JD Willerson, Circulation, 94: 866 (1996).

[0006] Sin embargo, la utilización de anticoagulantes están asociada a menudo con efectos secundarios, tales como hemorragia, reoclusión, síndrome de “coágulo blanco”, irritación, defectos en el parto, trombocitopenia y disfunción hepática. [0006] However, the use of anticoagulants are often associated with side effects such as hemorrhaging, re-occlusion, "white-clot", irritation, birth defects, thrombocytopenia and hepatic dysfunction syndrome effects. La administración a largo plazo de anticoagulantes puede incrementar particularmente el riesgo de enfermedades mortales (véase, por ejemplo, Gilman et al., supra). The long term administration of anticoagulants can particularly increase risk of life threatening diseases (see e.g., Gilman et al., Supra).

[0007] Ciertos anticuerpos con actividad antiplaquetaria también se han utilizado para aliviar varias trombosis. [0007] Certain antibodies with anti-platelet activity have also been used to alleviate various thromboses. Por ejemplo, Abciximab es un anticuerpo terapéutico que se administra habitualmente para aliviar varios trastornos tromboembólicos, tales como aquellos que aparecen de la angioplastia, infarto de miocardio, angina inestable y estenosis de arteria coronaria. For example, Abciximab is a therapeutic antibody that is routinely administered to alleviate various thromboembolic events, such as those that arise from angioplasty, myocardial infarction, unstable angina and coronary artery stenosis disorders. Adicionalmente, se puede utilizar Abciximab como agente profiláctico para reducir el riesgo de infarto de miocardio y angina Additionally, Abciximab can be used as a prophylactic agent to reduce the risk of myocardial infarction and angina

(JT Willerson, Circulation, 94:866 (1996); ML Simmons et al., Circulation, 89:596 (1994)). (JT Willerson, Circulation, 94: 866 (1996); ML Simmons et al, Circulation, 89: 596 (1994).).

[0008] También se conocen ciertos anticuerpos anticoagulantes. [0008] Certain anticoagulant antibodies are also known. Particularmente, se ha descrito que ciertos anticuerpos de unión a TF inhiben la coagulación de la sangre, presumiblemente interfiriendo con el ensamblaje de un complejo TF:VIIa catalíticamente activo (véase por ejemplo, Jeske et al., SEM in THROM. and HEMO, 22:213 (1996); Ragni et al., Circulation, 93:1913 (1996); Patente Europea No. 0 420 937 B1; W. Rufet al., Throm. Haemosp., 66:529 (1991); MM Fiorie et al., Blood, 8:3127 (1992)). Particularly, it has been disclosed that certain antibodies binding to TF inhibit blood coagulation, presumably by interfering with assembly of a TF complex. VIIa catalytically active (see e.g., Jeske et al, SEM in Throm and HEMO, 22. : 213 (1996); Ragni et al, Circulation, 93: 1913 (1996); European Patent No. B1 0,420,937; W. Rufet al, Throm Haemosp., 66: 529 (1991); MM Fiorie et... al, Blood., 8: 3127 (1992)).

[0009] Sin embargo, los actuales anticuerpos de unión a TF muestran desventajas significativas que pueden minimizar su idoneidad como anticoagulantes. [0009] However, current TF-binding antibodies exhibit significant disadvantages which can minimize their suitability as anticoagulants. Por ejemplo, los actuales anticuerpos de unión a TF no muestran una suficiente afinidad de unión para la actividad anticoagulante óptima. For example, current TF-binding antibodies do not exhibit sufficient binding affinity for optimal anti-coagulant activity. Por consiguiente, para muchas patologías trombóticas, para compensar dichas afinidades de unión inefectivas, se deben administrar niveles de anticuerpo inaceptablemente elevadas para minimizar la coagulación de la sangre. Accordingly, for many thrombotic conditions, to compensate for such ineffective binding affinities, administer antibody levels unacceptably high to minimize blood clotting. Además, los actuales anticuerpos de unión a TF no discriminan de manera eficaz entre TF nativo y formas no nativas de TF, es decir, los anticuerpos actuales no muestran una especificidad de unión suficiente. Further, current TF-binding antibodies do not discriminate effectively between native TF and non-native forms of TF, i.e. the current antibodies do not exhibit sufficient binding specificity. Además, los actuales anticuerpos de unión a TF no evitan que FX se una a TF y/o el complejo TF:VIIa. Further, current TF-binding antibodies do not prevent FX binds to TF and / or TF: VIIa complex.

[0010] De este modo, sería deseable tener un anticuerpo anticoagulante que se una a TF humano nativo con una afinidad y selectividad elevadas para inhibir así la coagulación indeseada de sangre y la formación de coágulos de sangre. [0010] Thus, it would be desirable to have an anticoagulant antibody that binds to native with high selectivity and affinity thus inhibiting unwanted blood clotting and the formation of blood clots human TF. Sería también deseable tener dicho anticuerpo anticoagulante que evite la unión del Factor X al complejo TF/VIIa. It would also be desirable to have anticoagulant antibody that prevents binding of Factor X complex TF / VIIa.

[0011] Fiore MM et al, Blood, vol. [0011] Fiore MM et al, Blood, vol. 80, no. 80, no. 12 (15 de diciembre), 1992; 12 (December 15), 1992; páginas 3127-3134 describe dos anticuerpos monoclonales anti-TF (TF8-11D12 y TF9-9C3). pages 3127-3134 discloses two anti-TF monoclonal antibodies (TF8-11D12 and TF9-9C3). WO 94/05328 se refiere a moléculas que se unen al factor tisular y alteran el complejo TF:VIIa. WO 94/05328 relates to molecules that bind tissue factor and disrupt the TF: VIIa complex. WO 96/40921 proporciona anticuerpos injertados en CDR contra factor tisular humano que mantiene la afinidad de unión elevada de anticuerpos monoclonales de roedor contra factor tisular, pero tienen una inmunogenicidad reducida. WO 96/40921 it provides CDR grafted human tissue factor against which maintains the high binding affinity of rodent monoclonal antibodies against tissue factor but have reduced immunogenicity antibodies. WO 89/12463 se refiere a un método y composición terapéutica para el tratamiento del infarto de miocardio que comprende la administración de un antagonista de proteína de factor tisular y un agente trombolítico. WO 89/12463 relates to a method and therapeutic composition for the treatment of myocardial infarction comprising administering an antagonist of tissue factor protein and a thrombolytic agent. US 5 437 864 proporciona un método de inhibición de la coagulación den circulación extracorpórea en un sujeto, que comprende la administración de una cantidad terapéuticamente efectiva de un anticuerpo monoclonal que inhibe la capacidad del factor tisular de unirse al factor VII/VIIa. US 5,437,864 provides a method of inhibiting coagulation in extracorporeal circulation give a subject, comprising administering a therapeutically effective amount of a monoclonal antibody that inhibits the ability of tissue factor to bind factor VII / VIIa.

DESCRIPCIÓN RESUMIDA DE LA INVENCIÓN SUMMARY OF THE INVENTION

[0012] Se han descubierto anticuerpos que proporcionan una actividad anticoagulante superior mediante la unión de un TF humano nativo con una afinidad y especificidad elevadas. [0012] We have discovered antibodies that provide superior anti-coagulant activity by binding native human TF of a with high specificity and affinity. De este modo, en un aspecto, la presente invención proporciona la reivindicación 1. Los anticuerpos de la invención pueden inhibir de manera eficaz la coagulación de la sangre in vivo. Thus, in one aspect, the present invention provides claim 1. Antibodies of the invention can effectively inhibit blood coagulation in vivo. Los anticuerpos de la invención se pueden unir a TF humano nativo, ya sea solo o presente en un complejo TF:VIIa, evitando de manera efectiva la unión del factor X a TF o ese complejo, y reduciendo así la coagulación de la sangre. The antibodies of the invention can bind native human TF, either alone or present in a TF: VIIa complex, effectively preventing the binding of X to TF or that complex factor, and thereby reducing blood coagulation.

[0013] Los anticuerpos preferidos de la invención con monoclonales y unen específicamente y une un epítopo conformacional predominante a TF humano nativo, cuyo epítopo proporciona un sitio de unión a anticuerpo inesperadamente fuerte. [0013] Preferred antibodies of the invention with monoclonal and specifically bind and binds a dominant conformational epitope to native human TF, which epitope provides a binding site unexpectedly strong antibody. De hecho, los anticuerpos preferidos de la invención se unen a TF humano nativo por lo menos aproximadamente 5 veces más, más habitualmente por lo menos aproximadamente diez veces más que la afinidad de unión mostrada por anticuerpos anticoagulantes anteriores. Indeed, preferred antibodies of the invention bind to native human TF at least about 5 times, more usually at least about ten times more than the binding affinity exhibited by prior anticoagulant antibodies. Adicionalmente, los anticuerpos preferidos de la invención son selectivos para TF humano nativo y no se unen sustancialmente a TF no nativo o desnaturalizado. Additionally preferred antibodies of the invention are selective for native human TF and does not substantially bind non-native or denatured TF. H36.D2.B7 (secretado por el hibridoma ATCC HB-12255) es un anticuerpo especialmente preferido de la invención. H36.D2.B7 (secreted by hybridoma ATCC HB-12255) is an especially preferred antibody of the invention.

[0014] Los anticuerpos preferidos de la invención se unen a TF, de manera que FX no se une de manera efectiva al complejo TF/factor VIIa, por lo cual FX no se convierte de manera efectiva en su forma activada (FXa). [0014] Preferred antibodies of the invention bind TF so that FX does not bind effectively to the complex TF / factor VIIa, whereby FX is not converted effectively into its activated form (FXa). Los anticuerpos preferidos de la invención pueden inhibir la función de TF mediante el bloqueo eficaz de la unión o acceso de FX a moléculas de TF. Preferred antibodies of the invention can inhibit TF function by effectively blocking FX binding or access to TF molecules. Véanse, por ejemplo, los resultados del ejemplo 3 a continuación. See, for example, the results of Example 3 below.

[0015] Los anticuerpos preferidos de la invención tampoco inhiben significativamente la interacción o unión entre TF y el factor VIIa, o inhiben la actividad del complejo de TF:factor VIIa con respecto a materiales diferentes de FX. [0015] Preferred antibodies of the invention did not significantly inhibit the interaction or binding between TF and factor VIIa, or inhibit the activity of the complex of TF: factor VIIa regarding different materials FX. Véase, por ejemplo, los resultados del ejemplo 4 siguiente. See, for example, the results of Example 4 below.

[0016] La invención también proporciona ácidos nucleicos que codifican anticuerpos de la invención. [0016] The invention also provides nucleic acids encoding antibodies of the invention. Las secuencias de ácido nucleico y aminoácidos (SEC ID:NOS 1-4) de regions variables de H36.D2.B7 se establecen en las figuras 1A y 1B de los dibujos. The nucleic acid and amino acid (SEQ ID: NOS 1-4) of variable regions of H36.D2.B7 are set forth in Figures 1A and 1B of the drawings.

[0017] En aspectos preferidos, los anticuerpos de la invención son para utilizar en la inhibición de la coagulación de la sangre y la formación de coágulos de sangre y en la reducción de los niveles de TF humanos. [0017] In preferred aspects, antibodies of the invention are for use in the inhibition of blood clotting and the formation of blood clots and in reducing human TF levels.

[0018] En general, los anticuerpos de la invención serán útiles para modular prácticamente cualquier respuesta biológica mediada por la unión de FX a TF o el complejo TF:VIIa, incluyendo la coagulación de la sangre indicada anteriormente, la inflamación u otros trastornos. [0018] In general, the antibodies of the invention will be useful to modulate virtually any biological response mediated by FX binding to TF or the TF: VIIa complex, including blood coagulation as above, inflammation or other disorders.

[0019] Los anticuerpos de la invención son particularmente útiles para aliviar varias trombosis, particularmente para evitar o inhibir la reestenosis, u otras trombosis después de un procedimiento médico invasivo, tal como cirugía arterial o cardiaca (por ejemplo, angioplastia). [0019] The antibodies of the invention are particularly useful to alleviate various thromboses, particularly to prevent or inhibit restenosis, or other thromboses following an invasive medical procedure such as arterial or cardiac surgery (e.g., angioplasty). Los anticuerpos de la invención también se pueden utilizar para reducir o incluso eliminar de manera efectiva la coagulación de la sangre que surge de la utilización de dispositivos médicos (por ejemplo, un catéter, stent u otros dispositivos médicos). The antibodies of the invention can also be used to reduce or even effectively eliminate blood coagulation arising from use of medical devices (eg a catheter, stent or other medical devices). Los anticuerpos preferidos de la invención serán compatibles con muchas composiciones anticoagulantes, antiplaquetarias y trombolíticas, permitiendo así la administración en un formato de cóctel para reforzar o prolongar la inhibición de la coagulación dela sangre. Preferred antibodies of the invention are compatible with many compositions anticoagulants, antiplatelet and thrombolytic, thereby allowing administration in a cocktail format to boost or prolong inhibition of blood coagulation dela.

[0020] Los anticuerpos de la invención también se pueden emplear como anticoagulante en circulación extracorpórea de un mamífero, particularmente un sujeto humano. [0020] Antibodies of the invention can also be used as an anticoagulant in extracorporeal circulation of a mammal, particularly a human subject. En dichos métodos, se administran uno o más anticuerpos al mamífero en una cantidad suficiente para inhibir la coagulación de la sangre antes o durante la circulación extracorpórea, tal como puede ocurrir con la cirugía cardiopulmonar con bypass, la cirugía del transplante de órganos u otras cirugías prolongadas. In such methods, they are administered one or more antibodies to the mammal in an amount sufficient to inhibit blood coagulation prior to or during extracorporeal circulation such as may occur with cardiopulmonary bypass surgery, surgery of organ transplantation or other surgeries protracted.

[0021] Los anticuerpos de la presente invención también se pueden utilizar como portadores para fármacos, particularmente productos farmacéuticos dirigidos a la interacción con un coágulo de sangre, tales como estreptoquinasa, activador de plasminógeno de tejido (t-PA) o uroquinasa. [0021] The antibodies of the present invention also can be used as carriers for drugs, particularly pharmaceuticals targeted for interaction with a blood clot, such as streptokinase, tissue plasminogen activator (t-PA) or urokinase. De manera similar, los anticuerpos de la invención se pueden utilizar como agente citotóxico mediante la conjugación de una toxina adecuada al anticuerpo. Similarly, the antibodies of the invention can be used as cytotoxic agent by conjugating a suitable toxin to the antibody. Los conjugados de los anticuerpos de la invención también se pueden utilizar para reducir los niveles de factor tisular en un mamífero, particularmente un humano, mediante la administración al mamífero de una cantidad efectiva de un anticuerpo de la invención que está unido covalentemente a una toxina celular o una molécula efectora para proporcionar la capacidad de fijación al complemento y la citotoxicidad mediada por la célula dependiente de anticuerpo, mediante lo cual el conjugado de anticuerpo se pone en contacto con células que expresan el factor tisular para reducir así los niveles de factor tisular en el mamífero. Conjugates of antibodies of the invention can also be used to reduce tissue factor levels in a mammal, particularly a human, by administering to the mammal an effective amount of an antibody of the invention that is covalently attached to a cellular toxin or an effector molecule to provide the ability of complement fixation and cytotoxicity mediated antibody-dependent cell, whereby the antibody conjugate contacts cells expressing tissue factor to thereby reduce tissue factor levels in the mammal.

[0022] Los anticuerpos de la invención también se pueden utilizar en métodos de diagnóstico in vivo que incluyen la obtención de imágenes de diagnóstico in vivo de TF humano nativo. [0022] Antibodies of the invention can also be used in diagnostic methods including in vivo imaging in vivo diagnostic native human TF.

[0023] Los anticuerpos de la invención también se pueden utilizar en ensayos in vitro para detectar TF nativo en una muestra biológica que incluye un fluido biológico (por ejemplo, plasma o suero) o tejido (por ejemplo, una muestra de biopsia). [0023] Antibodies of the invention can also be used in in vitro assays to detect native TF in a biological sample includes a biological fluid (e.g. plasma or serum) or tissue (e.g., a biopsy sample). Más particularmente, se pueden utilizar varios inmunoensayos heterogéneos y homogéneos en un formato competitivo o no competitivo para detectar la presencia y preferiblemente una cantidad de TF nativo en la muestra biológica. More particularly, they can be used various heterogeneous and homogeneous immunoassays in a competitive or non-competitive format to detect the presence and preferably an amount of native TF in the biological sample.

[0024] Dichos ensayos de la invención son muy útiles para determinar la presencia o probabilidad de un paciente de tener una coagulación de sangre o un coágulo de sangre. [0024] Such assays of the invention are very useful for determining the presence or likelihood of a patient having a blood coagulation or a blood clot. Es decir, la coagulación de la sangre está normalmente acompañada por la expresión de TF en superficies celulares, tales como células que recubren la vasculatura. That is, the blood coagulation is usually accompanied by TF expression in cell, such as cells lining the vasculature surfaces. En ausencia de coagulación de sangre, TF no se expresa normalmente. In the absence of blood coagulation, TF is not normally expressed. De este modo, la detección de TF en una muestra de fluido corporal mediante un ensayo de la invención será indicativa de la coagulación de la sangre. Thus, the detection of TF in a body fluid sample by an assay of the invention will be indicative of blood coagulation.

[0025] Los anticuerpos de la invención también se pueden utilizar para preparar TF nativo sustancialmente puro, particularmente TF humano nativo, de una muestra biológica. [0025] Antibodies of the invention can also be used to prepare substantially pure native TF, particularly native human TF, from a biological sample. Los anticuerpos de la invención también se pueden utilizar para detectar y purificar células que expresan TF nativo. The antibodies of the invention can also be used to detect and purify cells expressing native TF.

[0026] Los anticuerpos de la invención también se pueden utilizar como componente de un kit de diagnóstico, por ejemplo, para detectar y preferiblemente cuantificar el TF nativo en una muestra biológica. [0026] Antibodies of the invention can also be used as a component of a diagnostic kit, for example, to detect and quantify preferably native TF in a biological sample. Otros aspectos de la invención se describen más abajo y también se establecen en las reivindicaciones adjuntas. Other aspects of the invention are described below and set forth in the appended claims.

BREVE DESCRIPCIÓN DE LOS DIBUJOS BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Las figuras 1A y 1B muestra las secuencias de ácido nucleico (SEC ID NOS:1 y 3) y aminoácido (SEC ID NOS:2 y 4) de regiones variables de cadena ligera y cadena pesada de H36.D2.B7 con regiones hipervariables (CDRs o Regiones Determinantes de Complementariedad) subrayadas (subrayado simple para secuencias de ácido nucleico y subrayado doble para secuencias de aminoácidos). [0027] Figures 1A and 1B shows the nucleic acid sequences (SEQ ID NOS: 1 and 3) and amino acid (SEQ ID NOS: 2 and 4) variable regions of light chain and heavy chain with H36.D2.B7 hypervariable regions (CDRs or Complementarity Determining regions) underlined (underlined simple to nucleic acid sequences and double underline for amino acid sequences).

La figura 2 muestra las constantes de asociación (Ka) y disociación (Kd) de anticuerpos anti-factor tisular tal como se determina mediante ELISA o análisis BIACore. Figure 2 shows the association constants (Ka) and dissociation (Kd) of anti-tissue factor antibodies as determined by ELISA or BIACore analysis.

La figura 3 muestra la inhibición de la activación de FX mediada por el complejo TF:VIIa mediante la preincubación con factores anti-factor tisular. Figure 3 shows inhibition of FX activation mediated TF: VIIa complex by preincubation with anti-tissue factor factors.

La figura 4 muestra la inhibición de actividad de TF/VIIa hacia el sustrato S-2288 específico de FIBA por los anticuerpos antifactor tisular. Figure 4 shows inhibition of TF / VIIa to the S-2288 substrate by FIBA ​​specific antifactor tissue antibodies.

La figura 5 muestra la capacidad del anticuerpo H36 de incrementar el tiempo de protrombina (PT) en un ensayo de coagulación iniciado por TF. Figure 5 shows the ability of the antibody H36 to increase prothrombin time (PT) in a clotting assay initiated by TF.

Las figuras 6A y 6B muestran gráficamente la relación entre la formación de FXa y la proporción molar del anticuerpo H36.D2 y rhTF. 6A and 6B graphically show the relationship between FXa formation and molar ratio of the H36.D2 antibody and rhTF. Figura 6A: H36.D2 se preincubó con el complejo FT:VIIa antes de añadir FX. Figure 6A: H36.D2 was pre-incubated with the FT: VIIa complex prior to adding FX. Figura 6B: H36.D2, TF:VIIa y FX se añadieron simultáneamente. Figure 6B: H36.D2, TF: VIIa and FX were added simultaneously.

La figura 7 muestra la inhibición de la actividad de TF:VIIa por el anticuerpo H36.D2 en un ensayo de activación de células J-82. Figure 7 shows inhibition of TF activity: VIIa by H36.D2 antibody in an activation assay of J-82 cells. Las figuras 8A y 8B son representaciones de transferencias de puntos que muestran que el anticuerpo H36.D2 se une a un epítopo conformacional en rhTF. 8A and 8B are representations of dot blots showing that the H36.D2 antibody binds a conformational epitope on rhTF. Carril 1- rhTF nativo, Carril 2- rhTF nativo tratado con urea 8M, Carril 3- rhTF nativo tratado con urea 8 M y DTT 5 mM. Lane 1- native rhTF, lane 2- native rhTF treated with 8M urea, Lane 3- native rhTF treated with 8M urea and 5mM DTT. En la figura 8A, la transferencia se expuso durante aproximadamente 40 segundos, mientras que en la figura 8B, la transferencia se expuso durante 120 segundos. In Figure 8A, the blot was exposed for approximately 40 seconds, whereas in Figure 8B, the blot was exposed for 120 seconds.

DESCRIPCIÓN DETALLADA DE LA INVENCIÓN DETAILED DESCRIPTION OF THE INVENTION

[0028] Tal como se ha descrito anteriormente, los anticuerpos preferidos de la invención muestran una afinidad sustancial para TF humano nativo. [0028] As described above, preferred antibodies of the invention exhibit substantial affinity for native human TF. En particular, los anticuerpos preferidos de la invención muestran una constante de asociación (Ka, M-1) para TF humano nativo de por lo menos aproximadamente 1 x 108 según se determina mediante análisis de plasmones de superficie (particularmente, análisis BIACore según los procedimientos del ejemplo 1 siguiente), más preferiblemente por lo menos aproximadamente 5 x 108 según se determina mediante análisis de plasmones de superficie, aún más preferiblemente una Ka (Ka, M-1) para TF humano nativo de por lo menos aproximadamente 1 x 1010 según se determina mediante análisis de plasmones de superficie. In particular, preferred antibodies of the invention exhibit an association constant (Ka, M -1) for native human TF of at least about 1 x 108 as determined by analysis of surface plasmons (particularly, BIAcore analysis according to the procedures example 1 below), more preferably at least about 5 x 108 as determined by analysis of surface plasmons, even more preferably a Ka (Ka, M-1) TF native human of at least about 1 x 1010 according It determined by surface plasmon analysis. Dicha afinidad de unión sustancial de anticuerpos de la invención contrasta claramente con las afinidades mucho menores de anticuerpos descritos previamente. Such substantial binding affinity of antibodies of the invention contrasts markedly with the much lower affinities previously described antibodies.

[0029] En este aspecto, se puede utilizar una concentración efectiva bastante baja de un anticuerpo de la presente invención, por ejemplo, una concentración relativamente baja de anticuerpo para inhibir la función de TF según se desee (por ejemplo, por lo menos aproximadamente 95, 98 ó 99 por ciento de inhibición) en un ensayo in vitro, tal como el descrito ene l ejemplo 3 siguiente. [0029] In this aspect, one can use a very low effective concentration of an antibody of the present invention, for example, a relatively low concentration of antibody to inhibit the function of TF as desired (for example, at least about 95 , 98 or 99 percent inhibition) in an in vitro assay, as described Jan l example 3 below.

[0030] Los anticuerpos preferidos son altamente específicos para TF humano nativo, y preferiblemente no se unen sustancialmente con TF no nativo. [0030] Preferred antibodies are highly specific for native human TF, and preferably do not substantially bind with non-native TF. Los anticuerpos preferidos no se unen sustancialmente a TF no nativo u otras moléculas inmunológicamente no relacionadas según se determina, por ejemplo, mediante un ensayo de transferencia de puntos estándar (por ejemplo, sin unión o esencialmente sin unión a TF no nativo detectado visualmente mediante ensayo de transferencia de puntos). Preferred antibodies do not substantially bind non-native TF or other molecules immunologically unrelated as determined, for example, using a transfer assay standard points (for example, without binding or substantially no binding to TF nonnative detected visually by assaying transfer points). Las referencias de la presente invención a “TF no nativo” significan un TF humano natural o recombinante que ha sido tratado con un agente caotrópico, de manera que se desnaturaliza el TF. References herein to "non-native TF" mean a natural or recombinant human TF that has been treated with a chaotropic agent so that the TF is denatured. Los agentes caotrópicos incluyen un detergente (por ejemplo, SDS), urea, combinada con ditiotreotol o �-mercaptoetanol; Chaotropic agents include a detergent (e.g. SDS), urea combined with ditiotreotol or mercaptoethanol; clorhidrato de guanidina y similares. guanidine hydrochloride and the like. El anticuerpo H36, H36.D2 o H36.D2.B7 no se une sustancialmente a dicho TF no nativo. The H36, H36.D2 or H36.D2.B7 antibody does not substantially bind to said non-native TF. Véase, por ejemplo, los resultados del ejemplo 8 siguiente y es un ensayo de transferencia de puntos. See, for example, the results of Example 8 below and is a dot blot assay.

[0031] Tal como se ha descrito anteriormente, los anticuerpos preferidos de la invención también se unirán con TF, de manera que FX no se une de manera efectiva al complejo TF/factor VIIa, mediante lo cual FX no se convierte de manera efectiva en un forma activada (FXa). [0031] As described above, preferred antibodies of the invention also bind with TF so that FX does not bind effectively to the TF / factor VIIa complex whereby FX is not converted effectively into one activated form (FXa). Los anticuerpos particularmente preferidos de la invención inhibirán fuertemente la actividad de FX a un complejo TF/factor VIIa, por ejemplo, una inhibición de por lo menos aproximadamente el 50%, más preferiblemente por lo menos aproximadamente el 80%, e incluso más preferiblemente por lo menos aproximadamente 90% ó 95%, incluso a concentraciones bajas de TF, tales como menos de aproximadamente 1,0 nM de TF, o incluso menos de aproximadamente 0,20 nM ó 0,10 nM de TF, según se determina mediante un ensayo de unión in vitro estándar tal como el del ejemplo 3 siguiente e incluye poner en contacto FX con un complejo de TF:factor VIIa tanto en presencia (es decir, muestra experimental) como en ausencia (es decir, muestra de control) de un anticuerpo de la invención y determinar la diferencia en porcentaje de la conversión de FX a FXa entre las muestras experimentales y de control. Particularly preferred antibodies of the invention strongly inhibit the activity of FX to a TF / factor VIIa complex, for example, an inhibition of at least about 50%, more preferably at least about 80%, and even more preferably at least about 90% or 95%, even at low concentrations of TF, such as less than about 1.0 nM TF, or even less than about 0.20 nM or 0.10 nM TF, as determined by assay in vitro standard as the example 3 following binding and includes contacting FX with a complex of TF: factor VIIa both in the presence (i.e. experimental sample) and absence (i.e. control sample) of a antibody of the invention and determining the percent difference of conversion of FX to the FXa between the experimental and control samples.

[0032] Los anticuerpos de la invención son preferiblemente sustancialmente puros cuando se utilizan en los métodos y ensayos descritos. [0032] The antibodies of the invention are preferably substantially pure when used in the methods and assays described. Las referencias a un anticuerpo que es “sustancialmente puro” significa un anticuerpo o proteína que se ha separado de componentes que lo acompañan de forma natural. References to an antibody that is "substantially pure" means an antibody or protein that has been separated from components which naturally accompany it. Por ejemplo, mediante la utilización de técnicas de purificación por inmunoafinidad estándar o de afinidad con proteína A, un anticuerpo de la invención se puede purificar a partir de un cultivo de hibridoma mediante la utilización de TF nativo como un antígeno o resina de proteína A. De manera similar, se puede obtener TF nativo en una forma sustancialmente pura mediante la utilización de un anticuerpo de la invención con técnicas de purificación de inmunoafinidad estándar. For example, using standard purification techniques immunoaffinity or protein A affinity, an antibody of the invention can be purified from hybridoma culture by using native TF as of antigen or protein A resin Similarly, native TF can be obtained in substantially pure form by using an antibody of the invention with standard techniques immunoaffinity purification. Particularmente, un anticuerpo o proteína es sustancialmente puro cuando por lo menos un 50% de la proteína total (% en peso de la proteína total en una muestra determinada) es un anticuerpo o proteína de la invención. Particularly, an antibody or protein is substantially pure when at least 50% of the total protein (weight% of total protein in a given sample) is an antibody or protein of the invention. Preferiblemente, el anticuerpo o proteína es por lo menos un 60% en peso de la proteína total, más preferiblemente por lo menos un 75% en peso, incluso más preferiblemente por lo menos un 90% en peso, y lo más preferiblemente por lo menos un 98% en peso del material total. Preferably the antibody or protein is at least 60% by weight of the total protein, more preferably at least 75% by weight, even more preferably at least 90% by weight, and most preferably at least 98% by weight of the total material. La pureza se puede analizar fácilmente mediante métodos conocidos, tales como electroforesis en gel SDS (PAGE), cromatografía en columna (por ejemplo, cromatografía de afinidad) en análisis HPLC. Purity can be readily analyzed by known, such as SDS gel electrophoresis (PAGE), column chromatography (eg, affinity chromatography) HPLC analysis methods.

[0033] Las secuencias de ácidos nucleicos (SEC ID NOS: 1 y 3) y aminoácidos (SEC ID NOS: 2 y 4) de un anticuerpo preferido de la invención (H36.D2.B7) se muestran en las figuras 1A y 1B de los dibujos. [0033] The nucleic acid sequences (SEQ ID NOS: 1 and 3) and amino acid (SEQ ID NOS: 2 and 4) of a preferred of the invention (H36.D2.B7) antibody are shown in Figures 1A and 1B of the drawings. Las SEC ID NOS. SEQ ID NOS. 1 y 2 son las secuencias de ácidos nucleicos y aminoácidos respectivamente de la región variable de cadena ligera, y SEC ID NOS. 1 and 2 are the nucleic acid sequences and amino acid respectively of the light chain variable region, and SEQ ID NOS. 3 y 4 son las secuencias de ácidos nucleicos y aminoácidos respectivamente de la región variable de cadena pesada, con las regiones hipervariables (CDR 3 and 4 are the nucleic acid sequences and amino acid respectively of the heavy chain variable region, with hypervariable regions (CDR

o Regiones Determinantes de Complementariedad) subrayada en todas estas secuencias. or Complementarity Determining Regions) underlined in all these sequences. [0034] Los anticuerpos preferidos adicionales de la invención tendrán una identidad de secuencia sustancial con una o ambas de las secuencias de cadena ligera o pesada mostradas en las figuras 1A y 1B. [0034] Preferred additional antibodies of the invention will have substantial sequence identity with one or both of the sequences of light or heavy chain shown in Figures 1A and 1B. Más particularmente, los anticuerpos preferidos incluyen aquellos que tienen por lo menos aproximadamente un 70 por ciento de homología (identidad en la secuencia) con la SEC ID NOS. More particularly, preferred antibodies include those having at least about 70 percent homology (sequence identity) with SEQ ID NOS. 2 y/o 4, más preferiblemente aproximadamente un 80 por ciento o más de homología con las SEC ID NOS. 2 and / or 4, more preferably about 80 percent or more homology to SEQ ID NOS. 2 y/o 4, aún más preferiblemente aproximadamente un 85, 90 ó 95 por ciento o más de homología con las SEC ID NOS. 2 and / or 4, still more preferably about 85, 90 or 95 percent or more homology to SEQ ID NOS. 2 y/o 4. 2 and / or 4.

[0035] Los anticuerpos preferidos de la invención tendrán una identidad en la secuencia elevada con las regiones hipervariables (mostradas con un doble subrayado en las figuras 1A y 1B) de las SEC ID NOS. [0035] Preferred antibodies of the invention have a high sequence identity with the hypervariable regions (shown with double underlining in Figures 1A and 1B) of SEQ ID NOS. 2 y 4). 2 and 4). Los anticuerpos especialmente preferidos de la invención tendrán tres regiones hipervariables de la región variable de cadena ligera de H36.D2.B7 (aquellas regiones hipervariables mostradas con el subrayado en la figura 1A y son las siguientes: 1) LASQTID (SEC ID NO:5); Particularly preferred antibodies of the invention will have three hypervariable regions of the variable light chain region of H36.D2.B7 (those hypervariable regions shown with underlining in Figure 1A and are the following: 1) LASQTID (SEQ ID NO: 5 ); 2) AATNLAD (SEC ID NO:6); 2) AATNLAD (SEQ ID NO: 6); y 3) QQVYSSPFT (SEC ID NO:7)). and 3) QQVYSSPFT (SEQ ID NO: 7)).

[0036] Los anticuerpos especialmente preferidos de la invención también tendrán tres regiones hipervariables de la región variable de cadena pesada de H36.D2.B7 (aquellas regiones hipervariables mostradas con subrayado en la figura 1B y son las siguientes: 1) TDYNVY (SEC ID NO:8); [0036] Particularly preferred antibodies of the invention also will have three hypervariable regions of the variable heavy chain region of H36.D2.B7 (those hypervariable regions shown with underlining in Figure 1B and are the following: 1) TDYNVY (SEQ ID NO: 8); 2) YIDPYNGITIYDQNFKG (SEC ID NO:9); 2) YIDPYNGITIYDQNFKG (SEQ ID NO: 9); y 3) DVTTALDF (SEC ID NO: 10). and 3) DVTTALDF (SEQ ID NO: 10).

[0037] Los ácidos nucleicos de la memoria tienen preferiblemente una longitud suficiente (preferiblemente por lo menos aproximadamente 100, 200 ó 250 pares de bases) para unirse a la secuencia de SEC ID NO:1 y/o SEC ID NO:3 bajo las siguientes condiciones moderadamente rigurosas (referidas aquí como condiciones de "rigurosidad normal): utilización de un tampón de hibridación que comprende formamida al 20% en tampón de solución salina 0,8 M/citrato de sodio 0,08M (SSC) a una temperatura de 37°C y que permanece unido cuando se somete a lavado una vez con ese tampón SSC a 37°C. [0037] Nucleic acids of memory preferably have a length sufficient (preferably at least about 100, 200 or 250 base pairs) to bind to the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 3 under following moderately stringent conditions (referred to herein as conditions "normal stringency): use of a hybridization buffer comprising 20% ​​formamide buffer 0.8M saline / 0.08M sodium citrate (SSC) at a temperature of 37 ° C and remaining bound when subject to washing once with that SSC buffer at 37 ° C.

[0038] Más preferiblemente, los ácidos nucleicos de la memoria (preferiblemente por lo menos aproximadamente 100, 200 ó 250 pares de bases) se unirán a la secuencia de SEC ID NO:1 y/o SEC ID NO:3 bajo las siguientes condiciones rigurosas elevadas (referidas aquí como condiciones de “ridurosidad elevada”): utilización de un tampón de hibridación que comprende formamida al 20% en tampón de solución salina 0,9 M/citrato de sodio 0,09M (SSC) a una temperatura de 42°C y que permanece unido cuando se somete a lavado dos veces con ese tampón SSC a 42°C. [0038] More preferably, the nucleic acids of the memory (preferably at least about 100, 200 or 250 base pairs) will bind to the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 3 under the following conditions rigorous high (referred to herein as conditions of "high ridurosidad"): use of a hybridization buffer comprising 20% ​​formamide in 0.9 M buffer / 0,09M sodium citrate (SSC) saline at a temperature of 42 ° C and remaining bound when subject to washing twice with that SSC buffer at 42 ° C.

[0039] Los ácidos nucleicos de la memoria comprenden preferiblemente por lo menos 20 pares de bases, más preferiblemente por lo menos aproximadamente 50 pares de bases, y aún más preferiblemente un ácido nucleico de la invención comprende por lo menos aproximadamente 100, 200, 250 ó 300 pares de bases. [0039] Nucleic acids of the memory preferably comprises at least 20 base pairs, more preferably at least about 50 base pairs, and even more preferably a nucleic acid of the invention comprises at least about 100, 200, 250 or 300 base pairs.

[0040] Los ácidos nucleicos generalmente preferidos de la invención expresarán un anticuerpo de la invención que muestra las afinidades de unión preferidas y otras propiedades aquí descritas. [0040] The generally preferred nucleic acids of the invention will express an antibody of the invention showing binding affinities of preferred and other properties described herein.

[0041] Los ácidos nucleicos preferidos de la invención también tendrán una identidad en la secuencia sustancial con una o ambas de las secuencias de cadena ligera o pesada mostradas en las figuras 1A y 1B. [0041] Preferred nucleic acids of the invention also have a substantial sequence identity with one or both of the sequences of light or heavy chain shown in Figures 1A and 1B. Más particularmente, los ácidos nucleicos preferidos comprenderán una secuencia que tiene por lo menos aproximadamente un 70 por ciento de homología (identidad en la secuencia) con la SEC ID NOS. More particularly, preferred nucleic acids will comprise a sequence having at least about 70 percent homology (sequence identity) with SEQ ID NOS. 1 y/o 3, más preferiblemente aproximadamente un 80 por ciento o más de homología con las SEC ID NOS. 1 and / or 3, more preferably about 80 percent or more homology to SEQ ID NOS. 1 y/o 3, aún más preferiblemente aproximadamente un 85, 90 ó 95 por ciento o más de homología con las SEC ID NOS. 1 and / or 3, still more preferably about 85, 90 or 95 percent or more homology to SEQ ID NOS. 1 y/o 3. 1 and / or 3.

[0042] Las secuencias de ácidos nucleicos particularmente preferidas de la invención tendrán una identidad en la secuencia elevada con las regiones hipervariables (mostradas con subrayado en las figuras 1A y 1B) de las SEC ID NOS. [0042] The nucleic acid sequences of particularly preferred invention will have high sequence the hypervariable regions (shown with underlining in Figures 1A and 1B) of SEQ ID NOS. 1 y 3). 1 and 3). Los ácidos nucleicos especialmente preferidos incluyen aquellos que codifican una región variable de cadena ligera de anticuerpo y que tienen tres secuencias que codifican regiones hipervariables de H36.D2.B7 (aquellas regiones hipervariables mostradas con el subrayado en la figura 1A y son las siguientes: 1) CTGGCAAGTCAGACCATTGAT (SEC ID NO:11); Especially preferred nucleic acids include those encoding a variable region of antibody light chain and having three sequences encoding hypervariable regions of H36.D2.B7 (those hypervariable regions shown with underlining in Figure 1A and are the following: 1 ) CTGGCAAGTCAGACCATTGAT (SEQ ID NO: 11); 2) GCTGCCACCAACTTGGCAGAT (SEC ID NO: 12); 2) GCTGCCACCAACTTGGCAGAT (SEQ ID NO: 12); y 3) CAACAAGTTTACAGTTCTCCATTCACGT (SEC ID NO:13)). and 3) CAACAAGTTTACAGTTCTCCATTCACGT (SEQ ID NO: 13)).

[0043] Los ácidos nucleicos especialmente preferidos también codifican una región variable de cadena pesada de anticuerpo y tienen tres secuencias que codifican regiones hipervariables de H36.D2.B7 (aquellas regiones hipervariables mostradas con subrayado en la figura 1B y son las siguientes: 1) ACTGACTACAACGTGTAC (SEC ID NO:14); [0043] Especially preferred nucleic acids also encode a heavy chain variable region antibody and have three sequences encoding hypervariable regions of H36.D2.B7 (those hypervariable regions shown with underlining in Figure 1B and are the following: 1) ACTGACTACAACGTGTAC (SEQ ID NO: 14); 2) TATATTGATCCTTACAATGGTATTACTATCTACGACCA GAACTTCAAGGGC (SEC ID NO:15); 2) TATATTGATCCTTACAATGGTATTACTATCTACGACCA GAACTTCAAGGGC (SEQ ID NO: 15); y 3) GATGTGACTACGGCCCTTGAC TTC (SEC ID NO: 16)). and 3) GATGTGACTACGGCCCTTGAC TTC (SEQ ID NO: 16)).

[0044] Los ácidos nucleicos de la invención están aislados, lo que significa que un ácido nucleico determinado constituye normalmente por lo menos aproximadamente un 0,5%, preferiblemente por lo menos aproximadamente un 2%, y más preferiblemente por lo menos aproximadamente un 5% en peso del ácido nucleico total presente en una fracción determinada. [0044] Nucleic acids of the invention are isolated, which means that a given nucleic acid usually constitutes at least about 0.5%, preferably at least about 2%, and more preferably at least about 5 % by weight of total nucleic acid present in a given fraction. Un ácido nucleico parcialmente puro constituye por lo menos aproximadamente un 10%, preferiblemente por lo menos aproximadamente un 30%, y más preferiblemente por lo menos aproximadamente un 60% en peso de ácido nucleico total presente en una fracción determinada. A partially pure nucleic acid constitutes at least about 10%, preferably at least about 30%, and more preferably at least about 60% by weight of total nucleic acid present in a given fraction. Un ácido nucleico puro constituye por lo menos aproximadamente un 80%, preferiblemente por lo menos aproximadamente un 90%, y más preferiblemente por lo menos aproximadamente un 95% en peso del ácido nucleico total presente en una fracción determinada. A pure nucleic acid constitutes at least about 80%, preferably at least about 90%, and more preferably at least about 95% by weight of total nucleic acid present in a given fraction.

[0045] Los anticuerpos de la invención se pueden preparar mediante técnicas generalmente conocidas en la técnica, y se generar habitualmente para una muestra purificada de TF nativo, habitualmente TF humano nativo, preferiblemente factor tisular humano recombinante (rhTF). [0045] Antibodies of the invention can be prepared by techniques generally known in the art, and are typically generated to a purified sample of native TF, typically native human TF, preferably recombinant human tissue factor (rhTF). El factor tisular humano recombinante truncado o "rhTF" (compuesto de 243 aminoácidos y que carece del dominio citoplasmático) es particularmente preferido para generar anticuerpos de la invención. Recombinant human truncated tissue factor or "rhTF" (243 amino acid compound and lacking the cytoplasmic domain) is particularly preferred to generate antibodies of the invention. Los anticuerpos también se pueden generar a partir de un péptido inmunogénico que comprende uno o más epítopos de TF nativo que no son mostrados por un TF no nativo. Antibodies can also be generated from an immunogenic peptide comprising one or more epitopes of native TF that are not exhibited by non-native TF one. Las referencias aquí a “TF nativo” incluyen dichas muestras de TF, incluyendo dicho rhTF. References herein to "native TF" include such TF samples, including such rhTF. Tal como se ha descrito anteriormente, los anticuerpos monoclonales son generalmente preferidos, aunque también se pueden utilizar anticuerpos policlonales. As described above, the monoclonal antibodies are generally preferred, although polyclonal antibodies can also be used.

[0046] Más particularmente, los anticuerpos se pueden preparar inmunizando un mamífero con una muestra purificada de TF humano nativo, o un péptido inmunogénico descrito anteriormente, solo o complejado con un portador. [0046] More particularly, antibodies can be prepared by immunizing a mammal with a purified sample of native human TF, or an immunogenic peptide as described above, alone or complexed with a carrier. Entre los mamíferos adecuados se incluyen animales típicos de laboratorio, tales como oveja, cabras, conejos, cobayas, ratas y ratones. Suitable mammals typical laboratory animals such as sheep, goats, rabbits, guinea pigs, rats and mice are included. Las ratas y los ratones, especialmente los ratones, son preferidos para obtener anticuerpos monoclonales. Rats and mice, especially mice, are preferred for obtaining monoclonal antibodies. El antígeno se puede administrar al mamífero mediante un conjunto de rutas adecuadas, tales como inyección subcutánea, intraperitoneal, intravenosa, intramuscular The antigen can be administered to the mammal by a set of suitable routes such as subcutaneous, intraperitoneal, intravenous, intramuscular

o intracutánea. or intradermal. El intervalo óptimo de inmunización, la dosis de inmunización, etc., pueden variar en intervalos relativamente amplios y se pueden determinar empíricamente en base a esta memoria. The optimal range of immunization, the immunizing dose, etc. can vary within relatively wide ranges and can be determined empirically based on this memory. Los procedimientos habituales implican la inyección del antígeno varias veces durante unos meses. Current methods involve injection of the antigen several times over several months. Los anticuerpos se recogen del suero del animal inmunizado mediante técnicas estándar y se criban para encontrar anticuerpos específicos para TF humano nativo. Antibodies are collected from serum of the immunized animal by standard techniques and screened to find antibodies specific for native human TF. Los anticuerpos monoclonales se pueden producir en células que producen anticuerpos y estas células se utilizan para generar anticuerpos monoclonales mediante técnicas de fusión estándar para formar células de hibridoma. Monoclonal antibodies can be produced in cells which produce antibodies and those cells used to generate monoclonal antibodies by standard techniques fusion to form hybridoma cells. Véase G. Kohler, et al., Nature, 256:456 (1975). See G. Kohler, et al, Nature, 256:. 456 (1975). Habitualmente, esto implica la fusión de una célula productora de anticuerpos con una línea celular inmortal, tal como una célula de mieloma, para producir la célula híbrida. Typically, this involves fusing an antibody-producing cell with an immortal cell line such as a myeloma cell to produce the hybrid cell. Alternativamente, se pueden producir anticuerpos monoclonales a partir de células mediante el método de Huse, et al., Science, 256:1275 (1989). Alternatively, monoclonal antibodies can be produced from cells by the method of Huse, et al, Science 256. 1275 (1989).

[0047] Un protocolo adecuado proporciona la inmunización intraperitoneal de un ratón con una composición que comprende complejo rhTF purificado realizado durante un periodo de aproximadamente dos a siete meses. [0047] A suitable protocol provides intraperitoneal immunization of a mouse with a composition comprising purified rhTF complex conducted over a period of about two to seven months. A continuación, las células del bazo se pueden extraer del ratón inmunizado. Then spleen cells can be removed from the immunized mouse. El suero del ratón inmunizado se analiza por los títulos de anticuerpos específicos para rhTF antes de la escisión de las células del bazo. The immunized mouse serum was analyzed by the specific antibody titers for rhTF prior to excision of spleen cells. Las células del bazo de ratón escindidas se fusionan a continuación a una línea celular linfoide homogénica o heterogénica (preferiblemente homogénica) adecuada que tiene un marcador, tal como deficiencia de hipoxantina-guanina fosforibosiltransferasa (HGPRT) o deficiencia de timidina quinasa (TK-). Spleen cells excised mouse are then fused to a lymphoid (preferably homogenic) suitable cell line homogenic or heterogénica having a marker such as hypoxanthine phosphoribosyltransferase deficiency guanine (HGPRT) or thymidine kinase deficiency (TK-). Preferiblemente, se utiliza una célula de mieloma como línea celular linfoide. Preferably a myeloma cell line such as lymphoid cell is used. Las células de mieloma y las células de bazo se mezclan juntas, por ejemplo, a una proporción de aproximadamente 1 a 4 células de mieloma con respecto a células de bazo. Myeloma cells and spleen cells are mixed together, for example, at a ratio of about 1 to 4 myeloma cells relative to spleen cells. Las células se pueden fusionar mediante el método de polietilenglicol (PEG). The cells can be fused by the polyethylene glycol method (PEG). Véase G. Kohler, et al., Nature, supra. See G. Kohler, et al., Nature, supra. El hibridoma clonado de este modo se desarrolla en un medio de cultivo, por ejemplo RPMI-1640. The hybridoma thus cloned is developed in a culture medium, for example RPMI-1640. Véase GE More, et al., Journal of American Medical Association, 199:549 (1967). More See GE, et al, Journal of American Medical Association, 199: 549. (1967). Los hibridomas, desarrollados después del procedimiento de fusión, se criban mediante, por ejemplo, radioinmunoensayo o inmunoensayo con enzimas para la secreción de anticuerpos que se unen específicamente al rhTF purificado, por ejemplo, se seleccionan anticuerpos que se unen a rhTF purificado, pero no a TF no nativo. Hybridomas developed after the fusion procedure, are screened by, for example, radioimmunoassay or enzyme immunoassay for secretion of antibodies that specifically bind to rhTF purified, for example, antibodies that bind to rhTF purified are selected, but not TF nonnative. Preferiblemente, se utiliza un ELISA para el cribado. Preferably an ELISA is used for screening. Los hibridomas que muestran resultados positivos después de dichos cribado se pueden expandir y clonar mediante el método de dilución limitante. Hybridomas that show positive results after such screening can be expanded and cloned by limiting dilution method. Preferiblemente, se realizan cribados adicionales para seleccionar anticuerpos que se pueden unir a rhTF en solución, así como en una muestra de fluido humano. Preferably additional screening are performed to select antibodies that can bind to rhTF in solution as well as in a human fluid sample. Los anticuerpos aislados se pueden purificar posteriormente mediante cualquier técnica inmunológica adecuada, incluyendo cromatografía de afinidad. The isolated antibodies can be further purified by any suitable immunological technique including affinity chromatography. El cultivo de hibridoma que produce el anticuerpo particular preferido H36.D2.B7 se ha depositado según el Tratado de Budapest con la American Type Culture Collection (ATCC) en 12301 Parklawn Drive, Rockville, MD, 10852. El cultivo de hibridoma se depositó con la ATCC el 8 de enero de 1997 y se le asignó el Número de Acceso ATCC HB-12255. The hybridoma culture producing the particular preferred H36.D2.B7 antibody has been deposited under the Budapest Treaty with the American Type Culture Collection (ATCC) at 12301 Parklawn Drive, Rockville, MD, 10852. The hybridoma culture was deposited with the ATCC on January 8, 1997 and was assigned ATCC Accession Number HB-12255.

[0048] Para aplicaciones terapéuticas humanas, puede ser deseable producir derivados de anticuerpos quiméricos, por ejemplo, moléculas de anticuerpo que combinan una región variable animal no humana y una región constante humana, para hacer así que los anticuerpos sean menos inmunogénicos en un sujeto humano que el correspondiente anticuerpo no quimérico. [0048] For human therapeutic applications, it may be desirable to produce chimeric antibody derivatives, ie, antibody molecules that combine a non-human animal variable region and a human constant region, to thereby make the antibodies would be less immunogenic in a human subject corresponding non-chimeric antibody. Se puede preparar una variedad de tipos de dichos anticuerpos quiméricos, incluyendo, por ejemplo, produciendo quimeras de regiones variables humanas, en que partes de las regiones variables, especialmente las regiones conservadas del dominio de unión a antígeno, son de origen humano y sólo las regiones hipervariables son de origen no humano. Can prepare a variety of types of such chimeric antibodies, including, for example, producing chimeras human variable regions, in which parts of the variable regions, especially the conserved regions of domain antigen binding, are of human origin and only the hypervariable regions are of non-human origin. Véanse también las descripciones de anticuerpos quiméricos y métodos de producción de los mismos en SL Morrison, Science, 229:1202-1207 (1985); See also the descriptions of chimeric antibodies and methods of production thereof in SL Morrison, Science, 229: 1202-1207 (1985); Oi et al., BioTechniques, 4:214 (1986); Oi et al, BioTechniques, 4:. 214 (1986); Teng et al., Proc. Teng et al., Proc. Natl. Natl. Acad. Acad. Sci. USA, 80:7308-7312 (1983); Sci USA, 80: 7308-7312 (1983);. Kozbor et al., Immunology Today, 4:7279 (1983); Kozbor et al, Immunology Today, 4: 7279 (1983);. Olsson et al., Meth. Olsson et al., Meth. Enzymol., 9:3-16 (1982). Enzymol., 9: 3-16 (1982). Adicionalmente, se pueden utilizar ratones transgénicos. Additionally, transgenic mice can be used. Por ejemplo, se han creado ratones transgénicos que portan repertorios de anticuerpos humanos que se pueden inmunizar con TF humano nativo. For example, we have created transgenic mice carrying human antibody repertoires can be immunized with which native human TF. Los esplenocitos de ratones transgénicos inmunizados se pueden entonces utilizar para crear hibridomas que secretan anticuerpos monoclonales humanos que reaccionan específicamente con TF humano nativo tal como se ha descrito anteriormente. Splenocytes from immunized transgenic mice can then be used to create hybridomas that secrete human monoclonal antibodies that specifically react with native human TF as described above. Véase, N. Lonberg et al., Nature, 368:856-859 (1994); See N. Lonberg et al, Nature, 368: 856-859 (1994);. LL Green et al., Nature Genet., 7:13-21 (1994); LL Green et al, Nature Genet., 7:. 13-21 (1994); SL Morrison, Proc. SL Morrison, Proc. Natl. Natl. Acad. Acad. Sci. USA, 81:6851-6855 (1994). Sci USA., 81: 6851-6855 (1994).

[0049] Los ácidos nucleicos de anticuerpos de la invención también se pueden preparar mediante la reacción en cadena de la polimerasa (véanse los cebadores descritos en el ejemplo 1 siguiente). [0049] Nucleic acids of antibodies of the invention can also be prepared by polymerase chain reaction (see primers disclosed in Example 1 below). Véase, en general, Sambrook et al., Molecular Cloning (2d ed. 1989). See generally, Sambrook et al., Molecular Cloning (2d ed. 1989). Dichos ácidos nucleicos también se pueden sintetizar mediante métodos conocidos, por ejemplo, el método de transferencia de triéster (véase Oligonucleotide Synthesis, IRL Press (MJ Gait, ed., 1984)), o utilizando un sintetizador de oligonucleótidos automatizado disponible comercialmente. Such nucleic acids can also be synthesized by known methods, eg the triester method of transferring (see Oligonucleotide Synthesis, IRL Press (MJ Gait, ed., 1984)), or using an automated oligonucleotide synthesizer commercially available. Dichos ácido nucleico de la invención preparado se puede utilizar para expresar un anticuerpo de la invención mediante técnicas conocidas. Such nucleic acid of the invention prepared can be used to express an antibody of the invention by known techniques. Por ejemplo, un ácido nucleico que codifica un anticuerpo de la invención se puede incorporar en un vector adecuado por métodos conocidos mediante, por ejemplo, la utilización de enzimas de restricción para hacer cortes en el vector para la inserción de la construcción seguido de la unión. For example, a nucleic acid encoding an antibody of the invention may be incorporated into a suitable vector by known methods by, for example, the use of restriction enzymes to make cuts in the vector for insertion of the construct followed by ligation . El vector que contiene la secuencia de ácidos nucleicos insertada, unida operativamente de forma adecuada a una secuencia de promotor, se introduce a continuación en células huésped para la expresión. The vector containing the inserted nucleic acid sequence, operably linked appropriately to a promoter sequence, is then introduced into host cells for expression. Véase, en general, Sambrook et al., supra. See generally, Sambrook et al., Supra. La selección de vectores adecuados se puede realizar empíricamente en base a factores que dependen del protocolo de clonación. Selection of suitable vectors can be made empirically based on factors depending on the cloning protocol. Por ejemplo, el vector debe ser compatible con y tener el replicón adecuado para la célula huésped que se utiliza. For example, the vector should be compatible with and have the proper replicon for the host cell used. Además, el vector debe ser capaz de acomodar la secuencia de ácidos nucleicos insertada. Furthermore, the vector must be able to accommodate the inserted nucleic acid sequence. Las células huésped adecuadas incluirán una amplia variedad de células eucariotas o procariotas, tales como E. Coli y similares. Suitable host cells include a wide variety of eukaryotic or prokaryotic cells, such as E. coli and the like.

[0050] El peso molecular de los anticuerpos de la invención variará dependiendo de varios factores, tales como el uso pretendido y si el anticuerpo incluye una toxina conjugada o fusionada recombinantemente, un producto farmacéutico o marcador detectable, o similares. [0050] The molecular weight of the antibodies of the invention will vary depending on several factors such as the intended use and whether the antibody includes a conjugated or recombinantly fused like toxin, a pharmaceutical or detectable label, or. En general, un anticuerpo de la invención tendrá un peso molecular de entre aproximadamente 20 a 150 kDa. In general, an antibody of the invention will have a molecular weight of between about 20 to 150 kDa. Dichos pesos moleculares se pueden determinar fácilmente mediante métodos de tamaño molecular, tales como electroforesis en gel SDS-PAGE seguido de la tinción con proteínas o análisis de transferencia Western. Such molecular weights can be readily determined by methods of molecular size, such as gel electrophoresis SDS-PAGE followed by protein staining or Western blot analysis.

[0051] "Anticuerpo de la invención” u otro término similar se refiere a la inmunoglobulina completa, así como a fragmentos inmunológicamente activos que se unen a TF nativo. Las inmunoglobulinas y los fragmentos inmunológicamente activos de las mismas incluyen un sitio de unión a anticuerpo (es decir, un epítopo capaz de unirse específicamente a TF humano nativo). Entre los fragmentos de anticuerpo de ejemplo se incluyen, por ejemplo, fragmentos Fab, F(v), Fab', F(ab')2, "medias moléculas" obtenidas mediante la reducción de los enlaces disulfuro de inmunoglobulinas, inmunoglobulinas de cadena sencilla, u otros fragmentos de unión a antígeno adecuados (véase, por ejemplo, Bird et al., Science, pp. 242-424 (1988); Huston et al., PNAS, (USA), 85:5879 (1988); Webber et al., Mol. Immunol., 32:249 (1995)). El anticuerpo o fragmento inmunológicamente activo del mismo pueden ser de animal (por ejemplo, un roedor, tal como un ratón o una rata), o una forma quimérica (véase Mo [0051] "Antibody of the invention" or other similar term refers to whole immunoglobulin as well as immunologically active fragments which bind native TF. Immunoglobulins and assets of the same immunologically fragments include a binding site antibody (ie, an epitope capable of specifically binding native human TF). Among the antibody fragments of example they include, for example, Fab fragments, F (v), Fab ', F (ab') 2, "middle molecules "obtained by reducing the disulfide bonds of immunoglobulins, single chain immunoglobulins, or other binding fragments suitable antigen (see, e.g., Bird et al, Science, pp 242-424 (1988);.. Huston et al ., PNAS, (USA), 85: 5879 (1988); Webber et al, Mol Immunol., 32:... 249 (1995)) the antibody or fragment immunologically active thereof may be of animal (for example, a rodent such as a mouse or rat), or chimeric form (see Mo rrison et al., PNAS, 81:6851 (1984); rrison et al, PNAS, 81: 6851 (1984). Jones et al., Nature, pp. Jones et al., Nature, pp. 321, 522 (1986)). 321, 522 (1986)). Se pueden preferir los anticuerpos de cadena sencilla de la invención. You may be preferred single chain antibodies of the invention.

[0052] De manera similar, un “ácido nucleico de la invención” se refiere a una secuencia que se puede expresar para proporcionar un anticuerpo de la invención tal como se especifica que significa dicho término inmediatamente arriba. [0052] Similarly a "nucleic acid of the invention" refers to a sequence which can be expressed to provide an antibody of the invention as specified meaning the word immediately above.

[0053] Tal como se ha descrito anteriormente, los anticuerpos de la invención se pueden administrar a un mamífero, preferiblemente un primate, tal como un humano, para prevenir o reducir trombosis, tal como reestenosis, habitualmente en una composición que incluye uno o más portadores no tóxicos farmacéuticamente aceptables, tales como agua estéril o solución salina, aceites de origen vegetal, y similares. [0053] As described above, the antibodies of the invention may be administered to a mammal, preferably a primate, such as a human, to prevent or reduce thrombosis, such as restenosis, typically in a composition including one or more nontoxic pharmaceutically acceptable carriers, such as sterile water or saline, vegetable oils, and the like. En particular, pueden ser copolímeros de polímero láctido, glicólido láctido o copolímeros de polioxietileno, polioxipropileno como excipientes para controlar la liberación de las composiciones que contienen anticuerpos descritas aquí. In particular, they can be copolymers of lactide polymer, lactide glycolide copolymer or polyoxyethylene, polyoxypropylene as excipients to control the release of the compositions containing antibodies described herein. Otros sistemas de administración potencialmente útiles incluyen partículas de etileno y acetato de vinilo, bombas osmóticas y sistemas de perfusión implantable y liposomas. Other potentially useful administration systems include ethylene particles and vinyl acetate, osmotic pumps and implantable infusion and liposomes. En general, una composición de anticoagulante de la invención estará en forma de una solución o una suspensión e incluirá preferiblemente aproximadamente de 0,01% a 10% (p/v) del anticuerpo de la presente invención, preferiblemente aproximadamente de 0,01 % a 5% (p/p) del anticuerpo. In general, a composition of the invention will anticoagulant as a solution or suspension and will preferably include approximately 0.01% to 10% (w / v) of the antibody of the present invention, preferably about 0.01% 5% (w / w) of the antibody. El anticuerpo se puede administrar como un único principio activo en la composición, o como un cóctel que incluye uno o más de otros anticoagulantes (por ejemplo, heparina, hirudina, o Bivalirudina), antiplaquetarios (por ejemplo, Abciximab o agentes trombolíticos (por ejemplo, activador de plasminógeno de tejido, estreptoquinasa y uroquinasa). Adicionalmente, los anticuerpos de la invención se pueden administrar antes, o después, de la administración de uno o más agentes anticoagulantes, antiplaquetarios o trombolíticos para reforzar o prolongar la actividad anticoagulante deseada. The antibody can be administered as a single active ingredient in the composition or as a cocktail including one or more other anticoagulants (e.g., heparin, hirudin, or Bivalirudin), anti-platelet (e.g., Abciximab or thrombolytic agents (eg , tissue plasminogen activator, streptokinase and urokinase). Additionally, antibodies of the invention may be administered before or after administration of one or more anticoagulants, antiplatelet or thrombolytics to reinforce or extend the desired anticoagulant activity agents.

[0054] Tal como se ha descrito también anteriormente, los anticuerpos de la invención se pueden utilizar para reducir la potencial coagulación de sangre que surge del uso de dispositivos médicos, por ejemplo, un dispositivo de acción interna, tal como un catéter, un stent, etc. [0054] As also described above, antibodies of the invention can be used to reduce potential blood coagulation arising from use of medical devices, for example, a device internal action, such as a catheter, a stent , etc. En un método preferido, el dispositivo se puede tratar con un anticuerpo de la invención (por ejemplo, como una solución salina de 1 mg/ml) antes de entrar en contacto con un fluido corporal. In a preferred method, the device may be treated with an antibody of the invention (eg as a saline solution of 1mg / ml) before contact with a body fluid. Alternativamente, o adicionalmente, un anticuerpo de la invención se puede combinar con el fluido corporal en una cantidad suficiente para minimizar la coagulación de la sangre. Alternatively, or additionally, an antibody of the invention may be combined with the body fluid in an amount sufficient to minimize blood clotting amount.

[0055] Las composiciones anticoagulantes terapéuticas según la presente invención son adecuadas para la utilización en la administración parenteral o intravenosa, particularmente en forma de soluciones líquidas. [0055] Therapeutic compositions anticoagulants according to the present invention are suitable for use in parenteral or intravenous administration, particularly in the form of liquid solutions. Dichas composiciones se pueden administrar convenientemente en dosis unitarias y se pueden preparar según métodos conocidos en el sector farmacéutico. Such compositions may conveniently be administered in unit dosage form and may be prepared by known methods in the pharmaceutical sector. Véase Remington's Pharmaceutical Sciences, (Mack Publishing Co., Easton PA, (1980)). See Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton PA, (1980)). Por el término "dosis unitaria" se entiende una composición terapéutica de la presente invención utilizada en una unidad físicamente discreta adecuada como dosis unitaria para un primate, tal como un humano, conteniendo cada unidad una cantidad predeterminada de material activo calculada para producir el efecto terapéutico deseado en asociación con el diluyente o portador requerido. By the term "dosage unit" is meant a therapeutic composition of the present invention used in a physically discrete unit suitable as unitary dosages for a primate such as a human, each unit containing a predetermined quantity of active material calculated to produce the therapeutic effect desired effect in association with the required diluent or carrier. La dosis unitaria dependerá de una variedad de factores que incluyen el tipo y la gravedad de la trombosis a tratar, la capacidad del sistema de coagulación de sangre del sujeto a utilizar el anticuerpo, el grado de inhibición o neutralización de la activación de FX deseada. The unit dose will depend upon a variety of factors including the type and severity of thrombosis to be treated, capacity of the coagulation system of blood of the subject using the antibody, the degree of inhibition or neutralization of activation desired FX. Las cantidades precisas del anticuerpo a administrar típicamente estarán guiadas por el criterio del médico, aunque la dosis unitaria dependerá en general de la ruta de administración y estará en el intervalo de 10 ng/kg de peso corporal hasta 50 mg/kg de peso corporal por día, más habitualmente en el intervalo de 100 ng/kg de peso corporal hasta aproximadamente 10 mg/kg de peso corporal por día. Precise amounts of the antibody to be administered typically will be guided by judgment of the physician, although the unit dose will generally depend upon the route of administration and be in the range of 10 ng / kg body weight to 50 mg / kg body weight per day, more usually in the range of 100 ng / kg body weight to about 10 mg / kg body weight per day. Las pautas adecuadas para la administración inicial en administraciones de refuerzo también son variables, pero se tipifican por una administración inicial seguida por dosis repetidas a intervalos de una o más horas mediante una inyección posterior u otra administración. Suitable for initial administration in booster administrations patterns are also variable, but are typified by an initial administration followed by repeated doses at intervals of one or more hours by a subsequent injection or other administration. Alternativamente, se pueden realizar perfusiones intravenosas continuas o intermitentes de forma suficiente para mantener concentraciones de por lo menos desde aproximadamente 10 nanomolar a 10 micromolar del anticuerpo en la sangre. Alternatively, one can perform intermittent intravenous infusions or continuous manner sufficient to maintain concentrations of at least from about 10 nanomolar to 10 micromolar of the antibody in blood.

[0056] En algunos casos, puede ser deseable modificar el anticuerpo de la presente invención para transmitir una propiedad biológica, química o física deseable al mismo. [0056] In some cases, it may be desirable to modify the antibody of the present invention to transmit a desirable biological, chemical or physical property thereto. Más particularmente, puede ser útil conjugar (es decir unir covalentemente) el anticuerpo a un agente farmacéutico, por ejemplo, un fármaco fibrinolítico, tal como t-Pa, estreptoquinasa, o uroquinasa para proporcionar actividad fibrinolítica. More particularly, it may be useful to conjugate (i.e. covalently link) the antibody to a pharmaceutical agent, for example, a fibrinolytic drug such as t-PA, streptokinase, or urokinase to provide fibrinolytic activity. Dicha unión se puede realizar mediante diversos métodos, incluyendo la utilización de una molécula de unión, tal como un agente reticulante de proteína heterobifuncional, por ejemplo, SPDP, carbodimida, o similar, o mediante métodos recombinantes. Such attachment may be accomplished by various methods, including the use of a binding molecule, such as a heterobifunctional protein cross-linking agent, for example, SPDP, carbodiimide, or the like, or by recombinant methods.

[0057] Además de productos farmacéuticos, tales como un agente fibrinolítico, se puede conjugar un anticuerpo de la invención a una toxina de, por ejemplo, origen vegetal o bacteriano, tal como la toxina de la difteria (es decir, DT), toxina shiga, abrina, toxina del cólera, ricina, saporina, exotoxinas de pseudomonas (PE), proteína antiviral de ombú o gelonina. [0057] In addition to pharmaceuticals such as a fibrinolytic agent products may be conjugated to an antibody of the invention to a toxin, for instance, plant or bacterial origin such as diphtheria toxin (i.e., DT), toxin shiga, abrin, cholera toxin, ricin, saporin, pseudomonas exotoxin (PE), antiviral protein or gelonin ombú. Los fragmentos biológicamente activos de dichas toxinas son bien conocidas en la técnica e incluyen, por ejemplo, cadena A de DT y cadena A de ricina. Biologically active fragments of such toxins are well known in the art and include, for example, DT A chain and ricin A chain. La toxina también puede ser un agente activo en las superficies celulares, tales como fosfolipasas (por ejemplo, fosfolipasa C). The toxin can also be an active agent in the cell, such as phospholipases (e.g., phospholipase C) surfaces. Como otro ejemplo, la toxina puede ser un fármaco quimioterapéutico, tal como, por ejemplo, vendesina, vincristina, vinblastina, metotrexato, adriamicina, bleomicina, o cisplatino, o, la toxina puede ser un radionucleido, tal como, por ejemplo, yodo-131, itrio-90, renio-188 o bismuto-212 (véase en general, Moskaug et al., J. Biol. Chem., 264:15709 (1989); 1. As another example, the toxin can be a chemotherapeutic drug such as, for example, vendesina, vincristine, vinblastine, methotrexate, adriamycin, bleomycin, or cisplatin, or, the toxin can be a radionuclide, such as, for example, iodo- 131, yttrium-90, rhenium-188 or bismuth-212 (see generally, Moskaug et al, J Biol Chem 264:... 15709 (1989); 1.

Pastan et al., Cell, 47:641 (1986); Pastan et al, Cell, 47: 641 (1986). Pastan et al., Recombinant Toxins as Novel Therapeutic Agents, Ann. Graze et al., Recombinant Toxins as Novel Therapeutic Agents, Ann. Rev. Biochem., 61:331 (1992); Rev. Biochem, 61: 331 (1992). Chimeric Toxins Olsnes and Phil, Pharmac. Chimeric Toxins Olsnes and Phil, Pharmac. Ther., 25:355 (1982); Ther., 25: 355 (1982); solicitud PCT publicada No. WO 94/29350; Published PCT application WO 94/29350 No.; solicitud PCT publicada No. WO 94/04689; Published PCT application WO 94/04689 No.; y patente de Estados Unidos No. 5,620,939). and Patent No. 5,620,939 US). Además, tal como se ha descrito anteriormente, además de una toxina, un anticuerpo de la invención se puede conjugar a una molécula efectora (por ejemplo, IgG1 o IgG3) para proporcionar la capacidad de fijación a complemento y citotoxicidad mediada por célula dependiente de anticuerpo tras la administración a un mamífero. Further, as described above, along with a toxin, an antibody of the invention can be conjugated to an effector molecule (e.g. IgG1 or IgG3) to provide fixability to complement and cytotoxicity mediated antibody-dependent cell upon administration to a mammal.

[0058] Dicho conjugado de anticuerpo/citotoxina o molécula efectora se puede administrar en una cantidad terapéuticamente eficaz a un mamífero, preferiblemente un primate, tal como un humano, donde se sabe que el mamífero tiene o se sospecha que tiene células tumorales, células del sistema inmune, o células de endotelio capaces de expresar TF. [0058] Such conjugated antibody / cytotoxin or effector molecule can be administered in a therapeutically effective amount to a mammal, preferably a primate, such as a human, where it is known that the mammal has or is suspected of having tumor cells, the immune system, or endothelial cells capable of expressing TF. Ejemplos de dichas células tumorales, células del sistema inmune y células de endotelio incluyen tumores malignos de la mama y pulmón, monocitos y endotelio vascular. Examples of such tumor cells, immune cells and endothelial cells include malignant tumors of breast and lung, monocytes and vascular endothelium.

[0059] Los anticuerpos de la invención también se pueden conjugar con una variedad de otros agentes farmacéuticos además de los descritos anteriormente, tales como, por ejemplo, enzimas, hormonas, agentes quelantes capaces de unirse a un radionucleido, así como otras proteínas y polipéptidos útiles para el diagnóstico o tratamiento de la enfermedad. [0059] Antibodies of the invention can also be conjugated with a variety of other pharmaceutical agents in addition to those described above, such as, for example, enzymes, hormones, chelating agents capable of binding a radionuclide, as well as other proteins and polypeptides useful for the diagnosis or treatment of disease. Para fines de diagnóstico, el anticuerpo de la presente invención se puede utilizar de forma marcada de forma detectable o no marcada. For diagnostic purposes, the antibody of the present invention can be used detectably labeled form or unlabeled. Por ejemplo, se puede utilizar de forma adecuada una amplia variedad de marcadores para marcar de forma detectable el anticuerpo, tal como radionucleidos, agentes fluorescentes, enzimas, sustratos enzimáticos, cofactores enzimáticos, inhibidores enzimáticos, ligandos, tales como, por ejemplo, haptenos y similares. For example, it can be suitably used a wide variety of markers to detectably label the antibody, such as radionuclides, fluorescers, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, ligands such as, for example, haptens and Similar.

[0060] También se describen métodos de diagnóstico incluyendo obtención de imágenes de diagnóstico in vivo [véase, por ejemplo, AK Abbas, Cellular and Molecular Immunology, pág. [0060] Diagnostic methods are also described including imaging in vivo diagnosis [see, for example, AK Abbas, Cellular and Molecular Immunology, p. 328 (WB Saunders Co. 1991)]. 328 (WB Saunders Co. 1991)]. Para la mayoría de aplicaciones de obtención de imágenes in vivo, un anticuerpo de la invención se puede marcar de forma detectable con, por ejemplo, 125I, 32P,99Tc, u otra etiqueta detectable, y posteriormente administrarse a un mamífero, particularmente un humano, durante una cantidad de tiempo predeterminado suficiente para permitir que el anticuerpo entre en contacto con una diana deseada. For most imaging applications in vivo imaging, an antibody of the invention can be detectably labeled with, e.g., 125I, 32P, 99Tc or other detectable tag, and subsequently administered to a mammal, particularly a human, during a predetermined amount of time sufficient to allow the antibody to contact a desired target. A continuación, el sujeto se rastrea mediante procedimientos conocidos, tales como un análisis de cámara escintigráfica para detectar la unión del anticuerpo. Then the subject is scanned by known procedures such as scintigraphic camera analysis to detect binding of the antibody procedures. El análisis podría ayudar en el diagnóstico y el tratamiento de un conjunto de trombosis, tales como las descritas específicamente aquí. The analysis could aid in the diagnosis and treatment of a number of thromboses such as those specifically described here. El método es particularmente útil cuando se utiliza conjuntamente con cirugía cardiaca, particularmente angioplastia, u otro procedimiento quirúrgico donde puede tener lugar la formación indeseada de un coágulo de sangre, para visualizar el desarrollo o movimiento de un coágulo de sangre. The method is particularly useful when used in conjunction with cardiac surgery, particularly angioplasty, or other surgical procedure where undesired may occur formation of a blood clot, to visualize the development or movement of a blood clot.

[0061] Los anticuerpos de la invención también se pueden utilizar para preparar TF nativo sustancialmente puro (por ejemplo, por lo menos aproximadamente 90% puro, preferiblemente por lo menos aproximadamente 96 ó 97% puro), particularmente TF humano nativo a partir de una muestra biológica. [0061] Antibodies of the invention can also be used to prepare substantially pure native TF (for example, at least about 90% pure, preferably at least about 96 or 97% pure), particularly native human TF from a biological sample. Por ejemplo, el TF nativo se puede obtener tal como se ha descrito previamente (véase, por ejemplo, LVM Rao et al., Thrombosis Res., 56:109 (1989)) y purificarse mezclando la solución con un soporte sólido que comprende el anticuerpo para formar una mezcla de reacción de acoplamiento. For example, native TF can be obtained as previously described (see, for example, LVM Rao et al, Thrombosis Res., 56:. 109 (1989)) and purified by admixing the solution with a solid support comprising antibody to form a coupling reaction mixture. Los soportes sólidos de ejemplo incluyen una pared de una placa, tal como una placa de microtitulación, así como soportes que incluyen o que consisten en poliestireno, cloruro de polivinilo, un dextrano reticulado, tal como Sephadex™ (Pharmacia Fine Chemicals), agarosa, partículas de poliestireno (Abbott Laboratories), cloruro de polivinilo, poliestireno, poliacrilamida en forma reticulada, nitrocelulosa o nylon y similares. Solid supports for example include a wall of a plate such as a microtiter plate well as supports including or consisting of polystyrene, polyvinyl chloride, cross-linked dextran such as Sephadex ™ (Pharmacia Fine Chemicals), agarose, polystyrene particles (Abbott Laboratories), polyvinyl chloride, polystyrene, polyacrylamide crosslinked form, nitrocellulose or nylon and the like. El TF se puede aislar a continuación del soporte sólido en forma sustancialmente pura según técnicas inmunológicas estándar. The TF can then be isolated from the solid support in substantially pure form by standard immunological techniques. Véase, en general, Harlow and Lane in Antibodies: A Laboratory Manual, CSH Publications, New York (1988) y Ausubel et al. See generally, Harlow and Lane in Antibodies: A Laboratory Manual, CSH Publications, New York (1988) and Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989). Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989).

[0062] Tal como se ha descrito anteriormente, los anticuerpos de la invención se pueden utilizar para detectar TF humano nativo en una muestra biológica, particularmente TF nativo asociado con un coágulo de sangre. [0062] As described above, the antibodies of the invention can be used to detect native human TF in a biological sample, particularly native TF associated with a blood clot. Entre las muestras biológicas de ejemplo se incluyen plasma sanguíneo, suero, saliva, orina, heces, secreciones vaginales, bilis, linfa, humores oculares, fluido cerebroespinal, medio de cultivo celular y tejido, particularmente tejidos vasculares, tales como tejido cardiaco. Among the biological samples such as blood plasma, serum, saliva, urine, feces, vaginal secretions, bile, lymph, ocular humors, cerebrospinal fluid, cell culture medium and tissue, particularly vascular tissues such as cardiac tissue they are included. Las muestras se pueden obtener de forma adecuada de un mamífero que padece o es sospechoso de padecer una trombosis, preferiblemente reestenosis, asociada con, por ejemplo un procedimiento médico invasivo, tal como una cirugía cardiopulmonar con bypass; Samples can be obtained suitably a mammal suffering or suspected of suffering from a thrombosis, preferably restenosis, associated with, for example an invasive medical procedure such as cardiopulmonary bypass surgery; una enfermedad cardiaca, tal como infarto de miocardio, cardiomiopatía, enfermedad valvular cardiaca, angina inestable, o fibrilación artrial asociada con embolia; heart disease such as myocardial infarction, cardiomyopathy, valvular heart disease, unstable angina, or artrial fibrillation associated with stroke; una coagulopatía, incluyendo coagulación intravascular diseminada, despliegue de un dispositivo, tal como un stent o catéter; coagulopathy including disseminated intravascular coagulation, deployment of a device such as a stent or catheter; choque (por ejemplo, síndrome de choque séptico), trauma vascular, enfermedad hepática, apoplejía cardiaca, tumores malignos (por ejemplo, carcinoma pancreático, ovárico, o célula pequeña de pulmón), lupus, eclampsia, enfermedad oclusiva perivascular y enfermedad renal. shock (e.g., septic shock syndrome), vascular trauma, liver disease, heart stroke, malignancies (e.g., pancreatic carcinoma, ovarian, or small lung cell), lupus, eclampsia, perivascular occlusive disease, and renal disease.

[0063] Para dichos ensayos, un anticuerpo de la invención se puede marcar de forma detectable con un átomo o molécula adecuada, por ejemplo, yodo radioactivo, tritio, biotina o reactivo capaz de generar un producto detectable, tal como un anticuerpo antiidiotípico, unido a una enzima, tal como una enzima, tal �-galactosidasa o peroxidada de rábano picante, o una etiqueta fluorescente (por ejemplo, fluoresceína o rodamina) según métodos conocidos. [0063] For such assays, an antibody of the invention can be detectably labeled with an atom or molecule suitable, for example, radioactive iodine, tritium, biotin, or reagent capable of generating a detectable product such as an anti-idiotypic antibody, bound an enzyme such as an enzyme, such galactosidase or horseradish peroxidase, or a fluorescent label (e.g. fluorescein or rhodamine) by known methods. Después de contactar la muestra biológica con el anticuerpo marcado de forma detectable, cualquier anticuerpo no reaccionado se puede separar de la muestra biológica, se detecta el marcador (o producto) mediante métodos inmunológicos convencionales incluyendo ensayo de captura de anticuerpos, ensayo de sándwich de anticuerpos, RIA, ELISA, inmunoprecipitación, inmunoabsorción y similares (véase Harlow y Lane, supra; Ausubel et al. supra). After contacting the biological sample with the labeled antibody detectably any antibody unreacted can be separated from the biological sample, the label (or product) is detected by conventional immunological methods including test antibody capture assay, antibody sandwich RIA, ELISA, immunoprecipitation, immunoabsorption and the like (see Harlow and Lane, supra; Ausubel et al supra.). Cualquier marcador (o producto) en exceso del detectado en una muestra de control adecuada es indicativo de la presencia de TF nativo, más particularmente un coágulo de sangre, en la muestra biológica. Any label (or product) in excess detected in a sample suitable control is indicative of the presence of native TF, more particularly a blood clot, in the biological sample. Por ejemplo, los anticuerpos de la invención se pueden marcar de forma detectable para detectar, y preferiblemente cuantificar, TF nativo según técnicas inmunológicas estándar, tales como ensayo de captura de anticuerpos, ELISA, ensayo de sándwich de anticuerpos, RIA, inmunoprecipitación, inmunoabsorción, y similares. For example, the antibodies of the invention can be detectably labeled to detect, and preferably quantitate, native TF in accordance with standard, such immunological techniques as capture assay antibodies, ELISA, antibody sandwich RIA, immunoprecipitation, immunoabsorption, and the like. En algunos casos, particularmente cuando se utiliza un tejido, la técnica inmunológica puede incluir la fijación de tejido con un reactivo conocido por mantener sustancialmente la conformación de la proteína (por ejemplo, formaldehído diluido). In some cases, particularly when a tissue is used, the immunological technique may include tissue fixation with a reagent known to substantially maintain protein conformation (e.g., dilute formaldehyde). Véase, en general, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, (1989); See generally, Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, New York, (1989).; Harlow and Lane in Antibodies: A Laboratory Manual, CSH Publications, NY (1988). Harlow and Lane in Antibodies: A Laboratory Manual, CSH Publications, NY (1988).

[0064] Los anticuerpos de la invención también se pueden utilizar para detectar y purificar células que expresan TF nativo, incluyendo fibroblastos, células del cerebro, células inmunes (por ejemplo, monocitos), epitelio, así como ciertas células malignas. [0064] Antibodies of the invention also can be used to detect and purify cells expressing native TF, including fibroblasts, brain cells, immune cells (eg, monocytes), epithelia, as well as certain malignant cells. Los métodos preferidos de detección y purificación de células incluyen métodos inmunológicos convencionales (por ejemplo, métodos de citometría de flujo, tales como FACS y “inmunospanning”). Preferred detection and purification methods include conventional cell immunological methods (for example, flow cytometry methods such as FACS and "inmunospanning"). Las poblaciones sustancialmente puras de células que expresan TF nativo son útiles en entornos clínicos y de investigación, por ejemplo, para establecer dichas células como células cultivadas para cribar anticuerpos de unión de TF. Substantially pure populations of cells expressing native TF are useful in clinical and research settings, for example, to establish such cells as cultured cells for screening TF-binding antibodies of.

[0065] La memoria también describe kits de análisis y diagnóstico para la detección de TF nativo, particularmente TF humano nativo, en una muestra de análisis, especialmente un fluido corporal, tal como sangre, plasma, etc., o tejido tal como se ha descrito anteriormente. [0065] The specification also discloses test kits and diagnostics for detection of native TF, particularly human TF native, in a test sample, especially a body fluid such as blood, plasma, etc., or tissue as has previously described. Un kit preferido incluye un anticuerpo de la invención marcado para su detección. A preferred kit includes an antibody of the invention labeled for detection. El kit de diagnóstico se puede utilizar en cualquier formato inmunológicamente aceptable, tal como un formato ELISA para detectar la presencia o cantidad de TF nativo en la muestra biológica. The diagnostic kit can be used in any acceptable immunological format such as an ELISA format to detect the presence or quantity of native TF in the biological sample.

[0066] Los siguientes ejemplos no limitantes son ilustrativos de la invención. [0066] The following nonlimiting examples are illustrative of the invention. En los siguientes ejemplos y en otros puntos se hace referencia a los anticuerpos H36 y H36.D2. In the following examples and elsewhere reference to and H36.D2 antibody H36 is. Esos anticuerpos son el mismo anticuerpo que H36.D2.B7, pero H36 deriva del clon madre, y H36.D2 se obtiene del clon primario, mientras que H36.D2.B7 se obtiene del clon secundario. Those antibodies are the same antibody as H36.D2.B7, but H36 is derived from clone mother, and H36.D2 is obtained from the primary clone, whereas H36.D2.B7 is obtained from the secondary clone. No se han observado diferencias entre esos tres clones con respecto a la capacidad de inhibir TF u otras propiedades físicas. No differences were observed between those three clones with respect to ability to inhibit TF or other physical properties.

EJEMPLO 1 – Preparación y clonación de anticuerpos monoclonales anti-rhTF. EXAMPLE 1 - Preparation and Cloning of Anti-rhTF Monoclonal antibodies. Se prepararon anticuerpos monoclonales contra rhTF tal y como sigue: Monoclonal antibodies against rhTF were prepared such as follows:

A. Inmunización y refuerzos A. Immunization and reinforcements

[0067] Se inmunizaron cinco ratones BALB/c hembras con 10 μg de rhTF lipidado y purificado en cada uno. [0067] five mice BALB / c mice were immunized with 10 ug of lipidated rhTF and purified in each. Inicialmente se sensibilizaron los ratones intraperitonealmente utilizando adyuvante Titermax de Hunter. Initially mice intraperitoneally using Hunter's Titermax adjuvant is sensitized. Se administraron tres refuerzos finales en NaCl al 0,85%. final three reinforcements in 0.85% NaCl was administered. Los refuerzos fueron 2, 5,5, y 6,5 meses después de la sensibilización inicial. Reinforcements were 2, 5.5, and 6.5 months after the initial sensitization. Todos los refuerzos se administraron intraperitonealmente, excepto el primero que fue subcutáneo. All reinforcements were administered intraperitoneally, but the first that was subcutaneous. Se administró el refuerzo final 3 días antes de la fusión y se administraron 20 μg. The final boost was given 3 days before the fusion and were administered 20 mg.

B. Fusión de linfocitos de bazo de ratón con células de mieloma de ratón B. Fusion of Mouse spleen lymphocytes with mouse myeloma cells

[0068] Se fusionaron linfocitos del bazo de un ratón BALB/c inmunizado con rhTF con células de mieloma de ratón X63-Ag8.653 utilizando PEG 1500. Después de la exposición a PEG, se incubaron las células durante una hora en suero bovino fetal inactivado con calor a 37ºC. [0068] Spleen cells of a BALB / c mouse immunized with rhTF with myeloma cells X63-Ag8.653 mouse using PEG 1500. Following exposure to PEG were fused, the cells were incubated for one hour in fetal bovine serum heat inactivated at 37 ° C. A continuación, se resuspendieron las células fusionadas en RPMI 1640 y se incubaron durante toda la noche a 37ºC con CO2 al 10%. Then the fused cells in RPMI 1640 and incubated overnight at 37C with 10% CO2 resuspended. Al día siguiente se pusieron las células en placas utilizando RPMI 1640 y se complementaron con sobrenadante de cultivo de macrófago. The next day cells were plated using RPMI 1640 and supplemented with macrophage culture supernatant.

C. Desarrollo de ELISA C. ELISA Development

[0069] Se recubrieron las placas para el ensayo de ELISA con 100 microlitros de factor de tejido recombinante (0,25 μg/ml) en un tampón basado en carbonato. [0069] The plates for the ELISA assay with 100 microliters of recombinant tissue factor (0.25 ug / ml) in a carbonate based buffer were coated. Todos los pasos se realizaron a temperatura ambiente. All steps were performed at room temperature. Se bloquearon las placas con BSA, se lavaron, ya continuación se añadieron las muestras de análisis y los controles. Plates were blocked with BSA, washed, and then the test samples and controls were added. Se detectó la unión antígeno/anticuerpo mediante la incubación de la placa con conjugado de HRP anti-ratón de cabra (Jackson ImmunoResearch Laboratories) ya continuación la utilización de un sistema de sustrato de ABTS peroxidasa (Kirkegaad and Perry Laboratories). antigen / antibody binding was detected by incubating the plate with HRP conjugated goat anti-mouse (Jackson ImmunoResearch Laboratories) and then using an ABTS substrate system peroxidase (Kirkegaad and Perry Laboratories). Se leyó la absorbancia en un lector de placas automático a una longitud de onda de 405 nm. Absorbance was read in a reader automatically to a wavelength of 405 nm plates.

D. Estabilización de líneas celulares de hibridoma de rhTF D. Stabilization of hybridoma cell lines of rhTF

[0070] Dos semanas después de la fusión, se inició el cribado de colonias de hibridoma mediante ELISA de rhTF específico. [0070] Two weeks after fusion, screening of hybridoma colonies was initiated by specific rhTF ELISA. El cribado para nuevas colonias continuó durante tres semanas. Screening for new colonies continued for three weeks. Se analizaron los clones positivos cada una o dos semanas por la producción de anticuerpo continuada hasta que se congelaron quince clones estables. Positive clones every one or two weeks of continued antibody production until fifteen analyzed stable clones were frozen.

E. Clonación primaria y secundaria E. Primary and Secondary Cloning

[0071] Se realizó la clonación por dilución limitante sobre cada uno de los hibridomas estables positivos para obtener clones primarios. [0071] Cloning was performed by limiting dilution on each of the positive stable hybridomas to obtain primary clones. Se descongelaron las células, se desarrollaron en cultivo durante un período de tiempo corto, ya continuación se diluyeron desde 10 células/pocillo hasta 0,1 células/pocillo. cells were thawed, grown in culture for a short period of time, and then diluted from 10 cells / well to 0.1 cells / well. Se analizaron los clones primarios mediante ELISA de anti-rhTF y se expandieron y se congelaron de cinco a seis clones positivos. primary clones were analyzed by ELISA and anti-rhTF expanded and frozen five to six positive clones.

[0072] Se obtuvo el clon secundario de anti-rhTF, H36.D2.B7, a partir del clon primario, H36.D2, se preparó y se guardó en nitrógeno líquido tal y como se describe anteriormente. [0072] the secondary clone anti-rhTF, H36.D2.B7 was obtained from primary clone, H36.D2, prepared and stored in liquid nitrogen and such as described above. Se prepararon cuatro diluciones diferentes, 5 células/pocillo, 2 células/pocillo, 1 célula/pocillo, 0,5 células/pocillo del clon primario en placas de microtitulación de 96 pocillos para comenzar la clonación secundaria. Four different dilutions, 5 cells / well, 2 cells / well, 1 cell / well, 0.5 cells / well of the primary clone plates 96-well microtiter to start the secondary cloning were prepared. Se diluyeron células en medios de cultivo de tejido IMDM que contenía los siguientes aditivos: suero bovino fetal al 20% (FBS), L-glutamina 2 mM, 100 unidades/ml de penicilina, 100 μg/ml de estreptomicina, GMS-S al 1%, NaHCO3 al 0,075%. Cells were diluted in culture media IMDM tissue containing the following additives: fetal bovine serum 20% (FBS), L-glutamine 2 mM, 100 units / ml penicillin, 100 ug / ml streptomycin, GMS-S to 1%, 0.075% NaHCO3. Para determinar clones que secretan anticuerpo anti-rhTF, se extrajeron los sobrenadantes de cinco pocillos individuales de la placa de microtitulación de 0,2 células/pocillo después de dos semanas de crecimiento y se analizaron por la presencia de anticuerpo anti-rhTF mediante ensayos ELISA tal y como se describe anteriormente. To determine clones that secrete anti-rhTF antibody, supernatants from five individual wells of the microtiter plate 0.2 cells / well after two weeks of growth were extracted and analyzed for the presence of anti-rhTF antibody by ELISA assays as described above. Los cinco clones mostraron resultados positivos en el ensayo ELISA, siendo el H36.D2.B7 el mejor productor de anticuerpos. All five clones showed positive results in the ELISA assay, H36.D2.B7 being the best antibody producer. Se adaptaron todos los cinco clones y se expandieron en medio RPMI que contenía los siguientes aditivos: FBS al 10%, L-glutamina 2 mM, 100 unidades/ml de penicilina, 100 μg/ml de estreptomicina, GMS-S al 1%, NaHCO3 al 0,075%, y 0,013 mg/ml de ácido oxalacético. All five clones were adapted and expanded in RPMI media containing the following additives: 10% FBS, L-glutamine 2 mM, 100 units / ml penicillin, 100 ug / ml streptomycin, GMS-S 1%, NaHCO3 0.075%, and 0.013 mg / ml oxaloacetic acid. Se purificó H36.D2.B7 mediante cromatografía de afinidad de Proteína A a partir del sobrenadante del cultivo celular y se analizó por su capacidad de inhibir TF:VIIa en un ensayo de activación de FX. H36.D2.B7 was purified by affinity chromatography Protein A from cell culture supernatant and analyzed by their ability to inhibit TF: VIIa in an activation assay of FX. Los resultados indicaron que H36.D2.B7 tenía la misma inhibición que el anticuerpo de H36.D2. The results indicated that H36.D2.B7 had the same inhibition as H36.D2 antibody. Se guardaron todas las células en nitrógeno líquido. All cells were stored in liquid nitrogen.

F. Aislamiento de ARN total de H36.D2.B7 F. Isolation of total RNA from H36.D2.B7

[0073] Se aislaron 269 μg de ARN total de 2,7 x 105 células de hibridoma H36.D2.B7. [0073] 269 .mu.g of total RNA from 2.7 x 105 hybridoma cells were isolated H36.D2.B7. Se realizó el aislamiento de ARN total tal y como se describe en el protocolo de RNeasy Midi Kits de Qiagen. isolation of total RNA was performed such as described in the RNeasy Midi Kits protocol from Qiagen. Se guardó la muestra de ARN en agua a -20ºC hasta que se necesitó. RNA sample was stored in water at -20 ° C until needed.

G. Síntesis de ADNc y clonación de regiones variables del gen de H36.D2.B7 G. cDNA Synthesis and cloning of variable regions of H36.D2.B7 Gene

[0074] Para obtener la primera cadena de ADNc, se preparó una mezcla de reacción que contenía 5 μg de ARN total aislado como se indica anteriormente, cebadores reversos JS300 (todos los cebadores están identificados a continuación) para la cadena pesada (HC) y OKA 57 para la cadena ligera (LC), inhibidor de ARnasa, dNTP, DTT, y transcriptasa inversa superscript II, y se incubó a 42°C durante 1 hora. [0074] For the first strand cDNA, a reaction mixture containing 5 ug of total RNA isolated as above, reverse primers JS300 (all primers are identified below) for the heavy chain (HC) was prepared and OKA 57 for the light chain (LC), RNase inhibitor, dNTP, DTT, and superscript II reverse transcriptase, and incubated at 42 ° C for 1 hour. A continuación se incuba el tubo de reacción a 65ºC durante 15 minutos para parar la transcripción. Then the reaction tube at 65 ° C for 15 minutes to incubate stop transcription. Después de enfriar, se añadieron cinco unidades de ARnasa H y se dejó incubar la reacción a 37ºC durante 20 minutos. After cooling, five units of RNase H were added and allowed to incubate the reaction at 37 for 20 minutes. Se guardó la muestra de ADNc a -70ºC hasta que se necesitó. The cDNA sample was stored at -70 ° C until needed.

[0075] Se realizó una PCR (reacción en cadena de la polimerasa) separadamente para clonar las regiones variables tanto de HC como de LC de anti-rhTF, H36.D2.B7 del ADNc producido como se indica anteriormente (en las Figuras 1A y 1B se describen las secuencias de ácidos nucleicos y aminoácidos de estas regiones variables de HC y LC). [0075] PCR (polymerase chain reaction) was conducted separately to clone the variable regions of both HC and LC of anti-rhTF, H36.D2.B7 cDNA produced as indicated above (in Figures 1A and 1B sequences nucleic and amino acid of these variable regions for HC and LC) are described. Se realizaron tres rondas de PCR. Three rounds of PCR were performed. Ronda 1: se procesó la PCR durante 35 ciclos a 96°C, 53°C y 72°C utilizando el cebador hacia delante JS002 y cebador reverso JS300 para HC. Round 1: PCR was run for 35 cycles at 96 ° C, 53 ° C and 72 ° C using the forward primer JS002 and JS300 for HC reverse primer. Para la LC se utilizaron el cebador hacia delante JS009 y el cebador reverso OKA 57 y se procesó la PCR durante 35 ciclos a 96°C, 63°C y 72°C. For LC front primer JS009 and to reverse primer OKA 57 were used and PCR was run for 35 cycles at 96 ° C, 63 ° C and 72 ° C. Ronda 2: se procesó la PCR tanto de HC como de LC igual que en la Ronda 1 con la excepción de que se utilizó pMC-18 para cebador hacia delante de HC y pMC-15 para cebador hacia delante de LC. Round 2: PCR both HC and LC was processed as in Round 1 with the exception that pMC-18 was used for HC front primer and to pMC-15 for LC forward primer. Ronda 3: se procesó la PCR durante 30 ciclos a 96ºC, 60-65ºC y 72ºC utilizando cebadores H36HCF y H36HCR para HC. Round 3: PCR was run for 30 cycles at 96 ° C, 60-65 ° C and 72 ° C using primers H36HCR H36HCF and HC. Para LC, se procesó la PCR durante 30 ciclos a 96ºC, 58ºC y 72ºC utilizando cebadores H36LCF y H36LCR. For LC, PCR was run for 30 cycles at 96 ° C, 58 ° C and 72 ° C using primers H36LCF and H36LCR.

[0076] Se utilizaron los siguientes cebadores para clonación de regiones variables de H36.D2.B7 de HC y LC. [0076] The following primers for cloning H36.D2.B7 variable regions of HC and LC of were used.

OKA 57: 5'-GCACCTCCAGATGTTAACTGCTC-3' (SEC ID Nº: 17) OKA 57: 5'-GCACCTCCAGATGTTAACTGCTC-3 '(SEQ ID NO: 17)

[0077] JS300: 5'-GAARTAVCCCTTGACCAGGC-3' (SEC ID Nº: 18) [0077] JS300: 5'-GAARTAVCCCTTGACCAGGC-3 '(SEQ ID NO: 18)

[0078] JS009: 5'-GGAGGCGGCGGTTCTGACATTGTGMTGWCMCARTC-3' (SEC ID Nº: 19) JS002: 5'-ATTTCAGGCCCAGCCGGCCATGGCCGARGTYCARCTKCARCARYC-3' (SEC ID Nº: 20) pMC-15: 5'-CCCGGGCCACCATGKCCCCWRCTCAGYTYCTKG-3' (SEC ID Nº: 21) pMC-18: 5'-CCCGGGCCACCATGGRATGSAGCTGKGTMATSCTC-3' (SEC ID Nº: 22) H36HCF: [0078] JS009: 5'-GGAGGCGGCGGTTCTGACATTGTGMTGWCMCARTC-3 '(SEQ ID NO: 19) JS002: 5'-ATTTCAGGCCCAGCCGGCCATGGCCGARGTYCARCTKCARCARYC-3' (SEQ ID NO: 20) pMC-15: 5'-CCCGGGCCACCATGKCCCCWRCTCAGYTYCTKG-3 '(SEQ ID NO : 21) pMC-18: 5'-CCCGGGCCACCATGGRATGSAGCTGKGTMATSCTC-3 '(SEQ ID NO: 22) H36HCF:

5'-ATATACTCGCGACAGCTACAGGTGTCCACTCCGAGATCCAGCTGCAGCAGTC-3' (SEC ID Nº: 23) 5'-ATATACTCGCGACAGCTACAGGTGTCCACTCCGAGATCCAGCTGCAGCAGTC-3 '(SEQ ID NO: 23)

H36HCR: H36HCR:

5'-GACCTGAATTCTAAGGAGACTGTGAGAGTGG-3' (SEC ID Nº: 24) H36LCF: 5'-TTAATTGATATCCAGATGACCCAGTCTCC-3' (SEC ID Nº: 25) H36LCR: TAATCGTTCGAAAAGTGTACTTACGTTTCAGCTCCAGCTTGGTCC (SEC ID Nº: 26) en el que desde la SEC ID Nº: 17 hasta la 26 anteriores: K es G o T; 5'-GACCTGAATTCTAAGGAGACTGTGAGAGTGG-3 '(SEQ ID NO: 24) H36LCF: 5'- TTAATTGATATCCAGATGACCCAGTCTCC-3' (SEQ ID NO: 25) H36LCR: TAATCGTTCGAAAAGTGTACTTACGTTTCAGCTCCAGCTTGGTCC (SEQ ID NO: 26) in which from SEQ ID NO: 17 to above 26: K is G or T; M es A o C; M is A or C; R es A o G; R is A or G; S es C o G; S is C or G; V es A, C V is A, C

o G; or G; W es A o T; W is A or T; Y es C o T. Y is C or T.

EJEMPLO 2 – Actividad de unión de Mabs de la invención EXAMPLE 2 - Binding activity of Mabs of the invention

[0079] Se utilizaron los Mabs de la invención tal y como se preparan en el Ejemplo 1 anterior. [0079] Mabs of the invention as were used and as prepared in Example 1 above. Se expresó la molécula rhTF en E.coli y se purificó mediante cromatografía de inmunoafinidad según los procedimientos estándar (ver Harlow y Lane, supra, Ausubel et al. supra). The rhTF molecule was expressed in E.coli and purified by immunoaffinity chromatography according to standard methods (see Harlow and Lane, supra, Ausubel et al. supra). Se determinaron las constantes de asociación (Ka) y de disociación (Kd) de Mab mediante ELISA y ensayos de resonancia de plasmones de superficie (es decir, BIACore) (ver por ejemplo, Harlow y Lane, supra; Ausubel et al. supra; Altschuh et al., Biochem., 31:6298 (1992); y el procedimiento BIAcore descrito por Pharmacia Biosensor). the association constants (Ka) and dissociation (Kd) of MAb by ELISA and plasmon resonance surface assays (ie, BIACore) were determined (see for example, Harlow and Lane, supra; Ausubel et al., supra; Altschuh et al, Biochem, 31: 6298 (1992); and the BIAcore method described by Pharmacia Biosensor)... Para ensayos BIACore, se inmovilizó rhTF sobre un chip biosensor según las instrucciones del fabricante. For testing Biacore rhTF he was immobilized on a biosensor chip according to the manufacturer's instructions. Se determinaron las constantes para cada Mab a cuatro concentraciones de anticuerpo (0,125 nM, 0,25 nM, 0,5 nM, y 1 nM). constants for each Mab four antibody concentrations (0.125 nM, 0.25 nM, 0.5 nM, and 1 nM) were determined. [0080] Se determinaron las concentraciones de proteína mediante ensayo estándar (MM Bradford, Anal. Biochem., [0080] Protein concentrations were determined by standard assay (Bradford MM, Anal. Biochem.,

72:248 (1976)) utilizando Albúmina Sérica Bovina como patrón y un reactivo colorante disponible comercialmente (Bio-Rad). 72: 248 (1976)) using Bovine Serum Albumin as a standard and a reactive dye commercially available (Bio-Rad).

[0081] La Figura 2 muestra las constantes de asociación y disociación para cada Mab anti-rhTF. [0081] Figure 2 shows the association and dissociation constants for each anti-rhTF Mab. Mab H36 mostró la mayor velocidad de asociación (Ka= 3,1 X 1010 M-1) y la menor velocidad de disociación (Kd=3,2 X 10-11 M) de cualquiera de los Mabs anti-rhTF analizados. Mab H36 exhibited the highest association rate (Ka = 3.1 X 1010 M-1) and the lower dissociation rate (Kd = 3.2 X 10-11 M) of any of the anti-rhTF Mabs tested.

EJEMPLO 3 – Ensayo de sustrato específico de FXa EXAMPLE 3 - Assay FXa specific substrate

[0082] En general, los experimentos descritos en la presente invención se realizaron utilizando rhTF lipidado con fosfatidilcolina (0,07 mg/ml) y fosfatidilserina (0,03 mg/ml) en un proporción 70/30 p/p en Tris-HCl 50 mM, pH 7,5, albúmina sérica bovina (BSA) al 0,1% durante 30 minutos a 37ºC. [0082] In general, the experiments described herein were conducted using rhTF lipidated with phosphatidylcholine (0.07 mg / ml) and phosphatidylserine (0.03 mg / ml) in a 70/30 w / w in Tris- 50 mM HCl, pH 7.5, bovine serum albumin (BSA) at 0.1% for 30 minutes at 37C. Se produjo una solución madre de complejo TF:VIIa preformado mediante la incubación de 5 nM del rhTF lipidado y 5 nM de FVIIa durante 30 minutos a 37ºC. There was a stock solution of TF: VIIa complex preformed by incubation of 5 nM lipidated rhTF and 5 of nM FVIIa for 30 minutes at 37C. Se alicuotó el complejo TF:VIIa y se guardó a -70ºC hasta que se necesitó. TF complex aliquoted: VIIa and stored at -70 ° C until needed. Se obtuvieron los factores humanos VII, VIIa y FX purificados de Enyzme Research Laboratories, Inc. Se utilizó el siguiente tampón para todos los ensayos de FXa y FVIIa: Hepes-NaOH 25 mM, CaCl2 5 mM, NaCl 150 mM, BSA al 0,1%, pH 7,5. human factors VII, VIIa and FX purified enyzme Research Laboratories, Inc. The following buffer was used for all FXa and FVIIa assays were obtained: Hepes-NaOH 25 mM, 5 mM CaCl2, 150 mM NaCl, BSA 0, 1%, pH 7.5.

[0083] Se cribaron los Mabs por la capacidad de bloquear la activación de FX a Fxa mediada por TF:VIIa. [0083] Mabs were screened for the ability to block the activation of FX to FXa mediated TF: VIIa. Se determinó la activación de FX en dos pasos discontinuos. FX activation in two discrete steps determined. En el primer paso (activación de FX), se ensayó la conversión de FX en FXa en presencia de Ca+2. In the first step (FX activation), FX conversion to FXa was assayed in the presence of Ca + 2. En el segundo paso (ensayo de actividad de Fxa), se detuvo la activación de FX mediante EDTA y se determinó la formación de FXa utilizando un sustrato cromogénico específico de FXa (S-2222). In the second step (FXa activity assay), FX activation was quenched by EDTA and the formation of FXa was determined using a FXa-specific chromogenic substrate (S-2222). Los cromógenos S-2222 y S-2288 (ver más adelante) se obtuvieron de Chromogenix (distribuido por Pharmacia Hepar Inc.). The chromogenic S-2222 and S-2288 (see below) were obtained from Chromogenix (distributed by Pharmacia Hepar Inc.). Se realizó la activación de FX en tubos de microcentrífuga de 1,5 ml mediante la incubación de la mezcla de reacción con TF:VIIa 0,08 nM, ya sea preincubado con un anticuerpo anti-rhTF o un tampón de control. FX activation was conducted in microcentrifuge tubes 1.5 ml by incubating the reaction mixture with TF: VIIa 0.08 nM, either preincubated with an anti-rhTF antibody or a buffer control. Se incubó posteriormente la mezcla de reacción durante 30 minutos a 37ºC, a continuación se añadió FX 30 nM seguido de una incubación adicional durante 10 minutos a 37ºC. The reaction mixture was subsequently incubated for 30 minutes at 37, then 30 nM FX was added followed by further incubation for 10 minutes at 37C. Se determinó la actividad de FXa en placas de titulación de 96 pocillos. FXa activity in plates 96 well titer was determined. Se extrajeron veinte microlitros de muestra del paso uno y se mezclaron con un mismo volumen de EDTA (500 nM) en cada pocillo, seguido de la adición de 0,144 ml de tampón y 0,016 ml de sustrato S-2222 5mM. Twenty microliters of sample from step one were extracted and mixed with an equal volume of EDTA (500 nM) to each well, followed by addition of 0.144 ml of buffer and 0.016 ml of 5mM substrate S-2222. Se dejó que se incubara la mezcla de reacción durante unos 15-30 minutos adicionales a 37ºC. Allow the reaction mixture was incubated for about 15-30 additional minutes at 37C. A continuación se detuvieron las mezclas de reacción con 0,05 ml de ácido acético al 50%, después del cual, se registró la absorbancia a 405 nm de cada mezcla de reacción. Then the reaction mixtures with 0.05 ml of acetic acid 50%, after which the absorbance at 405 nm of each reaction was stopped recorded. Se calculó la inhibición de la actividad de TF:VIIa a partir de los valores de DO405nm en las muestras experimentales (más anticuerpo) y de control (sin anticuerpo). VIIa from DO405nm values ​​in experimental samples (plus antibody) and control (no antibody): inhibition of TF activity was calculated. En algunos experimentos, se añadieron simultáneamente un anticuerpo anti-hTF, TF/VIIa, y FX para detectar la competición de unión. In some experiments, they were simultaneously added an anti-hTF, TF / VIIa, and FX antibody to detect binding competition. La Figura 3 muestra que el MAb H36.D2 (en negrita) inhibió la actividad de TF:/VIIa hacia FX en un grado significativamente mayor (95%) que otros Mabs anti-rHTF analizados. Figure 3 shows that MAb H36.D2 (in bold) inhibited TF activity: / VIIa toward FX to a significantly greater extent (95%) than other anti-rHTF Mabs analyzed.

EJEMPLO 4 – Ensayo de sustrato específico de FVIIa Example 4 - Assay of FVIIa specific substrate

[0084] Se cribaron adicionalmente los Mab mediante un ensayo específico de FVIIa. [0084] Mabs were further screened by an FVIIa specific assay. En este ensayo, se incubó en primer lugar rhTF lipidado 5 nM con tampón (control) o anticuerpo 50 nM (experimental) en una placa de microtitulación de 96 pocillos durante 30 minutos a 37°C, a continuación se mezcló con FVIIa humano purificado 5 nM (VT= 0,192 ml), seguido de una incubación de 30 minutos a 37°C. In this assay, it incubated first rhTF place lipidated 5 nM with buffer (control) or antibody 50 nM (experimental) in a microtiter plate 96 wells for 30 minutes at 37 ° C, then mixed with human FVIIa purified 5 nM (VT = 0.192 ml), followed by incubation for 30 minutes at 37 ° C. A continuación, se añadieron a cada pocillo ocho microlitros de una solución madre 20 mM del sustrato específico de FVIIa S-2288 (concentración final, 0,8 mM). Then, to each well they were added eight microliters of a 20mM stock solution of the FVIIa specific substrate S-2288 (final concentration, 0.8 mM). Posteriormente, la mezcla de reacción se incubó durante una hora a 37°C. Subsequently, the reaction mixture was incubated for one hour at 37 ° C. A continuación, se midió la absorbancia a 405 nm después de detenerla con 0,06 ml de ácido acético al 50%. Then, the absorbance at 405 nm after stopping with 0.06 ml of acetic acid 50% was measured. El porcentaje de inhibición de la actividad de TF/VIIa se calculó a partir de los valores de DO405nm de las muestras experimentales y de control. Percent inhibition of TF activity / VIIa was calculated from the values ​​of the experimental samples DO405nm and control.

[0085] La figura 4 muestra que el anticuerpo H36 no bloqueaba significativamente la actividad de TF/VIIa hacia el sustrato S2288 cuando el anticuerpo se preincubaba con TF (antes de la adición de VIIa) o se añadía a TF preincubado con VIIa (antes de añadir el anticuerpo). [0085] Figure 4 shows the H36 antibody did not significantly block the activity of TF / VIIa to the S2288 substrate when the antibody was preincubated with TF (prior to addition of VIIa) or added to TF pre-incubated with VIIa (prior adding antibody). Esto indica que H36 no interfiere con la interacción (unión) entre TF y FVIIa, y que H36 tampoco inhibe la actividad de TF:VIIa hacia un sustrato peptídico. This indicates that H36 does not interfere with the interaction (binding) between TF and FVIIa, and that H36 also inhibits the activity of TF: VIIa to a peptide substrate.

EJEMPLO 5 – Ensayo del tiempo de protrombina (PT) Example 5 - Assay of prothrombin time (PT)

[0086] El plasma sanguíneo calcificado coagulará en unos segundos después de la adición de tromplastina (TF); [0086] Blood plasma calcified coagulate within seconds after addition of tromplastina (TF); un fenómeno denominado el “tiempo de protrombina” (PT). a phenomenon called the "prothrombin time" (PT). Un PT prolongado es habitualmente un indicador útil de la actividad de anticoagulación (véase, por ejemplo, Gilman et al. supra). A prolonged PT is typically a useful indicator of anticoagulation activity (see e.g., Gilman et al. Supra).

[0087] El anticuerpo H36.D2 se investigó por la capacidad de afectar al PT según los métodos estándar utilizando plasma humano disponible comercialmente (Control Ci-Trol, Nivel I obtenido de Baxter Diagnostics Inc.). [0087] The H36.D2 antibody was investigated for capacity to affect PT according to standard methods using commercially available human plasma (Ci-Trol Control, Level I obtained from Baxter Diagnostics Inc.). Las reacciones de coagulación se iniciaron mediante la adición de rhTF lipidado en presencia de Ca++. Coagulation reactions were initiated by addition of lipidated rhTF in the presence Ca ++. El tiempo de coagulación de monitorizó mediante un controlador del tiempo de coagulación automatizado (MLA Electra 800). The clotting time monitored by a controller automated clotting time (MLA Electra 800). Los ensayo de PT se iniciaron mediante la inyección de 0,2 ml de rhTF lipidado (en un tampón de Tris-HCl 50 mM, pH 7,5, que contiene BSA al 0,1%, CaCl2 14,6 mM, 0,07 mg/ml de fosfatidilcolina, y 0,03 mg/ml de fosfatidilserina) en cubetas de doble pocillo de plástico. The PT assay initiated by injecting 0.2 ml of lipidated rhTF (in a buffer of 50 mM Tris-HCl, pH 7.5, containing 0.1% BSA, 14.6 mM CaCl2, 0, 07 mg / ml of phosphatidylcholine, and 0.03 mg / ml of phosphatidylserine) into cuvettes double plastic well. Las cubetas contenían cada una 0,1 ml del plasma preincubado con 0,01 ml de tampón (muestra de control) o anticuerpo (muestra experimental) durante 1-2 minutos. Cuvettes contained each 0.1 ml plasma preincubated with 0.01 ml of buffer (control sample) or antibody (experimental sample) for 1-2 minutes. La inhibición de coagulación mediada por TF por el anticuerpo H36.D2 se calculó utilizando una curva estándar de TF en la que el log [TF] se representó frente al log del tiempo de coagulación. Inhibition of TF-mediated coagulation by the H36.D2 antibody was calculated using a standard curve of TF in which the log [TF] was plotted against the log of the clotting time.

[0088] La figura 5 muestra que el anticuerpo H36.D2 inhibe sustancialmente la coagulación iniciada por TF en plasma humano. [0088] Figure 5 shows the H36.D2 antibody substantially that inhibits TF-initiated coagulation in human plasma. El anticuerpo H36.D2 incrementó los tiempo de PT significativamente, mostrando que el anticuerpo es un inhibidor efectivo de la coagulación iniciada por TF (hasta aproximadamente una inhibición del 99%). The H36.D2 antibody increased PT significantly the time, showing that the antibody is an effective inhibitor of TF-initiated coagulation (up to approximately 99% inhibition).

EJEMPLO 6 - FX y el anticuerpo H36.D2 compiten por la unión al complejo TF:VIIa EXAMPLE 6 - FX and H36.D2 antibody compete for the binding to TF: VIIa complex

[0089] Los experimentos de competición se realizaron entre TF/VIIa, FX y el anticuerpo H36.D2. [0089] Competition experiments were conducted between TF / VIIa, FX and the H36.D2 antibody. La figura 6A ilustra los resultados de un experimento en que un complejo TF/VIIa preformado (0,08 nM) se preincubó a 37°C durante 30 minutos en tampón incluyendo 0,02 nM, 0,04 nM, 0,08 nM y 0,16 nM del anticuerpo monoclonal H36.D2, respectivamente. 6A illustrates the results of an experiment in which a TF / VIIa preformed complex (0.08 nM) was preincubated at 37 ° C for 30 minutes in buffer including 0.02 nM, 0.04 nM, 0.08 nM and 0.16 nM H36.D2 monoclonal antibody, respectively. A continuación, se añadió FX (30 nM) a la mezcla de TF/VIIa y anticuerpo H36.D2 y la mezcla se dejó incubar durante 10 minutos adicionales a 37°C. Then FX is added (30 nM) to the mixture of TF / VIIa and H36.D2 antibody mixture and allowed to incubate for an additional 10 minutes at 37 ° C. La activación de FX se detuvo con EDTA tal como se ha descrito previamente. FX activation was quenched with EDTA as described previously. De este modo, el Fxa producido se determinó mediante el ensayo específico de FXa descrito en el Ejemplo 3 anterior. Thus, the FXa produced was determined by the FXa-specific assay described in Example 3 above.

[0090] La figura 6B muestra los resultados de un experimento realizado en la misma línea descrita anteriormente, a excepción de que el anticuerpo H36.D2, TF:VIIA preformado, y FX se añadieron simultáneamente para iniciar el ensayo de activación de FX. [0090] Figure 6B shows the results of an experiment conducted in the same line as described above, except that the H36.D2, TF antibody: VIIA preforming, and FX were added simultaneously to start the FX activation assay.

[0091] Los datos establecidos en las figuras 6A y 6B muestran que el anticuerpo H36.D2 y FX compiten por la unión al complejo TF/VIIa preformado. [0091] The data set forth in Figures 6A and 6B show that the H36.D2 antibody and FX compete for binding to TF / VIIa complex preformed.

EJEMPLO 7 – Inhibición de la actividad de TF en cultivo celular EXAMPLE 7 - Inhibition of TF activity in cell culture

[0092] J-82 es una línea celular de carcinoma de vejiga humano (disponible de ATCC) que expresa de manera abundante TF humano nativo como proteína de la superficie celular. [0092] J-82 cell line is a human bladder carcinoma (available from ATCC) expressing native human TF abundantly as cell surface protein. Para ver si el anticuerpo H36.D2 podía evitar que FX se uniera a TF nativo expresado en la superficie celular, se realizó un ensayo de activación de FX de J-82 en placas de microtitulación en presencia de FVII (véase DS Fair et al., J. Biol. Chem., 262:11692 (1987)). To see if the H36.D2 antibody could prevent FX join native TF expressed on the cell surface, a FX activation assay of J-82 in microtiter plates in the presence of FVII (see DS Fair et al was conducted. Chem., 262:. 11 692 (1987)). A cada pocillo, se añadieron 2 x 105 células y se incubaron con 50 ng de FVII, tampón (muestra de control) o el anticuerpo anti-TF (muestra experimental) durante 2 horas a 37°C. To each well, 2 x 105 cells were added and incubated with 50 ng FVII, buffer (control sample) or the anti-TF (experimental sample) antibody for 2 hours at 37 ° C. Después, cada pocillo se lavó suavemente con tampón y se añadieron 0,3 ml de FX (0,05 mg/ml) a cada pocillo durante 30 minutos a temperatura ambiente. Then, each well was washed gently with buffer and 0.3 ml of FX (0.05 mg / ml) was added to each well for 30 minutes at room temperature. En algunos casos, el anticuerpo se añadió a la vez que FX para detectar la competición de unión por el TF nativo. In some cases, the antibody was added while FX to detect binding competition for the native TF. Después de esto, se extrajeron alícuotas de 0,05 ml y se añadieron a nuevos pocillos en una placa de titulación de 96 pocillos que contenía 0,025 ml de EDTA 100 mM. Thereafter, 0.05 ml aliquots were removed and added to new wells in a titer plate 96 well containing 0.025 ml of 100 mM EDTA. La actividad de FXa se determinó mediante un ensayo específico de FXa tal como se describe en ejemplo 3 anterior. FXa activity was determined using a FXa-specific assay as described in Example 3 above. La inhibición de la actividad de TF en la superficie de las células J-82 se calculó a partir de la DO405 nm en ausencia (muestra de control) y presencia del anticuerpo (muestra experimental). Inhibition of TF activity on the surface of the J-82 cells was calculated from the OD 405 nm in the absence (control sample) and presence of antibody (experimental sample).

[0093] La figura 7 muestra que el anticuerpo H36.D2 se unió a TF nativo expresado en membranas celulares de J-82 e inhibió la activación de FX mediada por TF. [0093] Figure 7 shows that the H36.D2 antibody bound native TF expressed on cell membranes and inhibited J-82 FX activation mediated TF. Estos resultados indican que el anticuerpo compite con FX por la unión a TF nativo expresado en la superficie celular. These results indicate that the antibody competes with FX for binding to native TF expressed on the cell surface. Tomados con los datos del ejemplo 8 a continuación, los resultados también muestran que el anticuerpo H36.D2 se puede unir a un epítopo conformacional en TF nativo en una membrana celular. Taken with the data of Example 8 below, the results also show that the H36.D2 antibody can bind a conformational epitope on native TF in a cell membrane.

EJEMPLO 8 – Unión específica del anticuerpo H36.D2 a rhTF nativo EXAMPLE 8 - Specific Binding of the H36.D2 Antibody to Native rhTF

[0094] La evaluación de la unión de H36.D2 a rhTF nativo y no nativo se realizó mediante un ensayo de transferencia de puntos (dot) simplificado. [0094] Evaluation of H36.D2 binding to native and non-native rhTF was performed by a dot blot assay (dot) simplified. Específicamente, se diluyó rhTF hasta 30 !g/ml en cada uno de los siguientes tres tampones: 10 mM Tris-HCl 10 mM, pH 8,0; Specifically, rhTF was diluted to 30 g / ml in each of the following three buffers: 10 mM Tris-HCl 10 mM, pH 8.0; Tris-HCl 10 mM, pH 8,0 y urea 8 M; 10 mM Tris-HCl, pH 8.0 and 8M urea; y Tris-HCl 10 mM, pH 8,0, urea 8 M y ditiotreitol 5 mM. and 10 mM Tris-HCl, pH 8.0, 8 M urea and 5 mM dithiothreitol. La incubación en el tampón de Tris mantiene el rhTF en forma nativa, mientras que el tratamiento con urea 8 M y ditiotreitol 5 nM produce rhTF no nativo (desnaturalizado). Incubation in the Tris buffer maintains rhTF in the native form, whereas treatment with 8M urea and 5nM dithiothreitol produces non-native rhTF (denatured). Cada muestra se incubó durante 24 horas a temperatura ambiente. Each sample was incubated for 24 hours at room temperature. Después de la incubación, se prehumectó una membrana Millipore Immobilon (sección de 7x7cm) con metanol, seguido de Tris 25 mM, pH 10,4, incluyendo metanol al 20%. After incubation, a Millipore Immobilon membrane (7x7cm section) with methanol followed by 25 mM Tris, pH 10.4, including 20% ​​methanol was prehumectó. Después de secar las membranas al aire, se aplicaron 0,5 !l, 1 !l, y 2 !l de cada muestra (30 !g/ml) a la membrana y se secaron al vacío. After drying the membranes to the air, they applied 0.5 uL, 1 uL, and 2 ul of each sample (30 ug / ml) to the membrane and dried in vacuo. Después de bloquear la membrana mediante PBS que contenía leche desnatada al 5% (p/v) y NP-40 al 5% (v/v), la membrana se sondó con el anticuerpo H36.D2, seguido de la incubación con un conjugado de peroxidasa e IgG anti-ratón de cabra (obtenido de Jackson ImmunoResearch Laboratories, Inc.). After blocking the membrane by PBS containing 5% skimmed milk (w / v) NP-40 and 5% (v / v), the membrane was probed with H36.D2 antibody, followed by incubation with a conjugate peroxidase and anti-mouse IgG goat (obtained from Jackson ImmunoResearch Laboratories, Inc.). Después de la incubación con reactivos de transferencia Western ECL según las instrucciones del fabricante (Amersham), la membrana se envolvió con una película de plástico (Saran Wrap) y se expuso a una película de rayos X varias veces. After incubation with ECL Western blotting reagents according to manufacturer's instructions (Amersham), the membrane was wrapped with plastic film (Saran Wrap) and exposed to a film of X-rays repeatedly.

[0095] La figura 8A muestra que el Mab H36.D2 se une a un epítopo conformacional en TF nativo en presencia de tampón Tris o tampón Tris con urea 8M (carriles 1 y 2). [0095] Figure 8A shows the H36.D2 Mab binds a conformational epitope on native TF in the presence of Tris buffer or Tris buffer with 8M urea (lanes 1 and 2). El autorradiograma se expuso durante 40 segundos. The autoradiogram was exposed for 40 seconds. Sin embargo, cuando se desnaturalizó el TF nativo con urea 8M y DTT 5 mM, la unión de H36.D2 se redujo significativamente o se eliminó (carril 3). However, when the native TF with 8M urea and 5mM DTT denatured, H36.D2 binding was significantly reduced or (lane 3) was removed. La figura 8B muestra un autorradiograma sobreexpuesto que muestra la unión residual del anticuerpo H36.D2 a rhTF no nativo (es decir, desnaturalizado). 8B shows overexposed autoradiogram showing residual binding of antibody H36.D2 to rhTF non-native (i.e., denatured). La sobreexposición fue de aproximadamente 120 segundos. Overexposure was about 120 seconds. El tratamiento con urea 8M sola dio lugar probablemente a una desnaturalización sólo parcial del rhTF nativo, ya que los dos enlaces disulfuro en TF no se reducen. Treatment with 8M urea alone probably resulted in only partial denaturation of a native rhTF since the two disulfide bonds in TF are not reduced. También es posible que el TF parcialmente desnaturalizado se pueda replegar a la conformación nativa durante un proceso de transferencia posterior cuando se extrae la urea. It is also possible that the partially denatured TF may refold to be native conformation for a subsequent transfer process when urea is removed. Estos resultados también diferencian claramente los anticuerpos preferidos de la invención que no se unen a TF desnaturalizado de anticuerpos previamente descritos que no se unen selectivamente a un epítopo conformacional y se unen a TF desnaturalizado (véase la patente de Estados Unidos 5,437,864 donde en la Figura 18 el análisis de transferencia Western muestra la unión a TF desnaturalizado mediante SDS). These results also clearly distinguish preferred antibodies of the invention do not bind denatured TF from previously reported antibodies which do not selectively bind to a conformational epitope and bind to TF denatured (see US Patent 5,437,864 where in Figure 18 Western blot analysis shows binding to TF denatured by SDS).

LISTADO DE SECUENCIAS SEQUENCE LISTING

[0096] [0096]

(1) (one)
INFORMACIÓN GENERAL GENERAL INFORMATION

(i) SOLICITANTE: Wong, Hing C. Jiao, Jin-an Esperanza, Nieves Lawrence, Luepschen (I) APPLICANT: Wong Hing C. Jiao Jin-an Hope, Nieves Lawrence, Luepschen

(ii) (Ii)
T�?TULO DE LA INVENCIÓN: ANTICUERPOS PARA INHIBIR LA COAGULACIÓN DE LA SANGRE Y MÉTODOS DE UTILIZACIÓN DE LOS MISMOS TITLE OF INVENTION: antibodies to inhibit blood clotting AND METHODS OF USE THEREOF

(iii) NÚMERO DE SECUENCIAS: 26 (Iii) NUMBER OF SEQUENCES: 26

(iv) (Iv)
DIRECCIÓN DE CORRESPONDENCIA: CORRESPONDENCE ADDRESS:

(A) (TO)
DESTINATARIO: Dike, Bronstein, Roberts & Cushman, LLP RECIPIENT: Dike, Bronstein, Roberts & Cushman, LLP

(B) (B)
CALLE: 130 Water Street STREET: 130 Water Street

(C) (C)
CIUDAD: Boston CITY: Boston

(D) (D)
ESTADO: MA STATE: MA

(E) (AND)
PA�?S: Estado Unidos PA S: United States

(F) (F)
CP: 02109 CP: 02109

(v) (V)
FORMA DE LECTURA POR ORDENADOR: FORM computer readable:

(A) (TO)
TIPO DE MEDIO: Diskette MEDIUM TYPE: Diskette

(B) (B)
ORDENADOR: IBM Compatible COMPUTER: IBM Compatible

(C) (C)
SISTEMA OPERATIVO: DOS OPERATING SYSTEM: DOS

(D) (D)
SOFTWARE: FastSEQ Version 1.5 SOFTWARE: FastSEQ Version 1.5

(vi) (saw)
DATOS DE LA PRESENTE SOLICITUD: THIS APPLICATION DATA:

(A) (TO)
NÚMERO DE SOLICITUD: APPLICATION NUMBER:

(B) (B)
FECHA DE SOLICITUD: APPLICATION DATE:

(C) (C)
CLASIFICACIÓN: CLASSIFICATION:

(vii) DATOS DE LA SOLICITUD ANTERIOR: (Vii) the previous application DATA:

(A) (TO)
NÚMERO DE SOLICITUD: APPLICATION NUMBER:

(B) (B)
FECHA DE SOLICITUD: APPLICATION DATE:

(viii) INFORMACIÓN DEL ABOGADO/AGENTE: (Viii) ATTORNEY INFORMATION / AGENT:

(A) (TO)
NOMBRE: Corless, Peter F NAME: Corless, Peter F

(B) (B)
NÚMERO DE REGISTRO: 33,860 REGISTRATION NUMBER: 33.860

(C) (C)
NÚMERO DE REFERENCIA/EXPEDIENTE: 46943-PCT REFERENCE NUMBER / FILE: 46943-PCT

(ix) (Ix)
INFORMACIÓN DE COMUNICACIÓN: INFORMATION COMMUNICATION:

(A) (TO)
TELÉFONO: 617-523-3400 PHONE: 617-523-3400

(B) (B)
TELEFAX: 617-523-6440 Fax: 617-523-6440

(C) (C)
TELEX: TELEX:

(A) (TO)
LONGITUD: 7 aminoácidos LENGTH: 7 amino acids

(B) (B)
TIPO: aminoácido TYPE: amino acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: péptido MOLECULE TYPE: peptide

(2) INFORMACIÓN PARA LA SEC ID NO:1: (2) INFORMATION FOR SEQ ID NO: 1:

(i) CARACTER�?STICAS DE LA SECUENCIA: (A) LONGITUD: 321 pares de bases (B) TIPO: ácido nucleico (C) CADENA: sencilla(D) TOPOLOG�?A: lineal (I) SEQUENCE CHARACTER OF SPECIFICATIONS: (A) LENGTH: 321 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) topology: linear

(ii) TIPO DE MOLÉCULA: ADNc(iii) HIPOTÉTICO: NO (iv) ANTISENTIDO: NO (v) TIPO DE FRAGMENTO: (vi) ORIGEN: (Ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTISENSE: NO (v) FRAGMENT TYPE: (vi) ORIGIN:

(xi) DESCRIPCIÓN DE SECUENCIA: SEC ID NO:1: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

GACATTCAGA TGACCCAGTC TCCTGCCTCC CAGTCTGCAT CTCTGGGAGA AAGTGTCACC ATCACATGCC TGGCAAGTCA GACCATTGAT ACATGGTTAG CATGGTATCA GCAGAAACCA GGGAAATCTC CTCAGCTCCT GATTTATGCT GCCACCAACT TGGCAGATGG GGTCCCATCA AGGTTCAGTG GCAGTGGATC TGGCACAAAA TTTTCTTTCA AGATCAGCAG CCTACAGGCT GAAGATTTTG TAAATTATTA CTGTCAACAA GTTTACAGTT CTCCATTCAC GTTCGGTGCT GGGACCAAGC TGGAGCTGAA A GACATTCAGA TGACCCAGTC TCCTGCCTCC CAGTCTGCAT CTCTGGGAGA AAGTGTCACC ATCACATGCC TGGCAAGTCA GACCATTGAT ACATGGTTAG CATGGTATCA GCAGAAACCA GGGAAATCTC CTCAGCTCCT GATTTATGCT GCCACCAACT TGGCAGATGG GGTCCCATCA AGGTTCAGTG GCAGTGGATC TGGCACAAAA TTTTCTTTCA AGATCAGCAG CCTACAGGCT GAAGATTTTG TAAATTATTA CTGTCAACAA GTTTACAGTT CTCCATTCAC GTTCGGTGCT GGGACCAAGC TGGAGCTGAA A
60 120 180 240 300 321 60 120 180 240 300 321

(2) INFORMACIÓN PARA LA SEC ID NO:2: (2) INFORMATION FOR SEQ ID NO: 2:

(i) CARACTER�?STICAS DE LA SECUENCIA: (A) LONGITUD: 107 aminoácidos (B) TIPO: aminoácido (C) CADENA: sencilla(D) TOPOLOG�?A: lineal (I) SEQUENCE CHARACTER OF SPECIFICATIONS: (A) LENGTH: 107 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) topology: linear

(ii) TIPO DE MOLÉCULA: péptido (iii) HIPOTÉTICO: NO (iv) ANTISENTIDO: NO (v) TIPO DE FRAGMENTO: N-terminal (vi) ORIGEN: (Ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (iv) ANTISENSE: NO (v) FRAGMENT TYPE: N-terminal (vi) ORIGIN:

(xi) DESCRIPCIÓN DE SECUENCIA: SEC ID NO:2: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Gln Ser Ala Ser Leu Gly 1 5 10 15 Glu Ser Val Thr Ile Thr Cys Leu Ala Ser Gln Thr Ile Asp Thr Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro Gln Leu Leu Ile 35 40 45 Tyr Ala Ala Thr Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Lys Phe Ser Phe Lys Ile Ser Ser Leu Gln Ala 65 70 75 80 Glu Asp Phe Val Asn Tyr Tyr Cys Gln Gln Val Tyr Ser Ser Pro Phe 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Gln Ser Ala Ser Leu Gly January 5 10 15 Glu Ser Val Thr Ile Thr Cys Leu Ala Ser Gln Thr Ile Asp Thr Trp 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro Gln Leu Leu Ile 35 40 45 Tyr Ala Ala Thr Asn Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Lys Phe Ser Phe Lys Ile Ser Ser Leu Gln Ala 65 70 75 80 Glu Asp Phe Val Tyr Tyr Cys Gln Asn Gln Val Pro Phe Tyr Ser Ser Thr Phe 85 90 95 Gly Ala Gly Thr Lys Leu Glu Lys Leu 100 105

(2) INFORMACIÓN PARA LA SEC ID NO:3: (2) INFORMATION FOR SEQ ID NO: 3:

(i) CARACTER�?STICAS DE LA SECUENCIA: (A) LONGITUD: 351 pares de bases (B) TIPO: ácido nucleico (C) CADENA: sencilla(D) TOPOLOG�?A: lineal (I) SEQUENCE CHARACTER OF SPECIFICATIONS: (A) LENGTH: 351 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) topology: linear

(ii) TIPO DE MOLÉCULA: ADN (iii) HIPOTÉTICO: NO (iv) ANTISENTIDO: NO (Ii) MOLECULE TYPE: DNA (iii) HYPOTHETICAL: NO (iv) ANTISENSE: NO

(v) TIPO DE FRAGMENTO: (vi) ORIGEN: (V) FRAGMENT TYPE: (vi) ORIGIN:

(xi) DESCRIPCIÓN DE SECUENCIA: SEC ID NO:3: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

GAGATCCAGC TGCAGCAGTC TGGACCTGAG CTGGTGAAGC CTGGGGCTTC AGTGCAGGTA TCCTGCAAGA CTTCTGGTTA CTCATTCACT GACTACAACG TGTACTGGGT GAGGCAGAGC CATGGAAAGA GCCTTGAGTG GATTGGATAT ATTGATCCTT ACAATGGTAT TACTATCTAC GACCAGAACT TCAAGGGCAA GGCCACATTG ACTGTTGACA AGTCTTCCAC CACAGCCTTC ATGCATCTCA ACAGCCTGAC ATCTGACGAC TCTGCAGTTT ATTTCTGTGC AAGAGATGTG ACTACGGCCC TTGACTTCTG GGGCCAAGGC ACCACTCTCA CAGTCTCCTC A GAGATCCAGC TGCAGCAGTC TGGACCTGAG CTGGTGAAGC CTGGGGCTTC AGTGCAGGTA TCCTGCAAGA CTTCTGGTTA CTCATTCACT GACTACAACG TGTACTGGGT GAGGCAGAGC CATGGAAAGA GCCTTGAGTG GATTGGATAT ATTGATCCTT ACAATGGTAT TACTATCTAC GACCAGAACT TCAAGGGCAA GGCCACATTG ACTGTTGACA AGTCTTCCAC CACAGCCTTC ATGCATCTCA ACAGCCTGAC ATCTGACGAC TCTGCAGTTT ATTTCTGTGC AAGAGATGTG ACTACGGCCC TTGACTTCTG GGGCCAAGGC ACCACTCTCA CAGTCTCCTC A
60 120 180 240 300 351 60 120 180 240 300 351

(2) INFORMACIÓN PARA LA SEC ID NO:4: (2) INFORMATION FOR SEQ ID NO: 4:

(i) CARACTER�?STICAS DE LA SECUENCIA: (A) LONGITUD: 117 aminoácidos (B) TIPO: aminoácido (C) CADENA: sencilla(D) TOPOLOG�?A: lineal (I) AGER CHARACTER SEQUENCE: (A) LENGTH: 117 amino acids (B) TYPE: amino acid (C) CHAIN: single (D) topology: Linear

(ii) TIPO DE MOLÉCULA: péptido(iii) HIPOTÉTICO: NO (iv) ANTISENTIDO: NO (v) TIPO DE FRAGMENTO: N-terminal (vi) ORIGEN: (Ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (iv) ANTISENSE: NO (v) FRAGMENT TYPE: N-terminal (vi) ORIGIN:

(xi) DESCRIPCIÓN DE SECUENCIA: SEC ID NO:4: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

Glu Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Gln Val Ser Cys Lys Thr Xaa Gly Tyr Ser Phe Thr Asp Tyr 20 25 30 Asn Val Tyr Trp Val Arg Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Asp Pro Tyr Asn Gly Ile Thr Ile Tyr Asp Gln Asn Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Thr Thr Ala Phe 65 70 75 80 Met His Leu Asn Ser Leu Thr Ser Asp Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala Arg Asp Val Thr Thr Ala Leu Asp Phe Trp Gly Gln Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 Glu Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly rocker 1 May 10 15 Ser Val Gln Val Ser Cys Lys Thr Xaa Gly Tyr Ser Phe Thr Asp Tyr 20 25 30 Asn Val Tyr Trp Val Arg Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Tyr Ile Asp Pro Tyr Asn Gly Ile Thr Ile Tyr Asp Gln Asn Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Thr Thr Ala Phe 65 70 75 80 Met His Leu Asn Ser Thr Ser Asp Leu Ser Asp Ala Val Tyr Phe Cys Ala Arg 85 90 95 Asp Thr Val Thr Ala Leu Asp Phe Trp Gly Gln Gly Thr Thr Leu Thr 100 105 110 Val Ser Ser 115

(2) INFORMACIÓN PARA LA SEC ID NO:5: (2) INFORMATION FOR SEQ ID NO: 5:

(i) CARACTER�?STICAS DE LA SECUENCIA: (A) LONGITUD: 7 aminoácidos (B) TIPO: aminoácido (C) CADENA: sencilla (D) TOPOLOG�?A: lineal (I) SEQUENCE CHARACTER OF SPECIFICATIONS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) topology: linear

(ii) TIPO DE MOLÉCULA: péptido (iii) HIPOTÉTICO: NO (iv) ANTISENTIDO: NO (v) TIPO DE FRAGMENTO: N-terminal (vi) ORIGEN: (Ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: NO (iv) ANTISENSE: NO (v) FRAGMENT TYPE: N-terminal (vi) ORIGIN:

(xi) DESCRIPCIÓN DE SECUENCIA: SEC ID NO:5: (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

Leu Ala Ser Gln Thr Ile Asp 1 5 Leu Gln Thr Ala Ser Ile Asp May 1

(2) INFORMACIÓN PARA LA SEC ID NO:6: (2) INFORMATION FOR SEQ ID NO: 6:

(i) CARACTER�?STICAS DE LA SECUENCIA: ? (I) SEQUENCE CHARACTER AGER:

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: N-terminal FRAGMENT TYPE: N-terminal

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:6: SEQUENCE DESCRIPTION: SEQ ID NO: 6:

Ala Ala Thr Asn Leu Ala Asp 15 Ala Ala Ala Leu Asp Asn Thr 15

(2) INFORMACIÓN PARA LA SEC ID NO:7: (2) INFORMATION FOR SEQ ID NO: 7:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 9 aminoácidos LENGTH: 9 amino acids

(B) (B)
TIPO: aminoácido TYPE: amino acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: péptido MOLECULE TYPE: peptide

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: N-terminal FRAGMENT TYPE: N-terminal

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:7: SEQUENCE DESCRIPTION: SEQ ID NO: 7:

Gln Gln Val Tyr Ser Ser Pro Phe Thr 15 Gln Gln Tyr Ser Val Ser Pro Phe Thr 15

(2) INFORMACIÓN PARA LA SEC ID NO:8: (2) INFORMATION FOR SEQ ID NO: 8:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 6 aminoácidos LENGTH: 6 amino acids

(B) (B)
TIPO: aminoácido TYPE: amino acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: péptido MOLECULE TYPE: peptide

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: N-terminal FRAGMENT TYPE: N-terminal

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:8: SEQUENCE DESCRIPTION: SEQ ID NO: 8:

Thr Asp Tyr Asn Val Tyr 15 Tyr Asp Val Thr Asn Tyr 15

(2) INFORMACIÓN PARA LA SEC ID NO:9: (2) INFORMATION FOR SEQ ID NO: 9:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 17 aminoácidos LENGTH: 17 amino acids

(B) (B)
TIPO: aminoácido TYPE: amino acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: péptido MOLECULE TYPE: peptide

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: N-terminal FRAGMENT TYPE: N-terminal

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:9: SEQUENCE DESCRIPTION: SEQ ID NO: 9:

Tyr Ile Asp Pro Tyr Asn Gly Ile Thr Ile Tyr Asp Gln Asn Phe Lys 15 10 15 Gly Ile Tyr Asp Pro Asn Tyr Gly Ile Thr Ile Tyr Asp Gln Asn Phe Lys Gly 15 Oct. 15

(2) INFORMACIÓN PARA LA SEC ID NO:10: (2) INFORMATION FOR SEQ ID NO: 10:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 8 aminoácidos LENGTH: 8 amino acids

(B) (B)
TIPO: aminoácido TYPE: amino acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: péptido MOLECULE TYPE: peptide

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: N-terminal FRAGMENT TYPE: N-terminal

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:10: SEQUENCE DESCRIPTION: SEQ ID NO: 10:

Asp Val Thr Thr Ala Leu Asp Phe 15 Asp Val Thr Leu Thr Ala Asp Phe 15

(2) INFORMACIÓN PARA LA SEC ID NO:11: (2) INFORMATION FOR SEQ ID NO: 11:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 21 pares de bases LENGTH: 21 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:11: SEQUENCE DESCRIPTION: SEQ ID NO: 11:

CTGGCAAGTC AGACCATTGA T 21 CTGGCAAGTC AGACCATTGA T 21

(2) INFORMACIÓN PARA LA SEC ID NO:12: (2) INFORMATION FOR SEQ ID NO: 12:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 21 pares de bases LENGTH: 21 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:12: SEQUENCE DESCRIPTION: SEQ ID NO: 12:

GCTGCCACCA ACTTGGCAGA T 21 GCTGCCACCA ACTTGGCAGA T 21

(2) INFORMACIÓN PARA LA SEC ID NO:13: (2) INFORMATION FOR SEQ ID NO: 13:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 28 pares de bases LENGTH: 28 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:13: SEQUENCE DESCRIPTION: SEQ ID NO: 13:

CAACAAGTTT ACAGTTCTCC ATTCACGT 28 CAACAAGTTT ACAGTTCTCC ATTCACGT 28

(2) INFORMACIÓN PARA LA SEC ID NO:14: (2) INFORMATION FOR SEQ ID NO: 14:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 18 pares de bases LENGTH: 18 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:14: SEQUENCE DESCRIPTION: SEQ ID NO: 14:

ACTGACTACA ACGTGTAC 18 ACTGACTACA ACGTGTAC 18

(2) INFORMACIÓN PARA LA SEC ID NO:15: (2) INFORMATION FOR SEQ ID NO: 15:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 51 pares de bases LENGTH: 51 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:15: SEQUENCE DESCRIPTION: SEQ ID NO: 15:

TATATTGATC CTTACAATGG TATTACTATC TACGACCAGA ACTTCAAGGG C TATATTGATC CTTACAATGG TATTACTATC TACGACCAGA ACTTCAAGGG C

(2) (two)
INFORMACIÓN PARA LA SEC ID NO:16: INFORMATION FOR SEQ ID NO: 16:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 24 pares de bases LENGTH: 24 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: cDNA MOLECULE TYPE: cDNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:16: SEQUENCE DESCRIPTION: SEQ ID NO: 16:

(2) (two)
INFORMACIÓN PARA LA SEC ID NO:17: INFORMATION FOR SEQ ID NO: 17:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 23 pares de bases LENGTH: 23 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

GATGTGACTA CGGCCCTTGA CTTC 24 (iii) HIPOTÉTICO: NO GATGTGACTA CGGCCCTTGA CTTC 24 (iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:17: SEQUENCE DESCRIPTION: SEQ ID NO: 17:

GCACCTCCAG ATGTTAACTG CTC CTC ATGTTAACTG GCACCTCCAG

(2) (two)
INFORMACIÓN PARA LA SEC ID NO:18: INFORMATION FOR SEQ ID NO: 18:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 20 pares de bases LENGTH: 20 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:18: GAARTAVCCC TTGACCAGGC SEQUENCE DESCRIPTION: SEQ ID NO: 18: GAARTAVCCC TTGACCAGGC

(2) (two)
INFORMACIÓN PARA LA SEC ID NO:19: INFORMATION FOR SEQ ID NO: 19:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 35 pares de bases LENGTH: 35 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:19: SEQUENCE DESCRIPTION: SEQ ID NO: 19:

GGAGGCGGCG GTTCTGACAT TGTGMTGWCM CARTC GGAGGCGGCG GTTCTGACAT TGTGMTGWCM CARTC

(2) INFORMACIÓN PARA LA SEC ID NO:20: (2) INFORMATION FOR SEQ ID NO: 20:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 45 pares de bases LENGTH: 45 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

20 (xi) DESCRIPCIÓN DE SECUENCIA: SEC ID NO:20: 20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:

ATTTCAGGCC CAGCCGGCCA TGGCCGARGT YCARCTKCAR CARYC ATTTCAGGCC CAGCCGGCCA TGGCCGARGT YCARCTKCAR CARYC

(2) INFORMACIÓN PARA LA SEC ID NO:21: (2) INFORMATION FOR SEQ ID NO: 21:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 33 pares de bases LENGTH: 33 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:21: SEQUENCE DESCRIPTION: SEQ ID NO: 21:

CCCGGGCCAC CATGKCCCCW RCTCAGYTYC TKG 33 CCCGGGCCAC CATGKCCCCW RCTCAGYTYC TKG 33

(2) INFORMACIÓN PARA LA SEC ID NO:22: (2) INFORMATION FOR SEQ ID NO: 22:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 35 pares de bases LENGTH: 35 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:22: SEQUENCE DESCRIPTION: SEQ ID NO: 22:

CCCGGGCCAC CATGGRATGS AGCTGKGTMA TSCTC 35 CCCGGGCCAC CATGGRATGS AGCTGKGTMA TSCTC 35

(2) INFORMACIÓN PARA LA SEC ID NO:23: (2) INFORMATION FOR SEQ ID NO: 23:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 52 pares de bases LENGTH: 52 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:23: SEQUENCE DESCRIPTION: SEQ ID NO: 23:

ATATACTCGC GACAGCTACA GGTGTCCACT CCGAGATCCA GCTGCAGCAG TC ATATACTCGC GACAGCTACA GGTGTCCACT CCGAGATCCA GCTGCAGCAG TC

(2) INFORMACIÓN PARA LA SEC ID NO:24: (2) INFORMATION FOR SEQ ID NO: 24:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 31 pares de bases LENGTH: 31 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:24: SEQUENCE DESCRIPTION: SEQ ID NO: 24:

GACCTGAATT CTAAGGAGAC TGTGAGAGTG G GACCTGAATT CTAAGGAGAC TGTGAGAGTG G

(2) INFORMACIÓN PARA LA SEC ID NO:25: (2) INFORMATION FOR SEQ ID NO: 25:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 29 pares de bases LENGTH: 29 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:25: SEQUENCE DESCRIPTION: SEQ ID NO: 25:

TTAATTGATA TCCAGATGAC CCAGTCTCC 29 TTAATTGATA TCCAGATGAC CCAGTCTCC 29

(2) INFORMACIÓN PARA LA SEC ID NO:26: (2) INFORMATION FOR SEQ ID NO: 26:

(i) (I)
CARACTER�?STICAS DE LA SECUENCIA: AGER CHARACTER SEQUENCE?:

(A) (TO)
LONGITUD: 45 pares de bases LENGTH: 45 base pairs

(B) (B)
TIPO: ácido nucleico TYPE: nucleic acid

(C) (C)
CADENA: sencilla CHAIN: Simple

(D) (D)
TOPOLOG�?A: lineal Topology: Linear

(ii) (Ii)
TIPO DE MOLÉCULA: ADN MOLECULE TYPE: DNA

(iii) HIPOTÉTICO: NO (Iii) HYPOTHETICAL: NO

(iv) (Iv)
ANTISENTIDO: NO Antisense: NO

(v) (V)
TIPO DE FRAGMENTO: FRAGMENT TYPE:

(vi) (saw)
ORIGEN: ORIGIN:

(xi) (Xi)
DESCRIPCIÓN DE SECUENCIA: SEC ID NO:26: SEQUENCE DESCRIPTION: SEQ ID NO: 26:

TAATCGTTCG AAAAGTGTAC TTACGTTTCA GCTCCAGCTT GGTCC TAATCGTTCG AAAAGTGTAC TTACGTTTCA GCTCCAGCTT GGTCC

Claims (28)

  1. REIVINDICACIONES What is claimed
    1. Anticuerpo o fragmento del mismo que se une a factor tisular (“TF”) humano, en el que el anticuerpo o fragmento comprende: 1. An antibody or fragment thereof that binds to tissue factor ( "TF") human, wherein the antibody or fragment comprises:
    (i) (I)
    regiones hipervariables de cadena ligera CDR1, CDR2, y CDR3, en las que: CDR1 comprende la secuencia de SEC ID NO: 5; hypervariable regions CDR1 light chain, CDR2, and CDR3, wherein: CDR1 comprises the sequence of SEQ ID NO: 5; CDR2 comprende la secuencia de SEC ID NO: 6; CDR2 comprises the sequence of SEQ ID NO: 6; y CDR3 comprende la secuencia de SEC ID NO: 7; and CDR3 comprises the sequence of SEQ ID NO: 7; y Y
    (ii) (Ii)
    regiones hipervariables de cadena pesada CDR1, CDR2 y CDR3, en las que: CDR1 comprende la secuencia de SEC ID NO: 8; hypervariable regions CDR1 heavy chain, CDR2 and CDR3, wherein: CDR1 comprises the sequence of SEQ ID NO: 8; CDR2 comprende la secuencia de SEC ID NO: 9; CDR2 comprises the sequence of SEQ ID NO: 9; y CDR3 comprende la secuencia de SEC ID NO: 10. and CDR3 comprises the sequence of SEQ ID NO: 10.
  2. 2. two.
    Anticuerpo o fragmento según la reivindicación 1, en el que el anticuerpo o fragmento es un anticuerpo monoclonal. Antibody or fragment according to claim 1, wherein the antibody or fragment is a monoclonal antibody.
  3. 3. 3.
    Anticuerpo o fragmento según la reivindicación 1 o la reivindicación 2, en el que el anticuerpo o fragmento es un anticuerpo quimérico. Antibody or fragment of claim 1 or claim 2, wherein the antibody or fragment is a chimeric antibody.
  4. 4. Four.
    Anticuerpo o fragmento según la reivindicación 1 o la reivindicación 2, en el que el anticuerpo o fragmento es un anticuerpo humanizado. Antibody or fragment of claim 1 or claim 2, wherein the antibody or fragment is a humanized antibody.
  5. 5. 5.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones anteriores, en el que el anticuerpo o fragmento comprende una región variable de cadena ligera que tiene por lo menos un 95% de identidad en la secuencia con la secuencia de aminoácidos de la SEC ID NO: 2 y/o una región variable de cadena pesada que tiene por lo menos un 95% de identidad en la secuencia con la secuencia de aminoácidos de la SEC ID NO: 4. Antibody or fragment according to any of the preceding claims, wherein the antibody or fragment comprises a variable light chain region having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 2 and / or a variable heavy chain region having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 4.
  6. 6. 6.
    Anticuerpo o fragmento según la reivindicación 5, en el que el anticuerpo o fragmento comprende una región variable de cadena ligera que tiene la secuencia de aminoácidos de la SEC ID NO: 2 y/o una región variable de cadena pesada que tiene la secuencia de aminoácidos de la SEC ID NO: 4. Antibody or fragment according to claim 5, wherein the antibody or fragment comprises a variable light chain region having the amino acid sequence of SEQ ID NO: 2 and / or a variable heavy chain region having the amino acid sequence SEQ ID NO: 4.
  7. 7. 7.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones anteriores, en el que el anticuerpo o fragmento comprende una región constante humana. Antibody or fragment according to any of the preceding claims, wherein the antibody or fragment comprises a human constant region.
  8. 8. 8.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones anteriores, en el que el anticuerpo o fragmento es un anticuerpo de cadena sencilla. Antibody or fragment according to any of the preceding claims, wherein the antibody or fragment is a single chain antibody.
  9. 9. 9.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones anteriores, en el que la afinidad de unión del anticuerpo o fragmento para un TF humano es igual o superior a la del anticuerpo monoclonal H36.D2.B7 que es producido por el hibridoma que se deposita con la ATCC bajo el número de acceso HB-12255. Antibody or fragment according to any of the preceding claims, wherein the binding affinity of the antibody or fragment for human TF is equal to or higher than the monoclonal antibody H36.D2.B7 that is produced by the hybridoma deposited with the ATCC under accession number HB-12255 access.
  10. 10. 10.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones anteriores, en el que el anticuerpo o fragmento tiene una constante de asociación para TF humano de por lo menos aproximadamente 1 x 1010 M-1. Antibody or fragment according to any of the preceding claims, wherein the antibody or fragment has an association constant for human TF of at least about 1 x 1010 M-1.
  11. 11. eleven.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones anteriores, en el que la afinidad de unión del anticuerpo o fragmento para un TF humano sobre TF humano desnaturalizado es igual o superior a la del anticuerpo monoclonal H36.D2.B7 que es producido por el hibridoma que se deposita con la ATCC bajo el número de acceso HB-12255. Antibody or fragment according to any of the preceding claims, wherein the binding affinity of the antibody or fragment for human TF over denatured human TF is equal to or higher than the monoclonal antibody H36.D2.B7 that is produced by the hybridoma It deposited with the ATCC under accession number HB-12255 access.
  12. 12. 12.
    Anticuerpo que se une a factor tisular (“TF”) humano, en el que el anticuerpo es el anticuerpo monoclonal H36.D2.B7 que es producido por el hibridoma que se deposita con la ATCC bajo el número de acceso HB-12255. Antibody that binds to tissue factor ( "TF") human, wherein the antibody is the monoclonal antibody H36.D2.B7 that is produced by the hybridoma deposited with the ATCC under accession number HB-12255 access.
  13. 13. 13.
    Anticuerpo humanizado que se une a factor tisular (“TF”) humano, en el que el anticuerpo es un derivado humanizado del anticuerpo según la reivindicación 12. humanized antibody that binds to tissue factor ( "TF") human, wherein the antibody is a humanized antibody derivative according to claim 12.
  14. 14. 14.
    Método de purificación de factor tisular (“TF”) humano a partir de una muestra biológica, comprendiendo el método poner en contacto la muestra biológica con un anticuerpo o fragmento según cualquiera de las reivindicaciones 1 a 13. Method of purifying human tissue factor ( "TF") from a biological sample, the method comprising contacting the biological sample with an antibody or fragment according to any of claims 1 to 13.
  15. 15. fifteen.
    Método para detectar factor tisular (“TF”) humano en una muestra biológica, comprendiendo el método poner en contacto la muestra biológica con un anticuerpo o fragmento según cualquiera de las reivindicaciones 1 a 13. Method for detecting human tissue factor ( "TF") in a biological sample, the method comprising contacting the biological sample with an antibody or fragment according to any of claims 1 to 13.
  16. 16. 16.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones 1 a 13, para utilizar en la inhibición de la coagulación de la sangre en un mamífero. Antibody or fragment according to any of claims 1 to 13 for use in inhibiting blood coagulation in a mammal.
  17. 17. 17.
    Utilización de un anticuerpo o fragmento según cualquiera de las reivindicaciones 1 a 13, para la fabricación de un medicamento para inhibir la coagulación de la sangre en un mamífero. Use of an antibody or fragment according to any of claims 1 to 13 for the manufacture of a medicament for inhibiting blood coagulation in a mammal.
  18. 18. 18.
    Anticuerpo o fragmento según la reivindicación 16, o utilización según la reivindicación 17, en que el mamífero padece o es sospechoso de tener una trombosis, o el mamífero padece o es susceptible a una reestenosis asociada con un procedimiento médico invasivo, o el mamífero padece una patología tromboembólica asociada con una enfermedad cardiovascular, una enfermedad infecciosa, una enfermedad neoplásica, o utilización de un agente trombolítico. Antibody or fragment according to claim 16 or use according to claim 17 wherein the mammal has or is suspected of having a thrombosis, or the mammal suffering from or susceptible to restenosis associated with an invasive medical procedure, or the mammal suffers thromboembolic pathology associated with a cardiovascular disease, an infectious disease, a neoplastic disease, or use of a thrombolytic agent.
  19. 19. 19.
    Anticuerpo o fragmento según la reivindicación 16, o utilización según la reivindicación 17, en que el mamífero es un humano. Antibody or fragment according to claim 16 or use according to claim 17 wherein the mammal is a human.
  20. 20. twenty.
    Anticuerpo o fragmento según la reivindicación 16, o utilización según la reivindicación 17, en que el anticuerpo se administra combinado con una composición antiplaquetaria, una composición trombolítica o una composición anticoagulante. Antibody or fragment according to claim 16 or use according to claim 17 wherein the antibody is administered in combination with antiplatelet composition, a thrombolytic composition, or an anticoagulant composition.
  21. 21. twenty-one.
    Anticuerpo o fragmento según la reivindicación 16, o utilización según la reivindicación 17, en que el anticuerpo se administra combinado con heparina, hirudina, Bivalirudina, Abciximab, activador de plasminógeno de tejido, estreptoquinasa, o uroquinasa. Antibody or fragment according to claim 16 or use according to claim 17 wherein the antibody is administered in combination with heparin, hirudin, Bivalirudin, Abciximab, tissue plasminogen activator, streptokinase, or urokinase.
  22. 22. 22.
    Anticuerpo o fragmento según cualquiera de las reivindicaciones 1 a 13, para utilizar como medicamento. Antibody or fragment according to any of claims 1 to 13 for use as a medicament.
  23. 23. 2. 3.
    �?cido nucleico aislado que codifica un anticuerpo o fragmento del mismo que se une a factor tisular (“TF”) humano, en el que: ? Nucleic acid encoding an antibody isolated or fragment thereof that binds to human tissue factor ( "TF"), wherein:
    (a) el ácido nucleico codifica una región variable de cadena ligera y comprende las secuencias de polinucleótidos de SEC ID NOs: 11, 12, y 13; (A) the nucleic acid encodes a light chain variable region and comprises the polynucleotide sequences of SEQ ID NOs: 11, 12, and 13; y (b) el ácido nucleico codifica una región variable de cadena pesada y comprende las secuencias de polinucleótidos de SEC ID NOs: 14, 15, y 16. and (b) the nucleic acid encodes a heavy chain variable region and comprises the polynucleotide sequences of SEQ ID NOs: 14, 15, and 16.
  24. 24. 24.
    �?cido nucleico aislado según la reivindicación 23, que comprende la secuencia de polinucleótidos de SEC ID NO: 1 y la secuencia de polinucleótidos de SEC ID NO: 3. ? Nucleic acid isolated according to claim 23, comprising the polynucleotide sequence of SEQ ID NO: 1 and the polynucleotide sequence of SEQ ID NO: 3.
  25. 25. 25.
    �?cido nucleico que codifica un anticuerpo o fragmento del mismo según cualquiera de las reivindicaciones 1 a 11. ? Nucleic acid encoding an antibody or fragment thereof according to any of claims 1 to 11.
  26. 26. 26.
    Vector que comprende el ácido nucleico según cualquiera de las reivindicaciones 23 a 25. A vector comprising the nucleic acid of any of claims 23 to 25.
  27. 27. 27.
    Célula huésped que comprende el vector según la reivindicación 26. A host cell comprising the vector of claim 26.
  28. 28. 28.
    Célula huésped que comprende (a) un primer vector que comprende un ácido nucleico, en el que el ácido nucleico codifica una región variable de cadena ligera de un anticuerpo o fragmento del mismo que se une a factor tisular (“TF”) humano y comprende las secuencias de polinucleótidos de SEC ID NOs: 11, 12, y 13; A host cell comprising (a) a first vector comprising a nucleic acid, wherein the nucleic acid encodes a variable light chain region of an antibody or fragment thereof that binds to human tissue factor ( "TF") and comprises the polynucleotide sequences of SEQ ID NOs: 11, 12, and 13; y (b) un segundo vector que comprende un ácido nucleico, en el que el ácido nucleico codifica una región variable de cadena pesada de un anticuerpo o fragmento del mismo que se une a factor tisular (“TF”) humano y comprende las secuencias de polinucleótidos de SEC ID NOs: 14, 15, y 16. and (b) a second vector comprising a nucleic acid, wherein the nucleic acid encodes a variable heavy chain region of an antibody or fragment thereof that binds to human tissue factor ( "TF") and comprises sequences polynucleotides of SEQ ID NOs: 14, 15, and 16.
    REGIÓN VARIABLE DE CADENA LIGERA ANTI-FACTOR TISULAR LIGHT CHAIN ​​VARIABLE REGION OF ANTI-TISSUE FACTOR
ES98910277T 1997-03-10 1998-03-10 Antibodies to inhibit blood coagulation and methods of use thereof Expired - Lifetime ES2380452T3 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US814806 1997-03-10
US08/814,806 US5986065A (en) 1997-03-10 1997-03-10 Antibodies for inhibiting blood coagulation and methods of use thereof
PCT/US1998/004644 WO1998040408A1 (en) 1997-03-10 1998-03-10 Antibodies for inhibiting blood coagulation and methods of use thereof

Publications (1)

Publication Number Publication Date
ES2380452T3 true ES2380452T3 (en) 2012-05-11

Family

ID=25216046

Family Applications (1)

Application Number Title Priority Date Filing Date
ES98910277T Expired - Lifetime ES2380452T3 (en) 1997-03-10 1998-03-10 Antibodies to inhibit blood coagulation and methods of use thereof

Country Status (13)

Country Link
US (5) US5986065A (en)
EP (1) EP0975672B1 (en)
JP (2) JP4281852B2 (en)
KR (2) KR100585473B1 (en)
CN (2) CN101298479A (en)
AT (1) AT540976T (en)
AU (1) AU745506B2 (en)
CA (1) CA2283746C (en)
DK (1) DK0975672T3 (en)
ES (1) ES2380452T3 (en)
HK (1) HK1029123A1 (en)
PT (1) PT975672E (en)
WO (1) WO1998040408A1 (en)

Families Citing this family (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060235209A9 (en) * 1997-03-10 2006-10-19 Jin-An Jiao Use of anti-tissue factor antibodies for treating thromboses
US20040229282A1 (en) * 1997-03-10 2004-11-18 Sunol Molecular Corporation Antibodies for inhibiting blood coagulation and methods of use thereof
US5986065A (en) * 1997-03-10 1999-11-16 Sunol Molecular Corporation Antibodies for inhibiting blood coagulation and methods of use thereof
US7749498B2 (en) * 1997-03-10 2010-07-06 Genentech, Inc. Antibodies for inhibiting blood coagulation and methods of use thereof
JP2002525323A (en) 1998-09-25 2002-08-13 スノル・モレキュラー・コーポレーション Pharmaceutically active compounds and methods of use thereof
US7764130B2 (en) * 1999-01-22 2010-07-27 Multigig Inc. Electronic circuitry
US6398772B1 (en) * 1999-03-26 2002-06-04 Coraje, Inc. Method and apparatus for emergency treatment of patients experiencing a thrombotic vascular occlusion
US6924359B1 (en) 1999-07-01 2005-08-02 Yale University Neovascular-targeted immunoconjugates
EP2351483A1 (en) * 1999-10-01 2011-08-03 Chugai Seiyaku Kabushiki Kaisha Prevention and treatment of blood coagulation-related diseases
KR20070049251A (en) 1999-10-27 2007-05-10 타녹스 인코퍼레이티드 Tissue factor antagonists and methods of use thereof
EP1829535A3 (en) * 1999-10-27 2007-10-24 Tanox, Inc. Tissue factor antagonists and methods of use thereof
US6703494B2 (en) 2000-03-16 2004-03-09 Genentech, Inc. Anti-tissue factor antibodies with enhanced anticoagulant potency
US20030143225A1 (en) * 2001-03-08 2003-07-31 Genentech, Inc. Combinations of anti-tissue factor antibodies and anticoagulant and/or antiplatelet agents
AU2001250814B2 (en) * 2000-03-16 2007-02-15 Genentech, Inc. Anti-tissue factor antibodies with enhanced anticoagulant potency
US7160540B2 (en) * 2000-06-30 2007-01-09 Regents Of The University Of Minnesota Methods for detecting activity of clottings factors
US20030211094A1 (en) 2001-06-26 2003-11-13 Nelsestuen Gary L. High molecular weight derivatives of vitamin k-dependent polypeptides
AU2002240000A1 (en) * 2001-01-23 2002-08-06 Saint Louis University Factor ixa: factor viiia interaction and methods therefor
US20040126856A1 (en) * 2002-01-23 2004-07-01 Bajaj Paul S. Factor ixa: factor Vllla interaction and methods therefor
WO2002078738A1 (en) * 2001-03-26 2002-10-10 Koji Suzuki Blood rheology improving agents
TWI338009B (en) * 2001-10-29 2011-03-01 Genentech Inc Antibodies for inhibiting blood coagulation and methods of use thereof
US20030190705A1 (en) 2001-10-29 2003-10-09 Sunol Molecular Corporation Method of humanizing immune system molecules
US20030109680A1 (en) * 2001-11-21 2003-06-12 Sunol Molecular Corporation Antibodies for inhibiting blood coagulation and methods of use thereof
WO2003070275A1 (en) * 2002-02-22 2003-08-28 Prophy Med Ab Use of an inhibitor or antagonist against tissue factor
JP2005529080A (en) * 2002-03-08 2005-09-29 エモリー ユニバーシティEmory University Curcuminoids novel as suppressor of growth and angiogenesis of tumor - Factor VIIa construct
US20090011991A1 (en) * 2002-03-08 2009-01-08 Emory University Novel Curcuminoid-Factor VIIA Constructs as Suppressors of Tumor Growth and Angiogenesis
US6706068B2 (en) 2002-04-23 2004-03-16 Bret A. Ferree Artificial disc replacements with natural kinematics
US7579000B2 (en) 2002-05-01 2009-08-25 Bayer Schering Pharma Ag Tissue factor targeted antibodies as anticoagulants
NZ536243A (en) 2002-05-01 2006-06-30 Schering Ag Novel tissue factor targeted antibodies as anticoagulants
US20050106139A1 (en) * 2002-10-31 2005-05-19 Ivan Svendsen Humanized tissue factor antibodies
US7425328B2 (en) * 2003-04-22 2008-09-16 Purdue Pharma L.P. Tissue factor antibodies and uses thereof
CN100528229C (en) * 2003-05-30 2009-08-19 森托科尔公司 Method of inhibiting tumor growth with anti-tissue factor antibodies
US7605235B2 (en) 2003-05-30 2009-10-20 Centocor, Inc. Anti-tissue factor antibodies and compositions
US9708410B2 (en) 2003-05-30 2017-07-18 Janssen Biotech, Inc. Anti-tissue factor antibodies and compositions
EP1644039B1 (en) * 2003-06-19 2014-10-01 Genentech, Inc. Compositions and methods for treating coagulation related disorders
WO2005025623A2 (en) * 2003-07-28 2005-03-24 Emory University Ef-24-factor vii conjugates
AU2004268648A1 (en) * 2003-08-29 2005-03-10 Centocor, Inc. Method of promoting graft survival with anti-tissue factor antibodies
US8048101B2 (en) 2004-02-25 2011-11-01 Femasys Inc. Methods and devices for conduit occlusion
US8052669B2 (en) 2004-02-25 2011-11-08 Femasys Inc. Methods and devices for delivery of compositions to conduits
US8048086B2 (en) 2004-02-25 2011-11-01 Femasys Inc. Methods and devices for conduit occlusion
US9238127B2 (en) 2004-02-25 2016-01-19 Femasys Inc. Methods and devices for delivering to conduit
US7514539B2 (en) * 2004-04-26 2009-04-07 Centocor, Inc. Epitope directed selection of antibodies to murine tissue factor
WO2005118646A2 (en) * 2004-04-26 2005-12-15 Centocor, Inc. Epitope directed selection of antibodies to murine tissue factor
EP1774001B1 (en) 2004-06-25 2012-08-22 Altor BioScience Corporation Mammalian Tissue Factor obtained from plants and applications of the same
CN102225966B (en) 2004-10-19 2012-12-26 隆萨股份公司 Method for solid phase peptide synthesis
EP1676574A3 (en) 2004-12-30 2006-07-26 Johnson & Johnson Vision Care, Inc. Methods for promoting survival of transplanted tissues and cells
US20080254043A1 (en) * 2005-02-07 2008-10-16 Chugai Seiyaku Kabushiki Kaisha National University Corporation Hamamatsu Drug For Treating Ischemic Disease
WO2007097810A2 (en) * 2005-10-21 2007-08-30 Genentech, Inc. Treatment for antiphospholipid-syndrome-related pregnancy complications
WO2007076091A2 (en) * 2005-12-22 2007-07-05 Genentech, Inc. Treatment of viral infections using a tissue factor inhibitor
US10070888B2 (en) 2008-10-03 2018-09-11 Femasys, Inc. Methods and devices for sonographic imaging
US9554826B2 (en) 2008-10-03 2017-01-31 Femasys, Inc. Contrast agent injection system for sonographic imaging
UA109633C2 (en) * 2008-12-09 2015-09-25 An antibody against human tissue factor
CN101717447B (en) 2009-12-17 2012-06-27 太原博奥特生物技术有限公司 Method for preparing antihuman recombinant tissue factor monoclonal antibody
CN106084053A (en) 2010-06-15 2016-11-09 根马布股份公司 Human Antibody Drug Conjugates Against Tissue Factor
US8722044B2 (en) 2011-03-15 2014-05-13 Janssen Biotech, Inc. Human tissue factor antibody and uses thereof
KR20160136279A (en) 2014-02-03 2016-11-29 국립연구개발법인 고쿠리츠간켄큐센터 Anti-tissue factor monoclonal antibody

Family Cites Families (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
EP0173552B1 (en) * 1984-08-24 1991-10-09 The Upjohn Company Recombinant dna compounds and the expression of polypeptides such as tpa
US4644055A (en) * 1984-12-17 1987-02-17 E. I. Du Pont De Nemours And Company Method for preparing specific inhibitors of virus-specified proteases
US5168062A (en) * 1985-01-30 1992-12-01 University Of Iowa Research Foundation Transfer vectors and microorganisms containing human cytomegalovirus immediate-early promoter-regulatory DNA sequence
GB8607679D0 (en) 1986-03-27 1986-04-30 Winter G P Recombinant dna product
US5225539A (en) * 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
US5589173A (en) * 1986-11-04 1996-12-31 Genentech, Inc. Method and therapeutic compositions for the treatment of myocardial infarction
US6001978A (en) * 1987-03-31 1999-12-14 The Scripps Research Institute Human tissue factor related DNA segments polypeptides and antibodies
US5223427A (en) * 1987-03-31 1993-06-29 The Scripps Research Institute Hybridomas producing monoclonal antibodies reactive with human tissue-factor glycoprotein heavy chain
US5437864A (en) * 1987-03-31 1995-08-01 The Scripps Research Institute Method of inhibiting blood coagulation in extracorporeal circulation by inhibiting human tissue factor
DE68919361D1 (en) 1988-06-21 1994-12-15 Genentech Inc Therapeutic compositions for the treatment of myocardial infarction.
IL162181A (en) 1988-12-28 2006-04-10 Pdl Biopharma Inc A method of producing humanized immunoglubulin, and polynucleotides encoding the same
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5216132A (en) * 1990-01-12 1993-06-01 Protein Design Labs, Inc. Soluble t-cell antigen receptor chimeric antigens
US6416971B1 (en) * 1990-05-15 2002-07-09 E.R. Squibb & Sons, Inc. Soluble single chain T cell receptors
US5171662A (en) * 1990-09-13 1992-12-15 The Upjohn Company Method of detecting HIV protease activity
US5889157A (en) * 1990-10-12 1999-03-30 The United States Of America As Represented By The Department Of Health And Human Services Humanized B3 antibody fragments, fusion proteins, and uses thereof
WO1994004679A1 (en) * 1991-06-14 1994-03-03 Genentech, Inc. Method for making humanized antibodies
GB9115364D0 (en) * 1991-07-16 1991-08-28 Wellcome Found Antibody
AT249840T (en) * 1991-12-13 2003-10-15 Xoma Corp Methods and materials for preparation of modified antibody variable domains and their therapeutic use
DE69334351D1 (en) * 1992-02-06 2011-05-12 Novartis Vaccines & Diagnostic Biosynthetic binding protein for tumor markers
WO1994004689A1 (en) 1992-08-14 1994-03-03 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Recombinant toxin with increased half-life
WO1994005328A1 (en) * 1992-08-28 1994-03-17 The Scripps Research Institute Inhibition of tumor metastasis via neutralization of tissue factor function
US5639641A (en) * 1992-09-09 1997-06-17 Immunogen Inc. Resurfacing of rodent antibodies
US5879677A (en) * 1992-12-09 1999-03-09 The Scripps Research Institute Method for inhibition of cerebral tissue factor mediated reperfusion damage
US5747654A (en) 1993-06-14 1998-05-05 The United States Of America As Represented By The Department Of Health And Human Services Recombinant disulfide-stabilized polypeptide fragments having binding specificity
US5552300A (en) * 1994-01-13 1996-09-03 T Cell Sciences, Inc. T cell antigen receptor V region proteins and methods of preparation thereof
US5487460A (en) 1994-07-29 1996-01-30 Macmillan Bloedel Limited Short strand orienter
US6309636B1 (en) * 1995-09-14 2001-10-30 Cancer Research Institute Of Contra Costa Recombinant peptides derived from the Mc3 anti-BA46 antibody, methods of use thereof, and methods of humanizing antibody peptides
WO1996013593A2 (en) * 1994-10-26 1996-05-09 Procept, Inc. Soluble single chain t cell receptors
WO1996018105A1 (en) * 1994-12-06 1996-06-13 The President And Fellows Of Harvard College Single chain t-cell receptor
US5958713A (en) * 1995-01-31 1999-09-28 Novo Nordisk A/S Method of detecting biologically active substances by using green fluorescent protein
US5869046A (en) * 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US5861267A (en) * 1995-05-01 1999-01-19 Vertex Pharmaceuticals Incorporated Methods, nucleotide sequences and host cells for assaying exogenous and endogenous protease activity
WO1996040921A1 (en) * 1995-06-07 1996-12-19 Ortho Farmaceutical Corporation Cdr-grafted anti-tissue factor antibodies and methods of use thereof
US5534592A (en) 1995-09-22 1996-07-09 The Goodyear Tire & Rubber Company High performance blend for tire treads
US6593291B1 (en) * 1997-02-06 2003-07-15 Entremed, Inc. Compositions and methods of use of ligands that bind components of the blood coagulation/clotting pathway for the treatment of cancer and angiogenic-based disease
US7749498B2 (en) * 1997-03-10 2010-07-06 Genentech, Inc. Antibodies for inhibiting blood coagulation and methods of use thereof
US20060235209A9 (en) * 1997-03-10 2006-10-19 Jin-An Jiao Use of anti-tissue factor antibodies for treating thromboses
US20040229282A1 (en) * 1997-03-10 2004-11-18 Sunol Molecular Corporation Antibodies for inhibiting blood coagulation and methods of use thereof
US5986065A (en) 1997-03-10 1999-11-16 Sunol Molecular Corporation Antibodies for inhibiting blood coagulation and methods of use thereof
DE19719652A1 (en) 1997-05-09 1998-12-03 Merckle Gmbh Use of tissue factor
US6610293B1 (en) * 1997-06-16 2003-08-26 The Henry M. Jackson Foundation For The Advancement Of Military Medicine Opsonic and protective monoclonal and chimeric antibodies specific for lipoteichoic acid of gram positive bacteria
WO1999043713A1 (en) 1998-02-25 1999-09-02 Lexigen Pharmaceuticals Corporation Enhancing the circulating half-life of antibody-based fusion proteins
BR9909382A (en) 1998-04-03 2000-12-05 Chugai Pharmaceutical Co Ltd A humanized antibody against human tissue factor (TF) antibody and humanized production process
FR2776939B1 (en) 1998-04-07 2000-05-19 Air Liquide Process for the production of oxygen by adsorption variation of transatmospheric pressure
US6117639A (en) * 1998-08-31 2000-09-12 Vertex Pharmaceuticals Incorporated Fusion proteins, DNA molecules, vectors, and host cells useful for measuring protease activity
JP2002525323A (en) 1998-09-25 2002-08-13 スノル・モレキュラー・コーポレーション Pharmaceutically active compounds and methods of use thereof
US6245884B1 (en) * 1998-10-16 2001-06-12 Vivian Y. H. Hook Secretases related to alzheimer's dementia
KR20070049251A (en) 1999-10-27 2007-05-10 타녹스 인코퍼레이티드 Tissue factor antagonists and methods of use thereof
US20020025508A1 (en) * 2000-01-06 2002-02-28 Katja Fechteler Process for finding a protease inhibitor
US6333167B1 (en) * 2000-03-10 2001-12-25 American Home Products Corp. Methods and reagents for identifying inhibitors of proteolysis of membrane-associated proteins
US20030124117A1 (en) 2000-03-16 2003-07-03 Refino Canio J. Combinations of anti-tissue factor antibodies and anticoagulant and/or antiplatelet agents
AU2001250814B2 (en) 2000-03-16 2007-02-15 Genentech, Inc. Anti-tissue factor antibodies with enhanced anticoagulant potency
US6703494B2 (en) * 2000-03-16 2004-03-09 Genentech, Inc. Anti-tissue factor antibodies with enhanced anticoagulant potency
EP1404813A4 (en) * 2001-06-13 2004-11-24 Genentech Inc Methods of culturing animal cells and polypeptide production in animal cells
PL368989A1 (en) 2001-10-02 2005-04-04 Novo Nordisk A/S Human tissue factor antibodies
TWI338009B (en) 2001-10-29 2011-03-01 Genentech Inc Antibodies for inhibiting blood coagulation and methods of use thereof
US20030109680A1 (en) * 2001-11-21 2003-06-12 Sunol Molecular Corporation Antibodies for inhibiting blood coagulation and methods of use thereof
EP1644039B1 (en) 2003-06-19 2014-10-01 Genentech, Inc. Compositions and methods for treating coagulation related disorders

Also Published As

Publication number Publication date
AU745506B2 (en) 2002-03-21
US20020168357A1 (en) 2002-11-14
US6555319B2 (en) 2003-04-29
JP4281852B2 (en) 2009-06-17
PT975672E (en) 2012-02-15
US20030082636A1 (en) 2003-05-01
DK0975672T3 (en) 2012-02-27
KR100585473B1 (en) 2006-06-02
KR20000075734A (en) 2000-12-26
CN100383163C (en) 2008-04-23
US20090041766A1 (en) 2009-02-12
AT540976T (en) 2012-01-15
US5986065A (en) 1999-11-16
US7824677B2 (en) 2010-11-02
US20050271664A1 (en) 2005-12-08
EP0975672B1 (en) 2012-01-11
WO1998040408A1 (en) 1998-09-17
CN101298479A (en) 2008-11-05
CA2283746A1 (en) 1998-09-17
CA2283746C (en) 2017-01-17
EP0975672A1 (en) 2000-02-02
EP0975672A4 (en) 2005-02-02
JP2001516214A (en) 2001-09-25
AU6455998A (en) 1998-09-29
HK1029123A1 (en) 2009-02-13
CN1252810A (en) 2000-05-10
KR20060015702A (en) 2006-02-17
JP2009022275A (en) 2009-02-05

Similar Documents

Publication Publication Date Title
Morrissey et al. Monoclonal antibody analysis of purified and cell-associated tissue factor
CA2106299C (en) Monoclonal and chimeric antibodies specific for human tumor necrosis factor
US5472939A (en) Method of treating complement mediated disorders
US5583107A (en) Agents affecting thrombosis and hemostasis
EP1007092B1 (en) A process for inhibiting complement activation via the alternative pathway
US7056509B2 (en) Antibody methods for selectively inhibiting VEGF
CA1340633C (en) Method and therapeutic compositions for the treatment of myocardial infarction
EP0450479B1 (en) Bispecific monoclonal anti-bodies, their production and use
AU605864B2 (en) Human tissue factor related dna segments, polypeptides and antibodies
JP4932883B2 (en) Methods and compositions for the specific coagulation of the vascular system
JP5721693B2 (en) How cancer treatment with therapeutic conjugates that bind to aminophospholipids
CA2645810C (en) Treatment of paroxysmal nocturnal hemoglobinuria patients by an inhibitor of complement
US7494647B2 (en) Humanized antibody against human tissue factor (TF) and process of production of the humanized antibody
KR19990077329A (en) Anticoagulants useful for the treatment of thrombosis
US5589173A (en) Method and therapeutic compositions for the treatment of myocardial infarction
US5777085A (en) Humanized antibodies reactive with GPIIB/IIIA
Kasperkiewicz et al. Pemphigoid diseases: pathogenesis, diagnosis, and treatment
US20040229301A1 (en) Tissue factor antibodies and uses thereof
Pawashe et al. A monoclonal antibody against rabbit tissue factor inhibits thrombus formation in stenotic injured rabbit carotid arteries.
Biemond et al. Complete inhibition of endotoxin-induced coagulation activation in chimpanzees with a monoclonal Fab fragment against factor VII/VIIa
ES2141467T5 (en) Anti-CD30 antibodies which prevent proteolytic cleavage and release of the CD30 antigen bound to the membrane.
US6998469B2 (en) Platelet membrane glycoprotein VI (GPVI) DNA and protein sequences, and uses thereof
AU780775B2 (en) Factor IX/factor IXa antibodies and antibody derivatives
JP3323508B2 (en) Binding substance to the Cd23
JP3484189B2 (en) Human C3b / C4b receptor (CR1)